Discovery of novel 3-hydroxyandrosta-5,7-Diene-17-Carboxylic acid derivatives as anti-inflammatory bowel diseases (IBD) agents

Article abstract of DOI:10.1016/j.ejmech.2021.113468

A series of steroidal compounds based on 3-hydroxyandrosta-5,7-diene-17-carboxylic acid core structure were designed, synthesized and bio-evaluated for their anti-inflammatory potency. Among them, compound 5c, 6f, and 6q effectively inhibited the producti

Full text of DOI:10.1016/j.ejmech.2021.113468

European Journal of Medicinal Chemistry 220 (2021) 113468
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Discovery of novel 3-hydroxyandrosta-5,7-Diene-17-Carboxylic acid
derivatives as anti-inflammatory bowel diseases (IBD) agents
,
,
Jingxuan Chen a 1, Ling Li a 1, Jin Liu a, Sijie Yuan b, Wenzhen Liao b, Andrzej T. Slominski c,
d
e
a, *
_
Wei Li , Michał A. Zmijewski , Jianjun Chen
a School of Pharmaceutical Sciences, Guangdong Provincial Key Laboratory of New Drug Screening, Southern Medical University, Guangzhou, 510515, China
b Department of Nutrition and Food Hygiene, Guangdong Provincial Key Laboratory of Tropical Disease Research, School of Public Health, Southern Medical
University, Guangzhou, China
c Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL, 35294, USA
d Department of Pharmaceutical Sciences, University of Tennessee Health Science Center, Memphis, TN, 38163, USA
e
ꢀ
ꢀ
Department of Histology, Faculty of Medicine, Medical University of Gdansk, Gdansk, Poland
a r t i c l e i n f o
a b s t r a c t
Article history:
A series of steroidal compounds based on 3-hydroxyandrosta-5,7-diene-17-carboxylic acid core structure
were designed, synthesized and bio-evaluated for their anti-inflammatory potency. Among them,
compound 5c, 6f, and 6q effectively inhibited the production of nitric oxide (NO) in lipopolysaccharide
(LPS) stimulated RAW 264.7 macrophages. They inhibited the expression of inducible NO synthase (iNOS)
and prostaglandin synthase-2 (COX-2) at mRNA level. Compound 6q displayed inhibitory effects on both
iNOS and COX-2 expression in a concentration-dependent manner. Furthermore, 6q was found to
effectively decrease the mRNA and protein levels of interleukin 6 (IL-6). Mechanically, 6q could potently
Received 31 December 2020
Received in revised form
29 March 2021
Accepted 9 April 2021
Available online 24 April 2021
Keywords:
Steroidal compounds
NF-kB signaling
DSS-Induced mouse colitis
downregulate NF-kB signaling via suppression of the Akt/PI3K pathway. Moreover, 6q demonstrated high
in vivo anti-inflammatory activities in a mouse colitis model induced by dextran sulfate sodium (DSS).
Taken together, these data indicate that 6q represents a novel and promising anti-inflammatory bowel
diseases (IBD) agent worthy of further investigation.
Anti-inflammatory bowel diseases
© 2021 Elsevier Masson SAS. All rights reserved.
1. Introduction
controlling symptoms, maintaining remission, and preventing
relapse. Current medications used in the treatment of IBD include
Inflammation is a complex immunological response of the body
against tissue damage [1,2], causing swelling, redness, and heat
with pain [3]. In the western world inflammatory bowel diseases
(IBD), comprising ulcerative colitis (UC) and Crohn’s disease (CD),
affect up to 0.5% of the general population [4,5]. The widespread
and debilitating disease is characterized by uncontrolled inflam-
mation in the intestinal mucosa, triggered by an unbalanced, pro-
inflammatory immune response to the commensal gut microbiota
[6]. Patients with IBD suffer from fever, diarrhea, and rectal
bleeding, which causes a substantial increase in health care costs
and impairs their quality of life [7]. Importantly, patients with long-
standing UC and extensive CD are at an increased risk for dysplasia
and colorectal cancer [8]. Treatments for IBD are limited to
small molecules (Fig.1) and biologics, such as aminosalicylates (e.g.,
mesalamine), corticosteroids (e.g., prednisolone, and dexametha-
sone), immunomodulators (e.g., methotrexate), anti-tumor necro-
sis factor-
a (TNF-a) drugs (e.g., infliximab), anti-cell adhesion
molecules (e.g., vedolizumab), etc. [9]. Although considerable
progress has been made recently, an unmet clinical need remains
for more effective and safer IBD therapeutics.
Steroid hormones are crucial substances for many biological
processes such as metabolism, inflammation, and immune func-
tions. Steroids are commonly used in the treatment of various
diseases, including cardiovascular, autoimmune diseases, and
cancer. For instance, corticosteroids have been commonly used for
patients suffering from moderate to severe ulcerative proctitis or
* Corresponding author.
E-mail address: jchen21@smu.edu.cn (J. Chen).
These authors contributed equally to this work.
1
https://doi.org/10.1016/j.ejmech.2021.113468
0223-5234/© 2021 Elsevier Masson SAS. All rights reserved.

J. Chen, L. Li, J. Liu et al.
European Journal of Medicinal Chemistry 220 (2021) 113468
Fig. 1. Structures of anti-IBD drugs.
distal ulcerative colitis [10]. However, the risks of long-term ther-
apy outweigh their benefits when used as maintenance therapy in
the treatment of either ulcerative colitis or Crohn’s disease [11].
We have previously reported the synthesis of 3-
hydroxyandrosta-5,7-diene-17-carboxylic acid (17-COOH-7DA) as
an effective anti-proliferative agent against melanocytes [12]. In a
continuation of our research interest in this scaffold, we designed,
synthesized and evaluated the biological activities of several series
of novel steroids based on the structure of 17-COOH-DA (Fig. 2).
However, these compounds exhibited little anti-proliferative and
2. Results and discussion
2.1. Chemistry
Compounds 4a-k and 6a-d were synthesized according to the
routes depicted in Scheme 1. Started with the commercially avail-
able compound 1 (pregnenolone acetate), the oxidative cleavage of
the side chain under basic condition provided the key intermediate
2 (3b-acetoxy-etientic acid) with high yield (>95%) [13]. The 17-
COOH of compound 2 was subject to an esterification reaction
cytotoxic activities (e.g. IC50 > 50
mM) against different cancer cell
with appropriate alcohols to generate various esters for further
lines. Since they are structurally similar to corticosteroids that are
commonly used in the management of inflammatory bowel disease
(IBD), we then evaluated the anti-inflammatory activity of these
compounds as detailed below.
reactions. The esters were acetylated at the 3b-OH position with
acetic anhydride to obtain intermediate 3. Intermediates 4 were
prepared by introduction of the 5,7-diene to intermediate 3 fol-
lowed by removal of the 3-acetyl group to generate compounds 5a-
Fig. 2. Rationale for the design of target compounds.
2

J. Chen, L. Li, J. Liu et al.
European Journal of Medicinal Chemistry 220 (2021) 113468
Scheme 1. Synthesis of compounds 5a-d and compounds 6a-s.
Reagents and conditions: (a) NaOH, Br2, 0 ꢀC-RT; (b) ROH, H2SO4, reflux; (c) AcO2, Triethylamine (TEA), 4-dimethylaminopyridine (DMAP), CH2Cl2; (d) Dibromantin, azobisiso-
butyronitrile (AIBN), hexane: benzene (1:1), reflux 20min; (e) tetra-butylammonium bromide (TBAB), Tetrahydrofuran (THF), RT, 75min, then tetra-butylammonium fluoride
(TBAF), RT, 50min; (f) LiOH, methanol, H2O, RT; (g) 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI), 1-Hydroxybenzotriazole (HOBt), TEA, various amines,
Dimethyl sulfoxide (DMSO), RT.
d. The amide compounds 6a-s were synthesized by coupling the 17-
COOH of intermediate 2 with appropriate amines.
preliminary screening showed that nine compounds displayed
inhibitory effects (inhibition rate greater than 50%) at a dose of
Compounds 8a-c were produced following the synthetic strat-
egy outlined in Scheme 2. Pregnenolone acetate was transformed
to the 5,7-diene compound 7 by dehydrobromination. Compound 7
underwent Grignard reaction with appropriate Grignard reagents
to afford the final products 8a-c.
20 mM, as shown in Table 1. For 5,7-diene 17-ester compounds (5a-
d), 5c with a propyl ester was the most potent in inhibiting the
production of NO, indicating the importance of an appropriate
sidechain length to the inhibitory activity. The 20-hydroxylated
(20SeOH) compounds (8a-c) exhibited moderate activity with 8b
(propyl side chain) being the best and 8c (butyl sidechain) the
worst.
For the 5-ene compounds substituted with aliphatic hydrocar-
bons (6a-6g, 6k-6n, 6q, 6r, Table 1), 6f with a propylamino side-
chain demonstrated relatively high activity in the inhibition NO
production (72.81%). Replacing the propylamine by an iso-
propylamino side chain (6b, 7.57%) or larger groups [e.g. 6e with a
2.2. Biological evaluation
2.2.1. Inhibition of nitric oxide (NO) production in macrophages
stimulated by lipopolysaccharide (LPS)
In macrophages, NO release stimulated by LPS has a pivotal role
in inflammatory conditions [14]. Hence, the newly synthesized
compounds were evaluated for their inhibitory effects against NO
generation in LPS-induced RAW 264.7 macrophages, with dexa-
methasone as positive control. To exclude the possibility that the
inhibitions of inflammatory response were due to cytotoxicity
caused by these compounds’ treatment, cell viability assay with 3-
cyclohexanamine side chain, 47.75%; 6n with
a
2-
morpholinoethan-1-amine side chain, 36.36%; 6r with an acet-
aminoethylamine side chain, 16.0%) displayed diminished activity.
When substituted with aromatic groups at the terminal aliphatic
hydrocarbons, compounds with similar length of sidechains
showed nearly equal activities (6g with a phenylethylamine side
chain, 45.39%; 6m with an imidazolyl propylamine side chain,
50.39%; 6s with a thienyl ethylamine side chain, 55.58%). For the 5-
ene compounds substituted with aromatic hydrocarbons, 6l with a
(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide
(MTT) assays were performed in RAW 264.7 macrophages treated
with individual compounds with or without LPS for 24 h, and no
significant inhibitory effect was observed (shown in Table S1). The
Scheme 2. Synthesis of compounds 8a-c.
Reagents and conditions: (a) Dibromantin, AIBN, hexane: benzene (1:1), reflux 20min; (b) TBAB, THF, RT, 75min, then TBAF, RT, 50min; (c) ReMgBr, THF, 0oC-RT.
3

J. Chen, L. Li, J. Liu et al.
European Journal of Medicinal Chemistry 220 (2021) 113468
Table 1
Inhibition of NO production by compounds 5a-5d, 8a-8c and 6a-6s in LPS-stimulated RAW 264.7 cells.
General structure
R
Compd ID
Inhibition (%) at 20
m
M
IC50 (mM)
CH3
CH2CH3
CH2CH2CH3
CH2CH2CH2CH3
5a
5b
5c
5d
21.75 5.67
11.35 1.08
89.36 2.32
37.83 8.64
>20
>20
9.022 1.53
>20
CH2CH3
CH2CH2CH3
CH2CH2CH2CH3
8a
8b
8c
52.48 3.06
55.32 9.90
28.84 1.77
27.01 2.10
>20
>20
6a
25.53 3.06
>20
6b
6c
7.84 1.77
>20
>20
44.44 8.43
6d
41.13 8.35
>20
6e
6f
47.75 7.88
72.81 2.91
>20
15.62 1.26
6g
6h
45.39 5.31
38.77 3.34
>20
>20
6i
37.35 10.44
59.22 5.30
24.94 5.47
>20
6j
11.28 0.68
>20
6k
6l
35.84 8.94
50.39 6.28
36.36 5.30
>20
>20
>20
6m
6n
6o
50.39 6.53
31.32 5.21
6p
6q
40.52 4.09
99.99 0.73
>20
6.675 0.93
6r
16.10 2.71
>20
6s
55.58 4.41
93.62 1.16
21.19 1.42
14.75 4.57
e
Dexamethasone
e
methylpyrazolyl side chain showed low inhibitory activity with an
inhibition rate of 35.84%, while the inhibition rate of 6q with an
imidazolyl side chain was 99.99%, higher than that of the positive
control, dexamethasone (93.62%). Consistent with the inhibitory
2.2.2. Inhibition of inducible NO synthase (iNOS) and
cyclooxygenase-2 (COX-2) expression at the transcriptional level
Both COX-2 and iNOS play important roles in mediating in-
flammatory processes. The pathophysiology of inflammatory dis-
orders has been related to improper up-regulation of COX-2 and/or
iNOS [15,16]. When stimulated by proinflammatory factors such as
LPS, reactive species, and/or TNF, intestinal epithelial cells express
COX-2 and further produce prostaglandins, leading to enhanced
water/ionic secretion, contractility and vasodilation [17,18]. In
rate at 20
mM, half inhibitory concentration of compound 6q was
lowest among the tested compounds (IC50 ¼ 6.675
0.93 M).
m
Based on the high anti-inflammatory activity and low cytotoxicity
towards LPS-induced RAW264.7 cells, compound 6q was selected
for subsequent biological studies as detailed below.
4

J. Chen, L. Li, J. Liu et al.
European Journal of Medicinal Chemistry 220 (2021) 113468
addition, the pathophysiology of IBD is closely associated with the
overexpression of reactive nitrogen species like ꢁ NO, which is
produced by iNOS in a constant manner [19].
Based on the preliminary screening results, we studied inhibi-
tory activities of compounds 6f, 6q, and 5c against iNOS and COX-2
at the transcriptional level. After growing in a six-well plate for
12 h, RAW 264.7 cells were cultured with LPS (100 ng/ml) and
indicated concentrations of compounds 6f, 6q, and 5c (dexameth-
asone as positive control) for 8h for Quantitative real time PCR
(qPCR). LPS markedly increased the mRNA levels of both iNOS and
COX-2 (Fig. 3A and B), as compared to the control group (neither
treatment with compound 6f, 6q, or 5c nor with LPS). However, the
mRNA levels were significantly down-regulated by compounds 6q
and 5c. Compound 6f only alleviated the mRNA level of COX-2,
whereas no significant difference was observed for iNOS mRNA
expression. Notably, compound 6q displayed the strongest activity
in suppressing the expression of iNOS and COX-2 at the transcrip-
tion level, and the effects were concentration dependent (Fig. 3C
and D).
Fig. 4. Effects of compounds 5c, 6f, 6q on the mRNA levels of IL-6, IL-1b, TNF-a, and
MCP-1 stimulated by LPS. Quantitative real-time PCR was performed to determine the
D
mRNA levels (2ꢂ Ct) of each gene, which were depicted as percentages of the LPS
2.2.3. Inhibition of inflammatory cytokines and chemokines release
LPS stimulated macrophages are able to produce proin-
flammatory cytokines such as TNF-a, Interleukin-6 (IL-6), and IL-1b,
group. The results were normalized to mRNA level of GAPDH and are presented as
mean þ SEM, n ¼ 3. ### ¼ p < 0.001 for the LPS group compared to the control group;
* ¼ p < 0.05, ** ¼ p < 0.01, and *** ¼ p < 0.001 compared to the LPS group.
& ¼ p < 0.05 between 6q and dexamethasone (Dex), &&& ¼ p < 0.001 between 6q and
Dex.
and chemokines like monocyte chemotactic protein-1 (MCP-1),
which facilitate acute inflammatory responses [20,21]. Therefore,
we studied the biological activities of compound 6f, 6q, and 5c by
examining the messenger RNA (mRNA) levels of these inflamma-
tory mediators in LPS-activated macrophages. After treatment with
LPS and compounds 6f, 6q, or 5c, total RNA was extracted from the
macrophages for qPCR. As shown in Fig. 4, compounds 6q and 5c at
20
mM down-regulated the mRNA level of IL-1b and IL-6 in a
Fig. 3. Effects of compounds 6f, 6q, and 5c on the levels of iNOS and COX-2 mRNA expression induced by LPS. Quantitative PCR was performed to assess the level of mRNA for iNOS
(A) and COX-2 (B) in LPS-stimulated RAW 264.7 macrophages cultured with vehicle or compound 5c, 6f, 6q for 8h, and iNOS (C) and COX-2 (D) expression in RAW 264.7 cells
cultured with compound 6q at various concentrations. The results were normalized to the mRNA level of GAPDH and are presented as mean þ SD, n ¼ 3. ### ¼ p < 0.001 for the LPS
group as compared to the control group; * ¼ p < 0.05, ** ¼ p < 0.01, and *** ¼ p < 0.001 compared with macrophages cultured with LPS only.
5

J. Chen, L. Li, J. Liu et al.
European Journal of Medicinal Chemistry 220 (2021) 113468
statistically significant manner, while compound 6f exhibited no
chronic intestinal inflammation with multifactorial etiology [24].
The colitis model induced by DSS is widely employed because of its
rapidity, simplicity, reproducibility, and controllability [25]. Hence,
we employed the acute DSS colitis model to evaluate the anti-
inflammatory efficacy of 6q in vivo. After one-week acclimation,
mice were randomly assigned into control (A group), model (B
group), or treatment groups (C, D, E, and F groups). Except for the
control group, each mouse was given 3.5% DSS solution but treated
differently by intraperitoneal injection of compound 6q (100 mg/kg
in C group, 50 mg/kg in D group, 25 mg/kg in E group), dexa-
methasone (20 mg/kg, F group), or a vehicle solution (B group) for 7
days. The characteristic of stools that reflects the gastrointestinal
symptoms was monitored and recorded daily as previously
described [25,26] (Stool consistency: 0, well-formed pellets; 2,
semi-formed and pasty stools, not sticking to the anus; 4, liquid
stools, sticking to the anus. Stool bleeding: 0, no blood in hemoc-
cult; 2, positive hemoccult; the characteristic of stools reflecting the
gastrointestinal symptoms were evaluated; 4, gross bleeding).
As shown in Fig. 7, the colon in Group B was significantly shorter
than that in Group A, which was attenuated in Group D and Group E
(Fig. 7A). Consistently, scores of stool consistency and bleeding in
model group were the highest, while mice in other treatment
groups exhibited significant reduced scores (Fig. 7B and C). How-
ever, the alleviation was not concentration-dependent, indicating
high-dose of compound 6q may cause side effects.
Histopathology analysis indicated that mice with DSS treatment
(Fig. 8B1) exhibited crypt abscess, loss of goblet cells, loss of the
mucus layer, and substantial neutrophil infiltration into the lamina
propria, as described in previous studies [27]. Colons in C and D
groups (Fig. 8C1, 8D1) showed nearly intact structure with few
inflammatory cells. As macrophages are the first line of defense in
innate immunity, CD86 immunohistochemistry was used to
investigate M1 macrophages colonies in the lamina propria of the
colon [28]. CD86 (þ) cells were clustered in group B to form several
significant positive colonies (Fig. 8B2), while several CD86 (þ) cells
were dispersed in the other groups (Fig. 8A2, 8C2, 8D2, 8E2, 8F2).
significant activity. Nevertheless, the mRNA level of TNF-
a was
significantly decreased (P < 0.01) only by compound 5c and dexa-
methasone, no significant difference was observed in other treat-
ment groups. In addition, MCP-1 mRNA expression was
significantly inhibited by compounds 6f, 6q, and 5c. Compound 6q
even showed relatively higher inhibitory effects on IL-6 (P < 0.05)
and MCP-1 (P < 0.001) mRNA levels than the positive control
dexamethasone.
It is noted that in response to environmental stress factors such
as infections and tissue injuries, an immediate and transient
expression of IL-6 is generated, triggering an alarm signal and
activating host defense mechanisms against stress [22]. Since IL-6
and IL-1b were identified as keystone cytokines in the inflamma-
tory process, we further evaluated the inhibition of IL-6 and IL-1
b
expression at protein level. Compound 6q displayed
a
concentration-dependent inhibitory effect on the expression of IL-6
and IL-1 protein (Fig. 5A and B). This result further proved that
compound 6q was able to inhibit the expression of other inflam-
matory mediators (e.g. IL-6 and IL-1 ) in addition to NO.
b
b
2.2.4. Mechanism of anti-inflammatory effects of 6q
Nuclear factor-kappa B (NF- B), one of the most ubiquitous
eukaryotic transcription factors, is involved in regulating the
expression of iNOS and COX-2 expression [23]. In addition, NF-
plays a central role in the regulation of IL-6 induced by LPS [22].
Thus, we next evaluated NF- B activation in LPS-stimulated RAW
k
kB
k
264.7 cells, and compared the expression of related proteins be-
tween cells with LPS-alone and LPS plus compound 6q. As shown in
Fig. 6, compounds 5c, 6f, and 6q significantly reduced NF-
kB mRNA
levels at 20 M (Fig. 6A), and 6q inhibited the expression of NF-kB
m
mRNA concentration-dependently (Fig. 6B). In addition, LPS stim-
ulation dramatically accelerated the phosphorylation of Akt and
further activation of p-I
F). However, cells with compound 6q-treatment showed reduced
expression of p-Akt at 1.25 M in a statistically significant manner,
accompanied by an increased level of Akt. Furthermore, the accu-
mulation of NF- B p-p65 subunit induced by LPS was inhibited
drastically by 6q at 1.25 M. Moreover, compound 6q inhibited
kB-a (Fig. 6C) and NF-kB p-p65 (Fig. 6D, E,
m
Compared with mice in Group B, the level of colonic IL-1b (Fig. 8G)
was significantly decreased in Group D (P < 0.001) and Group E
(P < 0.001). In addition, the colon tissues of mice in Group D and E
k
m
showed reduced expression of p-p65 and p-I
kB-a (Fig. 8H and I).
nuclear Phosph-p65 (p-p65) protein in a concentration-dependent
Taken together, compound 6q could attenuate colonic inflamma-
manner (Fig. 6D and E). These results indicated that compound 6q
tion induced by DSS through blocking NF-kB pathway.
exerted anti-inflammatory activity via suppression of NF-kB
pathway.
3. Conclusion
2.2.5. Treatment with 6q protects mice from dextran sulfate sodium
(DSS) induced colitis
IBD (inflammatory bowel diseases), including ulcerative colitis
(UC) and Crohn’s Disease (CD), are characterized by both acute and
Steroids, lipophilic molecules that diffuse readily through cell
membranes, contribute to the regulation of many key physiological
processes throughout all stages of life [29,30]. They have shown
Fig. 5. Effects of compound 6q on (A) IL-1
ELISA was performed to determine the concentrations of IL-1
* ¼ p < 0.05, ** ¼ p < 0.01, *** ¼ p < 0.001 compared to the LPS group.
b
and (B) IL-6 production. LPS-stimulated RAW 264.7 cells were treated with increasing concentrations of compound 6q for 24 h and then
b
and IL-6. Results are depicted as mean þ SD, n ¼ 3, ### ¼ p < 0.001 for the LPS group compared to the control group;
6

J. Chen, L. Li, J. Liu et al.
European Journal of Medicinal Chemistry 220 (2021) 113468
Fig. 6. Mechanism of action for compound 6q. The level of (A) NF-
k
B mRNA in RAW 264.7 cells cultured with compounds 5c, 6f, and 6q at 20 M and (B) NF-
m
kB mRNA levels in RAW
264.7 cells cultured with compound 6q at various concentrations were analyzed by quantitative RT-PCR. (C) Akt, p-Akt, I
k
B- and p-I B-a protein was detected with actin as a
a
k
control. (D) Phosph- and/or p65 protein were detected by Western Blot with actin or GAPDH as a control, and nuclear phosph-p65 protein with H3 as a control. (E) 6q reduced the
level of nuclear p-p65; (F) The ratio of nuclear p-p65 to p65. Each immunoblotting trace shown in the figures was a representative of three independent experiments. Densitometry
analyses are presented as the relative rations of p-p65/H3 in nuclear protein and p-p65/p65 in total protein. Each value shows the mean þ SD (n ¼ 3). ### ¼ p < 0.001 compared
with the control group; ** ¼ p < 0.01, *** ¼ p < 0.001 compared with cells cultured with LPS only.
great therapeutic value for a broad array of pathologies, especially
inflammation [31] and cancer [32,33]. In the treatment of IBD,
corticosteroids are frequently used when 5-aminosalicylateebased
compounds are inadequate.
In the present study, a novel series of steroidal compounds were
synthesized based on our previously reported steroidal 5,7-diene
Fig. 7. Compound 6q alleviates DSS-induced colitis in vivo (n ¼ 5). (A) Gross picture of colons. (B) Stool consistency characters. (C) Stool bleeding characters. The bar graphs show
mean þ SD (n ¼ 3). Group A, control group; Group B, model group; Group C, mice treated with 100 mg/kg of compound 6q; Group D, mice treated with 50 mg/kg of compound 6q;
Group E, mice treated with 25 mg/kg of compound 6q; Group F, mice treated with 25 mg/kg of dexamethasone. ### ¼ p < 0.001 compared with mice in Group A; *** ¼ p < 0.001 as
compared to mice in Group B.
7

J. Chen, L. Li, J. Liu et al.
European Journal of Medicinal Chemistry 220 (2021) 113468
Fig. 8. Effects of compound 6q on the colon of mice with DSS-induced colitis in vivo (n ¼ 5). (A1) colonic histology of mice without DSS or drug treatment (control); (B1) colonic
histology of mice with DSS vehicle control (200X); (C1) colonic histology of mice with DSS and 100 mg/kg of compound 6q (200X). (D1) colonic histology of mice with DSS and
50 mg/kg of compound 6q (200X); (E1) colonic histology of mice with DSS and 25 mg/kg of compound 6q (200X). (F1) colonic histology of mice with DSS and 25 mg/kg of
dexamethasone (200X). (A2) immunochemistry analysis with CD86 in mice without DSS or drug treatment (control); (B2) immunochemistry analysis with CD86 in mice with DSS
and vehicle control (400X); (C2) immunochemistry analysis with CD86 in mice with DSS and 100 mg/kg of compound 6q (400X). (D2) immunochemistry analysis with CD86 in mice
with DSS and 50 mg/kg of compound 6q (400X); (E2) immunochemistry analysis with CD86 in mice with DSS and 25 mg/kg of compound 6q (400X). (F2) immunochemistry
analysis with CD86 in mice with DSS and 25 mg/kg of dexamethasone (400X). (G) Relative IL-1
protein analyzed by Western Blot. (I) Relative levels of p-p65 and p-I B-
C, mice treated with 100 mg/kg of compound 6q; Group D, mice treated with 50 mg/kg of compound 6q; Group E, mice treated with 25 mg/kg of compound 6q; Group F, mice
b levels (per milligram of colonic protein). (H) p-Akt, p-IkB-a, and p-p65 in colonic
in colonic protein. The bar graphs show mean þ SD. Group A, control group; Group B, model group; Group
k
a
treated with 25 mg/kg of dexamethasone. Red arrow points to positive macrophage. ### ¼ p < 0.001 compared with mice in Group A; *** ¼ p < 0.001 as compared to mice in
Group B.
derivative,
3
b
-hydroxyandrosta-5,7-diene-17
b
-carboxylic acid.
chromatography was performed to monitor the reaction progress
with dynamic adsorbents silica gel F-254 TLC plates visualizable at
254 nm and 365 nm or stained with phosphomolybdic acid. Silica
gel (100e200 mesh) was used for column chromatographic puri-
fications. High resolution mass spectra were obtained on Bruker
micrOTOF-Q instrument with an ESI ion source. NMR spectra were
acquired with a Bruker AVANCE 400 MHz spectrometer (1H at
400 MHz, 13C at 100 MHz, respectively) in deuterated solvents,
using residual signal of deuterated solvents (e.g., CD3OD, CDCl3,
and (CD3)2SO) as internal reference. Chemical shifts were given in
parts per million (ppm) and coupling constants were reported in
Hertz (Hz). The purity of compounds screened in biological assays
was assessed via High-performance liquid chromatography (HPLC)
on a Shimadzu LC-20A HPLC system installed with a UV detector,
with ultrapure water as mobile phase A and methanol as mobile
phase B at a flow rate of 1 ml/min.
Among them, compound 6q, with the sidechain of 1H-imidazole-1-
yl ketone, was identified as the most potent anti-inflammatory
agent (IC50 ¼ 6.675
demonstrated that compound 6q had significant inhibitory effects
on the expression of inflammatory mediators (e.g., IL-6 and IL-1
stimulated by LPS in RAW 264.7 macrophages. Based on previous
studies related to the mechanisms of anti-inflammation and pre-
sent study, we speculate that compound 6q exerted the anti-
0.93 mM). The ELISA experiment further
b
)
inflammatory activities partially by suppressing NF-
blockade of Akt/I B pathway, further inhibiting the expression of
kB and
k
downstream inflammatory mediators (Fig. 9). Kim, J. M. et al. has
demonstrated that guggulsterone derivative, GG-52, attenuated
DSS-induced colitis at a dose of 50 mg/kg through inhibiting NF-kB
signaling in in intestinal epithelial cells [34]. Similarly, our syn-
thetic steroid derivative, 6q, was able to ameliorate DSS-induced
colitis in vivo at a dose of 25 mg/kg. Taken together, the novel
compound holds the potential to be developed as an anti-
inflammatory agent in treating ulcerative colitis, and other IBDs.
4.1.1. General procedure for preparation of compounds 2
To a vigorously stirred aqueous solution (180 mL) of sodium
hydroxide (21 g) was added bromine (28.8 g) dropwise while
cooling in an ice bath. After all the bromine was dissolved, the
mixture was diluted with 120 mL of cold dioxane. Then the ice-cold
hypobromite solution was added slowly to a stirred mixture of
pregnenolone acetate (14.4 g) in 560 mL of dioxane and 160 mL of
water. A white precipitate was slowly formed in the reaction
mixture. After stirring for 12h at room temperature, an excess of
4. Experimental section
4.1. Chemistry
Unless otherwise noted, all commercially available reagents and
solvents were used without further purification. Thin layer
8

J. Chen, L. Li, J. Liu et al.
European Journal of Medicinal Chemistry 220 (2021) 113468
Fig. 9. Proposed mechanism of anti-inflammatory effects of 6q.
sodium sulfite solution was added to quench the reaction. The
mixture was then heated to dissolve the solid material. The solution
was acidified with concentrated hydrochloric acid to provide a
white precipitate, which was purified give intermediate 2. Yield:
98%.
compound, which was subjected to column chromatography with
hexane/ethyl acetate (50:1) to yield pure compounds 4a-d. Yield:
30e40%.
4.1.4. General procedure for preparation of compounds 5a-d
To a solution of compound 4 (1 mmol) in methanol-water 5:1
(24 mL) and water, lithium hydroxide (24 mg, 1 mmol) was added
and the resulting solution was stirred overnight at room temper-
ature. After concentration of the mixture, extraction with ethyl
acetate, separation of the combined organic layer, and removal of
the solvent, the resulting residue was further purified by flash
chromatography (hexane/ethyl acetate (50:1) yielded the pure
compounds 5a-d. Yield:95e98%.
4.1.2. General procedure for preparation of compounds 3a-d
Various alcohols as reactants and solvents were added to com-
pound 2 (3.18 g, 10 mmol), and concentrated sulfuric acid (2e5
drops) was used to catalyze the reaction. Under reflux, the resulting
mixture was stirred for 4h. TLC was used to monitor the progress.
Then the reaction was quenched by H2O and the corresponding
esters were obtained after removing the solvent in vacuum.
Acetic anhydride (1.12 g, 11 mmol), triethylamine (1.11 mg,
11 mmol), and 4-dimethylaminopyridine (DMAP, 60.1 mg,
0.1 mmol) were mixed under ice bath in a solution of the obtained
ester dissolved in anhydrous CH2Cl2. After stirring for 8h at room
temperature, the resulting solution was poured into water and
extracted with CH2Cl2. Washing with brine, drying by Na2SO4 and
concentrated to give a crude product, which was purified by col-
umn chromatography (hexane:ethyl acetate 50:1) to obtain a white
solid. Yield: 80%.
4.1.5. General procedure for preparation of compounds 6a-s
A mixture of compound 2, 1-Ethyl-3-(3-dimethylaminopropyl)
carbodiimide hydrochloride (EDCI), 1-hydroxybenzotriazole
(HOBt), triethylamine (TEA) and dimethyl sulfoxide was stirred at
room temperature for 12 h. The reaction mixture was diluted with
water to precipitate white material. After filtration, the solid was
partitioned between ethyl acetate and water. The organic layers
were dried with anhydrous Na2SO4, filtered, and concentrated. The
crude was subjected to flash chromatography to provide a white
solid. Yield: 85e96%.
4.1.3. General procedure for preparation of compounds 4a-d
As previously described [13,35], Compound 3 was dissolved in
benzene-hexane 1:1 (120 mL) to obtain a solution, to which 2,2-
azobisisobutyronitrile (0.2 mmol, 33 mg) and dibromantin
(3.0 mmol, 0.86 g) were added. In a pretreated oil bath, the mixture
was refluxed at 100 ꢀC for 20 min. After cooling in an ice bath,
removal of insoluble material by suction filtration and evaporation
of the filtrate gave a yellow-brown solid. The obtained solid was
dissolved in anhydrous tetrahydrofuran (40 mL), and then tetra-
butylammonium bromide (1.25 mmol, 0.4 g) was mixed in the
resulting solution. After stirring at room temperature under ni-
trogen for 75 min, 10 ml of tetrabutylammonium fluoride solution
in tetrahydrofuran (1.0 M, 10 mmol) was added to the mixture.
Following stirring for 50 min, a brown solid was obtained after
evaporation of solvent. Then dissolved the solid with ethyl acetate,
washed with water and dried over Na2SO4 to get the crude
4.1.6. General procedure for preparation of compound 7
Compound
7 was prepared from pregnenolone acetate
following the same approach as described for the synthesis of
compounds 4a-d.
4.1.7. General procedure for preparation of compounds 8a-c
To a solution of Grignard reagent in dry tetrahydrofuran (THF),
compound 7 was added at 0 ꢀC under argon. The reaction mixture
was stirred overnight at room temperature, then quenched with
saturated NH4Cl solution. Extraction with ethyl acetate followed by
concentration of the organic layers gave crude products. The ob-
tained solid was further purified by flash chromatography (hexane/
ethyl acetate, 20:1) to give a white solid. Yield: 90e98%.
9

J. Chen, L. Li, J. Liu et al.
European Journal of Medicinal Chemistry 220 (2021) 113468
4.1.8. Ethyl (3S,10R,13S,17S)-3-hydroxy-10,13-dimethyl-
2,3,4,9,10,11,12,13,14,15,16, 17-dodecahydro-1H-cyclopenta[a]
phenanthrene-17-carboxylate (5b)
J ¼ 5.5 Hz, 1H), 5.26 (d, J ¼ 3.4 Hz, 1H), 4.60 (d, J ¼ 4.2 Hz, 1H), 3.21
(ddt, J ¼ 26.4, 13.2, 6.3 Hz, 2H), 2.90 (td, J ¼ 12.0, 6.3 Hz, 1H),
2.18e1.98 (m, 4H), 1.93 (d, J ¼ 17.1 Hz, 1H), 1.81e1.72 (m, 2H), 1.67
(d, J ¼ 11.7 Hz, 1H), 1.56 (ddd, J ¼ 23.5, 15.3, 8.0 Hz, 4H), 1.41e1.34
(m, 4H), 1.27 (dt, J ¼ 14.5, 7.3 Hz, 4H), 1.20e1.13 (m, 1H), 1.04e0.91
(m, 5H), 0.87 (q, J ¼ 7.2 Hz, 4H), 0.57 (s, 3H). 13C NMR (101 MHz,
Yield: 96.9%; mp 48e49 ꢀC; 1H NMR (400 MHz, CDCl3)
d
5.64e5.54 (m, 1H), 5.48e5.36 (m, 1H), 4.24e4.07 (m, 2H), 3.76 (t,
J ¼ 6.3 Hz, 1H), 3.71e3.60 (m, 1H), 2.46 (dd, J ¼ 21.5, 12.6 Hz, 2H),
2.21 (ddd, J ¼ 30.5, 23.6, 12.7 Hz, 3H), 2.01 (d, J ¼ 9.3 Hz, 2H),
1.94e1.80 (m, 4H), 1.75e1.63 (m, 2H), 1.48 (d, J ¼ 4.3 Hz, 1H),
1.42e1.31 (m, 2H), 1.28 (t, J ¼ 7.1 Hz, 3H), 0.95 (s, 3H), 0.70e0.51 (m,
3H). MS (ESI) m/z 345.5 (M þ H)þ. Anal. (C22H32O3) C,H,O. Purity:
95.9% by HPLC (tR ¼ 16.44 min).
DMSO)
d 171.76, 141.71, 120.72, 70.40, 56.23, 55.98, 50.21, 43.57,
42.63, 40.56, 40.35, 40.14, 39.94, 39.73, 39.52, 39.31, 38.48, 38.10,
37.37, 36.56, 31.99, 31.93, 31.83, 24.73, 23.68, 20.88, 19.98, 19.55,
14.08, 13.62.MS (ESI) m/z 374.3 (M þ H)þ. Anal. (C24H39NO2)
C,H,N,O. Purity: 96.9% by HPLC (tR ¼ 22.02 min).
4.1.9. Propyl (3S,10R,13S,17S)-3-hydroxy-10,13-dimethyl-
2,3,4,9,10,11,12,13,14,15, 16,17-dodecahydro-1H-cyclopenta[a]
phenanthrene-17-carboxylate (5c)
4.1.14. (3S,10R,13S,17S)-3-hydroxy-N-(2-hydroxyethyl)-10,13-
dimethyl-2,3,4,7,8,9,10, 11,12,13,14,15,16,17-tetradecahydro-1H-
cyclopenta[a]phenanthrene-17-carboxamide (6d)
Yield: 96.2%; mp 50e51 ꢀC; 1H NMR (400 MHz, MeOD)
d
5.56 (s,
Yield: 85.3%; mp 89e90 ꢀC; 1H NMR (400 MHz, DMSO)
d 7.37 (t,
1H), 5.44 (s, 1H), 4.58 (s, 1H), 4.11e4.02 (m, 2H), 3.52 (d, J ¼ 11.0 Hz,
1H), 2.55e2.40 (m, 2H), 2.16 (ddd, J ¼ 82.4, 49.1, 22.7 Hz, 6H), 1.90
(d, J ¼ 14.3 Hz, 4H),1.68 (dd, J ¼ 13.9, 6.7 Hz, 5H),1.31 (s, 2H), 0.99 (t,
J ¼ 6.9 Hz, 3H), 0.96 (s, 3H), 0.65 (s, 3H). MS (ESI) m/z 359.5
J ¼ 5.4 Hz, 1H), 5.26 (d, J ¼ 3.6 Hz, 1H), 4.61 (s, 2H), 3.37 (s, 2H), 3.21
(td, J ¼ 12.5, 6.1 Hz, 2H), 3.03 (td, J ¼ 12.1, 6.0 Hz, 1H), 2.23e1.97 (m,
4H), 1.93 (d, J ¼ 17.5 Hz, 1H), 1.84e1.45 (m, 7H), 1.43e1.13 (m, 5H),
1.08e0.81 (m, 6H), 0.56 (s, 3H). 13C NMR (101 MHz, DMSO)
d 172.15,
(M
þ
H)þ. Anal. (C23H34O3) C,H,O. Purity: 97.6% by HPLC
141.71, 120.74, 70.39, 60.58, 56.17, 55.91, 50.18, 43.57, 42.63, 41.81,
40.59, 40.55, 40.34, 40.13, 39.92, 39.71, 39.50, 39.29, 37.96, 37.37,
36.56, 31.94, 31.80, 24.74, 23.60, 20.86, 19.56, 13.56. MS (ESI) m/z
362.3 (M þ H)þ. Anal. (C22H35NO3) C,H,N,O. Purity: 96.3% by HPLC
(tR ¼ 22.02 min).
(tR ¼ 17.71 min).
4.1.10. Butyl (3S,10R,13S,17S)-3-hydroxy-10,13-dimethyl-
2,3,4,9,10,11,12,13,14,15,16, 17-dodecahydro-1H-cyclopenta[a]
phenanthrene-17-carboxylate (5d)
Yield: 95.4%; mp 54e55 ꢀC; 1H NMR (400 MHz, MeOD)
d
5.57 (d,
4.1.15. (3S,10R,13S,17S)eN-cyclohexyl-3-hydroxy-10,13-dimethyl-
2,3,4,7,8,9,10,11,12, 13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]
phenanthrene-17-carboxamide (6e)
J ¼ 1.1 Hz, 1H), 5.44 (d, J ¼ 4.3 Hz, 1H), 4.58 (d, J ¼ 1.2 Hz, 1H),
4.19e4.02 (m, 2H), 3.59e3.48 (m,1H), 2.56e2.37 (m, 2H), 2.32e2.10
(m, 3H), 2.04 (s, 2H),1.97e1.83 (m, 4H),1.74e1.58 (m, 5H),1.47e1.41
(m, 3H), 1.32 (d, J ¼ 4.4 Hz, 2H), 1.01e0.95 (m, 6H), 0.65 (s, 3H). MS
(ESI) m/z 373.5 (M þ H)þ. Anal. (C24H36O3) C,H,O. Purity: 96.2% by
HPLC (tR ¼ 18.76 min).
Yield: 96.2%; mp 92e94 ꢀC; 1H NMR (400 MHz, DMSO)
d 7.22 (d,
J ¼ 7.9 Hz,1H), 5.26 (d, J ¼ 3.9 Hz,1H), 4.60 (s,1H), 3.55 (d, J ¼ 7.6 Hz,
1H), 3.28e3.19 (m, 1H), 2.19e1.87 (m, 5H), 1.66 (ddd, J ¼ 54.6, 20.0,
13.3 Hz, 12H), 1.42e1.07 (m, 10H), 1.05e0.83 (m, 6H), 0.56 (s, 3H).
13C NMR (101 MHz, DMSO)
d 170.36, 141.21, 120.21, 69.89, 55.78,
4.1.11. (3S,10R,13S,17S)eN,N-diethyl-3-hydroxy-10,13-dimethyl-
2,3,4,7,8,9,10,11,12,13, 14,15,16,17-tetradecahydro-1H-cyclopenta[a]
phenanthrene-17-carboxamide (6a)
55.20, 49.74, 47.19, 43.12, 42.12, 40.11, 40.06, 39.85, 39.64, 39.43,
39.22, 39.02, 38.81, 37.51, 36.86, 36.05, 33.05, 32.20, 31.43, 31.31,
25.17, 24.63, 24.56, 24.25, 23.02, 20.36, 19.04, 13.16. MS (ESI) m/z
400.3 (M þ H)þ. Anal. (C26H41NO2) C,H,N,O. Purity: 95.7% by HPLC
(tR ¼ 22.00 min).
Yield: 83.1%; mp 105e107 ꢀC; 1H NMR (400 MHz, DMSO)
d 5.27
(s,1H), 4.63 (s,1H), 3.70e3.48 (m, 2H), 3.26 (s,1H), 3.13 (dd, J ¼ 14.6,
7.2 Hz, 1H), 2.94 (dd, J ¼ 13.4, 6.9 Hz, 1H), 2.81 (d, J ¼ 64.0 Hz, 1H),
2.66 (t, J ¼ 8.5 Hz, 1H), 2.21e2.01 (m, 3H), 1.94 (d, J ¼ 17.3 Hz, 1H),
4.1.16. (3S,10R,13S,17S)-3-hydroxy-10,13-dimethyl-N-propyl-
2,3,4,7,8,9,10,11,12,13,14, 15,16,17-tetradecahydro-1H-cyclopenta[a]
phenanthrene-17-carboxamide (6f)
1.80e1.29 (m, 11H), 1.19 (s, 2H), 1.08e0.89 (m, 10H), 0.62 (s, 3H). 13
C
NMR (101 MHz, DMSO)
d 171.51, 141.69, 120.71, 70.38, 56.12, 50.31,
50.03, 44.68, 42.60, 41.70, 40.54, 40.34, 40.13, 39.92, 39.81, 39.71,
39.50, 39.29, 38.42, 37.35, 36.54, 32.01, 31.85, 31.80, 25.72, 24.84,
20.99, 19.51, 15.12, 14.10, 13.80. MS (ESI) m/z 374.3 (M þ H)þ. Anal.
(C24H39NO2) C,H,N,O. Purity: 96.3% by HPLC (tR ¼ 16.02 min).
Yield: 92.9%; mp 118e120 ꢀC; 1H NMR (400 MHz, DMSO)
d 7.43
(t, J ¼ 5.4 Hz, 1H), 5.27 (s, 1H), 4.61 (s, 1H), 3.25 (td, J ¼ 10.5, 5.2 Hz,
1H), 3.14 (td, J ¼ 13.1, 6.6 Hz, 1H), 2.87 (td, J ¼ 12.4, 6.3 Hz, 1H),
2.20e1.99 (m, 4H), 1.93 (d, J ¼ 17.0 Hz, 1H), 1.77 (d, J ¼ 12.4 Hz, 2H),
1.70e1.48 (m, 5H), 1.34 (ddd, J ¼ 45.1, 21.0, 10.3 Hz, 6H), 1.21e1.12
(m, 1H), 1.01 (dd, J ¼ 20.2, 7.2 Hz, 2H), 0.96e0.77 (m, 7H), 0.57 (s,
4.1.12. (3S,10R,13S,17S)-3-hydroxy-N-isopropyl-10,13-dimethyl-
2,3,4,7,8,9,10,11,12, 13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]
phenanthrene-17-carboxamide (6b)
3H). 13C NMR (101 MHz, DMSO)
d 171.82, 141.71, 120.72, 70.40,
56.23, 55.98, 50.20, 43.57, 42.62, 40.66, 40.55, 40.34, 40.14, 39.93,
39.72, 39.51, 39.30, 38.09, 37.36, 36.56, 31.93, 31.82, 24.73, 23.68,
23.09, 20.87, 19.55, 13.61, 11.87. MS (ESI) m/z 360.3 (M þ H)þ. Anal.
(C23H37NO2) C,H,N,O. Purity: 96.0% by HPLC (tR ¼ 22.01 min).
Yield: 90.6%; mp 106e107 ꢀC; 1H NMR (400 MHz, DMSO)
d 7.25
(d, J ¼ 7.5 Hz, 1H), 5.27 (s, 1H), 4.62 (d, J ¼ 4.0 Hz, 1H), 3.87 (td,
J ¼ 13.3, 6.5 Hz, 1H), 3.26 (dd, J ¼ 9.4, 5.2 Hz, 1H), 2.20e1.87 (m, 5H),
1.86e1.65 (m, 3H), 1.64e1.23 (m, 8H), 1.22e1.13 (m, 1H), 1.12e0.65
(m, 12H), 0.57 (s, 3H). MS (ESI) m/z 360.3 (M þ H)þ. 13C NMR
4.1.17. (3S,10R,13S,17S)-3-hydroxy-10,13-dimethyl-N-phenethyl-
2,3,4,7,8,9,10,11,12,13, 14,15,16,17-tetradecahydro-1H-cyclopenta[a]
phenanthrene-17-carboxamide (6g)
(101 MHz, DMSO) d 170.91,141.71,120.72, 70.40, 56.26, 55.78, 50.24,
43.62, 42.63, 38.06, 37.37, 36.56, 36.53, 31.93, 31.81, 24.75, 23.54,
23.39, 22.69, 20.86, 19.55, 13.66. Anal. (C23H37NO2) C,H,N,O. Purity:
96.8% by HPLC (tR ¼ 16.44 min).
Yield: 96.4%; mp 63e64 ꢀC; 1H NMR (400 MHz, DMSO)
d 7.50 (t,
J ¼ 5.5 Hz, 1H), 7.23 (dq, J ¼ 15.3, 7.8 Hz, 5H), 5.26 (d, J ¼ 4.0 Hz, 1H),
4.61 (d, J ¼ 4.5 Hz, 1H), 3.42 (dt, J ¼ 13.5, 7.3 Hz, 1H), 3.27e3.10 (m,
2H), 2.71 (t, J ¼ 7.3 Hz, 2H), 2.17e1.97 (m, 4H), 1.90 (s, 1H), 1.76 (d,
J ¼ 13.1 Hz, 1H), 1.70e1.44 (m, 6H), 1.41e1.26 (m, 3H), 1.23e1.12 (m,
2H), 1.04e0.77 (m, 6H), 0.52 (s, 3H). 13C NMR (101 MHz, DMSO)
4.1.13. (3S,10R,13S,17S)eN-butyl-3-hydroxy-10,13-dimethyl-
2,3,4,7,8,9,10,11,12,13,14, 15,16,17-tetradecahydro-1H-cyclopenta[a]
phenanthrene-17-carboxamide (6c)
Yield: 93.4%; mp 96e98 ꢀC; 1H NMR (400 MHz, DMSO)
d
7.41 (t,
d 171.95, 141.71, 139.92, 129.03, 128.63, 126.39, 120.71, 70.40, 56.22,
10

J. Chen, L. Li, J. Liu et al.
European Journal of Medicinal Chemistry 220 (2021) 113468
55.96, 50.18, 43.55, 42.63, 40.62, 40.57, 40.48, 40.36, 40.15, 39.95,
39.74, 39.53, 39.32, 37.91, 37.38, 36.55, 35.85, 31.92, 31.82, 31.81,
24.71, 23.69, 20.80, 19.56, 13.46. MS (ESI) m/z 422.3 (M þ H)þ. Anal.
(C28H39NO2) C,H,N,O. Purity: 96.2% by HPLC (tR ¼ 14.07 min).
4.1.22. ((3S,10R,13S,17S)-3-hydroxy-10,13-dimethyl-
2,3,4,7,8,9,10,11,12,13,14,15,16,17 -tetradecahydro-1H-cyclopenta[a]
phenanthren-17-yl)(3-methyl-1H-pyrazol-1-yl)methanone (6l)
Yield: 91.0%; mp 75e77 ꢀC; 1H NMR (400 MHz, DMSO)
d 8.28 (s,
1H), 6.43 (s,1H), 5.28 (s,1H), 4.61 (s,1H), 3.76 (t, J ¼ 9.2 Hz,1H), 3.25
(s, 1H), 2.24 (s, 3H), 2.10 (dd, J ¼ 30.4, 8.9 Hz, 3H), 1.91 (dd, J ¼ 36.3,
12.4 Hz, 2H), 1.79e1.50 (m, 5H), 1.49e1.35 (m, 4H), 1.30 (d,
J ¼ 9.6 Hz, 3H), 1.04e0.86 (m, 5H), 0.68 (s, 3H). 13C NMR (101 MHz,
4.1.18. (3S,10R,13S,17S)-3-hydroxy-N-(2-hydroxy-2-methylpropyl)-
10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-
1H-cyclopenta[a]phenanthrene-17-carboxamide (6h)
DMSO)
d 172.22, 153.13, 141.69, 129.60, 120.62, 110.98, 70.36, 56.57,
Yield: 87.9%; mp 112e114 ꢀC; 1H NMR (400 MHz, DMSO)
d 7.29
51.88, 49.86, 45.74, 42.60, 40.52, 40.32, 40.11, 39.90, 39.69, 39.48,
39.27, 38.17, 37.26, 36.49, 32.10, 31.80, 24.85, 24.71, 20.94, 19.52,
14.03, 13.99. MS (ESI) m/z 383.2 (M þ H)þ. Anal. (C24H34N2O2)
C,H,N,O. Purity: 98.7% by HPLC (tR ¼ 18.01 min).
(t, J ¼ 5.7 Hz, 1H), 5.27 (s, 1H), 4.61 (d, J ¼ 4.5 Hz, 1H), 4.47 (s, 1H),
3.28 (dd, J ¼ 13.2, 7.2 Hz, 2H), 2.79 (dd, J ¼ 13.1, 4.8 Hz, 1H), 2.23 (d,
J ¼ 9.1 Hz, 1H), 2.08 (dt, J ¼ 16.9, 7.9 Hz, 3H), 1.93 (d, J ¼ 17.4 Hz, 1H),
1.83e1.73 (m, 2H), 1.59 (dt, J ¼ 26.9, 12.2 Hz, 5H), 1.37 (dd, J ¼ 21.1,
9.5 Hz, 4H), 1.19 (t, J ¼ 14.7 Hz, 1H), 0.96 (dd, J ¼ 39.1, 20.8 Hz, 12H),
4.1.23. (3S,10R,13S,17S)eN-(3-(1H-imidazole-1-yl)propyl)-3-
hydroxy-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-
tetradecahydro-1H-cyclopenta[a]phenanthrene-17-carboxamide
(6 m)
0.59 (s, 3H). 13C NMR (101 MHz, DMSO)
d 172.51, 141.72, 120.72,
70.41, 69.87, 56.27, 55.84, 50.20, 50.14, 43.73, 42.64, 40.56, 40.36,
40.15, 39.94, 39.73, 39.52, 39.31, 37.94, 37.36, 36.56, 31.93, 31.85,
31.79, 27.95, 27.72, 24.70, 23.81, 20.89, 19.55, 13.63. MS (ESI) m/z
390.3 (M þ H)þ. Anal. (C24H39NO3) C,H,N,O. Purity: 96.8% by HPLC
(tR ¼ 21.87 min).
Yield: 94.8%; mp 114e116 ꢀC; 1H NMR (400 MHz, DMSO)
d 7.58
(d, J ¼ 26.0 Hz, 2H), 7.17 (s, 1H), 6.89 (s, 1H), 5.26 (s, 1H), 4.62 (s, 1H),
3.95 (s, 2H), 3.25 (s, 1H), 3.10 (s, 1H), 2.90 (s, 1H), 2.10 (d, J ¼ 8.9 Hz,
4H), 1.92 (s, 1H), 1.67 (dd, J ¼ 85.6, 18.9 Hz, 9H), 1.26 (d, J ¼ 83.3 Hz,
5H), 1.07e0.78 (m, 6H), 0.58 (s, 3H). 13C NMR (101 MHz, DMSO)
4.1.19. ((3S,10R,13S,17S)-3-hydroxy-10,13-dimethyl-
2,3,4,7,8,9,10,11,12,13,14,15,16,17 -tetradecahydro-1H-cyclopenta[a]
phenanthren-17-yl)(piperidin-1-yl)methanone (6i)
d
172.21, 162.71, 141.67, 137.69, 128.75, 120.72, 119.75, 70.40, 56.19,
56.01, 50.17, 44.09, 43.64, 42.62, 38.17, 37.37, 36.55, 36.15, 31.92,
31.81, 31.50, 31.17, 24.73, 23.69, 20.89, 19.55, 13.66. MS (ESI) m/z
326.3 (M þ H)þ. Anal. (C26H39N3O2) C,H,N,O. Purity: 97.5% by HPLC
(tR ¼ 20.93 min).
Yield: 92.7%; mp 49e51 ꢀC; 1H NMR (400 MHz, DMSO)
d 5.27 (s,
1H), 4.58 (d, J ¼ 3.9 Hz, 1H), 3.46 (s, 4H), 3.26 (d, J ¼ 4.5 Hz, 1H), 2.79
(t, J ¼ 7.9 Hz, 1H), 2.20e2.04 (m, 3H), 1.94 (d, J ¼ 16.7 Hz, 1H),
1.78e1.64 (m, 3H), 1.58 (d, J ¼ 18.0 Hz, 6H), 1.39 (dd, J ¼ 25.6,
18.8 Hz, 8H), 1.19 (s, 2H), 1.03e0.86 (m, 5H), 0.60 (s, 3H). 13C NMR
4.1.24. (3S,10R,13S,17S)-3-hydroxy-10,13-dimethyl-N-(2-
morpholinoethyl)-2,3,4,7,8,9, 10,11,12,13,14,15,16,17-tetradecahydro-
1H-cyclopenta[a]phenanthrene-17-carboxamide (6n)
(101 MHz, DMSO)
d 170.86, 141.70, 120.71, 99.93, 70.38, 56.12,
50.02, 49.89, 46.81, 44.56, 42.82, 42.61, 40.57, 40.36, 40.16, 39.95,
39.74, 39.53, 39.32, 38.08, 37.33, 36.53, 32.02, 31.83, 27.07, 26.00,
25.49, 24.80, 24.61, 21.02, 19.53, 13.99. MS (ESI) m/z 386.3 (M þ H)þ.
Anal. (C25H39NO2) C,H,N,O. Purity: 97.2% by HPLC (tR ¼ 22.6 min).
Yield: 87.9%; mp 94e95 ꢀC; 1H NMR (400 MHz, DMSO)
d 7.31 (s,
1H), 5.26 (s, 1H), 4.60 (s, 1H), 3.30e3.20 (m, 2H), 3.08e2.96 (m, 1H),
2.42 (s, 6H), 2.18e2.00 (m, 4H), 1.93 (d, J ¼ 17.1 Hz, 1H), 1.79 (t,
J ¼ 14.4 Hz, 2H), 1.71e1.46 (m, 9H), 1.45e1.31 (m, 3H), 1.29e1.12 (m,
2H), 1.00 (d, J ¼ 15.8 Hz, 2H), 0.94e0.81 (m, 4H), 0.56 (s, 3H). 13
C
4.1.20. (3S,10R,13S,17S)-3-hydroxy-N-isopentyl-10,13-dimethyl-
2,3,4,7,8,9,10,11,12,13, 14,15,16,17-tetradecahydro-1H-cyclopenta[a]
phenanthrene-17-carboxamide (6j)
NMR (101 MHz, DMSO)
d 171.85, 141.70, 120.74, 70.39, 66.58, 57.92,
56.19, 55.96, 53.61, 50.18, 43.64, 42.62, 40.32, 37.90, 37.36, 36.55,
36.05, 31.94, 31.81, 24.74, 23.48, 20.83, 19.57, 13.53.MS (ESI) m/z
331.3 (M þ H)þ. Anal. (C26H42N2O3) C,H,N,O. Purity: 97.8% by HPLC
(tR ¼ 20.95 min).
Yield: 89.3%; mp 88e89 ꢀC; 1H NMR (400 MHz, DMSO)
d 7.40 (s,
1H), 5.27 (s, 1H), 4.61 (s, 1H), 3.21 (ddd, J ¼ 27.0, 13.9, 5.6 Hz, 2H),
2.93 (dd, J ¼ 12.9, 6.1 Hz, 1H), 2.19e1.86 (m, 5H), 1.81e1.63 (m, 3H),
1.63e1.42 (m, 5H), 1.35 (d, J ¼ 11.8 Hz, 3H), 1.22 (dd, J ¼ 42.5, 8.5 Hz,
4H), 1.00 (d, J ¼ 12.2 Hz, 2H), 0.93 (s, 3H), 0.86 (d, J ¼ 5.3 Hz, 6H),
4.1.25. (3S,10R,13S,17S)-3-hydroxy-10,13-dimethyl-N-(2-
(pyrrolidin-1-yl)ethyl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-
tetradecahydro-1H-cyclopenta[a]phenanthrene-17-carboxamide
(6o)
0.56 (s, 3H). 13C NMR (101 MHz, DMSO)
d 171.73, 141.72, 120.72,
70.40, 56.23, 55.98, 50.22, 43.57, 42.64, 40.57, 40.36, 40.15, 39.94,
39.73, 39.52, 39.31, 38.93, 38.11, 37.37, 37.11, 36.56, 31.93, 31.84,
31.80, 25.60, 24.73, 23.68, 22.86, 22.76, 20.88, 19.56, 13.62. MS (ESI)
m/z 388.3 (M þ H)þ. Anal. (C25H41NO2) C,H,N,O. Purity: 95.5% by
HPLC (tR ¼ 22.07 min).
Yield: 92.1%; mp 72e73 ꢀC; 1H NMR (400 MHz, DMSO)
d 7.28 (t,
J ¼ 5.0 Hz, 1H), 5.26 (s, 1H), 4.59 (d, J ¼ 4.3 Hz, 1H), 3.54 (s, 4H), 3.36
(d, J ¼ 6.2 Hz, 1H), 3.29e3.21 (m, 1H), 3.00 (td, J ¼ 11.7, 5.6 Hz, 1H),
2.41e2.25 (m, 6H), 2.12 (dd, J ¼ 23.8, 8.8 Hz, 3H), 2.05e1.97 (m, 1H),
1.90 (t, J ¼ 17.1 Hz, 2H), 1.77 (d, J ¼ 13.0 Hz, 1H), 1.67 (d, J ¼ 11.3 Hz,
1H), 1.56 (ddd, J ¼ 19.6, 15.5, 8.9 Hz, 4H), 1.37 (d, J ¼ 10.6 Hz, 3H),
1.29e1.15 (m, 2H), 1.08e0.96 (m, 2H), 0.95e0.85 (m, 4H), 0.57 (s,
4.1.21. (3S,10R,13S,17S)eN-(4-cyano-1H-pyrazol-3-yl)-3-hydroxy-
10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-
1H-cyclopenta[a]phenanthrene-17-carboxamide (6k)
3H). 13C NMR (101 MHz, DMSO)
d 171.58, 141.62, 120.60, 55.94,
Yield: 95.6%; mp 81e83 ꢀC; 1H NMR (400 MHz, DMSO)
d
7.93 (s,
55.45, 53.91, 50.19, 43.58, 40.56, 40.35, 40.14, 39.93, 39.73, 39.52,
39.31, 38.25, 37.37, 36.55, 31.82, 23.55, 19.55, 13.50. MS (ESI) m/z
415.3 (M þ H)þ. Anal. (C26H42N2O2) C,H,N,O. Purity: 98.3% by HPLC
(tR ¼ 21.26 min).
2H), 7.83 (s, 1H), 5.27 (s, 1H), 4.59 (d, J ¼ 3.9 Hz, 1H), 3.68 (t,
J ¼ 9.3 Hz, 1H), 3.26 (s, 1H), 2.19e2.04 (m, 3H), 1.90 (dd, J ¼ 35.4,
13.9 Hz, 2H), 1.70 (dd, J ¼ 27.7, 13.4 Hz, 3H), 1.58 (d, J ¼ 10.9 Hz, 1H),
1.52e1.20 (m, 8H), 1.04e0.87 (m, 5H), 0.69 (s, 3H). 13C NMR
(101 MHz, DMSO)
d
176.78, 154.95, 143.68, 141.73, 120.61, 114.17,
4.1.26. (3S,10R,13S,17S)eN-cyclopropyl-3-hydroxy-10,13-dimethyl-
2,3,4,7,8,9,10,11,12, 13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]
phenanthrene-17-carboxamide (6p)
72.98, 70.37, 56.57, 53.10, 49.84, 46.22, 42.60, 40.57, 40.36, 40.15,
39.94, 39.74, 39.53, 39.32, 38.44, 37.27, 36.48, 32.09, 31.80, 31.70,
24.77, 24.53, 20.94, 19.54, 14.08. MS (ESI) m/z 409.4 (M þ H)þ. Anal.
(C24H32N4O2) C,H,N,O. Purity: 95.4% by HPLC (tR ¼ 15.15 min).
Yield: 87.5%; mp 76e78 ꢀC; 1H NMR (400 MHz, DMSO)
d
7.51 (s,
1H), 5.25 (s, 1H), 4.59 (s, 1H), 3.33 (s, 1H), 3.24 (s, 1H), 2.56 (s, 2H),
11

J. Chen, L. Li, J. Liu et al.
European Journal of Medicinal Chemistry 220 (2021) 113468
2.21e1.81 (m, 5H), 1.80e1.45 (m, 6H), 1.44e1.09 (m, 5H), 0.92 (q,
J ¼ 16.8 Hz, 5H), 0.56 (s, 5H), 0.35 (d, J ¼ 19.5 Hz, 2H). 13C NMR
4.1.31. (3S,9S,10R,13S,14R,17S)-17-(2-hydroxypentan-2-yl)-10,13-
dimethyl-2,3,4,9,10, 11,12,13,14,15,16,17-dodecahydro-1H-
cyclopenta[a]phenanthren-3-ol (8b)
(101 MHz, DMSO) d 173.27,141.71,120.72, 70.39, 56.26, 55.63, 50.20,
43.68, 42.62, 40.56, 40.35, 40.14, 39.93, 39.73, 39.52, 39.31, 38.06,
37.37, 36.55, 31.91, 31.79, 24.72, 23.64, 22.64, 20.83, 19.55, 13.65,
6.60, 6.07. MS (ESI) m/z 358.3 (M þ H)þ. Anal. (C23H35NO2) C,H,N,O.
Purity: 96.1% by HPLC (tR ¼ 21.98 min).
Yield: 95.3%; mp 63e64 ꢀC; 1H NMR (400 MHz, MeOD)
d 5.56 (d,
J ¼ 3.4 Hz, 1H), 5.44e5.37 (m, 1H), 4.58 (s, 1H), 3.51 (ddd, J ¼ 18.7,
11.6, 7.2 Hz, 1H), 2.50e2.36 (m, 1H), 2.32e2.15 (m, 2H), 1.99e1.82
(m, 5H), 1.82e1.72 (m, 3H), 1.63 (d, J ¼ 9.3 Hz, 2H), 1.49 (dd, J ¼ 23.1,
12.2 Hz, 3H), 1.35 (dd, J ¼ 18.4, 10.0 Hz, 5H), 1.27 (s, 3H), 0.94 (dd,
J ¼ 12.4, 5.6 Hz, 6H), 0.81 (s, 3H). MS (ESI) m/z 359.3 (M þ H)þ. Anal.
(C24H38O2) C,H,O. Purity: 97.4% by HPLC (tR ¼ 17.24 min).
4.1.27. ((3S,10R,13S,17S)-3-hydroxy-10,13-dimethyl-
2,3,4,7,8,9,10,11,12,13,14,15,16,17 -tetradecahydro-1H-cyclopenta[a]
phenanthren-17-yl)(1H-imidazole-1-yl)methanone (6q)
4.1.32. (3S,9S,10R,13S,14R,17S)-17-(2-hydroxyhexan-2-yl)-10,13-
dimethyl-2,3,4,9,10, 11,12,13,14,15,16,17-dodecahydro-1H-
cyclopenta[a]phenanthren-3-ol(8c)
Yield: 93.8%; mp 122e123 ꢀC; 1H NMR (400 MHz, DMSO)
d 8.44
(s, 1H), 7.73 (s, 1H), 7.06 (s, 1H), 5.28 (d, J ¼ 3.1 Hz, 1H), 4.59 (d,
J ¼ 4.4 Hz, 1H), 3.41 (t, J ¼ 8.8 Hz, 1H), 3.29e3.20 (m, 1H), 2.14 (dt,
J ¼ 35.9, 11.9 Hz, 3H), 1.93 (dd, J ¼ 33.6, 11.3 Hz, 2H), 1.71 (dd,
J ¼ 29.3, 10.3 Hz, 3H), 1.55 (dd, J ¼ 27.2, 11.6 Hz, 4H), 1.40e1.21 (m,
5H), 1.08e0.88 (m, 5H), 0.65 (s, 3H). 13C NMR (101 MHz, DMSO)
Yield: 92.6%; mp 84e85 ꢀC; 1H NMR (400 MHz, MeOD)
d 5.56 (d,
J ¼ 3.7 Hz, 1H), 5.46e5.36 (m, 1H), 4.58 (s, 1H), 3.58e3.48 (m, 1H),
2.42 (d, J ¼ 12.2 Hz, 1H), 2.24 (dd, J ¼ 28.8, 13.3 Hz, 2H), 1.99e1.74
(m, 8H), 1.63 (d, J ¼ 9.5 Hz, 2H), 1.56e1.40 (m, 4H), 1.39e1.30 (m,
6H), 1.28 (s, 3H), 0.99e0.92 (m, 6H), 0.81 (s, 3H). MS (ESI) m/z 373.3
d
175.16, 141.73, 135.55, 122.06, 120.67, 70.40, 55.91, 54.96, 50.04,
43.41, 42.61, 40.52, 40.31, 40.10, 39.89, 39.68, 39.47, 39.26, 38.11,
37.37, 36.55, 32.00, 31.82, 31.73, 24.54, 23.65, 20.88, 19.55,13.42. MS
(ESI) m/z 369.3 (M þ H)þ. Anal. (C23H32N2O2) C,H,N,O. Purity: 96.9%
by HPLC (tR ¼ 21.98 min).
(M
þ
H)þ. Anal. (C25H40O2) C,H,O. Purity: 97.4% by HPLC
(tR ¼ 18.29 min).
4.2. Chemicals and antibodies
4.1.28. (3S,10R,13S,17S)eN-(2-acetamidoethyl)-3-hydroxy-10,13-
dimethyl-2,3,4,7,8,9,10, 11,12,13,14,15,16,17-tetradecahydro-1H-
cyclopenta[a]phenanthrene-17-carboxamide (6r)
All reagents used in chemical synthesis were purchased from
Shanghai Macklin Biochemical Co. (Shanghai, China). The solvents
used for column chromatography were purchased from Guangdong
Guanghua Sci-Tech Co. (Guangdong, China). Dexamethasone (Cat#
V1836; CAS #: 50-02-2) was obtained from InvivoChem (Liberty-
ville, IL 60048, USA). Primary antibodies were supplied by Abcam
and the horseradish peroxidase-labeled secondary antibody were
supplied by Fdbio science. Other biological reagents used in cell
culture were supplied by Gibco.
Yield: 90.4%; mp 114e115 ꢀC; 1H NMR (400 MHz, DMSO)
d 7.84
(d, J ¼ 4.9 Hz,1H), 7.47 (t, J ¼ 4.8 Hz,1H), 5.26 (d, J ¼ 3.8 Hz,1H), 4.61
(d, J ¼ 4.5 Hz, 1H), 3.31e3.10 (m, 3H), 3.02 (ddd, J ¼ 19.7, 12.1, 6.1 Hz,
3H), 2.18e1.99 (m, 4H), 1.93 (d, J ¼ 17.5 Hz, 1H), 1.77 (d, J ¼ 11.1 Hz,
4H), 1.59 (ddd, J ¼ 27.9, 26.3, 11.4 Hz, 5H), 1.43e1.29 (m, 3H), 1.21
(ddd, J ¼ 23.6, 15.5, 6.8 Hz, 2H), 1.07e0.77 (m, 6H), 0.56 (s, 3H). 13
C
NMR (101 MHz, DMSO)
d 172.21, 169.76, 141.69, 130.07, 127.91,
120.74, 70.39, 56.17, 56.03, 50.15, 43.56, 42.62, 39.04, 38.77, 38.00,
37.37, 36.55, 31.92, 31.81, 31.79, 24.71, 23.60, 23.04, 20.88, 19.56,
13.51. MS (ESI) m/z 403.3 (M þ H)þ. Anal. (C24H38N2O3) C,H,N,O.
Purity: 98.6% by HPLC (tR ¼ 21.97 min).
4.3. Biological activities
4.3.1. Cell culture
Murine macrophagic cell line (RAW 264.7) was cultured in
DMEM medium containing 10% Fetal Bovine Serum (FBS), 4 mM
glutamine,100 U penicillin, and 100 m
g/mL streptomycin, at 37 ꢀC in
4.1.29. (3S,10R,13S,17S)-3-hydroxy-10,13-dimethyl-N-(2-(thiophen-
2-yl)ethyl)-2,3,4,7,8, 9,10,11,12,13,14,15,16,17-tetradecahydro-1H-
cyclopenta[a]phenanthrene-17-carboxamide (6s)
a humidified 5% CO2 incubator. The cells were grown in 75 cm2
flasks and were sub-cultured until they reached 70e80% conflu-
ence with increasing passage number. Cells with a passage number
of 4e10 were used for further experiments.
Yield: 95.2%; mp 78e79 ꢀC; 1H NMR (400 MHz, DMSO)
d 7.58 (t,
J ¼ 5.5 Hz, 1H), 7.33 (d, J ¼ 4.8 Hz, 1H), 6.97e6.91 (m, 1H), 6.87 (d,
J ¼ 2.6 Hz, 1H), 5.26 (d, J ¼ 3.4 Hz, 1H), 3.42 (dt, J ¼ 13.0, 6.8 Hz, 2H),
3.27e3.12 (m, 2H), 2.92 (t, J ¼ 7.2 Hz, 2H), 2.18e1.98 (m, 4H), 1.92 (d,
J ¼ 17.5 Hz, 1H), 1.79e1.63 (m, 3H), 1.62e1.44 (m, 4H), 1.40e1.25 (m,
3H), 1.24e1.14 (m, 2H), 1.04e0.83 (m, 6H), 0.54 (s, 3H). 13C NMR
4.3.2. Cell viability assay
Cell viability was evaluated by the MTT assay. RAW 264.7 cells
were seeded into a 96-well plate at a density of 1.0 ꢃ 104 cells per
well. After incubated at 37 ꢀC with 5% CO2 overnight, the cells were
treated for 24 h with various concentrations from 100
of the synthesized compounds in the presence or absence of LPS
(100 ng/mL). the culture medium was removed, and then 100 L of
MTT (0.5 mg/mL in PBS) was added to the wells. After incubation
for another 4 h, the supernatant was removed and 100 L DMSO
(101 MHz, DMSO)
d 172.10, 142.07, 141.72, 127.26, 125.48, 124.25,
mM to 3 mM
120.72, 70.40, 56.22, 55.98, 50.17, 43.58, 42.64, 40.77, 40.57, 40.37,
40.16, 39.95, 39.74, 39.53, 39.32, 37.38, 36.55, 31.93, 31.80, 30.02,
24.71, 23.69, 20.84, 19.57, 13.50. MS (ESI) m/z 428.3 (M þ H)þ. Anal.
(C26H37NO2S) C,H,N,O,S. Purity: 96.4% by HPLC (tR ¼ 21.98 min).
m
m
was added. The resulting solution was assayed at 540 nm using a
microplate reader (BioTek Instruments, Inc.). The results were
shown as mean SD from three independent experiments.
4.1.30. (3S,9S,10R,13S,14R,17S)-17-(2-hydroxybutan-2-yl)-10,13-
dimethyl-2,3,4,9,10,11, 12,13,14,15,16,17-dodecahydro-1H-
cyclopenta[a]phenanthren-3-ol (8a)
Yield: 97.4%; mp 60e61 ꢀC; 1H NMR (400 MHz, MeOD)
d
5.55 (s,
4.3.3. NO measurement assay
1H), 5.41 (s, 1H), 4.58 (s, 1H), 3.53 (t, J ¼ 11.1 Hz, 1H), 2.43 (d,
J ¼ 14.0 Hz, 1H), 2.24 (dd, J ¼ 27.5, 12.3 Hz, 2H), 1.97e1.71 (m, 8H),
1.64 (d, J ¼ 8.9 Hz, 2H), 1.49 (dd, J ¼ 25.2, 7.8 Hz, 4H), 1.33 (d,
J ¼ 12.9 Hz, 2H), 1.26 (s, 3H), 0.96 (s, 3H), 0.90 (t, J ¼ 7.4 Hz, 3H), 0.81
(s, 3H). MS (ESI) m/z 345.3 (M þ H)þ. Anal. (C23H36O2) C,H,O. Purity:
96.0% by HPLC (tR ¼ 15.91 min).
RAW 264.7 macrophages were seeded in 96-well culture plate at
a density of 1 ꢃ 105 cells/mL at 37 ꢀC with 5% CO2. The cells were
cultured at 37 ꢀC with 5% CO2 for 24 h, followed by stimulation with
LPS from Escherichia coli (100 ng/mL as final concentration). Then
they were treated with different concentrations from 100
mM to
0.6 M of the synthesized compounds or dexamethasone for 24 h in
m
12

J. Chen, L. Li, J. Liu et al.
European Journal of Medicinal Chemistry 220 (2021) 113468
DMEM containing 10% FBS. As previously reported [36], the color-
imetric assay based on the Griess reaction was used to measure the
respectively. The results were shown as mean þ SD from three
independent experiments.
nitrite concentration in the medium. Briefly, 50 mL of medium was
collected, added to 96-well plates, and reacted with 1% sulfanil-
amide, 0.1% naphthyl ethylenediamine dihydrochloride, and 2.5%
phosphoric acid for 10 min at room temperature in the dark. The
optical density was detected with a microplate reader at 540 nm in
comparison with sodium nitrite as a standard. NO release by LPS
stimulation was designated as 100% for each experiment. The re-
4.3.6. Western blot analysis
The cells stimulated by LPS with 6q or dexamethasone treat-
ment were rinsed with ice-cold PBS and lysed in RIPA lysis with
protease and phosphatase inhibitor cocktails. After incubation for
30 min on ice, the lysates were centrifuged (12,000 g/min, 4 ꢀC for
20 min) to yield the supernatants for further analysis. The protein
concentration of each sample was quantified using a Pierce BCA
protein assay kit.
sults were shown as mean
experiments.
SD from three independent
Appropriate amount of total protein (20e30 mg) were loaded
4.3.4. RNA isolation and quantitative reverse-transcriptase
polymerase chain reaction (qRT-PCR) assay
and separated on 10% SDS-PAGE, then transferred to polyvinylidene
fluoride membranes (Millipore, MA, U.S.). The nitrocellulose
membranes were blocked with 5% nonfat dry milk-TBS-0.1% Tween
20 for 2 h, followed by incubation with indicated antibodies
(1:5,000; Bioworld, MN, U.S.) at 4 ꢀC overnight. Then the mem-
branes were incubated with horseradish peroxidase conjugated
secondary anti-rabbit antibody (1:5,000; Bioworld, MN, U.S.) for
2 h. The quantification of the chemiluminescent signal was carried
out by the enhanced chemiluminescence detection reagents (Key-
GEN, Nanjing, China) by a gel imaging system (ChemiScope 2850,
Clinx Science, Shanghai, China). The results were from three inde-
pendent experiments.
Total RNA extraction was performed with Eastep Super Total
RNA Extraction Kit (Promega, Shanghai, China) according to the
manufacturer’s instructions. cDNAs were prepared by reverse
transcription using M-MLV reverse transcriptase (Accurate
Biotechnology, Hunan, China). The mixture was incubated at 37 ꢀC
for 15 min, 85 ꢀC for 5 s, and hold at 4 ꢀC. Further PCR amplification
was performed with the obtained templates, gene-specific PCR
primer synthesized by Tsingke Biological Technology (Guangzhou,
China, Table 2), and 2X SYBR Green qPCR Master Mix (Accurate
Biotechnology, Hunan, China). All reactions were performed in
triplicate using LightCycler 480 (Roche) under the thermal cycling
conditions of 30 s at 95 ꢀC, followed by 40 cycles at 95 ꢀC for 5 s, and
60 ꢀC for 30 s. At the end of each cycle, the fluorescence signal was
4.3.7. In vivo evaluation of 6q in DSS-induced acute inflammation
model
-
DDCT
detected for each sample. Using 2
method, the relative
Male mice, 6 weeks of age, were purchased from SPF Biotech-
nology Co., Ltd (Beijing). Mice were caged under controlled tem-
perature (23
amount of gene expression was analyzed. Briefly, the mean value of
the replicates was calculated and expressed them as cycle threshold
(CT: cycle number of predetermined fluorescence threshold
2
ꢀC) with ad libitum access to food and water
throughout the experimental cycle. All experimental procedures
were approved by the National Institutional Animal Care and
ethical Committee of Southern Medical University.
reached by each PCR reaction). Then
DCT was calculated to repre-
sent the difference ( CT) between the mean CT value for the target
D
gene and the CT value for GAPDH, the internal control. For each
target gene, relative expression was calculated as the difference
After one-week acclimation, a total of 30 mice (c57BL/6) were
randomly assigned into 6 groups (A, normal control mice; B, DSS-
induced colitis model treated with vehicle control; C, DSS-
induced colitis model treated with 100 mg/kg of compound 6q;
D, DSS-induced colitis model treated with 50 mg/kg of 6q; E, DSS-
induced colitis model treated with 25 mg/kg of 6q; F, DSS-induced
colitis model treated with 25 mg/kg of dexamethasone). Compound
6q or dexamethasone was dissolved in a mixture of saline, castor
oil, ethanol, and DMSO (70:10:15:5) to provide desired concen-
trations. Briefly, mice were given 3.5% DSS solution and adminis-
(
DDCT) between the DCT values of the test sample and of the
control sample (not treated). Evaluation of 2 - CT indicated the fold
change in the expression of each gene relative to the untreated
control. The results were shown as mean þ SD from three inde-
pendent experiments.
DD
4.3.5. ELISA
RAW 264.7 cells were seeded in six-well plates at a density of
2 ꢃ 105 cells/well at 37 ꢀC in a 5% CO2 humidified incubator. After
12 h, non-adherent cells and medium were removed and the cells
were treated with 100 ng/mL LPS and various concentration (from
tered 100 mL of the drug via intraperitoneal injection for 7 days,
except mice in Group A only received common water. At the end of
the experiment, mice were sacrificed by cervical dislocation and
the portion of colonic tissues were fixed with 4% phosphate buff-
ered formalin for histopathology analysis.
20
collected for cytokine measurement. The level of the cytokine IL-6
and IL-1 were quantified using cytokine specific capture anti-
mM to 0.31 mM) of compound 6q for 24 h. The supernatants were
b
bodies, detection antibodies, and recombinant mouse cytokine
standards according to the specifications in a Human IL-6 ELISA Kit
4.3.8. Histological analysis and immunohistochemistry analysis
After sacrifice, the colon tissues of the mice were collected for
further analysis. Samples were fixed in 10% formalin, paraffin-
embedded, sliced into pieces and stained with hematoxylin and
eosin (HE) for observation under the microscope (200X). For
immunohistochemistry analysis, wax was removed from samples
after slicing, following by the antigen was recovered in citrate
buffer. 3% H2O2 was used to block the action of peroxidase. Samples
were incubated with primary antibodies (1:200 dilution), and then
incubated in IgG-HRP antibodies (1:200 dilution). After incubation,
samples were developed under the diaminobiphenyl microscope,
re-stained with hematoxylin, dehydrated, sealed into microslides.
With use of light microscope, the colonic structure was observed in
the magnification of 400X.
(Neobioscience), and a Human IL-1
b ELISA Kit (Neobioscience),
Table 2
Oligonucleotide primers used for qualitative real-time PCR (qPCR).
Gene
Forward primer (50 to 30)
Reverse primer (50 to 30)
iNOS
COX-2
IL-6
TGCTTTGTGCGAAGTGTCAG
TGGTGCCTGGTCTGATGATG
CTGCAAGAGACTTCCATCCAG
GAAATGCCACCTTTTGACAGTG
CAGGCGGTGCCTATGTCTC
TAAAAACCTGGATCGGAACCAAA
CCTGCTTCTGGAGGGTGATG
TGACCTCAACTACATGGTCTACA
CCCTTTGTGCTGGGAGTCAT
GTGGTAACCGCTCAGGTGTTG
AGTGGTATAGACAGGTCTGTTGG
TGGATGCTCTCATCAGGACAG
CGATCACCCCGAAGTTCAGTAG
GCATTAGCTTCAGATTTACGGGT
GCCGCTATATGCAGAGGTGT
CTTCCCATTCTCGGCCTTG
IL-1
TNF-
MCP-1
NF-
GAPDH
b
a
kB
13

J. Chen, L. Li, J. Liu et al.
European Journal of Medicinal Chemistry 220 (2021) 113468
20R-hydroxyvitamin D3, J. Med. Chem. 55 (2012) 3573e3577.
[14] L. Li, A. Hsu, P.K. Moore, Actions and interactions of nitric oxide, carbon
monoxide and hydrogen sulphide in the cardiovascular system and in
inflammation–a tale of three gases!, Pharmacol. Therapeut. 123 (2009)
386e400.
[15] T. Krakauer, Molecular therapeutic targets in inflammation: cyclooxygenase
and NF-kappaB, Curr. Drug Targets - Inflamm. Allergy 3 (2004) 317e324.
[16] P. Pacher, J.S. Beckman, L. Liaudet, Nitric oxide and peroxynitrite in health and
disease, Physiol. Rev. 87 (2007) 315e424.
[17] D. Ribeiro, C. Proenca, S. Rocha, J. Lima, F. Carvalho, E. Fernandes, M. Freitas,
Immunomodulatory effects of flavonoids in the prophylaxis and treatment of
inflammatory bowel diseases: a comprehensive review, Curr. Med. Chem. 25
(2018) 3374e3412.
4.3.9. Statistical analysis
All statistical analyses were performed by GraphPad Prism 8.0.
Data are presented as mean SD. Differences between groups were
analyzed using the Student’s t-test or one-way ANOVA.
values < 0.05 were considered significant.
P
Declaration of competing interest
The authors declare that they have no known competing
financial interests or personal relationships that could have
appeared to influence the work reported in this paper.
[18] D. Wang, R.N. Dubois, The role of COX-2 in intestinal inflammation and
colorectal cancer, Oncogene 29 (2010) 781e788.
[19] A. Piechota-Polanczyk, J. Fichna, Review article: the role of oxidative stress in
pathogenesis and treatment of inflammatory bowel diseases, N. Schmied.
Arch. Pharmacol. 387 (2014) 605e620.
Acknowledgement
[20] L.A. Abdulkhaleq, M.A. Assi, R. Abdullah, M. Zamri-Saad, Y.H. Taufiq-Yap,
M.N.M. Hezmee, The crucial roles of inflammatory mediators in inflammation:
a review, Vet. World 11 (2018) 627e635.
[21] L.C. Borish, J.W. Steinke, 2. Cytokines and chemokines, J. Allergy Clin. Immu-
nol. 111 (2003) S460eS475.
This work was supported by International Science and Tech-
nology Cooperation Projects of Guangdong Province (No.
G819310411).
[22] T. Tanaka, M. Narazaki, T. Kishimoto, IL-6 in inflammation, immunity, and
disease, Cold Spring Harb.Perspect. Biol 6 (2014) a016295.
Appendix A. Supplementary data
[23] Y.J. Surh, K.S. Chun, H.H. Cha, S.S. Han, Y.S. Keum, K.K. Park, S.S. Lee, Molecular
mechanisms underlying chemopreventive activities of anti-inflammatory
phytochemicals: down-regulation of COX-2 and iNOS through suppression
of NF-kappa B activation, Mutat. Res. 480e481 (2001) 243e268.
[24] R.J. Xavier, D.K. Podolsky, Unravelling the pathogenesis of inflammatory
bowel disease, Nature 448 (2007) 427e434.
[25] B. Chassaing, J.D. Aitken, M. Malleshappa, M. Vijay-Kumar, Dextran sulfate
sodium (DSS)-induced colitis in mice, Curr. Protoc. Im. 104 (2014), 15.25.11-
2515.25.14.
[26] F. Loher, C. Bauer, N. Landauer, K. Schmall, B. Siegmund, H.A. Lehr, M. Dauer,
M. Schoenharting, S. Endres, A. Eigler, The interleukin-1 beta-converting
enzyme inhibitor pralnacasan reduces dextran sulfate sodium-induced mu-
rine colitis and T helper 1 T-cell activation, J. Pharmacol. Exp. Therapeut. 308
(2004) 583e590.
[27] N.S. Nunes, P. Chandran, M. Sundby, F. Visioli, F. da Costa Gonçalves,
S.R. Burks, A.H. Paz, J.A. Frank, Therapeutic ultrasound attenuates DSS-induced
colitis through the cholinergic anti-inflammatory pathway, EBioMedicine 45
(2019) 495e510.
Supplementary data to this article can be found online at
https://doi.org/10.1016/j.ejmech.2021.113468.
References
[1] X. Chen, J. Leng, K.P. Rakesh, N. Darshini, T. Shubhavathi, H.K. Vivek,
N. Mallesha, H.L. Qin, Synthesis and molecular docking studies of xanthone
attached amino acids as potential antimicrobial and anti-inflammatory agents,
MedChemComm 8 (2017) 1706e1719.
[2] C. Li, M.B. Sridhara, K.P. Rakesh, H.K. Vivek, H.M. Manukumar,
C.S. Shantharam, H.L. Qin, Multi-targeted dihydrazones as potent bio-
therapeutics, Bioorg. Chem. 81 (2018) 389e395.
[3] W.Y. Fang, L. Ravindar, K.P. Rakesh, H.M. Manukumar, C.S. Shantharam,
N.S. Alharbi, H.L. Qin, Synthetic approaches and pharmaceutical applications
of chloro-containing molecules for drug discovery: a critical review, Eur. J.
Med. Chem. 173 (2019) 117e153.
[4] N.A. Molodecky, I.S. Soon, D.M. Rabi, W.A. Ghali, M. Ferris, G. Chernoff,
E.I. Benchimol, R. Panaccione, S. Ghosh, H.W. Barkema, G.G. Kaplan, Increasing
incidence and prevalence of the inflammatory bowel diseases with time,
based on systematic review, Gastroenterology 142 (2012) 46e54, e42; quiz
e30.
[5] S.M. Wang, G.F. Zha, K.P. Rakesh, N. Darshini, T. Shubhavathi, H.K. Vivek,
N. Mallesha, H.L. Qin, Synthesis of benzo[d]thiazole-hydrazone analogues:
molecular docking and SAR studies of potential H(þ)/K(þ) ATPase inhibitors
and anti-inflammatory agents, MedChemComm 8 (2017) 1173e1189.
[6] S.B. Hanauer, Inflammatory bowel disease: epidemiology, pathogenesis, and
therapeutic opportunities, Inflamm. Bowel Dis. 12 (Suppl 1) (2006) S3eS9.
[7] G.G. Kaplan, The global burden of IBD: from 2015 to 2025, Nature reviews,
Gastroenterol. Hepatol. 12 (2015) 720e727.
[28] S. Yuan, J. Shen, Bacteroides vulgatus diminishes colonic microbiota dysbiosis
ameliorating lumbar bone loss in ovariectomized mice, Bone 142 (2020)
115710.
[29] W.L. Miller, R.J. Auchus, The molecular biology, biochemistry, and physiology
of human steroidogenesis and its disorders, Endocr. Rev. 32 (2011) 81e151.
[30] T.J. Cole, K.L. Short, S.B. Hooper, The science of steroids, Semin. Fetal Neonatal
Med. 24 (2019) 170e175.
[31] A.S. Payne, R.J. Freishtat, Conserved steroid hormone homology converges on
nuclear factor kB to modulate inflammation in asthma, J. Invest. Med. : Off.
Publ.Am. Fed.Clin. Res. 60 (2012) 13e17.
[32] M.A. Zmijewski, W. Li, J.K. Zjawiony, T.W. Sweatman, J. Chen, D.D. Miller,
A.T. Slominski, Photo-conversion of two epimers (20R and 20S) of pregna-5,7-
diene-3beta, 17alpha, 20-triol and their bioactivity in melanoma cells, Ste-
roids 74 (2009) 218e228.
[33] A.T. Slominski, Z. Janjetovic, B.E. Fuller, M.A. Zmijewski, R.C. Tuckey,
M.N. Nguyen, T. Sweatman, W. Li, J. Zjawiony, D. Miller, T.C. Chen, G. Lozanski,
M.F. Holick, Products of vitamin D3 or 7-dehydrocholesterol metabolism by
cytochrome P450scc show anti-leukemia effects, having low or absent cal-
cemic activity, PloS One 5 (2010), e9907.
[34] J.M. Kim, H.W. Kang, M.Y. Cha, D. Yoo, N. Kim, I.K. Kim, J. Ku, S. Kim, S.H. Ma,
H.C. Jung, I.S. Song, J.S. Kim, Novel guggulsterone derivative GG-52 inhibits
NF-kappaB signaling in intestinal epithelial cells and attenuates acute murine
colitis, Laboratory investigation, J. Tech. Methods.Pathol. 90 (2010)
1004e1015.
[35] L.W. Guo, W.K. Wilson, J. Pang, C.H. Shackleton, Chemical synthesis of 7- and
8-dehydro derivatives of pregnane-3,17alpha,20-triols, potential steroid me-
tabolites in Smith-Lemli-Opitz syndrome, Steroids 68 (2003) 31e42.
[36] E. Ghidini, G. Marchini, A.M. Capelli, C. Carnini, V. Cenacchi, A. Fioni,
F. Facchinetti, F. Rancati, Novel pyrrolidine derivatives of budesonide as long
acting inhaled corticosteroids for the treatment of pulmonary inflammatory
diseases, J. Med. Chem. 61 (2018) 4757e4773.
[8] S. Zhu, C. Yang, L. Zhang, S. Wang, M. Ma, J. Zhao, Z. Song, F. Wang, X. Qu, F. Li,
W. Li, Development of M10, myricetin-3-O-b-d-lactose sodium salt, a deriv-
ative of myricetin as a potent agent of anti-chronic colonic inflammation, Eur.
J. Med. Chem. 174 (2019) 9e15.
[9] A. Carbo, R.D. Gandour, R. Hontecillas, N. Philipson, A. Uren, J. Bassaganya-
Riera, An N,N-Bis(benzimidazolylpicolinoyl)piperazine (BT-11): a novel lan-
thionine synthetase C-like 2-based therapeutic for inflammatory bowel dis-
ease, J. Med. Chem. 59 (2016) 10113e10126.
[10] D.K. Podolsky, Inflammatory bowel disease, N. Engl. J. Med. 347 (2002)
417e429.
[11] M.A. Engel, M.F. Neurath, New pathophysiological insights and modern
treatment of IBD, J. Gastroenterol. 45 (2010) 571e583.
[12] T.K. Kim, J. Chen, W. Li, J. Zjawiony, D. Miller, Z. Janjetovic, R.C. Tuckey,
A. Slominski, A new steroidal 5,7-diene derivative, 3beta-hydroxyandrosta-
5,7-diene-17beta-carboxylic acid, shows potent anti-proliferative activity,
Steroids 75 (2010) 230e239.
[13] Y. Lu, J. Chen, Z. Janjetovic, P. Michaels, E.K. Tang, J. Wang, R.C. Tuckey,
A.T. Slominski, W. Li, D.D. Miller, Design, synthesis, and biological action of
14