Synthesis and properties of oligonucleotides carrying isoquinoline imidazo[1,2- a] azine fluorescent units

Article abstract of DOI:10.1021/bc1000966

Oligonucleotides carrying novel fluorescent compounds with a dipolar isoquinoline imidazo[1,2-a]azine core were prepared. Analysis of the melting curves demonstrates that DNA duplexes carrying these fluorescent labels at their ends have a slight increase

Full text of DOI:10.1021/bc1000966

1622
Bioconjugate Chem. 2010, 21, 1622–1628
Synthesis and Properties of Oligonucleotides Carrying Isoquinoline
Imidazo[1,2-a]azine Fluorescent Units
So´nia Pe´rez-Rentero,† Nicola Kielland,‡ Montserrat Terrazas,† Rodolfo Lavilla,*,‡,§ and Ramon Eritja*,†
Institute for Research in Biomedicine, IQAC-CSIC, CIBER-BBN Networking Centre on Bioengineering, Biomaterials and
Nanomedicine, Baldiri Reixac 10, 08028 Barcelona, Spain, Institute for Research in Biomedicine, Laboratory of Organic
Chemistry, Faculty of Pharmacy, University of Barcelona, Baldiri Reixac 10-12, 08028 Barcelona, Spain, and Laboratory of
Organic Chemistry, Faculty of Pharmacy, University of Barcelona, Avda Joan XXIII s/n, 08028 Barcelona, Spain. Received
February 18, 2010; Revised Manuscript Received June 28, 2010
Oligonucleotides carrying novel fluorescent compounds with a dipolar isoquinoline imidazo[1,2-a]azine core were
prepared. Analysis of the melting curves demonstrates that DNA duplexes carrying these fluorescent labels at
their ends have a slight increase in DNA duplex stability. The UV absorption and fluorescent properties of the
oligonucleotide conjugates were analyzed. The fluorescent label is sensitive to duplex formation, as cooperative
melting curves are also observed at 366 nm and fluorescence has a large increase upon denaturation. Cell uptake
studies allow observation of these fluorescently labeled oligonucleotides internalized into HeLa cells.
Here, we report the conjugation of mesoionic acid fluorides
1a and 1b with oligonucleotides carrying alkyl amino groups
(Scheme 2) and demonstrate that fluorescence-labeled oligo-
nucleotides can be prepared in good yields directly from the
reaction of amino-oligonucleotides and mesoionic acid fluorides
in aqueous media. Dipoles 1a and 1b, bearing, respectively,
cyclohexyl and benzyl groups as substituents at the imidazole
nitrogen, were selected from a set of described analogues for
the following reasons. First, they can be synthesized on a
multigram scale with a simple methodology and are well
characterized (X-ray, NMR, and spectroscopy); in addition, their
substituents at the imidazole nitrogen (cyclohexyl and benzyl)
featuring relevant differences in terms of shape, volume,
polarity, and conformational behavior may confer to the
corresponding bioconjugates distinct properties. Furthermore,
both residues are chemically stable, unlikely to suffer degrada-
tion in physiological media, and, from an exploratory point of
view, easy to replace by a wide number of analogues.
INTRODUCTION
There is a considerable interest in the development of new
dyes and the introduction of these into biomolecules such as
peptides, proteins, and nucleic acids (1). Furthermore, the
development of new methodologies for the selective and
straightforward modification of biomolecules is having an
increasing impact on biopharmaceuticals. When fluorescent
molecules are attached to biomolecules that are not fluorescent,
the resulting new entity acquires the fluorescent properties. Thus,
fluorescent labels allow sensitive and selective detection of a
specific component of complex biomolecular assemblies. Fluo-
rescence-labeled oligonucleotides have large numbers of ap-
plications in several fields, such as biotechnology (2), cell
biology (3), molecular biology (4), and biophysics (5). There-
fore, the development of new fluorescent labels for oligonucle-
otides is of particular relevance (6, 7).
Recently, we described the synthesis of a new class of
fluorescent mesoionic acid fluorides using a multicomponent
strategy. The reaction involves the participation of an azine, an
isocyanide, and a fluorinated anhydride and yields dipolar
derivatives with an isoquinoline imidazo[1,2-a]azine core (see
Scheme 1) (8). These compounds are fluorescent, and when
trifluoroacetic anhydride is used, they contain a reactive acid
fluoride group that can be used to introduce the fluorescent label,
by means of amide formation, into biomolecules that carry
amino groups. The modular character of this multicomponent
reaction (MCR) (9) allows the convergent synthesis of a large
variety of structural analogs in a single step. Thus, both the
fluorescent and biological properties of the dye can be optimized
for specific applications. In this respect, the present study
determines the features of the conjugation of these stable dipolar
acyl fluorides with oligonucleotides, a fruitful strategy often used
in peptide synthesis (10), which to our knowledge is unprec-
edented in the oligonucleotide field.
Our results indicate that the novel fluorescent oligonucleotides
show potentially interesting properties for denaturation monitor-
ing procedures as well as for cellular uptake studies.
EXPERIMENTAL PROCEDURES
The phosphoramidites and ancillary reagents used during
oligonucleotide synthesis were from Applied Biosystems (PE
Biosystems Hispania S.A., Spain) and Link Technologies Ltd.
(Scotland). The rest of the chemicals were purchased from
Aldrich, Sigma, or Fluka (Sigma-Aldrich Qu´ımica S.A., Spain).
1-Cyclohexyl-3-(fluorocarbonyl)-2-oxo-2,3-dihydro-1H-imidazo-
[2,1-a]isoquinolin-4-ium-3-ide (1a), 1-benzyl-3-(fluorocarbo-
nyl)-2-oxo-2,3-dihydro-1H-imidazo[2,1-a]isoquinolin-4-ium-3-
ide (1b), 1-cyclohexyl-3-(4-methoxybenzylcarbamoyl)-2-oxo-
2,3-dihydro-1H-imidazo[2,1-a]isoquinolin-4-ium-3-ide (1c), and
1-cyclohexyl-3-(methoxycarbonyl)-2-oxo-2,3-dihydro-1H-imi-
dazo[2,1-a]isoquinolin-4-ium-3-ide (1d) were prepared follow-
ing literature procedures (8) (Scheme 1).
* To whom correspondence should be addressed. Phone 34-
934039942. E-mail recgma@cid.csic.es; rlavilla@pcb.ub.es.
† CIBER-BBN Networking Centre on Bioengineering, Biomaterials
and Nanomedicine.
Synthesis of Oligonucleotides. Oligonucleotide sequences
A, 5′-CCAATTGG-3′; B, 5′-TTCCGGAA-3′; and C, 5′-
CTCTCGCACCCATCTCTCTCCTTCT-3′ were prepared on an
automatic Applied Biosystems 3400 DNA synthesizer on 0.2-
or 1-µmol scale using commercially available chemicals. The
‡ Institute for Research in Biomedicine, University of Barcelona.
§ Laboratory of Organic Chemistry, University of Barcelona.
10.1021/bc1000966  2010 American Chemical Society
Published on Web 08/05/2010

Fluorescent Labeling of Oligonucleotides
Bioconjugate Chem., Vol. 21, No. 9, 2010 1623
Scheme 1. Three-Component Reaction of Isoquinoline and Isocyanides in the Presence of Trifluoroacetic Anhydride and Subsequent
Reaction of the Resulting Acyl Fluoride with P-Methoxybenzylamine or Methanola
a Reagents and conditions: (a) CH2Cl2, 14 h, r.t.; (b) p-methoxybenzylamine, TEA, CH2Cl2 anh., r.t., overnight; (c) MeOH, TEA, reflux.
Scheme 2. Synthesis of Oligonucleotides Carrying a Derivative of Isoquinoline at the 3′-End
sequences were prepared with and without the amino group at
the 3′-end. The synthesis was carried out using the standard
phosphite triester methodology and a controlled-pore-glass
support carrying the 2-(N-{[(9H-fluoren-9-yl)methoxy]carbo-
nyl}-4-aminobutyl)propane-1,3-diol linker (11) (Scheme 2) or
in regular low-volume (LV200) polystyrene supports. The
benzoyl (Bz) group was used to protect the amino group of dC
and dA, and the isobutyryl (ibu) group to protect dG. Coupling
yields were >95%. The last DMT group was removed at the
end of the synthesis. The oligonucleotide was deprotected and
cleaved from the support by treatment with aqueous concentrated
ammonia for 12 h at 55 °C. Under these conditions, all
protecting groups, including Fmoc, were removed to yield
unprotected 3′-amino-oligonucleotide. The mixture was filtered,
and the ammonia solution was concentrated to dryness. The
residue was passed through a Dowex 50 × 4 (Na+ form) column
to exchange ammonium ions for Na+ ions. The solution was
analyzed by HPLC and used directly in the dye conjugation.
Analytical HPLC solutions: Solvent A, 5% acetonitrile (MeCN)
in 100 mM triethylammonium acetate (pH ) 7); and solvent
B, 70% MeCN in 100 mM triethylammonium acetate (pH )
7). Column: X-Bridge OST C18 (2.5 µm, 4.6 × 50 mm). Flow
rate: 1 mL/min. Conditions for the analysis of octamers: 10 min
linear gradient from 0-30% B at 60 °C; for the analysis of
25mer: 4 min linear gradient from 0-12% B, then 6 min linear
gradient from 12-50% B at 60 °C. The desired oligonucleotides
eluted at 2.5-3.5 min. Alternatively, oligonucleotides were
purified by HPLC (see below).
Octamer sequence A (200 nmol scale): 33% yield (5 OD260)
tR ) 2.6 min. Octamer sequence A 3′-NH2 (1 µmol scale): 47%
yield (36 OD260), tR ) 2.6 min. MALDI-TOF MS m/z (negative
mode, THAP-CA, [M-H]-) expected for C85H106N31O50P8
2617.8, found 2618.7. Octamer sequence B (200 nmol scale):
39% yield (6 OD260) tR ) 3.2 min. Octamer sequence B 3′-
NH2 (1 µmol scale): 54% yield (42 OD260), tR ) 3.2 min.
MALDI-TOF MS m/z (negative mode, THAP-CA, [M-H]-)
calculated for C85H106N31O50P8 2617.8, found 2617.9. 25mer
sequence C 3′-NH2 (1 µmol scale): 58% yield 118 OD260, tR )
4.0 min. MALDI-TOF MS m/z (negative mode, THAP-CA,
[M-H]-) expected for C244H301N73O159P25 7600, found 7603.6.
General Protocol for Conjugation. The amino-oligonucle-
otides were reacted with 1-cyclohexyl-3-(fluorocarbonyl)-2-oxo-
2,3-dihydro-1H-imidazo[2,1-a]isoquinolin-4-ium-3-ide (1a) or
1-benzyl-3-(fluorocarbonyl)-2-oxo-2,3-dihydro-1H-imidazo[2,1-
a]isoquinolin-4-ium-3-ide (1b) or with fluorescein isothiocyanate
(FITC) (Isomer I, Sigma) as follows. Oligonucleotides (7 O.D.)
were dissolved with 250 µL of an aqueous solution of 0.2 M
NaHCO3 (pH ) 9). Then, 10 equiv of a solution of compound
1a or 1b or FITC in 0.25 mL of N,N-dimethylformamide (DMF)
were added and the mixture was left to react for 8 h at room
temperature. Then, 100 µL of an aqueous solution of 0.2 M
NaHCO3 (pH ) 9) and an additional 10 equiv of compound 1a
or 1b in 100 µL of DMF were added and the mixture was left
overnight at room temperature. The mixtures were concentrated
to dryness, and the residues were dissolved in 1 mL of H2O.
The solutions were purified by Sephadex G-25 (NAP-10

1624 Bioconjugate Chem., Vol. 21, No. 9, 2010
Pe´rez-Rentero et al.
nearest-neighbor method as well and adding the contribution
of fluorescein (the extinction coefficient of fluorescein (measured
as FITC) at 260 nm is around 13.7 mM-1 cm-1). Samples were
heated at 90 °C for 5 min, allowed to cool slowly to room
temperature to induce annealing, and then kept overnight in a
refrigerator (4 °C).
Melting curves were recorded by heating the samples with a
temperature controller from 15 to 80 °C at a constant rate of 1
°C/min and monitoring the absorbance at 260 nm. During the
experiment, when the temperature was below 25 °C, argon was
flushed to prevent water condensation on cuvettes. Absorption
spectra and melting experiments (absorbance vs temperature)
were recorded in 1 cm path-length cells. Melting curves were
analyzed by computer-fitting the denaturation data, using
Meltwin 3.5 software. Melting temperatures (Tm) decreased with
the concentration c, as expected for a bimolecular reaction (12).
The plot of 1/Tm vs ln c was linear, giving a slope and a
y-intercept, from which ∆H, ∆S, and ∆G were obtained (Table
2).
Fluorescence Analysis. Fluorescence spectra were measured
in solutions containing 1 M NaCl and 100 mM sodium
phosphate buffer (pH ) 7) at a concentration of 2.3 µM.
Excitation was set at 345 nm for octamers 2-4 and 493 nm for
octamer 5. Fluorescence spectra were measured before (FD) and
after (FRC) duplex denaturation to yield relative fluorescence
intensity (FRC/FD)). Results are shown in Figure 2 and Table 4.
Flow Cytometry Experiments. HT-29 cells were incubated
for 8 h with dipole 1c at concentrations of 2 µM, 5 µM, 10
µM, 20 µM, and 40 µM in a low glucose DMEM (Biological
Industries) medium in the absence of phenol red. A blank control
was also prepared. The supernatant was separated and placed
in falcon tubes. The cells were treated with trypsin and placed
in the corresponding falcon tubes. Each tube was centrifuged
for 4 min at 2000 rpm. The supernatant was removed and PBS
(500 µL) was added to each tube. The samples were treated
with a propidium iodide solution (5 µL of a 1 µg/mL solution)
and analyzed with a Cell Lab Quanta SC cytometer (Beckman
Coulter).
Confocal Microscopy Experiments. HT-29 cells were
incubated with dipole 1c and 1d (20 µM) for 2 h in a DMEM
medium without phenol red. The living cells were treated with
the plasmatic membrane marker WGA (Texas Red-x)-D (excita-
tion at 595 nm, emission 615 nm). After 15 min, the cells were
analyzed in vivo with a Leica TCS SP2 confocal microscope
(excitation at 350 nm, emission between 400 and 500 nm). In
these experiments, a blank control with the cells in the absence
of dipole 1c or its conjugate was analyzed. The intensity of the
laser was adjusted in order to prevent detection of autofluores-
cent processes. Products 1c and 1d were detected in the
cytoplasmatic region and they formed well-defined aggregates
(see Supporting Information). Using the same procedure, HeLa
cells were incubated with 1c and oligonucleotide 6 (20 µM)
for 4 h. While 1c showed the same result as in the previous
experiment, no fluorescence was detected using oligonucleotide
6. In the presence of Lipofectamine 2000, oligonucleotide 6
penetrated the cytoplasmatic region.
Figure 1. HPLC profiles of (a) the mixture obtained after the reaction
with compound 1a and amino-oligonucleotide sequence A to yield
compound 2 (conversion 91%) and (b) purified compound 2. HPLC
conditions: 4 min linear gradient from 0-12% B, then 6 min linear
gradient from 12-50% B at 60 °C. The desired oligonucleotide
(compound 2) eluted at 8.7 min (1 stands for amino-oligonucleotide
sequence A and [ stands for oligomer 2).
columns). The fractions containing oligonucleotides were
analyzed by HPLC as described above (Figure 1). Octamer 5
and 25mer 6 were used in the next step without further
purification. Octamers 2-4 were purified by HPLC on a
Nucleosil 120C18 (10 µm, 200 × 10 mm) column. Flow rate:
3 mL/min. Conditions: 10 min linear gradient from 0-30% B,
then a 10 min linear gradient from 30-100% B. The resulting
products were desalted with Sephadex G-25 (NAP-5 Column).
The coupling efficiency was determined by HPLC analyses
(octamer 2 91%, octamer 3 91%, octamer 4 94%, 25mer 6 85%,
octamer 5 (FITC) 94%. HPLC solutions as described above.
Column: X-Bridge OST C18 (2.5 µm, 4.6 × 50 mm). Flow
rate: 1 mL/min. Conditions: 4 min linear gradient from 0-12%
B, then a 1 min linear gradient from 12-40% B, then 5 min
linear gradient from 40-45% B at 60 °C. The purified oligomers
were analyzed by MS (MALDI-TOF) and UV-vis (Table 1).
Octamer 2: 39% yield (2.7 OD260), tR ) 6.7 min, λ ) 260
and 347 nm, MALDI-TOF MS m/z negative mode, THAP-CA,
[M-H]- calculated for C103H122N33O52P8 2910.1, found 2911.8.
Octamer 3: 54% yield (3.8 OD260), tR ) 6.7 min, λ ) 260
and 346 nm, MALDI-TOF MS m/z negative mode, THAP-CA,
[M-H]- calculated for C103H122N33O25P8 2910.1, found 2906.8.
Octamer 4: 26% yield (1.8 OD260), tR ) 6.4 min, λ ) 260
and 345 nm, MALDI-TOF MS m/z negative mode, THAP-CA,
[M-H]- calculated for C104H118N33O52P8 2918.3, found 2914.9.
Octamer 5: 84% yield (5.9 OD260), tR ) 5.8 min, λ ) 260
and 493 nm, MALDI-TOF MS m/z negative mode, THAP-CA,
[M-H]- calculated for C106H128N32O55P8S 3008.9, found 3004.0.
25mer 6 (from 30 OD260): 71% yield (21.3 OD260), tR ) 8.3
min (4 min linear gradient 0-12% B, then 6 min linear gradient
12-50% B, at 60 °C), λ ) 268 and 348 nm; MALDI-TOF MS
m/z negative mode, THAP-CA, [M-H]- expected 7892.3, found
7870.2.
RESULTS AND DISCUSSION
Synthesis and Thermodynamic Properties of Fluorescence
Labeled Oligonucleotides. Small ligands can be incorporated
into synthetic oligonucleotides at specific sites by preparing
oligonucleotides carrying aliphatic amino groups and performing
a conjugation reaction with the carboxylic derivatives of the
ligands (11, 13, 14). This strategy was used to incorporate the
acyl fluorides derivatives 1a and 1b into oligonucleotides
(Scheme 2). Oligonucleotide sequences (Table 1) carrying an
amino group at the 3′-end were assembled using a controlled
Melting Experiments. Melting experiments were performed
in duplicate at concentrations ranging 1.5-14 µM of duplex.
Solutions of each oligonucleotide were mixed in a solution
containing 1 M NaCl and 100 mM sodium phosphate buffer
pH ) 7. The DNA concentrations were determined by UV-
absorbance measurements (260 nm) at 80 °C, using the ε260
values calculated by the nearest-neighbor method for the DNA
coil state. For octamer 5, the ε260 value was calculated by the

Fluorescent Labeling of Oligonucleotides
Bioconjugate Chem., Vol. 21, No. 9, 2010 1625
Table 1. Mass Spectra and UV Maxima of Fluorescent Oligonucleotides Prepared in This Study
#
sequence (5′-3′)
CCAATTGG-NHCO-1a
TTCCGGAA- NHCO-1a
CCAATTGG-NHCO-1b
TTCCGGAA-NHCO-FITC
MS (expected)
MS (found)
UVmax, nm
2
3
4
5
6
2910.1
2910.1
2918.3
3008.9
7892.3
2911.8
2906.8
2914.9
3004.4
7870.2
260, 347
260, 346
260, 345
260, 493
267, 348
CTCTCGCACCCATCTCTCTCCTTCT NHCO-1a
Table 2. Thermodynamic Parameters for Duplex-to-Random-Coil Transitionsa
#
Duplex
Tm [°C]b
∆H [kcal/mol]
∆S [kcal/mol.K]
∆G [kcal/mol]
∆∆Gc[kcal/mol]
5′CCAATTGG3′
5′CCAATGG-1a3′
5′CCAATGG-1b3′
5′TTCCGGAA3′
5′TTCCGGAA-1a3′
33.3
41.1
34.0
31.8
44.2
-119.5
-116.8
-103.7
-107.5
-107.0
-340.5
-322.5
-288.3
-303.0
-287.8
-18.0
-20.6
-17.7
-17.2
-21.2
0
1.3
-0.15
0
2
4
3
2
a (1 M NaCl and 100 mM sodium phosphate buffer at pH ) 7). ∆G is calculated at 25 °C, with the assumption that ∆H and ∆S do not depend on
temperature; analysis was carried out with melting temperatures obtained from denaturation curves. b Tm calculated at 4 µM duplex concentration. c ∆G
(modified octamer) - ∆G (unmodified octamer)/2 fluorescent molecules.
Figure 2. (a) UV and (b) fluorescence spectra of oligonucleotide 2.
pore glass support carrying the 2-(N-{[(9H-fluoren-9-yl)methoxy]-
carbonyl}-4-aminobutyl)propane-1,3-diol linker (11) and fol-
lowing standard protocols. The resulting oligonucleotides were
used in the reaction with acyl fluorides (Scheme 1).
Amino-oligonucleotides were reacted with an excess of acyl
fluorides 1a and 1b in aqueous dimethylformamide (DMF)
mixtures at pH 9 and room temperature. In these mild condi-
tions, the desired fluorescent oligonucleotides 2-4 and 6 were
produced in good yields as shown by the presence of new
products with higher retention time, which were characterized
by mass spectrometry and UV spectra (Figure 1 and Table 1).
In addition, we have prepared the fluoresceine-labeled octamer
5 by reaction of the appropriate amino-octamer with fluoresceine
isothiocyanate (FITC).

1626 Bioconjugate Chem., Vol. 21, No. 9, 2010
Pe´rez-Rentero et al.
Figure 3. Melting curves of self-complementary oligonucleotide 2 measured at 260 and 366 nm.
The hybridization properties of the oligonucleotides carrying
the isoquinoline imidazo[1,2-a]azine group were measured
spectrophotometrically on the self-complementary octamer
duplexes 2-4. Unmodified octamers were included for com-
parison purposes (Table 2). The duplex formed by sequence A,
which carried two molecules of compound 1a (octamer 2),
melted at 41.1 °C (∆G 20.6 kcal/mol), while the unmodified
duplex melted at 33.3 °C (∆G 18.0 kcal/mol). This observation
implies an increase in duplex stability of 3.8 °C (∆∆G 1.3 kcal/
mol) per fluorescent molecule. In contrast, the duplex formed
by sequence A, carrying two molecules of compound 1b
(octamer 4), melted at 34 °C (∆G 17.7 kcal/mol), thereby
indicating a small destabilization of the duplex. This effect
should reflect the previously mentioned differences between the
substituents on the imidazole nitrogen of the dipoles, presumably
arising from the distinct interactions at the conformational level
of the cyclohexyl and benzyl groups with the oligonucleotide
backbone. The stabilizing properties of compound 1a were
slightly increased in octamer 3 (∆∆G 2.0 kcal/mol), thereby
indicating that the stabilizing properties of this compound are
not dependent on the DNA sequence at the end as octamer 3
has A.T base pairs, while octamer 2 has G.C base pairs.
Preliminary conformational studies of the linkers containing
cyclohexyl or benzyl substituents by means of computer-based
molecular modeling (Spartan’04 and Hyperchem’08; molecular
mechanics conformational search and geometry optimization)
suggest that, in the lower energy conformations, the isoquinoline
imidazo[1,2-a]azine core containing a cyclohexyl substituent
stacks over the terminal guanine nucleobase, at a distance of
approximately 3 to 4 Å, whereas the isoquinoline imidazo[1,2-a]-
azine core containing a benzyl substituent does not interact
significantly with the terminal guanine (see Supporting Informa-
tion Figure S1). These studies were carried out by keeping
frozen the duplex of DNA and by allowing the linker to move
freely during the calculations. In order to explore the rotational
freedom of the cyclohexyl or benzyl-fluorescent isoquinoline
imidazo[1,2-a]azine in more detail and to determine the dynamic
behavior of the conjugates, molecular dynamics simulations and
NMR studies on these modified duplexes would be necessary.
A comprehensive study is currently under way in our laboratory.
UV spectra of the modified oligonucleotides 2-4 at 20 °C
(duplex) and 70 °C obtained in a solution containing 1 M NaCl
and 100 mM sodium phosphate buffer of pH ) 7 at a
concentration of 6.8 µM are shown in Figure 2a. The maximum
caused by the isoquinoline derivative shows a slight shift
depending on the temperature. The hyperchromism in the
absorption spectra at 70 °C and the bathochromical shift
indicated that the molecule attached to the oligonucleotide is
sensitive to the presence of a duplex or a random coil form.
The UV spectra indicated a change in hyperchromicity between
340 and 380 nm, the difference being maximum around 366
nm, and so melting curves were recorded at 366 nm. Melting

Fluorescent Labeling of Oligonucleotides
Bioconjugate Chem., Vol. 21, No. 9, 2010 1627
Table 3. Melting Temperatures of Modified and Unmodified Duplex
at Different λ
have duplex-stabilizing properties. Next, we studied the capacity
of fluorescence-labeled oligonucleotides to monitor cellular
uptake.
Abs. (260
nm, 70 °C)
Tm (°C)
(260 nm)
Tm (°C)
(λ)a
#
oligonucleotide
Cell Uptake Experiments. A 25mer oligonucleotide se-
quence with an amino group at the 3′-end (Table 1) was also
prepared. This sequence corresponds to an antisense oligonucle-
otide known as GEM91 (17), which is complementary to the
initiation codon of gag gene of HIV-1 RNA. Reaction of 3′-
amino GEM91 with 1a yielded the expected fluorescence-
labeled oligonucleotide (6) in excellent yields (85% conversion
judged by HPLC, 71% isolated yield). The resulting product
was used in the transfection assays without further purification.
We first performed flow cytometry experiments with the
model isoquinoline compound 1c in order to assess the potential
toxicity of the dye. HT-29 cells were incubated for 8 h with
dipole 1c and analyzed by flow cytometry. The percentage of
living or dead cells remained almost constant at all concentra-
tions of 1c and was very similar to the control value (see
Supporting Information). These results support the notion that
this compound has a low toxicity profile.
We then performed confocal microscopy experiments to
analyze the distribution of the compound 1c inside the cells.
Compound 1c was detected in the cytoplasmatic region and
formed well-defined aggregates (see Supporting Information).
The analogous methyl ester dipole 1d (8) was analyzed under
the same conditions and showed a similar distribution pattern
(see Supporting Information).
We then performed further confocal microscopy experiments
to optimize the conditions in order to evaluate the capacity of
conjugate 6 to penetrate HeLa cells in the presence (or absence)
of Lipofectamine 2000. When cells were incubated with
conjugate 6 (20 µM) for 4 h, no fluorescence was detected,
whereas the same product in the presence of Lipofectamine 2000
penetrated the cytoplasmatic region. Longer incubation times
(22 h) with conjugate 6 (20 µM) in the presence of Lipo-
fectamine 2000 induced strong cell toxicity and no living cells
were found. This result may reflect the toxicity of Lipofectamine
under these conditions.
2
3
4
5
5′CCAATGG-1a3′
5′TTCCGGAA-1a3′
5′CCAATGG-1b3′
0.59
0.48
0.61
0.63
43.2
45.9
37.2
44.2
42.9
35.4
36.8
44.8
5′
TTCCGGAA-FITC3′
a Melting experiments performed at 366 nm for 2 and 4, 364 nm for
3, and 493 nm for 5.
Table 4. Fluorescence Spectral Data for the Modified
Oligonucleotides before and after Duplex Denaturation
emission
fluorescence
temperature (°C) maximum (nm) intensity (I) FRC/FD ∆I (%)
2
3
4
5
27
53
24
51
17
39
20
60
426
429
427
430
418
423
522
520
184
371
322
560
312
418
117
96
2.02
1.74
1.34
0.82
+102
+74
+34
-18
curves were recorded simultaneously at 260 and 366 nm for
comparison purposes (Figure 3). Melting temperatures at these
two wavelengths were similar, although at 366 nm, the duplex
showed a lower Tm (see, for example, compound 2 Tm: 42.9 °C
at 366 nm and 43.2 °C at 260 nm; Table 3). This indicates that
base pair dissociation observed at the end of the oligonucleotide
(measured at 366 nm where the fluorescent tag is located)
happens at a slightly lower temperature of the global melting
of the duplex (measured at 260 nm). A similar behavior has
been described for fluorescent compounds attached in the middle
a DNA duplex (15, 16). The fluoresceine octamer 5 had a
melting temperature of the same range than octamers carrying
the isoquinoline imidazo[1,2-a]azine core with the cyclohexyl
group (1a) 2 and 3 (Table 3). Surprisingly, at 493 nm it had a
slightly higher melting temperature (Tm 44.8 °C at 493 nm, Tm
44.2 °C at 260 nm).
CONCLUSIONS
Next, we studied the effects of duplex denaturation in
fluorescence. Fluorescent spectra of self-complementary duplex
2 in 1 M NaCl and 100 mM sodium phosphate buffer pH ) 7
at a concentration of 2.3 µM at different temperatures were
recorded. Figure 2b shows the fluorescent spectra at 27 and 53
°C. Excitation was set at 345 nm. Absorption maxima of
oligonucleotides 2-4 at high and low temperatures are sum-
marized in Table 4. A strong increase in fluorescence was
observed upon duplex denaturation. These results and the slight
increase in Tm indicates that the fluorescent label interacts with
the DNA duplex most probably as an end-cap and the complex
has a lower florescence. Upon duplex denaturation, the fluo-
rescent label changes the environment duplicating the fluores-
cence emission. These effects were more intense in octamers
carrying compound 1a (oligonucleotides 2 and 3) than those
carrying compound 1b (oligonucleotide 4). This effect may be
a consequence of the conformational preference of the iso-
quinoline imidazo[1,2-a]azine core containing a cyclohexyl
substituent to stack over the terminal nucleobase described
above. The fluoresceine octamer 5 does not increase the
fluorescence upon heating, but on the contrary, a clear decrease
on the fluorescence properties is observed (Table 4).
Here, we describe the use of unexpensive reagents in the
synthesis of oligonucleotides carrying highly sensitive fluoro-
phores. The acid fluoride derivative of the fluorophore required
for the preparation of the fluorescent-labeled oligonucleotides
was synthesized in high yield in a one-pot reaction using an
efficient MCR which has been described previously (8). The
acyl fluorides reacted efficiently in aqueous buffers at pH 9 with
amino-oligonucleotides to yield the desired conjugates. The
resulting oligonucleotides show intense fluorescent properties
in presence of ions, have slightly improved hybridization
properties, and are sensitive to denaturation. Flow cytometry
and confocal microscopy experiments showed a low toxicity
profile and good cell membrane permeability, respectively, for
dyes 1c and 1d. Oligonucleotide 6 had the capacity to penetrate
cells in the presence of Lipofectamine 2000 transfection reagent.
ACKNOWLEDGMENT
This study was supported by the “Direccio´n General de
Investigacio´n Cient´ıfica y Te´cnica” (grant BFU2007-63287,
CTQ2010-20541 and CTQ2009-07758), and the Generalitat de
Catalunya (2009/SGR/208). N. K. thanks the DGICYT for Ph.D.
fellowship.
In summary, dipolar isoquinoline derivatives 1a-b readily
prepared by MCR are efficient and inexpensive reagents for
introducing of fluorescent labels into synthetic oligonucleotides.
Reagent 1a is particularly useful as it produces fluorescence-
labeled oligonucleotides that are sensitive to hybridization and
Supporting Information Available: Structure of the most
energetically stable conformations of 1a and 1b conjugates by
molecular mechanics (MM) conformational searches and ge-
ometry optimization. Flow cytometry experiments with dipolar

1628 Bioconjugate Chem., Vol. 21, No. 9, 2010
Pe´rez-Rentero et al.
(10) Carpino, L. A., Beyermann, M., Wenschuh, H., and Bienert,
M. (1996) Peptide synthesis via amino acid halides. Acc. Chem.
Res. 29, 268–274.
amide 1c. Confocal microscopy images from cell uptake
experiments. Mass spectrometry, HPLC analysis, and melting
curves of purified oligonucleotides. This material is available
free of charge via the Internet at http://pubs.acs.org.
(11) Nelson, P. S., Kent, M., and Muthini, S. (1992) Oligonucle-
otide labeling methods. 3. Direct labeling of oligonucleotides
employing a novel, non-nucleosidic, 2-aminobutyl-1,3-pro-
panediol backbone. Nucleic Acids Res. 20, 6253–6259.
LITERATURE CITED
(1) Mayer, A., and Neuenhofer, S. (1994) Luminescent labels -
more than just an alternative to radioisotopes? Angew. Chem.,
Int. Ed. 33, 1044–1072.
(12) Mergny, J. L., and Lacroix, L. (2003) Analysis of thermal
melting curves. Oligonucleotides 13, 515–537.
(2) Gait, M. J. (1991) DNA/RNA synthesis and labeling. Curr.
Opin. Biotechnol. 2, 61–68.
(3) Wang, K., Tang, Z., Yang, C. J., Kim, Y., Fang, X., Li, W.,
Wu, Y., Medley, C. D., Cao, Z., Li, J., Colon, P., Lin, H., and
Tan, W. (2009) Molecular engineering of DNA: Molecular
Beacons. Angew. Chem., Int. Ed. 48, 856–870.
(4) Schubert, F., Cech, D., Reinhardt, R., and Wiesner, P. (1992)
Fluorescent labelling of sequencing primers for automated
oligonucleotide synthesis. DNA Seq. 2, 273–279.
(5) Lilley, D. W., and Wilson, T. J. (2000) Fluorescence resonance
energy transfer as a structural tool for nucleic acids. Curr. Opin.
Mol. Biol. 4, 507–517.
(6) Cuppoletti, A., Cho, Y., Park, J. S., Stra¨ssler, C., and Kool,
E. T. (2005) Oligomeric fluorescent labels for DNA. Bioconju-
gate Chem. 16, 528–534.
(7) Singh, S., and Singh, R. K. (2007) Synthesis and fluorescence
studies of some new fluorophores and their effect on hybridiza-
tion of oligodeoxyribonucleotides. J. Fluoresc. 17, 139–148.
(8) Are´valo, M. J., Kielland, N., Masdeu, C., Miguel, M., Isambert,
N., and Lavilla, R. (2009) Multicomponent access to function-
alized mesoionic structures based on TFAA activation of
isocyanides: Novel domino reactions. Eur. J. Org. Chem. 617–
625.
(13) Connolly, B. A. (1987) The synthesis of oligonucleotides
containing a primary amino group at the 5′-terminus. Nucleic
Acids Res. 15, 3131–3139.
(14) Davies, M. J., Shah, A., and Bruce, I. J. (2000) Synthesis of
fluorescently labelled oligonucleotides and nucleic acids. Chem.
Soc. ReV. 29, 97–107.
(15) Eritja, R., Kaplan, B. E., Mhaskar, D., Sowers, L. C., Petruska,
J., and Goodman, M. F. (1986) Synthesis and properties of
defined DNA oligomers containing base mispairs involving
2-aminopurine. Nucleic Acids Res. 14, 5869–5884.
(16) Ramzaeva, N., Rosemeyer, H., Leonard, P., Mu¨hlegger, K.,
Bergmann, F., von der Eltz, H., and Seela, F. (2000) Oligo-
nucleotides functionalized by fluoresceine and rhodamine dyes:
Michael addition of methyl acrylate to 2′-deoxypseudouridine.
HelV. Chim. Acta 83, 1108–1126.
(17) Lisziewicz, J., Sun, D., Weichold, F. F., Thierry, A. R., Lusso,
P., Tang, J., Gallo, R. C., and Agrawal, S. (1994) Antisense
oligodeoxynucleotide phosphorothioate complementary to gag
mRNA blocks replication of human immunodeficiency virus type
1 in human peripheral blood cells. Proc. Natl. Acad. Sci. U.S.A.
91, 7942–7946.
(9) Zhu, J., and Bienayme´, H. (2005) in Multicomponent Reactions,
Wiley-VCH, Weinheim.
BC1000966