Target-specific control of lymphoid-specific protein tyrosine phosphatase (Lyp) activity

Article abstract of DOI:10.1016/j.bmc.2010.06.022

Lymphoid-specific protein tyrosine phosphatase (Lyp), a member of the protein tyrosine phosphatase (PTP) superfamily of enzymes, is an important mediator of human-leukocyte signaling. Lyp has also emerged as a potential anti-autoimmune therapeutic target,

Full text of DOI:10.1016/j.bmc.2010.06.022

Bioorganic & Medicinal Chemistry 18 (2010) 4884–4891
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Target-specific control of lymphoid-specific protein tyrosine phosphatase
(Lyp) activity
*
Zandra E. Walton, Anthony C. Bishop
Amherst College, Department of Chemistry, Amherst, MA 01002, United States
a r t i c l e i n f o
a b s t r a c t
Article history:
Lymphoid-specific protein tyrosine phosphatase (Lyp), a member of the protein tyrosine phosphatase
(PTP) superfamily of enzymes, is an important mediator of human-leukocyte signaling. Lyp has also
emerged as a potential anti-autoimmune therapeutic target, owing to the association of a Lyp-activating
mutation with an array of autoimmune disorders. Toward the goal of generating a selective inhibitor of
Lyp activity that could be used for investigating Lyp’s roles in cell signaling and autoimmune-disease pro-
gression, here we report that Lyp’s PTP domain can be readily sensitized to target-specific inhibition by a
cell-permeable small molecule. Insertion of a tetracysteine-motif-containing peptide at a conserved posi-
tion in Lyp’s catalytic domain generated a mutant enzyme (Lyp-CCPGCC) that retains activity comparable
to that of wild-type Lyp in the absence of added ligand. Upon addition of a tetracysteine-targeting biar-
senical compound (FlAsH), however, the activity of the Lyp-CCPGCC drops dramatically, as assayed with
either small-molecule or phosphorylated-peptide PTP substrates. We show that FlAsH-induced Lyp-
CCPGCC inhibition is potent, specific, rapid, and independent of the nature of the PTP substrate used in
the inhibition assay. Moreover, we show that FlAsH can be used to specifically target overexpressed
Lyp-CCPGCC in a complex proteomic mixture. Since the mammalian-cell permeability of FlAsH is well
established, it is likely that FlAsH-mediated inhibition of Lyp-CCPGCC will be useful for specifically tar-
geting Lyp activity in engineered leukocytes and autoimmune-disease models.
Received 25 March 2010
Revised 1 June 2010
Accepted 7 June 2010
Available online 12 June 2010
Keywords:
Biarsenicals
FlAsH
Protein tyrosine phosphatases
Lyp
Protein engineering
Inhibitor sensitization
Ó 2010 Elsevier Ltd. All rights reserved.
1. Introduction
arthritis,10 Graves disease,11 myasthenia gravis,12 and systemic
lupus erythematosus (SLE).13 The SNP common to all of these asso-
Protein tyrosine phosphatases (PTPs) catalyze the dephospho-
rylation of phosphotyrosine, a central signal-transduction control
element in metazoan biology.1 Improperly regulated PTP activity
has been implicated as a causative agent in a range of human dis-
eases, including leukemia, solid-tumor cancers, diabetes, and auto-
immune disorders.2–6 While many disease-associated mutations in
PTP-encoding genes are loss-of-function mutations, gain-of-func-
tion PTP mutations are of particular interest from a therapeutic
perspective; it is this relatively small subset of PTP disease-associ-
ated mutants that one could envision as therapeutic targets for
small-molecule PTP inhibitors. Among the best characterized of
PTPs that have been linked to activating disease-associated muta-
tions is the lymphoid-specific protein tyrosine phosphatase (Lyp,
also called PTPN22), which is expressed predominantly in leuko-
cytes and is a negative regulator of T-cell activation.7 Recently, a
flurry of studies has uncovered associations between a single-
nucleotide polymorphism (SNP) in the PTPN22 gene and a range
of autoimmune disorders, including type-I diabetes,8,9 rheumatoid
ciations encodes an arginine-to-tryptophan mutation (R620W)
that increases Lyp’s PTP activity.14 This putative connection be-
tween high Lyp activity and autoimmune disease has become even
more compelling with the recent discovery of a PTP-activity-lower-
ing polymorphism (R263Q) that confers protection against SLE.15
Taken together, these studies present the exciting possibility that
Lyp inhibitors could represent an important class of anti-autoim-
mune therapeutics. Moreover, these genetic data highlight the
need for chemical tools that can be used to study the poorly under-
stood connection between Lyp activity and autoimmune-disease
progression.
PTP-inhibitor discovery is inherently difficult due to two recur-
ring problems observed with many active-site-directed inhibitors:
lack of target specificity (classical PTP catalytic domains share a
significant degree of sequence and structural homology with one
another) and poor bioavailability (many PTP-binding pharmaco-
phores contain negatively charged phosphotyrosine mimetics that
lower an inhibitor’s cellular permeability).6,16–18 Nevertheless, sev-
eral groups have recognized the potential therapeutic impact of
target-specific Lyp inhibitors, and significant efforts toward a
Lyp-specific inhibitor have recently been undertaken.19–23 While
* Corresponding author. Tel.: +1 413 542 8316; fax: +1 413 542 2735.
E-mail address: acbishop@amherst.edu (A.C. Bishop).
0968-0896/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2010.06.022

Z. E. Walton, A. C. Bishop / Bioorg. Med. Chem. 18 (2010) 4884–4891
4885
the compounds that have been identified from these studies pro-
vide important templates for further optimization and discovery,
Lyp-inhibitor discovery is a newly emerging field, and chemical
tools that can control Lyp activity in cells with high potency and
target selectivity are still needed.
represent the standard deviations of at least three independent
trials.
2.2. Cloning and mutagenesis
Our lab has recently described a systematic strategy for engi-
neering novel inhibitor sensitivity in PTPs.24–28 In our approach, a
mutation (point mutation and/or peptide insertion) in a target
PTP sensitizes the enzyme to inhibition by a small molecule that
does not inhibit wild-type PTPs. When a non-deleterious, inhibi-
tor-sensitizing mutation is discovered, the mutant and inhibitor
constitute a specific ligand/receptor pair that can be used to study
the cellular roles of the engineered—but functionally ‘wild-type-
like’—PTP targets. Toward this end, we have previously reported
that PTP domains can be sensitized to noncompetitive inhibition
by a compound that has no significant affinity for wild-type
PTPs26—namely, FlAsH, a cell-permeable biarsenical compound
that binds to cysteine-rich peptides.29,30 Specifically, insertion of
a FlAsH-binding hexapeptide (CCPGCC) at position 187 of a model
PTP (TCPTP) was shown to confer strong FlAsH sensitivity on the
enzyme.26 Although the 187 insertion position is distal from
TCPTP’s active site, the insertion mutant’s novel inhibitor sensitiv-
ity could be structurally rationalized,31 as Glu187 lies at the end of
a conserved PTP loop (the WPD loop) that closes upon substrate
binding, properly positioning a mechanistically important aspar-
tate residue (the ‘D’ of WPD) for the PTP reaction. Binding of FlAsH
to the TCPTP insertion mutant may impede proper closure of the
WPD loop, in a manner that is consistent with other noncompeti-
tive inhibitors that target natural allosteric sites in PTPs.32,33
The fundamental nature of the WPD loop in the structure and
mechanism of PTP domains augurs well for the prospect of using
FlAsH as an inhibitor of engineered PTPs beyond TCPTP: the WPD
loop is one of the most conserved regions in PTP catalytic domains
and it can be readily identified from primary-sequence align-
ments.34,35 Indeed, we have recently shown that PTPs from six dis-
tinct PTP sub-families can be sensitized to FlAsH inhibition.27 In all
cases, the engineered PTPs respond to FlAsH with high selectivity
and potency via a conserved mechanism that is independent of
the particular PTP that has been sensitized to inhibition.27
A PCR product encoding the Lyp catalytic domain (residues
1–294) was amplified from full-length PTPN22 cDNA (Open Biosys-
tems, Cat#: IHS1382-8404627) with PfuTurbo DNA polymerase
(Stratagene) using the following primers (50 to 30): ATCCTGAATTC
CATGGACCAAAGAGAAATTCTGCAGAAG and ATCCTAAGCTTCATCT
GTCTCTTAAATAGTTCTAATACAGC. The PCR product and pET-21b
were doubly digested with EcoRI and HindIII, gel purified, and li-
gated using T4 DNA ligase, yielding the Lyp-expressing plasmid
pZEW001. Insertional mutagenesis was carried out by Quik-
Change™ essentially as described for TCPTP26 with pZEW001 as
template and the following mutagenic primers (50 to 30): GAC
CATGATGTACCTTGCTGCCCGGGCTGCTGCTCATCTATAGACCCT and
AGGGTCTATAGATGAGCAGCAGCCCGGGCAGCAAGGTACATCATGGTC,
yielding the Lyp-CCPGCC-encoding plasmid pZEW014.
2.3. Lyp expression and purification
BL21(DE3)-codonPLUS-RIL Escherichia coli (Stratagene) contain-
ing either pZEW001 or pZEW014 were grown overnight at 37 °C in
LB. Cultures were diluted, grown to mid-log phase (OD600 = 0.5), in-
duced with 0.2 mM isopropyl-1-thio-b-D-galactopyranoside, and
shaken at 23 °C for 20 h. The cells were harvested by centrifuga-
tion, resuspended in binding buffer (50 mM Tris pH 7.9, 500 mM
NaCl, 5 mM Imidazole), and lysed by French Press at ꢀ2000 psi. Ly-
sates were clarified by centrifugation, and enzyme purifications
were carried out using SwellGel Nickel Chelated Discs (Pierce)
according to the manufacturer’s instructions. The protein solutions
obtained were exchanged into storage buffer (50 mM 3,3-dimeth-
ylglutarate pH 7.0, 1 mM EDTA, 150 mM NaCl, 1 mM dithiothrei-
tol), concentrated, flash-frozen in liquid nitrogen, and stored at
ꢁ80 °C. SDS–PAGE was used to estimate enzyme concentrations,
by comparison of pixel counts of the major 37-kD band in the en-
zyme preparation to those of a reference protein (BSA) run on the
same gel. Inspection of SDS–PAGE gels yielded estimates of >90%
and >50% purity for Lyp and Lyp-CCPGCC, respectively. Nickel-
affinity-chromatography-purified yields of both enzymes were
approximately 2 mg/L of culture.
A key advantage of inhibitor-design strategies that exploit sim-
ilarities in protein-family members (in this case, the conserved
WPD loop of the PTP domain) is that successful engineering can
potentially be applied to any protein-family member,36 and new
targets can be selected as complementary biological data reveal
their importance. The autoimmune-association studies noted
above have brought the need for Lyp inhibitors to the fore, and pri-
mary-sequence analysis suggests that Lyp may be amenable to
FlAsH-sensitization.34 Here we describe the generation and charac-
terization of a sensitized mutant of Lyp, which will provide a novel
tool for the elucidation of Lyp’s functions in engineered cells and,
potentially, for the pharmacological validation of Lyp as an anti-
autoimmune drug target.
2.4. PTP activity and inhibition assays (pNPP substrate)
2.4.1. Michaelis–Menten kinetic assays
Activity assays on para-nitrophenyl phosphate (pNPP) were car-
ried out at 25 °C in low protein-binding tubes. Solutions of wild-
type Lyp or Lyp-CCPGCC (2.5
buffer (50 mM 3,3-dimethylgluterate pH 7.0, 1 mM EDTA, 50 mM
NaCl) for 2.5 h in the presence of 10 M FlAsH or DMSO vehicle.
Solutions were then diluted in 1 ꢂ PTP buffer, and PTP reactions
were initiated by the addition of 20 L pNPP (varying concentra-
tions) to 180 L of the enzyme solution (enzyme concentration
in assay: 500 nM). Reactions were quenched by the addition of
40 L 5 M NaOH. 200 L of reaction mixture were then loaded onto
lM) Lyp were incubated in 1 ꢂ PTP
l
l
l
2. Materials and methods
2.1. General
l
l
a 96-well plate and the absorbance at 405 nm was measured.
Kinetic constants were determined by fitting the data to the
Michaelis–Menten equation.
FlAsH was synthesized as described previously.26,29,37 Absor-
bance measurements were made on a Molecular Devices Versamax
96-well plate reader. Fluorescence measurements were made on
either an ISS K2 multi-frequency phase fluorometer or a Molecular
Devices Spectra Max M5 96-well fluorescence plate reader. Gel
imaging and analyses were performed on a Syngene InGenius
gel-documentation system. Curve fitting was carried out with
SigmaPlot 11.0. Errors bars and values in all figures and tables
2.4.2. FlAsH-concentration-dependence inhibition assays
FlAsH-concentration-dependence assays were carried out at
9 mM pNPP, 250 nM Lyp or Lyp-CCPGCC, and varying concentra-
tions of FlAsH in 1 ꢂ PTP buffer. After a 2 h incubation of enzyme
and FlAsH (or vehicle control), pNPP was added. The reactions were
quenched and quantified as described above.

4886
Z. E. Walton, A. C. Bishop / Bioorg. Med. Chem. 18 (2010) 4884–4891
2.4.3. Kinetics of FlAsH inhibition
2.5 h at room temperature. The FlAsH-fluorescence values (excita-
Reactions were carried out in a total volume of 200
L of premixed solutions of FlAsH and pNPP were aliquoted
onto a 96-well plate. 170 L of an enzyme and buffer solution were
added such that the final concentrations were 250 nM enzyme,
10 mM pNPP, and 0.5–5
M FlAsH in 1 ꢂ PTP buffer. The increase
l
L at 25 °C.
tion: 510 nm, emission: 540 nm) of the solutions were measured in
96-well plates, corrected by subtraction of the fluorescence from a
FlAsH-only (no-protein) control, and normalized to estimate the
percentage of ligand complexed to protein at each Lyp-CCPGCC
concentration ð/Þ. To estimate the apparent dissociation constant
of the Lyp-CCPGCC/FlAsH interaction, the data were fit to Eq. 4,
which is derived from first principles for a reversible, tight-binding
inhibitor:40,41
30
l
l
l
in absorbance at 405 nm was monitored with readings every 10 s
for 45 min. Reaction velocity (At) for each dosage of FlAsH was then
determined at each time point, tx, by calculating the slope of the
linear regression over the 1-min interval tx ꢁ 30 6 tx 6 tx + 30. Rela-
tive activity (At/A0) was obtained by dividing the reaction velocity
in the presence of each FlAsH dosage by the no-FlAsH control. The
pseudo-first-order rate constant (kobs) was determined for each
FlAsH concentration by fitting the data to Eq. 1,38 in which A0
1
/ ¼
ꢃ ð½Fꢄ þ ½Lypꢄ þ KDappÞ
2½Fꢄ
qffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
2
ꢁ
ð½Fꢄ þ ½Lypꢄ þ KDappÞ ꢁ ð4½Fꢄ½LypꢄÞ
ð4Þ
[F] and [Lyp] represent the total concentrations of FlAsH and en-
and A represent the maximum and minimum reaction velocities,
1
zyme in the assay, respectively.
respectively:
At
A0
A
A0
A0 ꢁ A
1
1 þ
eꢁk
ð1Þ
obsꢃt
2.6.3. Fluorescence of Lyp-expressing cells
¼
A0
Pellets of E. coli cells expressing either Lyp or Lyp-CCPGCC were
prepared as described above (Section 2.3) and frozen at ꢁ80 °C.
Pellets from 15 mL of culture were resuspended and diluted to
OD600 = 6.9 (1 cm path length) in 1 ꢂ PTP buffer containing
Each kobs value was plotted against FlAsH concentration and the
data were fit to Eq. 2,38 in which KI is the apparent inhibition con-
stant, ki is the inactivation rate constant, and [F] is the concentra-
tion of FlAsH:
10 lM FlAsH. After 2.5 h at room temperature, the FlAsH-fluores-
cence values (excitation: 510 nm, emission: 540 nm) of the sus-
pensions were measured in 96-well plates and corrected by
subtraction of the fluorescence from a FlAsH-only (no-cell) control.
kix½Fꢄ
kobs
¼
ð2Þ
KI þ ½Fꢄ
2.6.4. In-gel detection of Lyp-CCPGCC/FlAsH fluorescence
Pellets of E. coli cells expressing either Lyp or Lyp-CCPGCC were
freeze-thawed and FlAsH-treated (10 lM) as described above (Sec-
2.5. PTP activity and inhibition assays (DADEpYLIPQQG
substrate)
tion 2.6.3). After 2.5 h at room temperature, the cell suspensions
were mixed 3:1 with 4 ꢂ loading buffer (4 ꢂ LDS, Invitrogen),
boiled for 10 min, and loaded on a 4–12% Bis–Tris SDS–PAGE gel
(Invitrogen). Following electrophoresis, fluorescent bands were
visualized on a gel-documentation system using a UV transillumi-
nator for excitation and a 500–600 nm emission filter.
The PTP activities of Lyp and Lyp-CCPGCC on the phosphopep-
tide DADEpYLIPQQG were measured by monitoring the time-
dependent increase of the peptide’s fluorescence at 305 nm, essen-
tially as described.39 Briefly, solutions of 59 nM enzyme and
294 nM FlAsH (or DMSO vehicle only) were incubated for 1.5 h in
peptide buffer (50 mM 3,3-dimethylglutarate pH 7, 125 mM NaCl,
1 mM EDTA). PTP reactions were initiated by the addition of DAD-
EpYLIPQQG (EMD) to the enzyme-FlAsH solution such that the fi-
nal reaction concentrations were 250 nM FlAsH (or control),
3. Results and discussion
50 nM enzyme, and 15 lM peptide. The increase in fluorescence
3.1. Design of and characterization of a FlAsH-sensitized Lyp
mutant
at 305 nm was then measured (kexc = 280 nm, kem = 305 nm,
0.5 nm slit widths) for 20 min or until substrate was consumed.
To extract kinetic parameters, the intensity of fluorescence was
converted to product concentration ([p]) for each time point (t)
and fit to Eq. 3,39 in which [Lyp] is the total concentration of en-
Lyp is a class-I cysteine-based, classical cytoplasmic PTP.34 In
addition to a canonical WPD loop, Lyp possesses significant cata-
lytic-domain homology to both TCPTP and the other PTPs to which
FlAsH sensitization has been applied.19,35 To design a potentially
FlAsH-sensitized version of Lyp we aligned its primary-sequence
and catalytic-domain structure with TCPTP, the model PTP on
which our PTP-sensitization was developed (Fig. 1A). Both se-
quence comparison and inspection of Lyp’s three-dimensional
structure (Fig. 1B) suggest that a CCPGCC insertion analogous to
the one that has been successful for sensitizing TCPTP may work
for the Lyp target as well. To test this idea, we generated the puta-
tively FlAsH-sensitized insertion mutant Lyp-CCPGCC (Fig. 1A) by
insertional mutagenesis and expressed it from E. coli as a six-histi-
dine tagged protein.
For a mutant enzyme/inhibitor pair to be useful in chemical
biology it is imperative that the mutated protein retains activity
in the absence of the drug.25,42 To investigate the possible effect
of the CCPGCC mutation on Lyp’s PTP activity, we determined the
Michaelis–Menten kinetic parameters for wild-type and Lyp-
CCPGCC with the artificial PTP substrate para-nitrophenyl phos-
phate (pNPP). We found that the insertion mutant retains almost
full catalytic activity in the absence of FlAsH, with a catalytic
rate-constant value (kcat) that is within a factor of two of the
zyme in the assay (50 nM) and [p] is the final concentration of
1
product (15
l
M):
ꢀ
ꢁ
½pꢄ
Km
½pꢄ1
t ¼
þ
ln
ð3Þ
kcat½Lypꢄ kcat½Lypꢄ
½pꢄ1 ꢁ ½pꢄ
2.6. Fluorescence
2.6.1. Kinetics of Lyp-CCPGCC-induced FlAsH fluorescence
Wild-type Lyp or Lyp-CCPGCC (250 nM in 1 ꢂ PTP buffer) was
mixed with FlAsH (500 nM) in 1 ꢂ PTP buffer, and FlAsH-fluores-
cence values (excitation: 510 nm, emission: 529 nm) of the result-
ing solutions were measured every 10 s. The displayed data sets
were normalized by the subtraction of a FlAsH-only (no protein)
control monitored over the same time range.
2.6.2. Measurement of the Lyp-CCPGCC/FlAsH apparent
dissociation constant (KDapp
)
Solutions of 25 nM FlAsH and Lyp-CCPGCC ranging in concen-
tration from 39–2500 nM were incubated in 1 ꢂ PTP buffer for

Z. E. Walton, A. C. Bishop / Bioorg. Med. Chem. 18 (2010) 4884–4891
4887
CCPGCC will be capable of dephosphorylating the tyrosine-phos-
phorylated substrates that Lyp encounters in a mammalian cell.
3.2. Target-specific inhibition of Lyp-CCPGCC by FlAsH
We next investigated the effects of FlAsH treatment on wild-
type Lyp and Lyp-CCPGCC. In previous studies from our lab, FlAsH
was found to have no discernible effect upon a panel of wild-type
PTPs.27 Consistent with this precedent, the kinetic parameters of
wild-type Lyp activity with pNPP were indistinguishable in the
presence and absence of FlAsH (Table 2, Fig. 2A). By contrast,
Lyp-CCPGCC is strongly inhibited by FlAsH: upon incubation with
a fourfold molar excess of FlAsH, the specificity constant of Lyp-
CCPGCC activity (kcat/KM) dropped 4.5-fold (Table 2, Fig. 2B). As
previously observed with other FlAsH-sensitized PTPs, Lyp-
CCPGCC inhibition appears to be noncompetitive in nature, as the
loss of catalytic efficiency is due completely to a decrease in kcat
(Table 2).
To test whether the degree of Lyp-CCPGCC inhibition was
dependent on the FlAsH dosage, we performed a concentration-
dependence inhibition assay (Fig. 2C). We observed that the degree
of inhibition by FlAsH is highly concentration-dependent, with 50%
inhibition (IC50) achieved at approximately 625 nM FlAsH. It
should be noted that FlAsH so potently inhibits Lyp-CCPGCC that
the IC50 value approaches the concentration of enzyme in the assay
(250 nM Lyp-CCPGCC, the lowest concentration that can be reason-
ably used in the pNPP-based assay). Under conditions of such po-
tent, almost stoichiometric, inhibition, measured IC50 values are
highly dependent on the enzyme concentration used, and, there-
fore, of little fundamental significance. For example, under the con-
ditions of the inhibition experiment shown in Fig. 2C (250 nM Lyp-
CCPGCC), it is theoretically impossible that an inhibitor which
binds enzyme in a 1:1 manner could demonstrate a 50% inhibition
value of less than 125 nM, half the enzyme concentration. As de-
scribed below (Section 3.4), more sensitive fluorescence-based as-
says reveal a substantially tighter Lyp-CCPGCC/FlAsH interaction
than would be inferred from the inhibition data.
If Lyp-CCPGCC inhibition is to be useful in a cellular context, it is
important that FlAsH, the target-specific inhibitor of Lyp-CCPGCC,
acts in a substrate-independent manner. To ensure that the FlAsH
sensitivity observed with pNPP was not substrate-dependent we
investigated Lyp-CCPGCC’s FlAsH sensitivity with DADEpYLIPQQG.
Indeed, the engineered FlAsH sensitivity of Lyp-CCPGCC proved to
be substrate-independent (Table 2 and Fig. 3). When incubated with
FlAsH, the activity of the mutant dropped dramatically and specifi-
cally (as with pNPP, FlAsH had no significant effect upon wild-type).
TheFlAsH-inducedinhibitionof DADEpYLIPQQG dephosphorylation
is essentially complete: following incubation with a fivefold molar
excess of FlAsH, the magnitude of Lyp-CCPGCC inhibition is so great
that the data could not be fit to derive kinetic constants (Fig. 3B).
Thus, FlAsH-induced inhibition of peptide dephosphorylation by
Lyp-CCPGCC is consistent with the potency observed with pNPP
and suggests that FlAsH-inhibition could be effective in cellulo,
where PTP substrates are more chemically similar to DAD-
EpYLIPQQG than to pNPP. And, taken together, these data showing
the potency, specificity, and substrate independence of Lyp-CCPGCC
Figure 1. Design of
a FlAsH-sensitized Lyp mutant. (A) Amino-acid sequence
alignment of the WPD-loop region of a previously FlAsH-sensitized PTP, TCPTP
(wild-type: WT, sensitized: TCPTP-CCPGCC), with that of wild-type Lyp and Lyp-
CCPGCC. (B) Ribbon diagram of the Lyp catalytic domain (PDB code: 2QCJ19). Lyp’s
canonical WPD loop is shown in yellow with the position of the Lyp-CCPGCC
insertion shown in red. For perspective, the phosphotyrosine-binding loop of the
PTP active site is shown in green.
corresponding wild-type construct (Table 1). (The wild-type Lyp
catalytic domain has been enzymatically characterized by others
with pNPP previously,19 and our construct yielded kinetic con-
stants that were in good agreement with literature data.) The tol-
erance of Lyp to the six-amino-acid insertion, indicated by its
relatively low 1.7-fold reduction in kcat, is interesting in light of
the fact that Lyp’s closest homolog, PEST, was substantially more
affected by the analogous CCPGCC insertion (wild-type PEST:
kcat = 0.59 sꢁ1; PEST-CCPGCC: kcat = 0.081 sꢁ1).27 These findings
suggest that primary-sequence alignments alone will not consti-
tute a suitable guide for prediction of which PTPs are most amena-
ble to FlAsH sensitization via CCPGCC insertion.
To further test the suitability of Lyp-CCPGCC as an inhibitor-sen-
sitized PTP, we measured its activity with a more physiologically rel-
evant substrate, the phosphopeptide DADEpYLIPQQG, which
corresponds to the auto-phosphorylation site of the epidermal
growth factor receptor (EGFR988-998). With the phosphopeptide sub-
strate we again found that, in the absence of FlAsH, Lyp-CCPGCC has
only a slightly lower activity than wild-type Lyp (virtually identical
1.8- and 1.7-fold drops in kcat relative to wild-type Lyp on peptide
and pNPP, respectively; see Table 1). These data show that the cata-
lytic activity of the CCPGCC mutant is ‘wild-type-like’ in activity
independent of substrate and suggest that, absent FlAsH, Lyp-
Table 2
PTP activities of wild-type Lyp and Lyp-CCPGCC catalytic domains after pre-
incubation with FlAsH
Table 1
Inherent PTP activities of wild-type Lyp and Lyp-CCPGCC catalytic domains
kcat (sꢁ1
)
KM (mM)
kcat (sꢁ1
)
KM (lM)
a
a
b
b
Enzyme
a
b
Enzyme
kcat (sꢁ1
a
)
KM (mM)
kcat (sꢁ1
b
)
KM (lM)
Wild-type Lyp
Lyp-CCPGCC
0.49 0.02
0.057 0.004
4.92 0.35
4.83 0.44
3.84 1.11
NDc
7.55 4.48
NDc
Wild-type Lyp
Lyp-CCPGCC
0.49 0.04
0.27 0.02
4.86 0.39
5.05 0.35
4.16 0.56
2.25 0.56
8.12 2.63
17.8 1.8
a
b
c
With pNPP used as the PTP substrate.
With DADEpYLIPQQG used as the PTP substrate.
ND: unable to determine kinetic parameters due to low activity; see Figure 3B.
a
With pNPP used as the PTP substrate.
With DADEpYLIPQQG used as the PTP substrate.
b

4888
Z. E. Walton, A. C. Bishop / Bioorg. Med. Chem. 18 (2010) 4884–4891
Figure 3. Target-specific inhibition of DADEpYLIPQQG dephosphorylation. (A) Wild-
type Lyp (59 nM) or (B) Lyp-CCPGCC (59 nM) was incubated in the absence (closed
circles) or presence of FlAsH (294 nM, open circles). After 90 min, DADEpYLIPQQG
(15 lM) was added to the enzyme solutions and peptide dephosphorylation was
monitored by fluorescence.
dent, and the timescale of FlAsH action on Lyp-CCPGCC is a poten-
tially complicating issue when using the compound for controlling
protein function.
To assess the rate of Lyp-CCPGCC inhibition by FlAsH, we used a
continuous assay of pNPP hydrolysis to probe enzyme activity and
time-dependent inhibition concurrently.44 We continuously moni-
tored the PTP reaction at various concentrations of FlAsH and
determined that the slopes of the resulting progress curves de-
creased over time, indicating a time-dependent drop in the con-
centration of catalytically active Lyp-CCPGCC. The rate at which
these progress curves fell was dependent on the concentration of
FlAsH, and the exponential decay of relative activity suggested a
first-order dependence on time (Fig. 4A). Analysis of the resulting
pseudo-first-order rate constants (kobs) as a function of FlAsH con-
centration showed that Lyp-CCPGCC inhibition displays saturation
kinetics (Fig. 4B). The nonlinear relationship between kobs and
inhibitor concentration suggests a two-step model of inhibition
in which FlAsH and Lyp-CCPGCC first associate in a loose, revers-
ible manner; then, in a second step, undergo a slow conversion
to an irreversibly inhibited form. Fitting the inhibition data to this
model (see Section 2.4.3) yielded values for the apparent inhibition
Figure 2. Target-specific inhibition of Lyp-CCPGCC. (A) WT Lyp (2.5 lM) or (B) Lyp-
CCPGCC (2.5
lM) was incubated in the absence (closed circles) or presence of FlAsH
(10 M, open circles), diluted, and assayed for activity with the PTP substrate pNPP
l
at the indicated concentrations. (C) Concentration-dependence of FlAsH-induced
inhibition: wild-type Lyp (250 nM, closed circles) or Lyp-CCPGCC (250 nM, open
circles) was incubated in the absence or presence (indicated concentrations) of
FlAsH. The resulting solutions were assayed for activity with pNPP (9 mM). ‘% PTP
Activity’ is defined as the initial velocity in the presence of FlAsH divided by the
initial velocity of the vehicle-only (100%) control.
inhibition imply that FlAsH could be used in a cellular context to tar-
get Lyp-CCPGCC without substantial off-target PTP inhibition.
3.3. Kinetics of Lyp-CCPGCC inhibition by FlAsH
constant (KaI pp) of 3.04 1.05
lM and an inactivation rate constant
(ki) of 0.0067 0.0022 sꢁ1. These derived measures of inactivation
kinetics compare favorably with other ‘slow-binding’ PTP inhibi-
tors; for example, a recently reported class of aryl vinyl sulfones
and sulfonates inactivate PTP domains with KI and ki values that
are roughly 100-fold higher and fivefold lower, respectively.38
In all of the inhibition experiments described above, Lyp-CCPGCC
was allowed to pre-incubate with FlAsH prior to the measurement of
PTP activity. Because FlAsH is not a rapid, reversible protein binder—
biarsenicals make covalent sulfur–arsenic bonds with their peptide
targets29,43—inhibition of Lyp-CCPGCC is presumably time-depen-

Z. E. Walton, A. C. Bishop / Bioorg. Med. Chem. 18 (2010) 4884–4891
4889
Figure 5. Lyp-CCPGCC-induced FlAsH fluorescence. (A) Wild-type Lyp (250 nM,
closed circles) or Lyp-CCPGCC (250 nM, open circles) was mixed with FlAsH
(500 nM), and FlAsH fluorescence was monitored over time. The displayed data sets
were normalized by the subtraction of a FlAsH-only (no protein) control. (B)
Determination of the Lyp-CCPGCC/FlAsH apparent dissociation constant: FlAsH
(25 nM) was incubated with the indicated concentrations of Lyp-CCPGCC for 2.5 h
and the FlAsH fluorescence of the resulting solutions was measured.
Figure 4. Kinetics of FlAsH-induced Lyp-CCPGCC inhibition. (A) Solutions of Lyp-
CCPGCC (250 nM) and pNPP (10 mM) were combined with varying concentrations
of FlAsH (closed circles: 0.5
lM, open circles: 1.0
lM, closed triangles: 2.0 lM, open
triangles: 4.0 M, squares: 5.0
l
lM) and assayed for PTP activity by continuous
measurement of absorbance at 405 nm. Relative activity at each time point was
computed as the slope of the reaction curve in the presence of FlAsH divided by the
slope of the reaction curve for a no-FlAsH control. The curves shown derive from the
fitting of the individual time points to a model of exponential activity decay with a
first-order dependence on time. (B) Pseudo-first-order rate constants were derived
from the curve fitting described above and plotted against the relevant indicated
concentrations of FlAsH.
complicates the extraction of true inhibition-constant values from
percent-inhibition values.) To estimate the apparent dissociation
constant in an assay that was not constrained by detection of Lyp-
CCPGCC activity, we incubated
a constant amount of FlAsH
(25 nM) with varying amounts of Lyp-CCPGCC and measured the
endpoint FlAsH-fluorescence values of the resulting solutions. As
shown in Fig. 5B, even at very low Lyp-CCPGCC concentrations FlAsH
is largely protein-bound, and a binding-model fit of the fluorescence
data yields an apparent dissociation (KaDpp) of 68 nM, a remarkably
tight interaction for an inhibitor of Lyp activity. (The few known
selective inhibitors of wild-type Lyp have inhibition constants in
3.4. Fluorescence characterization of Lyp-CCPGCC/FlAsH binding
FlAsH was developed by Tsien and co-workers as a fluores-
cence-based protein-visualization tool, and binding of FlAsH to
its tetracysteine target sequence (either in the context of a short
peptide or a protein) gives rise to a dramatic increase in the com-
pound’s fluorescence.29,30 While our primary interest lies in control
of Lyp activity, not in Lyp visualization, the putative increase in
FlAsH fluorescence upon Lyp-CCPGCC binding potentially provides
a useful tool for characterizing the kinetics and thermodynamics of
FlAsH’s interactions with the target enzyme. Indeed, we found that
incubation of Lyp-CCPGCC with FlAsH leads to a rapid increase in
fluorescence over the course of about 10 min (Fig. 5A). By contrast,
no substantial fluorescence increase was observed upon incubation
of wild-type Lyp with FlAsH (Fig. 5A). These data suggest that
FlAsH fluorescence can be a useful tool for specifically detecting
the Lyp-CCPGCC/FlAsH interaction, either for in vitro biophysical
studies, or in complex proteomic or cellular mixtures.
the range of 1–5 l
M.19,20) In a cell, the concentration of FlAsH re-
quired for potent Lyp-CCPGCC inhibition would depend on Lyp-
CCPGCC’s cellular concentration. Nevertheless, our in vitro data pre-
dict that FlAsH-induced Lyp-CCPGCC inhibition in a mammalian cell
would require administration of FlAsH at low concentrations, com-
pared to analogous experiments with known Lyp inhibitors, poten-
tially reducing the off-target effects inherent to applications of
small-molecule drugs to complex systems.
3.5. Targeting of Lyp-CCPGCC in a complex proteomic mixture
Having established that FlAsH inhibits purified Lyp-CCPGCC, we
next sought to determine whether FlAsH could specifically target
Lyp-CCPGCC in the context of a complex proteome, such as a cell
preparation. Since a direct in-cell reporter of Lyp activity is not avail-
able, we took advantage of Lyp-CCPGCC-induced FlAsH fluorescence
We used the Lyp-CCPGCC-induced increasein FlAsH fluorescence
to estimate the apparent binding constant of the Lyp-CCPGCC/FlAsH
interaction with greater sensitivity than could be achieved in pNPP-
based inhibition assays. (As noted earlier, the high potency of FlAsH

4890
Z. E. Walton, A. C. Bishop / Bioorg. Med. Chem. 18 (2010) 4884–4891
Importantly, measured FlAsH fluorescence in the presence of
Lyp-CCPGCC-expressing E. coli was reproducibly greater (approxi-
mately 80%) than that of wild-type-Lyp expressing cells (Fig. 6A).
To further investigate the origins of the greater bulk fluorescence
in the Lyp-CCPGCC-containing proteome, we separated proteins
from the FlAsH-treated cell preparations by SDS–PAGE. By in-gel
detection of FlAsH fluorescence, we observed a single band at 37
kD—the molecular weight of Lyp’s catalytic domain—that is en-
riched in lysates from the Lyp-CCPGCC expressing cells (Fig. 6B).
(Overexposure of the image allows for detection of other low-fluo-
rescence bands in both lanes, including one whose observed
molecular weight of 27 kD is consistent with that of SlyD, data
not shown.) Since the two cell populations used in these experi-
ments differ only by the presence of six amino acids in a single pro-
tein, the observed differences in bulk and 37-kD FlAsH
fluorescence unambiguously derive from FlAsH binding to its tar-
get sequence in the Lyp-CCPGCC. These results represent the first
demonstration that FlAsH can be used to target PTPs for inhibition
in complex proteomic mixtures and lay the groundwork for future
PTP targeting in eukaryotic cells.
4. Conclusions
Lymphoid-specific protein tyrosine phosphatase (Lyp) is an
important leukocyte-signaling molecule and a putative anti-auto-
immune therapeutic target. Small molecules that can specifically
control cellular Lyp activity are thus important chemical-biology
tools, both in basic signaling studies and in the potential drug-tar-
get validation of Lyp. We have shown that insertional mutagenesis
can be used to generate a Lyp mutant (Lyp-CCPGCC) that is sensi-
tive to inhibition by a small molecule (FlAsH) which does not inhi-
bit Lyp or any other wild-type PTP tested to date. Lyp-CCPGCC was
rationally engineered to display a FlAsH-binding peptide that does
not disrupt its inherent PTP activity in the absence of added ligand.
Upon addition of FlAsH, the activity of Lyp mutant is strongly
inhibited, even under experimental conditions in which FlAsH
and Lyp-CCPGCC are present at almost equal concentrations. We
have also shown that Lyp-CCPGCC can be targeted in cell prepara-
tions of E. coli that express the target protein. Lyp-CCPGCC/FlAsH
thus represents an ‘orthogonal’ PTP/inhibitor pair that can be used
to control Lyp activity, potentially providing a tool for elucidating
Lyp’s functions in mammalian cells and engineered organisms.
Figure 6. Targeting Lyp-CCPGCC in E. coli cell preparations. (A) Freeze-thawed
E. coli cells expressing either wild-type Lyp or Lyp-CCPGCC were incubated in the
presence of FlAsH (10 lM). After 2.5 h, the FlAsH-fluorescence values of the cell
suspensions were measured. (B and C) E. coli cells expressing either Lyp or Lyp-
CCPGCC were prepared and FlAsH-treated as in (A) and subsequently lysed. Cellular
proteins were separated by SDS–PAGE. FlAsH-labeled proteins were detected by
fluorescence (B), followed by visualization of all proteins in the same gel by
Coomassie staining (C). Lane 1: fluorescent protein standard (Invitrogen), Lane 2:
lysate from Lyp-expressing cells, Lane 3: lysate from Lyp-CCPGCC-expressing cells.
The black arrow indicates the prominent fluorescent 37-kD band that is enriched in
Lyp-CCPGCC-expressing lysates.
as a means to potentially detect Lyp-CCPGCC/FlAsH interactions in a
complexmilieu. AlthoughLypvisualizationis nottheprimarygoalof
the current work (FlAsH-mediated visualization of Lyp could be
accomplished simply by placing a CCPGCC tag at Lyp’s N- or C-termi-
nus37), thesensitivityof fluorescencedetection couldprovidea pow-
erful test of FlAsH’s ability to specifically target Lyp-CCPGCC in the
presence of thousands of potentially competing biomolecules.
To investigate the ability of FlAsH to bind Lyp-CCPGCC in a com-
plex mixture, we incubated freeze-thawed wild-type Lyp-express-
ing and Lyp-CCPGCC-expressing E. coli cells in the presence of
FlAsH and measured the fluorescence of the resulting cell suspen-
sions. (Although the mammalian-cell permeability of FlAsH is well
established,37 we found that a freeze-thaw cycle was necessary for
the timely penetration of FlAsH into E. coli cells.) We found that
wild-type-Lyp-expressing cells give rise to a significant FlAsH fluo-
Acknowledgments
This research was supported by the National Institutes of
Health (2 R15 GM071388-02) and Amherst College. The authors
thank Professor Patricia O’Hara for helpful conversations and for
the use of her lab’s K2 fluorometer.
References
1. Tonks, N. K. Nat. Rev. Mol. Cell Biol. 2006, 7, 833.
2. Jiang, Z. X.; Zhang, Z. Y. Cancer Metastasis Rev. 2008, 27, 263.
3. Zhang, S.; Zhang, Z. Y. Drug Discovery Today 2007, 12, 373.
4. Zhang, Z. Y.; Lee, S. Y. Expert Opin. Investig. Drugs 2003, 12, 222.
5. Easty, D.; Gallagher, W.; Bennett, D. C. Curr. Cancer Drug Targets 2006, 6, 519.
6. Bialy, L.; Waldmann, H. Angew. Chem., Int. Ed. 2005, 44, 3814.
7. Vang, T.; Miletic, A. V.; Bottini, N.; Mustelin, T. Autoimmunity 2007, 40, 453.
8. Bottini, N.; Musumeci, L.; Alonso, A.; Rahmouni, S.; Nika, K.; Rostamkhani, M.;
MacMurray, J.; Meloni, G. F.; Lucarelli, P.; Pellecchia, M.; Eisenbarth, G. S.;
Comings, D.; Mustelin, T. Nat. Genet. 2004, 36, 337.
9. Bottini, N.; Vang, T.; Cucca, F.; Mustelin, T. Semin. Immunol. 2006, 18, 207.
10. Begovich, A. B.; Carlton, V. E. H.; Honigberg, L. A.; Schrodi, S. J.; Chokkalingam,
A. P.; Alexander, H. C.; Ardlie, K. G.; Huang, Q. Q.; Smith, A. M.; Spoerke, J. M.;
Conn, M. T.; Chang, M.; Chang, S. Y. P.; Saiki, R. K.; Catanese, J. J.; Leong, D. U.;
Garcia, V. E.; McAllister, L. B.; Jeffery, D. A.; Lee, A. T.; Batliwalla, F.; Remmers,
E.; Criswell, L. A.; Seldin, M. F.; Kastner, D. L.; Amos, C. I.; Sninsky, J. J.;
Gregersen, P. K. Am. J. Hum. Genet. 2004, 75, 330.
rescence when compared to
a FlAsH/buffer control solution
(Fig. 6A). Although wild-type Lyp does not itself cause FlAsH to
fluoresce (Fig. 5A), our observed FlAsH fluorescence in the presence
of Lyp-expressing bacteria is consistent with the previous finding
that E. coli cells endogenously express at least one protein (SlyD)
that binds FlAsH and induces its fluorescence.40,45 We hypothesize,
therefore, that the FlAsH fluorescence from Lyp-expressing bacte-
ria results from the SlyD/FlAsH interaction, with possible low level
contributions from other E. coli gene products.

Z. E. Walton, A. C. Bishop / Bioorg. Med. Chem. 18 (2010) 4884–4891
4891
11. Velaga, M. R.; Wilson, V.; Jennings, C. E.; Owen, C. J.; Herington, S.; Donaldson,
P. T.; Ball, S. G.; James, R. A.; Quinton, R.; Perros, P.; Pearce, S. H. S. J. Clin.
Endocrinol. Metab. 2004, 89, 5862.
12. Vandiedonck, C.; Capdevielle, C.; Giraud, M.; Krumeich, S.; Jais, J. P.; Eymard, B.;
Tranchant, C.; Gajdos, P.; Garchon, H. J. Ann. Neurol. 2006, 59, 404.
13. Kyogoku, C.; Langefeld, C. D.; Ortmann, W. A.; Lee, A.; Selby, S.; Carlton, V. E. H.;
Chang, M.; Ramos, P.; Baechler, E. C.; Batliwalla, F. M.; Novitzke, J.; Williams, A.
H.; Gillett, C.; Rodine, P.; Graham, R. R.; Ardlie, K. G.; Gaffney, P. M.; Moser, K.
L.; Petri, M.; Begovich, A. B.; Gregersen, P. K.; Behrens, T. W. Am. J. Hum. Genet.
2004, 75, 504.
14. Vang, T.; Congia, M.; Macis, M. D.; Musumeci, L.; Orru, V.; Zavattari, P.; Nika, K.;
Tautz, L.; Tasken, K.; Cucca, F.; Mustelin, T.; Bottini, N. Nat. Genet. 2005, 37,
1317.
15. Orru, V.; Tsai, S. J.; Rueda, B.; Fiorillo, E.; Stanford, S. M.; Dasgupta, J.; Hartiala,
J.; Zhao, L.; Ortego-Centeno, N.; D’Alfonso, S.; Arnett, F. C.; Wu, H.; Gonzalez-
Gay, M. A.; Tsao, B. P.; Pons-Estel, B.; Alarcon-Riquelme, M. E.; He, Y. T.; Zhang,
Z. Y.; Allayee, H.; Chen, X. J. S.; Martin, J.; Bottini, N.; Italian Collaborative, G.
Hum. Mol. Genet. 2009, 18, 569.
27. Zhang, X. Y.; Chen, V. L.; Rosen, M. S.; Blair, E. R.; Lone, A. M.; Bishop, A. C.
Bioorg. Med. Chem. 2008, 16, 8090.
28. Zhang, X.-Y.; Bishop, A. C. Biochemistry 2008, 47, 4491.
29. Griffin, B. A.; Adams, S. R.; Tsien, R. Y. Science 1998, 281, 269.
30. Adams, S. R.; Campbell, R. E.; Gross, L. A.; Martin, B. R.; Walkup, G. K.; Yao, Y.;
Llopis, J.; Tsien, R. Y. J. Am. Chem. Soc. 2002, 124, 6063.
31. Iversen, L. F.; Moller, K. B.; Pedersen, A. K.; Peters, G. H.; Petersen, A. S.;
Andersen, H. S.; Branner, S.; Mortensen, S. B.; Moller, N. P. J. Biol. Chem. 2002,
277, 19982.
32. Wiesmann, C.; Barr, K. J.; Kung, J.; Zhu, J.; Erlanson, D. A.; Shen, W.; Fahr, B. J.;
Zhong, M.; Taylor, L.; Randal, M.; McDowell, R. S.; Hansen, S. K. Nat. Struct. Mol.
Biol. 2004, 11, 730.
33. Hansen, S. K.; Cancilla, M. T.; Shiau, T. P.; Kung, J.; Chen, T.; Erlanson, D. A.
Biochemistry 2005, 44, 7704.
34. Andersen, J. N.; Mortensen, O. H.; Peters, G. H.; Drake, P. G.; Iversen, L. F.; Olsen,
O. H.; Jansen, P. G.; Andersen, H. S.; Tonks, N. K.; Moller, N. P. Mol. Cell. Biol.
2001, 21, 7117.
35. Barr, A. J.; Ugochukwu, E.; Lee, W. H.; King, O. N. F.; Filippakopoulos, P.; Alfano,
I.; Savitsky, P.; Burgess-Brown, N. A.; Muller, S.; Knapp, S. Cell 2009, 136, 352.
36. Bishop, A. C.; Ubersax, J. A.; Petsch, D. T.; Matheos, D. P.; Gray, N. S.; Blethrow,
J.; Shimizu, E.; Tsien, J. Z.; Schultz, P. G.; Rose, M. D.; Wood, J. L.; Morgan, D. O.;
Shokat, K. M. Nature 2000, 407, 395.
37. Griffin, B. A.; Adams, S. R.; Jones, J.; Tsien, R. Y. Methods Enzymol. 2000, 327,
565.
38. Liu, S. J.; Zhou, B.; Yang, H. Y.; He, Y. T.; Jiang, Z. X.; Kumar, S.; Wu, L.; Zhang, Z.
Y. J. Am. Chem. Soc. 2008, 130, 8251.
16. Blaskovich, M. A. Curr. Med. Chem. 2009, 16, 2095.
17. Zhang, Z. Y. Curr. Opin. Chem. Biol. 2001, 5, 416.
18. Zhang, Z. Y. Annu. Rev. Pharmacol. Toxicol. 2002, 42, 209.
19. Yu, X.; Sun, J. P.; He, Y. T.; Guo, X. L.; Liu, S. J.; Zhou, B.; Hudmon, A.; Zhang, Z. Y.
Proc. Natl. Acad. Sci. U.S.A. 2007, 104, 19767.
20. Karver, M. R.; Krishnamurthy, D.; Kulkarni, R. A.; Bottini, N.; Barrios, A. M. J.
Med. Chem. 2009, 52, 6912.
21. Wu, S. D.; Bottini, M.; Rickert, R. C.; Mustelin, T.; Tautz, L. ChemMedChem 2009,
4, 440.
22. Krishnamurthy, D.; Karver, M. R.; Fiorillo, E.; Orru, V.; Stanford, S. M.; Bottini,
N.; Barrios, A. M. J. Med. Chem. 2008, 51, 4790.
23. Xie, Y. L.; Liu, Y. D.; Gong, G. L.; Rinderspacher, A.; Deng, S. X.; Smith, D. H.;
Toebben, U.; Tzilianos, E.; Branden, L.; Vidovic, D.; Chung, C.; Schurer, S.; Tautz,
L.; Landry, D. W. Bioorg. Med. Chem. Lett. 2008, 18, 2840.
24. Hoffman, H. E.; Blair, E. R.; Johndrow, J. E.; Bishop, A. C. J. Am. Chem. Soc. 2005,
127, 2824.
39. Zhang, Z. Y.; Maclean, D.; Thieme-Sefler, A. M.; Roeske, R. W.; Dixon, J. E. Anal.
Biochem. 1993, 211, 7.
40. Krishnan, B.; Gierasch, L. M. Chem. Biol. 2008, 15, 1104.
41. Luedtke, N. W.; Dexter, R. J.; Fried, D. B.; Schepartz, A. Nat. Chem. Biol. 2007, 3,
779.
42. Bishop, A. C.; Buzko, O.; Shokat, K. M. Trends Cell Biol. 2001, 11, 167.
43. Madani, F.; Lind, J.; Damberg, P.; Adams, S. R.; Tsien, R. Y.; Graslund, A. O. J. Am.
Chem. Soc. 2009, 131, 4613.
25. Bishop, A. C.; Zhang, X. Y.; Lone, A. M. Methods 2007, 42, 278.
26. Zhang, X. Y.; Bishop, A. C. J. Am. Chem. Soc. 2007, 129, 3812.
44. Montalibet, J.; Skorey, K. I.; Kennedy, B. P. Methods 2005, 35, 2.
45. Wang, T.; Yan, P.; Squier, T. C.; Mayer, M. U. ChemBioChem 2007, 8, 1937.