Full text of DOI:10.1111/j.1744-7348.2001.tb00113.x

Ann. appl. Biol. (2001), 138:281-292
Printed in Great Britain
281
Minor modifications to the cry1Ac9 nucleotide sequence are sufficient to
generate transgenic plants resistant to Phthorimaea operculella
By L L BEUNING*, D S MITRA, N P MARKWICK and A P GLEAVE
The Horticulture and Food Research Institute of New Zealand Ltd, Mt Albert Research Centre, Private
Bag 92-169, Auckland, New Zealand
(Accepted 15 February 2001; Received 7 September 2000)
Summary
Minor modifications were made sequentially to the nucleotide sequence of truncated cry1Ac9 to
produce cry1Ac9A (one nucleotide change) and then cry1Ac9B (seven nucleotide changes). The
derivative genes under the control of the CaMV 35S promoter were transformed into Nicotiana tabacum
in order to determine whether these modified genes conferred resistance on the resulting transgenic
tobacco plants to larvae of the potato tuber moth (Phthorimaea operculella). Over two trials with
PTM larvae on the transgenic plants expressing the cry1Ac9B gene, lower larval growth, development
and survival was evident for most of the lines compared to the control plants. In the second trial, for
four of these lines (7, 25, 26 and 28) larval growth rates were very low (0.28, 0.3, 0.42 and 0.28,
respectively) compared to the control growth rate (4.18) and leaf damage was minimal. Northern
analysis and RT-PCR analysis showed that higher levels of cry1Ac9 mRNA were present in the
transgenic tobacco lines containing cry1Ac9B than in the tobacco lines containing cry1Ac9A. These
results suggest that certain minor modifications to the nucleotide sequence of cry1Ac9 are sufficient
to improve the stability of its mRNA when expressed in tobacco and that this increase in steady state
mRNA is sufficient to confer significant resistance to PTM larvae.
Key words: Bacillus thuringiensis, cry1Ac9, sequence modification, transgenic tobacco, potato tuber
moth
Introduction
elements, mRNA processing signals and rare codons
in order to sufficiently stabilise the cry mRNA
transcripts and improve translation in plants. These
modifications are necessary so that adequate levels
of the Cry proteins are produced to give effective
and prolonged protection from insect pests (Perlak
et al., 1991). This approach has enabled the
commercial development of transgenic crops
expressing cry genes (James, 2000).
Bacillus thuringiensis (Bt) is a commonly
occurring soil bacterium, characterised by the
production of proteinaceous crystals during
sporulation (reviewed byAndrews et al., 1987). The
crystals are composed of 1-5 proteins (Cry proteins)
that have highly potent and specific insecticidal
activity.
Bt formulations have been in use for many years
as an effective alternative to synthetic insecticides
for the control of various insect pests. However,
more recently, the focus on the Cry proteins has been
on the production of transgenic plants expressing
cry genes (Fischhoff et al., 1987; Vaeck et al., 1987;
Barton, Whiteley & Yang, 1987; reviewed by
Peferoen, 1997; Schuler, Poppy, Kerry & Denholm,
1998; de Maagd, Bosch & Stiekema, 1999). Such
an approach is regarded as an additional tool for the
control of crop pests and can lead to a reduction in
the use of broad-spectrum insecticidal sprays.
Native cry genes, however, are very poorly
expressed in transgenic plants and, consequently,
such plants show minimal resistance to insect pests
(Delannay et al., 1989). Nucleotide sequence
modifications are needed to remove destabilising
Potato tuber moth (PTM, Phthorimaea operculella
Zeller) is a major insect pest of members of the
Solanaceae in warm-temperate and tropical regions.
Preferred hosts are potato and tobacco (Varela &
Bernays, 1988; Fenemore, 1988). In the potato,
PTM larvae damage both the leaves and the tubers.
In the case of the potato leaf, the larvae feed on the
mesophyll, forming transparent blisters in the leaves.
Sometimes the larvae burrow into the petiole and
continue into the stem. With the potato tuber, larvae
usually enter through the “eyes” from eggs laid
nearby and make slender tunnels throughout the
tuber. High levels of tuber infestation occur in the
field during summer and stored tubers can suffer
severe damage all year round (Foot, 1984; Varela &
Bernays, 1988). As part of a programme to improve
the potato’s resistance to PTM infestation, this
*Corresponding Author E-mail: lbeuning@hortresearch.co.nz
© 2001 Association of Applied Biologists

282
L L BEUNING, D S MITRA, N P MARKWICK & A P GLEAVE
research tests the susceptibility of PTM larvae to
transgenic tobacco expressing cry1Ac9. This work
contributes to a collaborative research effort to
produce transgenic potatoes expressing one or more
cry genes (Gleave, Hedges, Broadwell & Wigley,
1998).
U89872) at nucleotides 388-409 and 2218-2234,
respectively (Fig. 1). This truncated version of the
cry1Ac9 gene is herein referred to as cry1Ac9A.
Primer 13051/1 introduces a NcoI site around the
translation initiation codon (ATG) and a translation
initiation consensus sequence immediately 5' of this
codon (Lütcke et al., 1987). Utilising the KpnI site
(underlined) in primer 13051/1 and the HindIII site
(underlined) in primer 13051/2, the 1.9-kb PCR
product was cloned into pART7 (Gleave, 1992)
placing cry1Ac9A under the transcriptional control
of the 35S promoter and generating pART7732. The
35S-cry1Ac9A-ocs 3' cartridge was then cloned as a
3.9-kb NotI fragment into the binary vector pART27
(Gleave, 1992), generating pART27cry1Ac9A (Fig.
2).
Previously we isolated a gene encoding a 133kDa
insecticidal crystal protein from Bacillus
thuringiensis var. kurstaki isolate DSIR 732 (Gleave,
Hedges, Broadwell & Wigley, 1992). Sequence
comparisons between this gene and the sequences
of other cry genes revealed that the gene was a
member of the cry1Ac class of cry genes. This class
consists of cry genes that are active against
lepidopteran larvae (Whiteley & Schnepf, 1986).
Cry proteins are classified according to their
molecular weight and insecticidal spectrum (Höfte
& Whiteley, 1989), but more recently have been
reclassified based on amino acid homology
(Crickmore et al., 1998). The cry1Ac gene (now
reclassified as cry1Ac9) was expressed in
Escherichia coli and extracts were obtained and
shown to be insecticidally active against larvae of
the lepidopteran potato tuber moth (Phthorimaea
operculella, Zeller) (Gleave et al., 1992).
The insecticidal activity of the Cry1Ac protein is
located within the N-terminal 611 amino acids.
Fischhoff et al. (1987) and Vaeck et al. (1987)
showed that a truncation of the cry gene encoding 5'
amino acids improved insecticidal activity in
comparison to the entire coding sequence when
expressed transgenically. Perlak et al. (1991) then
demonstrated that modifications to the coding
sequence of cry1Ab and cry1Ac resulted in the
enhanced expression of insecticidally active protein.
However, they found that not all the nucleotide
changes resulted in an increase in expression of the
corresponding Cry protein and that changes in one
specific region (designated oligonucleotide B) were
responsible for a significant increase in expression.
We report here on the modification of a truncated
version of the cry1Ac9 nucleotide sequence that
incorporates the changes of oligonucleotide B, the
introduction of the modified gene into tobacco and
the subsequent analysis of the expression and
insecticidal activity of the modified cry1Ac9
transgene.
To further modify cry1Ac9 to produce cry1Ac9B,
PCR amplification was used to introduce nucleotide
changes into the 5' end of cry1Ac9A. Primer 13051/
3 (5'-GCCGTCTAGAAATGGCTTGATTCCTAGC
GAACTCTTCGATTCTCTGGTTGATGAGCTGTT
CAATTTGTAC-3') was designed to anneal to the
cry1Ac9A sequence at nucleotides 684-619 and
introduce seven nucleotide changes into the coding
sequence at positions 634 (T-C), 636 (A-C), 639 (T-
C), 646 (A-G), 651 (A-C), 657 (A-G) and 668 (C-
T). These changes remove six potential
polyadenylation signals (AATTAA, AACCAA,
AAGAAT, AATAGA, AAGAA and AACCA),
while not altering the amino acid sequence of the
Cry1Ac9 protein. PCR amplification was carried
out on pART7732 using primers 13051/1 and 13051/
3 (Fig. 1). Utilising the XbaI site (underlined) in
primer 13051/3, the 0.3-kb PCR product was cloned
as a KpnI-XbaI fragment into pSP72 (Promega) and
the nucleotide sequence was determined to ensure
all the intended changes had been incorporated. The
1.6-kb XbaI-HindIII fragment from pART7732,
encoding the 3' end of the cry1Ac9A gene, was then
cloned downstream of the 0.3-kb PCR product,
generating pSPcry1Ac9B. The 1.9-kb cry1Ac9B gene
was cloned as a KpnI-HindIII fragment into pART7
placing cry1Ac9B under the transcriptional control
of the 35S promoter and the expression cartridge
was then cloned as a 3.9-kb NotI fragment into the
binary vector pART27 (Gleave, 1992), generating
pART27cry1Ac9B (Fig. 2).
Materials and Methods
Tobacco transformation
The two binary derivatives, pART27cry1Ac9A and
pART27cry1Ac9B, were electroporated into
Agrobacterium tumefaciens strain LBA4404.
Tobacco (Nicotiana tabacum cv. Samsun) leaf discs
were cocultivated with Agrobacterium tumefaciens
containing either pART27cry1Ac9A or
pART27cry1Ac9B and placed on regeneration
medium (MS salts, plus vitamins and sucrose, 1.0
mg litre-1 BA and 0.1 mg litre-1 NAA, 100 mg ml-1
Modification of cry1Ac9
The region of the cry1Ac9 gene encoding the N-
terminal 615 amino acids was PCR-amplified from
pPOM4 (Gleave et al., 1992) using primers 13051/
1 (5'-GCCGGGTACCAACCATGGCTAACAATC
CGAACATCA-3') and 13051/2 (5'-GCCGAAGCT
TATTATTCAGCCTCGAGTGT-3') that anneal to
the cry1Ac9 sequence (Genbank Accession No.

cry1Ac9 modifications give tobacco PTM resistance
283
Nucleotide changes A
.GTACC.ACC....C.........
GAGGTAACTTATGGATAACAATCC
3’
5’
- - - - - - - - - - -
nucleotide 2234
- - - - - - - - - - -
cry1Ac9
nucleotide 388
13051/1
13051/2
Nucleotide changes B
...C.C..C.....G.....C.....G...........T...............
CAGTTAATTAACCAAAGAATAGAAGAATTCGCTAGGAACCAAGCCATTTCTAGA
A
5’
nucleotide 388
3’
cry1Ac9A
nucleotide 2234
13051/1
13051/3
5’
nucleotide 388
3’
cry1Ac9B
nucleotide 2234
A
B
Fig. 1. PCR strategy for modifying the nucleotide sequence of cry1Ac9. PCR primers 13051/1 and 13051/3 were
used to introduce Nucleotide changes A and Nucleotide changes B, respectively, into a truncated version of cry1Ac9,
as described in Materials and Methods. Construct cry1Ac9A was obtained by modifying cry1Ac9 and construct
cry1Ac9B was obtained by modifying cry1Ac9A. Ü = ATG initiation codon. Underlined sequences = potential
polyadenylation (AATAAA-like) signals.
or
= the direction of PCR amplification. Unchanged
nucleotides are indicated by a “.”.
RI RI
RI
N
N
cry1Ac9A
L-border
ocs 3’ pnos-nptII-nos3’
R-border 35S promoter
1.35
0.3
0.7
N
RI
RI
N
cry1Ac9B
L-border
ocs 3’ pnos-nptII-nos3’
R-border
35S promoter
1.35
1.0
35S probe
cry1Ac9 3’probe
cry1Ac9 probe
Fig. 2. The T-DNA organisational structure of the cry1Ac9A and cry1Ac9B constructs is shown. The blocks labelled
35S probe and cry1Ac9 probe indicate the size and location of the DNA sequences used for Southern hybridisation.
The block labelled cry1Ac9 3' probe indicates the sequences used for northern hybridisation and for RT-PCR analysis.
N, NotI; RI, EcoRI: 35S, cauliflower mosaic virus 35S promoter; ocs 3’, octopine synthase transcriptional terminator;
R-border, right border of T-DNA; L-border, left border of T-DNA; pnos-nptII-nos3’, nopaline synthase promoter-
neomycin phosphotransferase II-nopaline synthase transcriptional terminator.

284
L L BEUNING, D S MITRA, N P MARKWICK & A P GLEAVE
Cefotaxime) for 2 days. The leaf discs were placed
on regeneration medium containing 100 mg litre-1
kanamycin for 3-4 wk. Transformed shoots were
then transferred to regeneration medium containing
100 mg litre-1 kanamycin. Twenty-four independent
transgenic tobacco lines containing cry1Ac9A and
27 independent transgenic tobacco lines containing
cry1Ac9B were obtained. Each independent line was
multiplied by subculturing on to maintenance
medium (MS salts, plus vitamins and sucrose, 100
mg ml-1 Cefotaxime) containing 100 mg litre-1
kanamycin to obtain sufficient plants for analysis.
Resulting plantlets were potted in pumice mix and
transferred to the glasshouse.
from each line being tested in each replicate.
Statistical analyses
Survival and pupation data involving percentages
were first transformed using arcsin (Öx) and then
compared by analysis of variance, followed by two-
sample tests (MinitabÒ for Windows Release 12.1,
1998). Growth rates were calculated for individual
larvae, using the formula: Growth rate = loge (final
weight/initial weight). The initial weights used were
the mean for five larvae. The weight of individual
neonate larvae does not register on a 5-place balance.
Mean growth rates for each plant line in the whole
plant bioassay trials were then calculated and
compared by one-way ANOVA, followed by two-
sample tests (MinitabÒ for Windows Release 12.1,
1998) to detail differences between lines.
Insect bioassays
Excised leaf bioassays
Detached leaf pieces from transgenic tobacco lines
containing cry1Ac9A or cry1Ac9B or from control
transgenic tobacco lines containing pART27gus
were infested with neonate PTM larvae in an insect
feeding trial. Each leaf piece (approximately 3 cm
square) was infested with five neonate larvae
(hatched within the previous 24-h period) and then
placed into a 75 ml specimen container. Leaf pieces
were replaced every 2-3 days for a period of 14 days.
For each plant line, two leaf pieces infested with
PTM were set up (as above) on two occasions, so
that in total, 20 larvae were tested against each line.
The feeding trials were conducted under a 16:8 hour
light:dark cycle at 25oC ± 2oC. Larval survival was
recorded at 2, 7 and 14 days and pupation at 14 days.
Larvae were not weighed in this preliminary
bioassay.
Southern analysis
Genomic DNA was extracted from tobacco leaves
using a CTAB method (Doyle & Doyle, 1990). The
genomic DNA (10 mg) was digested with EcoRI,
electrophoresed through 0.7% agarose (BRL) and
transferred to Hybond N+ (Amersham) nylon
membrane in 0.4M NaOH. Prehybridisation at 65°C
(5 h) in 10 ml 0.5 M Na phosphate, pH 7.2, 0.7 g
SDS, 0.001 M EDTA, 200 mg denatured salmon
sperm DNA was followed by hybridisation at 65°C
(16 h) with two denatured radioactive DNA probes.
One DNA probe consisted of an EcoRI fragment
encoding the first 1000 bp of truncated cry1Ac9 (Fig.
2, cry1Ac9 probe) to verify the presence of the cry
gene. The other probe consisted of a NotI/XhoI
fragment encoding the 1.35 kb 35S promoter (Fig.
2, 35S probe) to determine the copy number of T-
DNA inserts. Both probes were labelled with [a-
32P]dCTP using Megaprime (Amersham). Following
hybridisation membranes were washed in 50 ml 0.3
M NaCl, 30 mM sodium citrate at room temperature
for 10 min twice. They were then washed in 50 ml
0.15 M NaCl, 15 mM sodium citrate, 50 mg SDS at
65°C for 15 min and finally in 50 ml 15 mM NaCl,
1.5 mM sodium citrate, 50 mg SDS at 65°C for 15
min. The membranes were then exposed to X-ray
film (Agfa).
Whole plant bioassays
The transgenic tobacco lines containing either
cry1Ac9A or cry1Ac9B that ranged from the most to
the least effective in the “Excised Leaf Bioassays”
were chosen for whole plant insect feeding trials.
Ten lines each of the transgenic plants and five
control plants were infested with neonate PTM
larvae as follows. Five larvae were weighed and
placed on a small (2.5 cm diameter) glass microfibre
filter disc that was then placed on a leaf of each
plant. Larvae were observed until they had moved
off the filter disc and were replaced if unable to make
the transition to the leaf.
The infested plants were placed individually in
large vented cylindrical clear acetate containers (20
cm diameter ´ 30 cm). After 9 days damaged leaves
were removed and photographed. Live larvae were
then removed from the leaves and weighed. The
larvae lose weight as they begin to lay down fatty
tissue in preparation for pupation. Therefore, only
the period of exponential growth (9 days) was used
for the calculation of growth rate (see below). The
trial was replicated with one different clonal plant
Northern analysis
Total RNAwas extracted from tobacco leaves with
Trizol Reagent (Gibco BRL), following the
manufacturer’s procedures. RNA (20 mg) was
electrophoresed through a 1% agarose-formaldehyde
gel (GibcoBRL) and transferred to Hybond N+
(Amersham) nylon membrane in 0.05 M NaOH.
Membranes were neutralised in 1.0 M NaCl, 0.5 M
Tris-HCl, pH 7.0. Prehybridisation at 65°C (2 h) in
20 ml 0.1 M NaCl, 0.2 g SDS, 2 g dextran sulphate,
500 mg salmon sperm DNA was followed by
hybridisation at 65°C (16 h) with a denatured

cry1Ac9 modifications give tobacco PTM resistance
285
radioactive DNA probe. The DNA probe was a 270
bp PCR fragment homologous to the 3' end of
truncated cry1Ac9 (Fig. 2, cry1Ac9 3' probe) that
was amplified with the primers 1Aca (5'
GATATCGAGTTCGTGTACGG 3') and 1Acb (5'
TTCAGCCTCGAGTGTTGCAG 3') and labelled
with [a-32P]dCTP using the RTS Radprime DNA
Labeling System (Gibco BRL). Hybridisation of a
[a32P]dCTP-labelled BamHI/EcoRI restriction
fragment encoding Arabidopsis thaliana actin
(Nairn, Winesett & Ferl, 1988) was used to check
RNA loadings and efficiency of transfer. Following
hybridisation membranes were washed in 50 ml 0.3
M NaCl, 30 mM sodium citrate at room temperature
for 5 min twice. They were then washed in 50 ml
0.3 M NaCl, 30 mM sodium citrate, 0.5 g SDS at
65°C for 30 min twice and finally in 50 ml 15 mM
NaCl, 1.5 mM sodium citrate at room temperature
for 30 min. Hybridisation signals were visualised
by exposure to X-ray film (X-Omat, Kodak) or by
scanning on a Storm 840 phospho-imaging system
(Molecular Dynamics) and analysed using
ImageQuant software.
of the PTM larvae after 14 days (Table 1) was almost
identical on both the control plants and the tobacco
lines containing cry1Ac9A. Construct cry1Ac9A had
only nucleotide changes that improved initiation of
translation (Lütcke et al., 1987). However, by
comparison larval survival appeared to be reduced
(10%) on the tobacco lines containing cry1Ac9B (F
= 2.96, P = 0.06, df = 2, 26). The effect of the plant
line on larval survival was significant among the
tobacco plants containing cry1Ac9B (F = 2.29, P =
0.002, df = 26, 81), but not among tobacco lines
containing cry1Ac9A (F = 0.65, P = 0.866, df = 21,
66) or among control lines (F = 1.17, P = 0.323, df
= 15, 48). Larvae that survived on the plants
containing cry1Ac9B ranged from two tiny
individuals from all replicates of line 25 to many
large healthy larvae on all replicates of lines 4, 11
and 24. In contrast, survivors on the tobacco lines
containing cry1Ac9A and on the control plants were
observed to be more uniform in size and
development. Photographs of larvae taken from
some of the tobacco lines containing cry1Ac9B
clearly show their small size compared to larvae
found on the control plants (Fig. 4A), indicating the
extent to which some of the lines containing this
construct reduced larval growth.
With larval pupation, there was a major effect due
to the presence of cry1Ac9B in the transgenic tobacco
(F = 52.38, P < 0.001, df = 2, 64). Only 1.2% of the
survivors on the transgenic tobacco lines containing
this construct had pupated by day 14 (Table 1) and
these were all found on only one of the tobacco lines
(line 24). This line was subsequently found not to
contain the cry1Ac9B gene (see later). In
comparison, 17% of the larvae on the transgenic
tobacco lines containing cry1Ac9A and 29.3% of the
larvae on the control tobacco plants had pupated,
and many large larvae on both sets of plants were
about to pupate. These percentages were also
significantly different (t = 2.54, P = 0.016, df = 32).
RT-PCR analysis
Total RNA extracted from tobacco leaves was
treated with DNase I (Gibco BRL), according to the
manufacturer’s directions. RT-PCR was performed
on the DNase I-digested RNA (1 mg) using the
Titanä One Tube RT-PCR System (Boehringer
Mannheim). The PCR primers used, 1Aca and 1Acb,
were those used for northern analysis, amplifying a
270 bp DNA fragment homologous to the 3' end of
truncated cry1Ac9. The resulting PCR products
were electro-phoresed through an agarose gel (1 g
100 ml-1), ethidium bromide-stained and
photographed on an ultra-violet transilluminator
(UVP). For Southern analysis, the PCR products
were then transferred to Hybond N+ (Amersham)
nylon membrane in 0.4 M NaOH. Prehybridisation,
hybridisation with the [a-32P]dCTP-labelled 270 bp
PCR fragment and visualisation of hybridisation
signals were as for northern analysis.
As a check on the amount of RNA used for RT-
PCR amplification, for each sample an equal amount
of RNA was electrophoresed through a 1 g 100 ml-1
agarose-formaldehyde gel, transferred to Hybond N+
(Amersham) nylon membrane in 0.4 M NaOH and
hybridised with [a-32P]dCTP-labelled crab apple 18S
rRNA (Simon &Weeden, 1992). Prehybridisation,
hybridisation and visualisation of hybridisation
signals were as for northern analysis.
Whole plant bioassays
For larvae on the control tobacco plants there were
no significant differences in growth rates between
Table 1. Survival and pupation (mean and standard
error) of potato tuber moth larvae after feeding for
14 days on control tobacco plants or on transgenic
tobacco leaves transformed with either cry1Ac9A or
cry1Ac9B
cry1Ac9
construct No. plant lines
% larval
survival
% larvae
pupated
Results
74.7 (± 2.5)a 29.3 (± 4.4)x
Controls
cry1Ac9A
cry1Ac9B
16
24
27
74.2 (± 2.1)a 17.0 (± 2.7)y
Excised leaf bioassays
In preliminary insect-feeding trials on leaf pieces
excised from the transgenic tobacco plants, survival
64.6 (± 3.8)b
1.2 (± 1.2)z
a,b
y,z
Data arcsinÖx transformed.
{Minitab, two sample t-test}
x,y P < 0.05 ,x,z
P < 0.001

286
L L BEUNING, D S MITRA, N P MARKWICK & A P GLEAVE
individual plants or between replicates and so these
were combined to give a mean larval growth rate
for all control plants. In the case of the cry1Ac9A
and cry1Ac9B -transformed tobacco plants, larval
growth rates within lines showed no significant
differences between replicates (except cry1Ac9B
lines 7, 26 and 28 where there were no survivors in
one replicate), and so replicates were combined (Fig.
3A and B).
the combined larval growth rate for the control plants
(F = 1.38, P = 0.195, df = 10, 131). However, mean
larval growth rates on the cry1Ac9B-containing lines
were significantly lower than those for both the
control plants and the cry1Ac9A-containing lines (F
= 14.96, P < 0.001, df = 20, 197). Within this overall
picture, though, larvae on individual tobacco lines
containing cry1Ac9B showed significant variation
in growth rates (F = 5.49, P < 0.001, df = 8, 57)
(Fig. 3A). Furthermore, tobacco lines inducing the
lowest larval growth rates also showed the lowest
Mean growth rates for larvae on the cry1Ac9A-
containing lines were not significantly different from
A
6
5
4
3
2
1
0
25 27 20 22 14 13 21 6 17 8
24 14 15 3 10 29 26 25 28 7
cry1Ac9B plant lines
cry1Ac9A plant lines
control
B
10
8
6
4
2
0
4 10 8 12 7
controls
21 25 27 6 13 17 22 14 20 8
cry1Ac9A plant lines
24 3 15 10 14 29 25 7 26 28
cry1Ac9B plant lines
Fig. 3. Growth rate and survival of potato tuber moth larvae on transgenic tobacco plants containing cry1Ac9A and
cry1Ac9B.

cry1Ac9 modifications give tobacco PTM resistance
287
A
Control
cry1Ac9B
B
cry1Ac9A
cry1Ac9B
C
D
E
Control
cry1Ac9A
cry1Ac9B
Fig. 4. PTM larval feeding trials on transgenic tobacco plants containing cry1Ac9A and cry1Ac9B. A. PTM larval size
after feeding on control tobacco plants (left) and on transgenic tobacco plants containing cry1Ac9B (right) for 9 days.
Scale: 1 division = 1 mm. B. Extent of damage to whole transgenic tobacco plants containing cry1Ac9A (left) and
cry1Ac9B (right) after infestation with PTM larvae. C.-E. Extent of damage to transgenic tobacco leaves from the
whole plant bioassays after infestation with 5 PTM larvae. C. Control (left), D. cry1Ac9A (centre) and E. cry1Ac9B
(right).

288
L L BEUNING, D S MITRA, N P MARKWICK & A P GLEAVE
larval survival (Fig. 3B). Four of the cry1Ac9B-
containing lines (7, 25, 26 and 28) showed only 10-
30% larval survival over the 14-day trial, while five
lines (3, 10, 14, 15 and 29) showed 50-80% larval
survival. One line (24) showed no mortality or
growth rate reduction. However, subsequent
Southern analysis indicated that this line did not
contain the cry1Ac9B gene.
After 9 days of infestation with PTM larvae the
amount of leaf damage varied considerably between
plants (Fig. 4B). Transgenic tobacco lines containing
cry1Ac9B had minimal leaf damage consisting of
small thread-like mines where larvae had started and
abandoned feeding sites (Fig. 4E). In contrast, both
control tobacco plants and transgenic tobacco lines
containing cry1Ac9A exhibited extensive leaf and
stem damage caused by larvae that generally stayed
within and expanded their first mine to form a large
window or blister in the leaf (Fig. 4C and D).
The extent of damage to the tobacco lines
correlated with both larval growth rate and survival.
For example, on transgenic tobacco line 28,
transformed with cry1Ac9B, where only one larva
survived (Fig 3B), its growth rate was the lowest
recorded at 0.279 (Fig 3A) and the leaf damage
sustained consisted of only tiny thread-like mines
(Fig. 4E).
Molecular analysis
The presence and copy number of the cry1Ac9
transgene in the transgenic tobacco lines were
determined by Southern analysis. With one
exception, all transgenic tobacco lines transformed
with cry1Ac9B had a 1 kb hybridisation band that
verified the presence of cry1Ac9B (Fig. 5). The
exception was line 24 in which no hybridisation band
was detected, suggesting that this line did not contain
cry1Ac9B. In the case of the tobacco lines
transformed with cry1Ac9A, because of the presence
of an additional EcoRI site within the 1kb EcoR1
fragment of this construct (Fig. 2), all these lines
had two hybridisation bands, 0.7kb and 0.3kb (Fig.
5). The 1.35kb 35S fragment that was included in
the same hybridisation showed that for each tobacco
line the number of copies of the transgene ranged
from one to seven (Fig. 5).
The expression of the cry1Ac9 transgene in five
of the transgenic tobacco plants was examined by
northern analysis (Fig. 6A). For the two tobacco
lines transformed with cry1Ac9A (21 and 22) there
was no detectable cry mRNA present. However,
for the tobacco lines transformed with cry1Ac9B (25,
cry1Ac9A
cry1Ac9B
MW
12.0
6
8
13 14 17 20 21 22 25
3
7 10 14 15 24 25 26 28 29
3.0
1.6
1.0
0.5
Fig. 5. Southern analysis of the transgenic tobacco lines containing cry1Ac9A and cry1Ac9B. Probes used for
hybridisation were a 1.35 kb DNA fragment corresponding to the 35S promoter sequence and a 1.0 kb DNA fragment
corresponding to the 5’ end of the cry1Ac9B sequence. Genomic DNA extracted from each transgenic tobacco line
was digested with EcoRI. For the cry1Ac9B-containing plants the transgene is visualised as a 1.0 kb band, however,
because of an internal EcoRI site in cry1Ac9A the transgene is visualised as two bands (0.7 kb and 0.3 kb) in the
cry1Ac9A-containing plants. Numbers above the lanes refer to the plant lines analysed. MW, molecular weight
markers (kb).

cry1Ac9 modifications give tobacco PTM resistance
289
A
A A
B
Control
Control
cryAc9
cryAc9B
cry1Ac9
cry1Ac9
ccrryy11AAcc99
Actin
Actin
Control
Control
21
21
22
22
25
25
26
26
28
28
B
ethidium bromide stained
ethidium bromide stained
cry1Ac9
cry1Ac9
primers
primers
32P probed
32
P probed
ccrryy11AAc9c9
Control
Control
21
21
22
22
25
25
26
26
28
28
Fig. 6. Northern and RT-PCR analysis of the transgenic tobacco lines containing cry1Ac9A and cry1Ac9B. A. Northern
analysis using as a probe a 270bp PCR fragment homologous to the 3’ end of truncated cry1Ac9. For each plant line,
the level of cry1Ac9 mRNA was adjusted for loading differences by hybridisation with an actin fragment from which
a histogram of cry1Ac9 mRNA levels was plotted. B. RT-PCR analysis using primers that amplified a 270 bp
fragment at the 3’ end of truncated cry1Ac9. The ethidium bromide-stained gel was then analysed by a Southern
using the 270 bp PCR fragment as a probe. Numbers along the bottom of A. and B. refer to the plant lines. Control,
control tobacco plant.

290
L L BEUNING, D S MITRA, N P MARKWICK & A P GLEAVE
26 and 28) a faint band corresponding to full-length
mRNA was detectable. These three cry1Ac9B lines
also showed good resistance to PTM infestation in
the bioassays, unlike the two cry1Ac9A lines (see
Fig. 3).
observed. These were more obvious between plant
lines containing cry1Ac9B but some variation did
occur between plant lines containing cry1Ac9A. For
example (Fig. 3A), one line containing cry1Ac9A
(line 8) had the same mean larval growth rate as the
least effective line containing cry1Ac9B (line 14).
This supports the suggestion above that, in some
lines, plants containing cry1Ac9A may have
expressed the gene at a very low level sufficient to
slow larval development. Plant line effects on larval
survival were also observed. On plants containing
cry1Ac9B larval survival ranged from eight down to
only one survivor in two lines (26 and 28). These
two lines together with lines 7 and 25 also had the
lowest growth rates.
Northern analysis revealed that a faint band of
cry1Ac mRNA was detectable in the transgenic
tobacco lines containing cry1Ac9B, but was not
detectable in either the control lines or the lines
containing cry1Ac9A. However, because of the low
level of cry1Ac9 mRNA detected, transcriptional
expression of the gene in the transgenic tobacco lines
was confirmed by RT-PCR analysis. When
visualised by agarose gel electrophoresis and
ethidium bromide staining, an amplified fragment
of the expected size was observed in only those lines
containing cry1Ac9B. Southern analysis of the gel
confirmed this result, but also showed that a very
low level of amplification had occurred in the lines
containing the cry1Ac9A gene. This latter result
supports the earlier suggestion from the preliminary
insect-feeding trials that a very low level of stable
expression of the mRNA for cry1Ac9A may be
sufficient to slightly slow the developmental time
of the PTM larvae.
Because of the low levels of cry mRNA detected
by northern analysis, these results were confirmed
by RT-PCR (Fig. 6B). When visualised by
electrophoresis and ethidium bromide staining, only
the transgenic tobacco lines containing cry1Ac9B
(25, 26 and 28) contained a DNA fragment of the
predicted size (270 bp). However, Southern analysis
of the PCR products showed that amplification of
the 270 bp fragment had occurred in all five
cry1Ac9-transformed tobacco lines but was present
at much higher levels in cry1Ac9B lines 25, 26 and
28. This result suggests that there were higher levels
of stable cry1Ac9 mRNA in the transgenic tobacco
lines containing the cry1Ac9B than the transgenic
tobacco lines containing cry1Ac9A. No band of
hybridisation was visible in the control tobacco line.
Discussion
Minor modifications were made to the nucleotide
sequence of cry1Ac9 to produce cry1Ac9B. Before
introducing these modifications, several nucleotide
changes were made to improve the context of the
cry1Ac9 translation initiation codon, generating
cry1Ac9A. Seven nucleotides in the cry1Ac9A
sequence were then altered to remove a cluster of
six potential polyadenylation (AATAAA-like)
signals, generating cry1Ac9B. Transgenic tobacco
containing cry1Ac9B were then shown to have
increased resistance to infestation by PTM larvae.
Preliminary insect-feeding trials using excised leaf
pieces revealed that no PTM larvae had pupated after
14 days on the tobacco plants containing cry1Ac9B.
On some lines, the PTM larvae present were so small
that it is unlikely that they would have survived
through to pupation. There was also a significant
difference in percentage pupation between PTM
larvae feeding on the tobacco plants containing
cry1Ac9A and those on the control tobacco plants,
suggesting that the plants containing cry1Ac9A may
have expressed the gene at a very low level sufficient
to slow larval development.
It is possible that the improved expression of the
cry gene in the tobacco plants containing cry1Ac9B
may be the result of better transcription of this
construct in comparison to the tobacco plants
containing cry1Ac9A. However, by using nuclear
run-on analysis we have shown previously that the
sequence modifications to another cry gene,
cry9Aa2T (Gleave et al., 1998), did not appear to
increase the rate at which transcription was initiated.
Similar rates of transcription were present in
transgenic tobacco plants containing either
unmodified or modified cry9Aa2T.
Based on these results, tobacco lines were selected
for further insect-feeding trials using whole plants.
In the whole plant bioassays, larval growth rates at
9 days showed no significant differences between
larvae on the control plants and those on the plants
containing cry1Ac9A. However, larvae on the plants
containing cry1Ac9B showed significantly lower
growth rates and survival than those on either the
control plants or the plants containing cry1Ac9A.
Within both groups of transgenic plants (cry1Ac9A
and cry1Ac9B), however, plant line effects were
Therefore, together these results suggest that the
minor modifications made to the nucleotide
sequence of cry1Ac9 to produce cry1Ac9B resulted
in improved expression of the gene in tobacco to a
level sufficient to severely reduce PMT larval growth
and survival. However, there was considerable
variation between plant lines in the degree of insect
resistance conferred on these plants. Four lines (7,
25, 26 and 28) showed severely retarded growth and
the few tiny larvae alive after 9 days were unlikely
to have survived to pupation. Other lines (3, 10, 14,

cry1Ac9 modifications give tobacco PTM resistance
291
Foot M. 1984. Potato tuber moth Phthorimaea operculella
(Zeller), life-cycle. DSIR Information Series No.105/15; 1st
revision. ISSN No. 0077-9636.
Gleave A P. 1992. A versatile binary vector system with a T-
DNA organisational structure conducive to efficient
integration of cloned DNA into the plant genome. Plant
Molecular Biology 20:1203-1207.
Gleave A P, Hedges R J, Broadwell A H, Wigley P J. 1992.
Cloning and nucleotide sequence of an insecticidal crystal
protein gene from Bacillus thuringiensis DSIR732 active
against three species of leafroller (Lepidoptera: Tortricidae).
New Zealand Journal of Crop and Horticultural Science
20:27-36.
Gleave A P, Mitra D S, Markwick N P, Morris B A M,
Beuning L L. 1998. Enhanced expression of the Bacillus
thuringiensis cry9Aa2 gene in transgenic plants by nucleotide
sequence modification confers resistance to potato tuber moth.
Molecular Breeding 4:459-472.
15 and 29) had higher growth rates and more
survivors, of which some, despite their delayed
development, may have survived, at least to
pupation. This variation was subsequently shown
by Southern analysis to be irrespective of the copy
number of the transgene and is presumably due to
chromosomal positional effects.
The seven nucleotide modifications to the cry1Ac9
sequence appear to improve the stability of the
mRNA, leading to higher steady state mRNA levels
in transgenic tobacco, resulting in increased
resistance of these plants to infestation by PTM
larvae.
Acknowledgements
Höfte H, Whiteley H R. 1989. Insecticidal crystal proteins of
Bacillus thuringiensis. Microbiological Reviews 53:242-255.
James C. 2000. Global status of commercialised transgenic
crops: 2000. ISAAABriefs 21: Preview. Ithaca, NY: ISAAA.
Lütcke H A, Chow K C, Mickel F S, Moss K A, Kern H F,
Scheele GA. 1987. Selection ofAUG initiation codons differs
in plants and animals. The EMBO Journal 6:43-48.
Nairn C J, Winesett L, Ferl R J. 1988. Nucleotide sequence
of an actin gene from Arabidopsis thaliana. Gene 65:247-
257.
This work was supported by the New Zealand
Foundation for Science, Research and Technology
Contract CO6412. The authors would also like to
thank S Marshall and L Burgess for their critical
comments on the manuscript.
References
Peferoen M. 1997. Review. Progress and prospects for field
use of Bt genes in crops. Trends in Biotechnology 15:173-
177.
Perlak F J, Fuchs R L, Dean D A, McPherson S L, Fischhoff
D A. 1991. Modification of the coding sequence enhances
plant expression of insect control protein genes. Proceedings
of the National Academy of Sciences of the United States of
America 88:3324-3328.
Andrews R E Jr, Faust R M, Wabiko H, Raymond K C, Bulla
LA. 1987. The biotechnology of Bacillus thuringiensis. CRC
Critical Reviews in Biotechnology 6:163-232.
Barton K A, Whiteley H R, Yang N-S. 1987. Bacillus
thuringiensis d-endotoxin expressed in transgenic Nicotiana
tabacum provides resistance to Lepidopteran insects. Plant
Physiology 8:1103-1109.
Crickmore N, Zeigler D R, Feitelson J, Schnepf E, Van Rie
J, Lereclus D, Baum J, Dean D H. 1998. Revision of the
nomenclature for the Bacillus thuringiensis pesticidal crystal
proteins. Microbiology and Molecular Biology Reviews
62:807-813.
Delannay X, La Vallee B J, Proksch R K, Fuchs R L, Sims S
R, Greenplate J T, Marrone PG, Dodson R B, Augustine J
J, Layton J G, Fischhoff D A. 1989. Field performance of
transgenic tomato plants expressing the Bacillus thuringiensis
var. Kurstaki insect control protein. Bio/Technology 7:1265-
1269.
de Maagd R A, Bosch D, Stiekema W. 1999. Bacillus
thuringiensis toxin-mediated insect resistance in plants.
Trends in Plant Science 4:9-13.
Doyle J L, Doyle J L. 1990. Isolation of plant DNA from fresh
tissue. Focus (Gibco-BRL) 12:13-15.
Schuler T H, Poppy GM, Kerry B R, Denholm I. 1998. Insect-
resistant transgenic plants. Trends in Biotechnology 16:168-
175.
Simon C J, Weeden N F. 1992. Molecular analysis and cloning
of Malus ribosomal DNA. Journal of the American Society
for Horticultural Science 117:164-168.
Vaeck M, Reynaerts A, Höfte H, Jansens S, De Beuckeleer
M, Dean C, Zabeau M, Van Montagu M, Leemans J. 1987.
Transgenic plants protected from insect attack. Nature
328:33-37.
Varela L G, Bernays E A. 1988. Behavior of newly hatched
potato tuber moth larvae, Phthorimaea operculella Zell.
(Lepidoptera: Gelechiidae), in relation to their host plants.
Journal of Insect Behaviour 1:261-275.
Whiteley H R, Schnepf H E. 1986. The molecular biology of
parasporal crystal body formation of Bacillus thuringiensis.
Annual Review of Microbiology 40:549-576.
Fenemore PG. 1988. Host-plant location and selection by adult
potato moth, Phthorimaea operculella (Lepidoptera:
Gelechiidae): a review. Journal of Insect Physiology 34:175-
177.
Fischhoff D A, Bowdish K S, Perlak F J, Marrone P G,
McCormick S M, Niedermeyer J G, Dean D A, Kusano-
Kretzmer K, Mayer E J, Rochester D E, Rogers S G, Fraley
R T. 1987. Insect tolerant transgenic tomato plants. Bio/
Technology 5:807-813.

292
L L BEUNING, D S MITRA, N P MARKWICK & A P GLEAVE