Synthesis and biological evaluation of pyrazolo-triazole hybrids as cytotoxic and apoptosis inducing agents

Article abstract of DOI:10.1039/c5ob00842e

A series of pyrazolo-triazole hybrids were designed and synthesized by combining the 1,3-diphenyl pyrazole and triazole scaffolds to obtain (1-benzyl-1H-1,2,3-triazol-4-yl)(1,3-diphenyl-1H-pyrazol-4-yl)methanones. All the synthesized compounds were screened for their anticancer activity against four tumor cell lines, viz. HT-29 (colon), PC-3 (prostate), A549 (lung), and U87MG (glioblastoma) cells. Most of the tested compounds showed moderate to potent cell growth inhibition on different cancer cells, in particular, the compounds 17, 23, and 29 exhibited promising cytotoxicity against these cell lines with the IC₅₀ values in the range of 0.86-3.72 μM. In addition, the potential mechanism of cell growth inhibition and apoptotic induction by these compounds was investigated in U87MG cancer cells using cell-based assays, including wound healing assay, flow cytometry, Hoechst staining, acridine orange/ethidium bromide staining, Annexin V-FITC/propidium Iodide dual staining, Rhodamine 123 staining, and carboxy-DCFDA staining. The results indicate that the compounds induce apoptosis in U87MG cells via mitochondrial pathway through up-regulation of pro-apoptotic (Bax) and down-regulation of anti-apoptotic (Bcl-2) genes. Based on these studies, three compounds 17, 23 and 29 have been identified as promising new molecules that have the potential to be developed as leads.

Full text of DOI:10.1039/c5ob00842e

View Article Online
View Journal
Organic &
Biomolecular
Chemistry
Accepted Manuscript
This article can be cited before page numbers have been issued, to do this please use: S. R. Telukutla, H.
kulhari, V. Ganga Reddy, S. R. A.V., V. Bansal, A. Kamal and R. Shukla, Org. Biomol. Chem., 2015, DOI:
10.1039/C5OB00842E.
This is an Accepted Manuscript, which has been through the
Royal Society of Chemistry peer review process and has been
accepted for publication.
Accepted Manuscripts are published online shortly after
acceptance, before technical editing, formatting and proof reading.
Using this free service, authors can make their results available
to the community, in citable form, before we publish the edited
article. We will replace this Accepted Manuscript with the edited
and formatted Advance Article as soon as it is available.
You can find more information about Accepted Manuscripts in the
Information for Authors.
Please note that technical editing may introduce minor changes
to the text and/or graphics, which may alter content. The journal’s
standard Terms & Conditions and the Ethical guidelines still
apply. In no event shall the Royal Society of Chemistry be held
responsible for any errors or omissions in this Accepted Manuscript
or any consequences arising from the use of any information it
contains.
www.rsc.org/obc

View Article Online
DOI: 10.1039/C5OB00842E
Organic & Biomolecular Chemistry
Page 1 ofJ1o4 urnal Name
Dynamic Article Links ►
Cite this: DOI: 10.1039/c0xx00000x
www.rsc.org/xxxxxx
ARTICLE
Synthesis and biological evaluation of pyrazolo-triazole hybrids as
cytotoxic and apoptosis inducing agents
T. Srinivasa Reddy,a,b,c,d Hitesh Kulhari,a,b,c,d V. Ganga Reddy,a A.V. Subba Rao,a Vipul Bansal,c,d Ahmed
5
Kamal*c,d and Ravi Shukla*c,d,e
Received (in XXX, XXX) Xth XXXXXXXXX 20XX, Accepted Xth XXXXXXXXX 20XX
DOI: 10.1039/b000000x
A series of pyrazolo-triazole hybrids were designed and synthesized by combining the 1,3-diphenyl
pyrazole and triazole scaffolds to obtain (1-benzyl-1H-1,2,3-triazol-4-yl)(1,3-diphenyl-1H-pyrazol-4-
10 yl)methanones. All the synthesized compounds were screened for their anticancer activity against four
tumor cell lines, viz. HT-29 (colon), PC-3 (prostate), A549 (lung), and U87MG (glioblastoma) cells.
Most of the tested compounds showed moderate to potent cell growth inhibition on different cancer cells,
in particular, the compounds 17, 23, and 29 exhibited promising cytotoxicity against these cell lines with
the IC50 values in the range of 0.86-3.72 µM. In addition, the potential mechanism of cell growth
15 inhibition and apoptotic induction by these compounds was investigated in U87MG cancer cells using
cell-based assays, including wound healing assay, flow cytometry, Hoechst staining, acridine
orange/ethidium bromide staining, Annexin V-FITC/Propidium Iodide dual staining, Rhodamine 123
staining, and Carboxy-DCFDA staining. The results indicate that the compounds induce apoptosis in
U87MG cells via mitochondrial pathway through up-regulation of pro-apoptotic (Bax) and down-
20 regulation of anti-apoptotic (Bcl-2) genes. Based on these studies, three compounds 17, 23 and 29 have
been identified as promising new molecules that have the potential to be developed as leads.
of apoptosis.12-13 Moreover, pyrazole-based molecules have been
Introduction
reported for excellent drug-like properties and high oral
bioavailability.14
Cancer is a disease of uncontrolled cell proliferation. It is the
second leading cause of disease related deaths.1 Many, if not most
25 of the existing anticancer drugs are limited in their therapeutic
action due to their nonspecific toxicity to normal growing cells
and/or development of drug resistance in cancer cells.2 The
enormous incidence and mortality rate of cancer warrant the
search for safer and effective anticancer agents that show potent
55 On the other hand, 1,2,3-triazoles are very important heterocyclic
structural motifs in organic as well as medicinal chemistry due to
their ease of synthesis by click chemistry and wide range of
pharmacological activities with potent anticancer properties.15-18
1,2,3-triazoles are highly stable under different acidic or basic
60 conditions and are capable of forming hydrogen bonds with the
biological targets.19 A number of 1,2,3-triazole containing drugs
such as cefatrizine, tazobactam, carboxyamidotriazole are
available in the market.20
30 and broad spectrum anticancer activity.
Apoptosis or
programmed cell death is a critical cellular process for the
maintenance of tissue homeostasis and normal development of
multicellular organisms. Inappropriate regulation of apoptosis
signaling pathways may lead to several diseases including
35 cancer.3 In tumor cells, the pathways that lead to apoptosis are
disrupted or impaired due to which cells undergo malignant
transformation. Therefore, targeting critical apoptosis regulators
with a goal to induce apoptosis in cancer cells has emerged as an
attractive strategy in cancer chemotherapy.4
Pharmacophore hybridization is an effective tool to design highly
65 active new chemical entities by covalently combining two or
more active pharmacophores into a single molecule. These
hybrids may act on multiple targets and offer the possibility of
overcoming drug resistance, and in addition, hybrids may also
often show synergetic action. In view the above considerations
70 and inspired by the promising anticancer activity of pyrazoles and
1,2,3-triazoles, we synthesized a series of various pyrazolo-
triazole hybrids by combining 1,3-diphenyl pyrazoles with 1,2,3-
triazoles via click chemistry with a view to produce promising
anticancer agents.
40
Pyrazole is an important heterocyclic structural motif, which is
known to exhibit extensive range of biological activities, such as
analgesic, anti-pyretic, anti-inflammatory, anti-oxidant, anti-
bacterial and anticancer activities.5-8 Pyrazole-based compounds
45 are reported to exert their anticancer activity through inhibition of
various targets such as epidermal growth factor (EGF), tumor
growth factor (TGF), fibroblast growth factor (FGF), telomerase
and different kinases that are significant for the management of
cancer.9-11 Among pyrazoles, 1,3-diphenylpyrazoles are known
50 for their potent anticancer activity, including cytotoxicity against
different cancer cells, induction of cell-cycle arrest and induction
75 Results and discussions
Chemistry
The synthetic route for (1-benzyl-1H-1,2,3-triazol-4-yl)(1,3-
diphenyl-1H-pyrazol-4-yl)methanone derivatives is illustrated in
Scheme 1. Condensation of the different substituted
80 acetophenones (1a-e) with phenyl hydrazine (2) in ethanol
This journal is © The Royal Society of Chemistry [year]
[journal], [year], [vol], 00–00 | 1

Organic & Biomolecular Chemistry
View ArticlPe Oanglinee 2 of 14
DOI: 10.1039/C5OB00842E
produced the corresponding acetophenone phenyl hydrazones 10 derivatives (6a-e). These terminal alkyne substituted
(3a-e) that on cyclization with DMF-POCl3 (Vilsmeir–Haack
reaction) afforded the corresponding 1,3-diphenyl pyrazole
carboxaldehydes (4a-e).21 Reaction of the aryl aldehyde
intermediates with ethynyl magnesium bromide in dry
intermediates were allowed to react with various synthesized
benzyl azides, in the presence of CuSO4.5H2O and sodium
ascorbate, in t-butyl alcohol and water (1:2) at room temperature
to afford the pyrazolo triazole hybrids (7-36) in good to excellent
5
tetrahydrofuran (THF) at 0 °C to room temperature yielded 15 yields (64-90%). All the structures of these hybrids were
alcohol substituted compounds 5a-e that upon oxidation with 2-
iodoxybenzoic acid (IBX) in the presence of dimethylsulfoxide
(DMSO) gave 1-(1,3-diphenyl-1H-pyrazol-4-yl)prop-2-yn-1-one
confirmed by spectral data (1H and 13C NMR and MS and
HRMS).
Scheme 1 General synthesis of (1-benzyl-1H-1,2,3-triazol-4-yl)(1,3-diphenyl-1H-pyrazol-4-yl)methanone (7-36). Reagents and
o
o
conditions: (a) ethanol, 50–60 C, 3 h; (b) DMF, POCl3, 50–60 C, 5 h; (c) ethynylmagnesium bromide, THF, 0°C-rt, 8-9 h; (d) 2-
20 iodoxybenzoic acid, DMSO, rt, 5 h; (e) PBr3, CH2Cl2, 0 °C, 30 min; f) NaN3, DMSO, rt, 12 h (g) different substituted aliphatic azides
(Ar-R1), CuSO4 5H2O, sodium ascorbate, tBuOH/H2O (1:2), rt, 8 h.
2
| Journal Name, [year], [vol], 00–00
This journal is © The Royal Society of Chemistry [year]

View Article Online
DOI: 10.1039/C5OB00842E
Page 3 of 14
Organic & Biomolecular Chemistry
Table 1 Anti-proliferative activities (aIC50-µM) of the (1-benzyl-1H-1,2,3-
triazol-4-yl)(1,3-diphenyl-1H-pyrazol-4-yl)methanone derivatives (7-36)
Biology
Antiproliferative activity
All the synthesized compounds (1-benzyl-1H-1,2,3-triazol-4-
5
yl)(1,3-diphenyl-1H-pyrazol-4-yl)methanone
[7-36]
were
evaluated for their anticancer activity against four human tumor
cell lines HT-29 (colon), PC3 (prostate), A549 (lung) and
U87MG (brain) by using standard MTT assay.22 The
concentrations that cause 50% inhibition of cancer cell growth
10 are expressed as IC50 values. The IC50 values of these
compounds in comparison to standard drug 5-fluorouracil are
presented in Table 1. Results from the MTT assay revealed that
most of the compounds showed moderate to potent cell growth
inhibition on U87MG cells selectively. Some of the
15 synthesized compounds such as 16, 17, 18, 23, 24, 29, 30, 35
and 36 displayed potent and broad spectrum of growth
inhibition against multiple cell lines and were comparable to
the positive standard (5-Fluorouracil). The highest growth
inhibitory activity was observed with the compounds 23 (IC50-
20 0.86 µM) followed by the compounds 29 (IC50-0.97 µM) and
17 (IC50-1.14 µM) against the U87MG cancer cell line. The
other three remaining cell lines also showed maximum
sensitivity towards these three compounds with IC50 values not
more than 3.71 μM. Compound 22 was highly active on colon
25 cancer HT-29 cell line (IC50-1.78 µM), while the compounds
16 and 35 showed selective potency against, lung cancer
(A549, IC50-2.13 µM) and prostate cancer (PC-3, IC50-2.32
µM) cell lines, respectively.The most active compounds in the
series 17, 23 and 29 were further investigated for their effect of
30 on normal human keratinocytes (HaCaT) proliferation.
Interestingly, none of the synthesized compounds had no effect
on keratinocyte cell growth inhibition (IC50 > 50 µM). These
results indicate the selectivity of (1-benzyl-1H-1,2,3-triazol-4-
yl)(1,3-diphenyl-1H-pyrazol-4 yl) methanones towards tumor
35 cells compared to the normal HaCaT cells.
We further investigated the structure-activity relationship
(SAR) by examining the effect of nature of substituents such as
fluorine, chlorine, triflouromethyl, and methoxy in A and B
phenyl rings of these derivatives on inhibiting cancer cell
40 proliferation. Firstly, the best substituent on the B ring is the
electron donating 3, 4-dimethoxy, as all the 3,4 dimethoxy
substituted hybrids 11, 17, 23, 29 and 35 showed remarkable
growth inhibition values on all the tested cancer cells with
specificity towards U87MG cancer cells. Moreover, the other
45 electron donating groups like methoxy (10, 16, 22, 28, and 34)
and trimethoxy (12, 18, 24, 30, and 36) substitutions on the B
ring produced derivatives with moderate to significant growth
inhibition of cancer cells. It is worth noting that derivatives
having electron withdrawing groups like flouro, chloro,
50 trifuromethyl on B ring displayed dramatic loss of potency. The
anticancer activity was also influenced by the presence of
various substituents on A ring. For instance, hybrids having
flouro (13-18) and chloro (19-24) group on A ring showed
increased sensitivity towards cancer cells when compared to un
55 substituted hybrids (7-12). Similarly the methoxy (25-30) and
trimethoxy (30-36) substitutions at the same position resulted
in moderate growth inhibition values. Overall, these SAR
studies indicate that electron withdrawing groups on A ring and
Compound
HT-29b
PC-3c
A549d
U87MGe
22.4±2.6
>50
7.07±0.6
6.45±1.3
7
8
>50
>50
>50
>50
>50
9
>50
>50
>50
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
5.71±1.8
2.92±0.3
4.63±0.7
14.48±2.6
15.92±2.3
>50
4.21±0.7
2.69±0.7
6.81±1.3
17.87±0.6
16.04±2.7
>50
7.21±1.3
4.69±1.7
5.56±1.6
5.92±0.2
8.5±1.9
>50
8.87±0.9
3.57±0.3
7.85±2.1
4.76±0.7
9.43±2.9
24.76±0.2
3.76±0.5
1.14±0.8
5.3±1.01
8.91±1.3
4.24±0.7
6.54±0.4
3.3±0.5
2.54±0.6
2.48±1.2
3.09±0.02
12.59±1.7
9.92±0.4
12.9±2.3
1.78±0.2
2.42±1.4
3.5±1.2
5.87±1.1
3.34±0.2
4.4±0.2
>50
2.13±0.4
2.3±0.8
3.8±1.01
4.98±0.5
6.04±0.9
5.72±1.2
5.3±0.6
1.93±0.5
2.42±0.1
13.7±2.3
11.21±4.1
14.5±1.0
4.84±1.2
2.24±0.1
5.32±1.2
>50
11.05 ±1.6
13.4±1.1
6.3±0.8
3.71±1.0
5.62±0.45
9.7±1.7
>50
0.86±0.3
3.95±0.03
15.5±3.8
5.89±1.0
4.24±0.6
3.63±0.8
0.97±0.3
1.15±0.4
18.9±2.6
26.7±3.5
8.25±1.1
2.47±0.9
3.61±0.5
3.81±1.2
14.7±2.6
7.22±1.1
29.11±1.8
6.99±0.09
1.78±1.0
4.4±0.7
>50
7.84±1.2
3.52±0.3
5.65±0.9
>50
28.6±1.9
24.1±2.6
14.72±0.5
4.39±0.3
2.6±0.1
>50
>50
>50
>50
>50
5.5±0.5
3.47±0.9
6.45±0.7
2.32±0.3
5.6±0.5
3.89±0.8
5-FUf
2.6±0.1
2.32±0.3
3.47±0.9
3.61±0.5
a
50% inhibitory concentration and mean
± SD of three individual
experiments performed in duplicate bcolon cancer, cprostate cancer and dlung
e
f
cancer and glioblastoma cells. 5-Flurouracil was included as reference
standard.
This journal is © The Royal Society of Chemistry [year]
Journal Name, [year], [vol], 00–00 | 3

Organic & Biomolecular Chemistry
View ArticlPe Oanglinee 4 of 14
DOI: 10.1039/C5OB00842E
electron donating groups on B ring are favorable for cytotoxic
activity of such hybrids. In view of the promising broad
spectrum anti-cancer activity and potent cytotoxicity towards
U87MG cells, the compounds 17, 23 and 29 were selected for
further detailed studies with a view to understand the cell
growth inhibition mechanisms of such hybrids.
35 The control cells exposed to DMSO showed 59.4 % cells in
G0/G1 phase, whereas compound treatment results in 74 to 86
% cells in G0/G1 phase. In particular, compound 29 increased
G0/G1 population of U87MG cells to 86%. Moreover, the
percentage of cells in S and G2/M phases were decreased
40 significantly in compound treated cells compared to the
control. These results indicated that the compound treatment of
U87MG cells resulted in G0/G1 phase of the cell cycle arrest.
5
In vitro cell migration assay
As migration of cancer cells is a key step of tumor metastasis,
10 cell migration assay23 was used to investigate the effect of 17,
23 and 29 on the migration potential of U87MG cancer cells.
As shown in Figure 1, cells migrated to the wound area
decreased significantly after treatment with these hybrids in
comparison to the control (untreated group) and showed 40-57
15 % of migration in the inhibition of U87MG cancer cells. These
results indicate that the migration of U87MG cancer cells was
significantly suppressed by these pyrazolo-triazole hybrids.
Figure 2 Effect of compounds 17, 23 and 29 on cell cycle arrest.
U87MG cells treated with the IC50 concentrations of the compounds or
45 vehicle control were harvested after 24 h. The cells were fixed and
stained with propidium iodide and analyzed by BD FACS Canto-II. For
each sample, 10,000 cells were used for sorting. The percentage of
cells in each phase was quantified by using Flowjo Software.
50 Apoptosis detection assays
Several members of the pyrazole and triazole derivatives have
been observed to induce apoptosis and/or reduce cell
proliferation in different cancer cell lines by inducing
apoptosis.24-25 Hence it was considered of interest to investigate
55 the apoptotic inducing effect of these potential hybrids in
U87MG cancer cells.
Hoechst staining
To investigate the apoptotic inducing effect of these hybrids
(17, 23 and 29), Hoechst staining assay was carried out on
60 U87MG cells. Hoechst 33242 is a cell membrane permeable
nuclear staining dye, which emits blue fluorescence and stains
the live cell nuclei as light blue, whereas the apoptotic cell
nuclei appear as bright blue due to chromatin condensation.
U87MG cells were treated with 17, 23 and 29 at their IC50
65 concentrations for 24 h and stained with Hoechst. The results
from Figure 3 indicated that in the control group, the untreated
cells did not show obvious morphological changes (all the cells
exhibited uniform rounded cell morphology), however in
compound treated group, 25-34 % of the cells exhibited typical
70 apoptotic morphology such as highly condensed nuclei
(brightly stained) as indicated by arrows which is comparable
to the standard 5-Flurouracil (29%). This observation
demonstrates that all the three hybrids 17, 23 and 29 are able to
induce apoptosis in U87MG cells.
Figure 1 Effect of compounds 17, 23 and 29 on U87MG cells
migration in vitro. U87MG cells were treated with the compounds 17,
20 23 and 29 and wounds were induced with 200 µL pipette. The edges of
wound were captured immediately (0 h) and 24 h after treatment.
Number of cells migrated into the wound area was counted manually. .
Data are mean ± SD from three independent experiments and viewed at
4X magnification. ** represents statistically significant difference with
25 respect to the control, p<0.001.
Cell cycle analysis
Cell cycle analysis was performed to determine whether the
compounds had any effect on the cell cycle progression.
30 U87MG cells were treated with the compounds 17, 23 and 29
with their IC50 concentrations for 24 h and stained with
propidium iodide. As shown in Figure 2, the compound
treatment increased the cells in the G0/G1 phase while
concomitantly decreasing the cells in the S and G2/M phases.
75 Acridine orange / ethidium bromide (AO/EB) staining
To further address the apoptosis inducing effect of these
hybrids, AO/EB staining assay was carried out. Acridine
orange stains the nucleus of the both intact and damaged cell
4
| Journal Name, [year], [vol], 00–00
This journal is © The Royal Society of Chemistry [year]

View Article Online
DOI: 10.1039/C5OB00842E
Page 5 of 14
Organic & Biomolecular Chemistry
Figure 3 Compounds 17, 23, 29 and 5-Flurouracil (5-FU) induced nuclear morphological changes of U87MG cells. Data are mean ± SD from three
independent experiments. ** represents statistically significant difference with respect to control group at p<0.001
membrane and emits green fluorescence; whereas ethidium
bromide (EB) only stains the nucleus of the damaged cell
membrane and emits red fluorescence. Therefore, viable cells
Control
can be observed as having uniform green nucleus and orange
cytoplasm. Early apoptotic cells exhibit bright green nuclei
because of condense chromatin and late apoptotic cells show
bright orange areas of condensed chromatin in the nucleus.
U87MG cells were treated with the compounds at their IC50
concentration for 24 h and stained with AO/EB, whereas cells
5
10 treated with DMSO were used as control. Results shown in
Figure 4 indicated that control cells appeared uniformly green
and did not take up the EB, while cells treated by 5-Flurouracil
and the hybrids 17, 23 and 29 showed apoptotic characteristics
(chromatin condensation) and appeared as intense green and
15 orange. These results clearly indicate that the pyrazolo-triazole
hybrids 17, 23 and 29 induce apoptosis in U87MG cells.
17
23
Annexin V/FITC dual staining assay
5-FU
29
The degree of apoptosis induced by the compounds 17, 23 and
20 29 in U87MG cells was investigated by Annexin V/Propidium
Iodide (PI) dual staining which facilitates the detection of live
cells (Q1-LL; AV-/PI-) early apoptotic cells (Q1-LR; AV+/PI-
), late apoptotic cells (Q1-UR-AV+/PI+) and necrotic cells
(Q1-UL; AV-/PI+). As shown in Figure 5 and Figure S3
25 (supplementary information), The apoptosis ratios of
compounds 17, 23 and 29
measured at their IC50
concentrations were found to 22.5% , 30.2% and 23.5
respectively, when compared to that that of control (2.0%) and
the standard 5-Flurouracil (29.5%). These results further
30 proved that the induced apoptosis by compounds is responsible
for the inhibition of cell proliferation.
35
Figure 4 AO/EB staining assay. U87MG cells were treated with
compounds 17, 23, 29 and 5-Flurouracil (5-FU) for 24 h and stained
with AO/EB. Images were captured with fluorescence microscope
(Nikon) using green and red filter. Green colour (live cells); intense
40 green (early apoptotic); intense yellow or orange (late apoptotic).
This journal is © The Royal Society of Chemistry [year]
Journal Name, [year], [vol], 00–00 | 5

Organic & Biomolecular Chemistry
View ArticlPe Oanglinee 6 of 14
DOI: 10.1039/C5OB00842E
20 Measurement of mitochondrial membrane potential (DΨm)
Previous reports have suggested that the loss of DΨm leads to
apoptosis.27 In order to further investigate the apoptosis-
inducing effect of target compounds, changes in DΨm was
measured after staining with Rhodamine-123. Mitochondria
25 that maintain normal DΨm can retain the Rhodamine 123,
which give strong green fluorescence. Disruption of DΨm was
associated with a decrease in green fluorescence due to a lack
of Rh-123 retention.28 Thus the relationship between DΨm and
Rh-123 fluorescence is considered as linear. U87MG cells were
30 treated with these hybrids 17, 23, 29 and 5-FU at their IC50
concentrations, stained with Rh-123 and the intensity of Rh-
123 fluorescence was measured by spectrofluorometer. The
results from the Figure 7 revealed that these compounds
induced 40-60 % loss of DΨm in U87MG cells. Compound 23
35 is more potent in causing drop in DΨm, which showed 60 % of
collapse of DΨm followed by the compounds 29 and 17 that
induced 53 and 40 % losses of DΨm, respectively, whereas 5-
Flurouracil treatment resulted in 47 % loss of DΨm. These
results demonstrate that these compounds induce apoptosis in
40 U87MG cells through changes in DΨm.
Figure 5 Effect of compounds 17, 23, 29 and 5-Flurouracil on
apoptosis of U87MG cells. Cells were analysed after being stained with
Annexin V-FITC/PI dual staining.
DNA fragmentation assay
5
During apoptosis, endonucleases cleave the DNA into smaller
fragments and these fragments can be detected by gel
electrophoresis as ladders. This ladder-like pattern is regarded
as the biochemical hallmark of apoptosis.26 In order to further
test the apoptosis inducing effect of these hybrids, DNA
10 fragmentation assay was carried out. The chromosomal DNA
extracted from the cells treated with these hybrids (17, 23, 29
and 5-FU) at IC50 for 24 h were used for agarose gel
electrophoresis. As shown in Figure 6, the exposure of U87MG
cells to 17, 23 and 29 resulted in DNA breaks (fragments),
15 which then led to the formation of the DNA ladder. These
breakages were extensive in case of 17, 23 and 5-Flurouracil,
which indicates the activation of cell death pathways upon
treatment by such hybrids.
45
50
55 Compounds 17, 23, 29 and 5-Flurouracil (5-FU) induced loss of
Figure 7 Compounds 17, 23, 29 and 5-Flurourcil induced mitochondrial
membrane potential (DΨm) in U87MG cells analyzed using
Rhodamine 123 staining. The loss in intensity of fluorescence was
measured by spetrofluorometer. Data are mean ± SD from three
60 independent experiments. ** represents statistically significant
difference with respect to control group at p<0.001.
Measurement of reactive oxygen species (ROS) levels
Loss of DΨm and elevation of intracellular ROS levels are two
closely related events that occur during apoptosis.29 The levels
65 of ROS were measured in U87MG cells by using a fluorescent
probe, Carboxy-2’,7’-dichlorofluorescein diacetate (Carboxy-
DCFDA) to examine whether the drop in DΨm was on account
of the production of ROS.30 The non-fluorescent DCFDA is
oxidized to green fluorescent DCF by intracellular esterases
70 when it diffuses into cells. Thus, the intracellular ROS levels
can be expressed as mean fluorescence intensity (MFI) of DCF.
As shown in Figure 8, U87MG cells treated with hybrids 17,
23, 29 and 5-Flurouracil showed increase in green fluorescence
compared to the control (untreated cells). The results from
75 quantitative analysis showed that these compounds caused
elevation of ROS levels by 1.5 to 3.5 times, compared to the
Figure 6 DNA fragmentation in U87MG cells induced by the
pyrazolo-triazole derivatives. U87MG cells were treated with the
IC50 concentrations of the compounds 17, 23, 29 and 5-Flurouracil
(5-FU) for 24 h. The DNA was analysed by agarose gel
electrophoresis at 75 V for 1.5 h. Lane 1: M (marker) Lane 2:
Control; Lane 3–5: U87MG cells treated with compounds 17, 23
and 29 respectively and Lane 6: 5-FU (5-Flurouracil)
6
| Journal Name, [year], [vol], 00–00
This journal is © The Royal Society of Chemistry [year]

View Article Online
DOI: 10.1039/C5OB00842E
Page 7 of 14
Organic & Biomolecular Chemistry
23
17
5-FU
29
Figure 8 Effect of compounds 17, 23, 29 and 5-FU on the intracellular levels of ROS. U87MG cells were treated with compounds 17, 23, 29 and 5-
Flurouracil (5-FU) for 24 h and stained with carboxy-DCFDA. Images were captured by a fluorescence microscope (Nikon). The intensity of DCFDA
fluorescence was measured by spetrofluorometer using an excitation wavelength of 485 nm and an emission wavelength of 535 nm.
Conclusion
control cells. Compound 29 showed marked increase in ROS
levels (3.5 times) and was found to be most potent ROS
inducer when compared to the 5-Flurouracil (2.7 times). Hence,
it could be concluded that these hybrids significantly elevate
the intracellular ROS levels.
In summary, a series of new pyrazolo-triazole hybrids (7-36)
have been prepared and evaluated for their cytotoxic activity
35 against four human tumor cell lines. The results showed that
most of these hybrids exhibited remarkable cell growth
inhibition activities on different cancer cells. Some of the
hybrids like 17, 23 and 29 exhibited potent broad spectrum of
cytotoxic activity against all the tested cancer cells and were
40 superior to the standard 5-Fluorouracil. Their exposure to the
U87MG cells resulted in inhibition of in vitro cell migration.
Flow cytometry analysis indicates that these compounds induce
cell cycle arrest at G1 phase. In addition, they induce apoptosis
in U87MG cells by causing collapse of DΨm, elevation of ROS
45 production, inducing DNA breaks and changes in Bax/Bcl-2
gene expression profiles. Overall, these results demonstrate that
the pyrazolo-triazole hybrids have the potential to be developed
as leads and their further structural modifications may produce
promising anticancer agents for U87MG cancer cells.
5
Effect on the mRNA expression of Bcl-2 and Bax
Bcl-2 family of proteins play an important role in inducing or
10 inhibiting the apoptosis31 and maintaining the homeostasis by
regulating the DΨm, cytochrome c release and caspase
activation.32 Therefore, we investigated the effect of these
hybrids on Bcl-2 and Bax mRNA expressions through RT-
PCR. The results revealed that these hybrids have significant
15 effect on the expression of Bax and Bcl-2 in U87MG cells. As
shown in the Figure 9, the compounds 17, 23, 29 and 5-
Flurouracil induced the expression of pro-apoptotic gene Bax
(1.8, 1.5, 2.16, 1.92 times, respectively) after 24 h of exposure.
Expression of anti-apoptotic gene Bcl-2 was down-regulated
20 0.31-0.69 times by these compounds. Moreover, the Bax/Bcl-2
ratio in U87MG cells was also determined and found as 2.95
(17), 3.89 (23) 4.07 (29) and 2.82 (5-FU) in comparison to the
control (1.00). This increase in the ratio of Bax/Bcl-2
stimulates the release of cytochrome-c from mitochondrion to
25 cytosol that leads to the activation of caspases causing cell
death. The dramatic increase in the ratio from 1 to 4.07,
particularly in compound 29, indicates its significant apoptotic
behaviour. These results suggest that U87MG induced cell
apoptosis by these hybrids is associated with the mitochondrial
30 pathway.
50
Acknowledgments
T.S.R. and H.K. are thankful to IICT-RMIT research centre for
the award of the research fellowship. A.K. also acknowledges
CSIR for financial support under the 12th Five Year plan
55 project ‘Affordable Cancer Therapeutics (ACT)’ (CSC0301).
V.B. acknowledges Australian Research Council (ARC) for a
Future Fellowship (FT140101285) and Ian Potter Foundation
for establishing the Ian Potter NanoBioSensing Facility at
RMIT University. V.B. and R.S. acknowledge ARC for
60 research support through the ARC-Linkage (LP130100437)
scheme. R.S acknowledges support of Maxwell Eagle
Endowment for cancer research.
This journal is © The Royal Society of Chemistry [year]
Journal Name, [year], [vol], 00–00 | 7

Organic & Biomolecular Chemistry
View ArticlPe Oanglinee 8 of 14
DOI: 10.1039/C5OB00842E
30 added to a cold solution of DMF (25 mL) and POCl3 (5 mL),
stirred at 50–60 ºC for 6 h. The resulting mixture was poured
into ice-cold water; a saturated solution of sodium bi carbonate
was added to neutralize the mixture, extracted with ethyl
acetate and concentrated in vacuo. Then the obtained residue
35 was purified by column chromatography to afford pure 1,3-
diphenyl-1H-pyrazole-4-carbaldehydes (4a-e) in good yields.
The spectroscopic data of the obtained aldehyde compounds
was in agreement with the reported data.
General Procedure for the synthesis of 1-(1,3-diphenyl-
40 1H-pyrazol-4-yl)prop-2-yn-1-ol derivatives (5a-e)
To a solution of aldehydes (4a-e, 5 mmol) in dry
tetrahydrofuran (THF) was added ethynylmagnesium bromide
in THF (0.5 M solution, 7.5 mmol) at 0 °C and stirred for 1 h at
same temperature. Then the reaction mixture was stirred at
45 room temperature for another 7-8 h. After completion of the
reaction, the reaction mixture was quenched with saturated
aqueous ammonium chloride solution and extracted with ethyl
acetate. The obtained organic layer was washed with brine,
dried over anhydrous sodium sulphate, and concentrated in
50 vacuo to get pure compounds which were used for the next step
without further purification.
Figure 9 Effect of compounds 17, 23, 29 and 5-Flurouracil (5-FU) on
mRNA expression of apoptotic signalling molecules (Bax and Bcl-2) in
U87MG cells. Cells were treated with IC50 concentration of the
compounds for 24 h. The mRNA expression levels of Bax and Bcl-2
were analysed by real-time PCR. Target gene expression is normalized
to β-actin. PCR products were run on a 1.5 % agarose gel containing
ethidium bromide and viewed under UV light.
General procedure for the synthesis of 1-(1,3-diphenyl-
1H-pyrazol-4-yl)prop-2-yn-1-one derivatives (6a-e)
To a homogenious solution of 2-iodoxy-benzoic acid (IBX)
55 (12.5 mmol) in dimethyl sulfoxide (DMSO) (50 mL) was
added different substituted secondary alcohols (5a-e, 5 mmol)
and the reaction mixture was stirred for 5 h at room
temperature. After completion of the reaction, the mixture was
quenched with water and stirred at room temperature for 10
60 min, and partitioned between water and ethyl acetate. Then, the
mixture was filtered through celite. The organic layer was
washed with water, saturated sodium bicarbonate solutions;
dried over sodium sulfate, and concentrated in vacuo to get the
pure terminal alkyne products (6a-e).
Experimental
Chemistry
5
Materials and Methods.
All the reagents, solvents used were of commercial grade and
were used without any further purification. The progress of the
reactions was monitored by thin layer chromatography (TLC),
65 1-(1,3-diphenyl-1H-pyrazol-4-yl)prop-2-yn-1-one (6a)
Light yellow solid, yield 79%, Mp: 145-147 ºC.; 1H NMR (300
MHz, CDCl3) δ 8.67 (s, 1H), 7.99 – 7.90 (m, 2H), 7.82 (dt, J =
3.4, 2.1 Hz, 2H), 7.58 – 7.36 (m, 6H), 3.25 (s, 1H); 13C NMR
(75 MHz, CDCl3) δ 169.3, 153.5, 138.8, 135.2, 131.4, 129.7,
70 129.3, 129.2, 128.0, 127.9, 122.5, 119.7, 81.6. MS (ESI): 273
10 performed on silica gel glass plates containing 60 F-254, and
visualization on TLC was achieved by UV light or iodine
indicator. Melting points were measured with an Electro
1
thermal melting point apparatus, and are uncorrected. H and
[M+H]+;
HRMS (ESI) calcd for
C18H13ON2 [M+H]+
13C NMR spectra were recorded on INOVA (400 MHz) or
15 Gemini Varian-VXR-unity (200 MHz) or Bruker
UXNMR/XWIN-NMR (300 MHz) instruments. Chemical
shifts (d) are reported in ppm downfield from internal TMS
standard. Signal multiplicities are represented by s (singlet), d
(doublet), t (triplet), ds (double singlet), dd (double doublet), m
20 (multiplet) and br s (broad singlet). ESI spectra were recorded
on Micro mass, Quattro LC using ESI+ software with capillary
voltage 3.98 kV and ESI mode positive ion.
273.1027; found: 273.1018 and C18H13ON2 Na[M+Na]+
295.0867.
1-(3-(4-fluorophenyl)-1-phenyl-1H-pyrazol-4-yl)prop-2-yn-1-
75 one (6b)
1
Light brown solid, yield 75%, Mp: 159-162 ºC; H NMR (300
MHz, CDCl3) δ 8.67 (s, 1H), 7.89 (d, J = 8.6 Hz, 2H), 7.80 (d,
J = 8.1 Hz, 2H), 7.53 (t, J = 7.7 Hz, 2H), 7.47-7.35 (m, 3H),
3.26 (s, 1H); 13C NMR (75 MHz, CDCl3) δ 182.3, 168.0, 159.8,
80 150.6, 137.1, 134.7, 129.8, 129.3, 128.2, 126.5, 120.8, 118.1,
117.9, 113.8, 113.3, 80.0, 79.0.; MS (ESI): 291[M+H]+;
HRMS (ESI) calcd for C18H12FN2O [M+H]+ 291.0934; found:
291.0886.
General procedure for the synthesis of 1, 3 diphenyl
pyrazole carboxaldehydes (4a-e)
25
The 1,3-diphenyl-1H-pyrazole-4-carboxaldehydes (4a-e)
were synthesized based on
literature method.21,33 as
a
1-(3-(4-chlorophenyl)-1-phenyl-1H-pyrazol-4-yl)prop-2-yn-
85 1-one (6c)
following: para-substituted acetophenones (1a-e, 20 mmol)
interact with phenyl hydrazine (2, 25 mmol) in anhydrous
ethanol to form acetophenone phenylhydrazones, which were
1
Light brown solid, yield 71%, Mp: 163-165 ºC; H NMR (300
MHz, CDCl3) δ 8.65 (s, 1H), 7.82 (d, J = 8.3 Hz, 2H), 7.75 (d,
8
| Journal Name, [year], [vol], 00–00
This journal is © The Royal Society of Chemistry [year]

View Article Online
DOI: 10.1039/C5OB00842E
Page 9 of 14
Organic & Biomolecular Chemistry
J = 8.1 Hz, 2H), 7.57 - 7.31 (m, 5H), 3.27 (s, 1H); 13C NMR
(1,3-diphenyl-1H-pyrazol-4-yl)(1-(4 (trifluoromethyl)benzyl)-
60 1H-1,2,3-triazol-4-yl)methanone (9)
(75 MHz, CDCl3) δ 167.7, 151.1, 138.2, 135.4, 130.2, 129.3,
128.1, 126.6, 120.5, 118.2, 117.9, 113.5, 80.1, 78.8.; MS (ESI):
307 [M+H]+; HRMS (ESI) calcd for C18H12ClN2O [M+H]+
307.0638; found: 307.0595.
Light brown solid, yield 71%, Mp: 170-172 ºC.; 1H NMR (500
MHz, CDCl3) δ 9.58 (s, 1H), 8.23 (s, 1H), 7.88-7.71 (m, 4H),
7.63 (d, J = 7.2 Hz, 2H), 7.50 (t, J = 7.7 Hz, 2H), 7.45 – 7.33
(m, 6H), 5.58 (s, 2H). 13C NMR (75 MHz, CDCl3) δ 178.1,
65 158.8, 155.0, 139.2, 137.6, 132.6, 131.6, 131.1, 129.5, 129.4,
128.8, 128.5, 127.9, 127.6, 126.3, 125.4, 121.8, 119.8, 53.9..;
MS (ESI): 474 [M+H]+; HRMS (ESI) calcd for C26H19ON5F3
[M+H]+ 474.15362; found: 474.15319.
5
1-(3-(4-methoxyphenyl)-1-phenyl-1H-pyrazol-4-yl)prop-2-yn-
1-one (6d)
Light yellow solid, yield 76%, Mp: 153-155 ºC.; 1H NMR (300
MHz, CDCl3) δ 8.66 (s, 1H), 7.92 (d, J = 8.1 Hz, 2H), 7.81 (d,
10 J = 8.0 Hz, 2H), 7.53 (t, J = 7.6 Hz, 2H), 7.41 (t, 1H), 6.96 (d,
2H), 3.87 (s, 3H), 3.25 (s, 1H); 13C NMR (75 MHz, CDCl3) δ
169.3, 161.0, 153.6, 139.2, 135.2, 131.3, 129.6, 127.9, 123.9,
122.3, 119.5, 113.5, 81.5, 55.3; MS (ESI): 303 [M+H]+;
HRMS (ESI) calcd for C19H15O2N2 [M+]+ 303.1133; found:
15 303.1178.
(1,3-diphenyl-1H-pyrazol-4-yl)(1-(4-methoxybenzyl)-1H-
70 1,2,3-triazol-4-yl)methanone (10)
Light brown solid, yield 69%, Mp: 202-204 ºC.; 1H NMR (300
MHz, CDCl3) δ 9.57 (s, 1H), 8.07 (s, 1H), 7.91 – 7.77 (m, 4H),
7.51 (t, J = 7.8 Hz, 2H), 7.46 – 7.33 (m, 4H), 7.29 – 7.20 (m,
2H), 6.90 (d, J = 8.7 Hz, 2H), 5.50 (s, 2H), 3.79 (s, 3H). 13C
75 NMR (125 MHz, CDCl3) δ 178.3, 160.1, 155.0, 149.2, 139.2,
134.6, 132.5, 129.9, 129.4, 129.3, 128.6, 127.8, 127.4, 127.2,
125.4, 119.7, 119.2, 114.6, 55.3, 54.1.; MS (ESI): 436 [M+H]+;
HRMS (ESI) calcd for C26H22O2N5 [M+H]+ 436.1773; found:
436.1792.
1-(1-phenyl-3-(3,4,5-trimethoxyphenyl)-1H-pyrazol-4-
yl)prop-2-yn-1-one (6e)
Light yellow solid, yield 78%, Mp: 147-149 ºC.; 1H NMR (300
MHz, CDCl3) δ 8.61 (s, 1H), 7.73 (d, J = 7.9 Hz, 2H), 7.45 (t, J
20 = 7.8 Hz, 2H), 7.33 (t, J = 7.4 Hz, 1H), 7.18 (d, J = 5.3 Hz,
1H), 7.09 (d, J = 13.7 Hz, 1H), 3.86 (s, 6H), 3.83 (s, 3H), 3.21
(s, 1H); 13C NMR (75 MHz, CDCl3) δ 169.3, 153.1, 152.8,
139.0, 138.7, 135.9, 129.7, 128.1, 126.6, 122.3, 119.8, 106.6,
81.7, 60.9, 56.2. MS (ESI): 363 [M+H]+; HRMS (ESI) calcd
25 for C21H18O4N2 [M+H]+ 362.1266; found: 362.1370.
General procedure for the synthesis of pyrazole-triazole
hybrids (7-36)
80 (1-(3,4-dimethoxybenzyl)-1H-1,2,3-triazol-4-yl)(1,3-
diphenyl-1H-pyrazol-4-yl)methanone (11)
Light brown solid, yield 71%, Mp: 142-144 ºC.; 1H NMR (500
MHz, CDCl3) δ 9.58 (s, 1H), 8.10 (s, 1H), 7.87 (d, J = 7.62 Hz,
2H), 7.82 (d, J = 8.4 Hz, 2H), 7.50 (t, J = 8.0 Hz, 2H), 7.45 –
85 7.39 (m, 3H), 7.37 (t, J = 7.4 Hz, 1H), 6.90 (dd, J = 8.2, 1.9 Hz,
1H), 6.85 (d, J = 8.2 Hz, 1H), 6.82 (d, J = 1.9 Hz, 1H), 5.48 (s,
2H), 3.88 (s, 3H), 3.84 (s, 3H); 13C NMR (75 MHz, CDCl3) δ
178.3, 55.1, 149.7, 149.6, 139.2, 134.6, 132.5, 129.5, 129.4,
128.7, 127.9, 127.5, 125.9, 121.2, 119.8, 119.2, 111.4, 56.3,
90 54.6.; MS (ESI): 466 [M+H]+; HRMS (ESI) calcd for
C27H24O3N5 [M+H]+ 466.18737; found: 466.18704.
(1,3-diphenyl-1H-pyrazol-4-yl)(1-(3,4,5-trimethoxybenzyl)-1H-
1,2,3-triazol-4-yl)methanone (12)
To
a solution of compounds (6 a-e, 2.0 mmol) and
corresponding aryl azides (2.0 mmol) in a mixture of t-
30 BuOH/H2O 1:2 (10 mL) was added CuSO4•5H2O (2.0 mmol)
and sodium ascorbate (10.0 mmol). The reaction mixture was
stirred at room temperature overnight. After completion of the
reaction, the mixture was diluted with 80 ml of H2O and
extracted with CHCl3 (2X20 mL). The combined extracts were
35 dried over Na2SO4, and evaporated in vacuo. The crude product
was purified by column chromatography using EtOAc/hexane
as eluent.
Light brown solid, yield 79%, Mp: 175-177 ºC.; 1H NMR (300
95 MHz, CDCl3) δ 9.60 (s, 1H), 8.13 (s, 1H), 7.88 (d, J = 8.1 Hz,
2H), 7.85 – 7.80 (m, 2H), 7.51 (t, J = 7.7 Hz, 2H), 7.35-7.45
(m, 4H), 6.54 (s, 2H), 5.47 (s, 2H), 3.84 (s, 9H). 13C NMR (126
MHz, CDCl3) δ 178.4, 155.2, 153.8, 149.3, 139.2, 138.6, 134.7,
132.5, 129.4, 129.1, 128.7, 127.9, 127.6, 119.8, 119.2, 105.6,
100 60.9, 56.2, 54.8.; MS (ESI): 496 [M+H]+; HRMS (ESI) calcd
for C28H26O4N5 [M+H]+ 496.19793; found: 496.19797.
(1-(4-fluorobenzyl)-1H-1,2,3-triazol-4-yl)(3-(4-
fluorophenyl)-1-phenyl-1H-pyrazol-4-yl)methanone (13)
Light brown solid, yield 80%, Mp: 163-165 ºC.; 1H NMR (500
105 MHz, CDCl3) δ 9.59 (s, 1H), 8.13 (s, 1H), 7.89 – 7.79 (m, 4H),
7.51 (t, J = 7.8 Hz, 2H), 7.38 (t, J = 7.4 Hz, 1H), 7.31 (dd, J =
8.4, 5.2 Hz, 2H), 7.16 – 7.02 (m, 4H), 5.55 (s, 2H). 13C NMR
(75 MHz, CDCl3) δ 178.1, 164.8, 161.5, 154.1, 139.1, 134.8,
131.4, 131.2, 130.2, 130.1, 129.5, 128.6, 127.6, 127.4, 119.7,
110 119.1, 116.5, 116.2, 114.9, 114.6, 53.7.; MS (ESI): 442
[M+H]+; HRMS (ESI) calcd for C25H18ON5F2 [M+H]+
442.14739; found: 442.14725.
(1,3-diphenyl-1H-pyrazol-4-yl)(1-(4-fluorobenzyl)-1H-1,2,3-
triazol-4-yl)methanone (7)
40 Light brown solid, yield 69%, Mp: 179-181 ºC.; 1H NMR (300
MHz, CDCl3) δ 9.58 (s, 1H), 8.12 (s, 1H), 7.87 (d, J = 7.9 Hz,
2H), 7.82 (d, J = 7.2 Hz, 2H), 7.51 (t, J = 7.6 Hz, 2H), 7.35-
7.45 (m, 4H), 7.27-7.33 (m, 2H), 7.08 (t, J = 8.3 Hz, 2H), 5.55
(s, 2H). 13C NMR (75 MHz, DMSO-d6) δ 177.4, 163.5, 160.2,
45 153.7, 138.2, 133.6, 131.7, 129.5, 128.7, 128.4, 127.7, 126.9,
126.6, 118.6, 115.2, 52.4.; MS (ESI): 424 [M+H]+; HRMS
(ESI) calcd for C25H19ON5F [M+H]+ 424.15681; found:
424.15679.
(1-(4-chlorobenzyl)-1H-1,2,3-triazol-4-yl)(1,3-diphenyl-1H-
50 pyrazol-4-yl)methanone (8)
Brown solid, yield 74%, Mp: 185-187 ºC.; 1H NMR (500 MHz,
CDCl3) δ 9.57 (s, 1H), 8.16 (s, 1H), 7.87 (d, J = 7.5 Hz, 2H),
7.82 (d, J = 6.4 Hz, 2H), 7.50 (t, J = 7.3 Hz, 2H), 7.45 – 7.32
(m, 6H), 7.22 (d, J = 7.9 Hz, 2H), 5.51 (s, 2H). 13C NMR (75
55 MHz, DMSO-d6) δ 177.7, 154.1, 148.5, 138.6, 134.2, 133.9,
132.0, 128.9, 128.7, 128.0, 127.2, 127.0, 119.0, 118.7, 52.9.;
MS (ESI): 440 [M+H]+; HRMS (ESI) calcd for C25H19ON5Cl
[M+H]+ 440.12726; found: 440.12755.
(1-(4-chlorobenzyl)-1H-1,2,3-triazol-4-yl)(3-(4-
fluorophenyl)-1-phenyl-1H-pyrazol-4-yl)methanone (14)
115 Light brown solid, yield 77%, Mp: 184-186 ºC.; 1H NMR (300
MHz, CDCl3) δ 9.60 (s, 1H), 8.15 (s, 1H), 7.86 (m, 4H), 7.53
This journal is © The Royal Society of Chemistry [year]
Journal Name, [year], [vol], 00–00 | 9

View Article Online
DOI: 10.1039/C5OB00842E
Organic & Biomolecular Chemistry
Page 10 of 14
(t, J = 7.8 Hz, 2H), 7.40 (m, 3H), 7.26 (d, J = 8.5 Hz, 2H), 7.13
458.11784; found: 458.11728.
(t, J = 8.8 Hz, 2H), 5.56 (s, 2H). 13C NMR (75 MHz, CDCl3) δ
178.2, 164.8, 161.5, 154.1, 149.5, 139.1, 135.2, 134.8, 132.1,
131.4, 131.2, 129.5, 127.6, 127.4, 119.7, 119.0, 115.0, 114.7,
53.4.; MS (ESI): 458 [M+H]+; HRMS (ESI) calcd for
C25H18ON5ClF [M+H]+ 458.11784; found: 458.11831
(3-(4-fluorophenyl)-1-phenyl-1H-pyrazol-4-yl)(1-(4-
(trifluoromethyl)benzyl)-1H-1,2,3-triazol-4-yl)methanone (15)
Brown solid, yield 75%, Mp: 188-190 ºC.; 1H NMR (500 MHz,
10 CDCl3) δ 9.60 (s, 1H), 8.19 (s, 1H), 7.91 – 7.76 (m, 4H), 7.66
(d, J = 8.0 Hz, 2H), 7.51 (t, J = 7.7 Hz, 2H), 7.46 – 7.32 (m,
3H), 7.11 (t, J = 8.6 Hz, 2H), 5.65 (s, 2H). 13C NMR (75 MHz,
CDCl3+DMSO-d6) δ 177.9, 164.3, 161.1, 153.6, 149.0, 138.7,
137.6, 134.4, 130.9, 129.2, 128.2, 127.6, 127.3, 125.8, 119.3,
15 118.7, 114.5, 53.3.; MS (ESI): 492 [M+H]+; HRMS (ESI) calcd
for C26H18ON5F4 [M+H]+ 492.14420; found: 492.14413.
(3-(4-fluorophenyl)-1-phenyl-1H-pyrazol-4-yl)(1-(4-
60 (1-(4-chlorobenzyl)-1H-1,2,3-triazol-4-yl)(3-(4-
chlorophenyl)-1-phenyl-1H-pyrazol-4-yl)methanone (20)
Light yellow solid, yield 76%, Mp: 207-209 ºC.; 1H NMR (300
MHz, CDCl3) δ 9.58 (s, 1H), 8.15 (s, 1H), 7.85 (d, J = 7.7 Hz,
2H), 7.79 (d, J = 8.5 Hz, 2H), 7.51 (t, J = 7.8 Hz, 2H), 7.43 –
65 7.34 (m, 5H), 7.27 – 7.21 (m, 2H), 5.54 (s, 2H). 13C NMR (75
13C NMR (75 MHz, CDCl3) δ 178.1, 153.9, 139.1, 135.3,
134.8, 132.1, 131.0, 130.8, 129.5, 128.1, 127.7, 127.4, 119.9,
119.1, 53.7.; MS (ESI): 474 [M+H]+; HRMS (ESI) calcd for
C25H18ON5Cl2 [M+H]+ 474.08829; found: 474.08920.
70 (3-(4-chlorophenyl)-1-phenyl-1H-pyrazol-4-yl)(1-(4-
(trifluoromethyl)benzyl)-1H-1,2,3-triazol-4-yl)methanone (21)
Light yellow solid, yield 71%, Mp: 211-213 ºC.; 1H NMR (300
MHz, CDCl3+DMSO-d6) δ 9.14 (s, 1H), 8.63 (s, 1H), 7.86 (s,
1H), 7.62 (d, J = 7.7 Hz, 2H), 7.48 (d, J = 8.5 Hz, 2H), 7.38 (d,
75 J = 8.2 Hz, 2H), 7.24 (dd, J = 14.7, 7.7 Hz, 4H), 7.09 (dd, J =
13.2, 7.9 Hz, 2H), 5.50 (s, 2H). 13C NMR (75 MHz, CDCl3) δ
176.5, 150.6, 146.0, 137.8, 136.9, 132.8, 131.7, 129.3, 128.8,
127.7, 126.9, 126.0, 125.7, 123.8, 117.5, 50.8.; MS (ESI): 508
[M+H]+; HRMS (ESI) calcd for C26H18ON5ClF3 [M+H]+
80 508.11465; found: 508.11503.
5
methoxybenzyl)-1H-1,2,3-triazol-4-yl)methanone (16)
Light brown solid, yield 77%, Mp: 199-201 ºC.; 1H NMR (300
20 MHz, CDCl3) δ 9.61 (s, 1H), 8.08 (s, 1H), 7.93 – 7.79 (m, 4H),
7.53 (t, J = 7.8 Hz, 2H), 7.39 (t, J = 7.4 Hz, 1H), 7.33 – 7.24
(m, 2H), 7.13 (t, J = 8.8 Hz, 2H), 6.93 (d, J = 8.7 Hz, 2H), 5.53
(s, 2H), 3.83 (s, 3H). 13C NMR (126 MHz, CDCl3) δ 178.6,
164.4, 162.1, 160.1, 154.4, 149.4, 139.2, 135.2, 131.3, 129.5,
25 128.7, 127.6, 125.5, 119.8, 119.1, 114.7, 55.1, 53.7.; MS (ESI):
454 [M+H]+; HRMS (ESI) calcd for C26H21O2N5F [M+H]+
454.16738; found: 454.16706.
(3-(4-chlorophenyl)-1-phenyl-1H-pyrazol-4-yl)(1-(4-
methoxybenzyl)-1H-1,2,3-triazol-4-yl)methanone (22)
Brown solid, yield 73%, Mp: 157-159 ºC.; 1H NMR (300 MHz,
CDCl3) δ 9.58 (s, 1H), 8.07 (s, 1H), 7.85 (d, J = 7.9 Hz, 2H),
85 7.79 (d, J = 8.5 Hz, 2H), 7.51 (t, J = 7.8 Hz, 2H), 7.39 (d, J =
8.5 Hz, 2H), 7.23 (d, J = 2.26 Hz, 2H), 7.13 (t, J = 8.8 Hz, 1H),
6.91 (d, J = 8.6 Hz, 2H), 5.51 (s, 2H), 3.76 (s, 3H). 13C NMR
(75 MHz, CDCl3) δ 178.3, 160.2, 153.9, 139.1, 134.8, 130.8,
129.9, 129.5, 128.0, 127.6, 127.3, 125.4, 120.0, 119.2, 114.7,
90 113.9, 55.2, 54.1.; MS (ESI): 470 [M+H]+; HRMS (ESI) calcd
for C26H21O2N5Cl [M+H]+ 470.13783; found: 470.13810.
(3-(4-chlorophenyl)-1-phenyl-1H-pyrazol-4-yl)(1-(3,4-
(1-(3,4-dimethoxybenzyl)-1H-1,2,3-triazol-4-yl)(3-(4-
fluorophenyl)-1-phenyl-1H-pyrazol-4-yl)methanone (17)
30 Brown solid, yield 73%, Mp: 169-171 ºC.; 1H NMR (300 MHz,
CDCl3) δ 9.60 (s, 1H), 8.10 (s, 1H), 7.90 – 7.80 (m, 4H), 7.51
(t, J = 7.8 Hz, 2H), 7.38 (t, J = 7.4 Hz, 1H), 7.11 (t, J = 8.8 Hz,
2H), 6.88 (m, 3H), 5.51 (s, 2H), 3.89 (s, 3H), 3.86 (s, 3H). 13C
NMR (75 MHz, CDCl3) δ 178.4, 164.8, 161.5, 154.3, 149.6,
35 139.2, 134.8, 131.4, 129.5, 127.6, 125.9, 121.2, 119.7, 114.9,
111.4, 55.9, 54.6.; MS (ESI): 484 [M+H]+; HRMS (ESI) calcd
for C27H22O3N5FNa [M+Na]+ 506.15989; found: 506.16105.
(3-(4-fluorophenyl)-1-phenyl-1H-pyrazol-4-yl)(1-(3,4,5-
trimethoxybenzyl)-1H-1,2,3-triazol-4-yl)methanone (18)
40 Light brown solid, yield 71%, Mp: 180-182 ºC.; 1H NMR (300
MHz, CDCl3) δ 9.63 (s, 1H), 8.16 (s, 1H), 7.92 – 7.80 (m, 4H),
7.53 (t, J = 7.8 Hz, 2H), 7.39 (t, J = 7.4 Hz, 1H), 7.11 (q, J =
8.8 Hz, 2H), 6.56 (s, 2H), 5.49 (s, 2H), 3.87 (s, 6H) 3.83 (s,
3H). 13C NMR (126 MHz, CDCl3) δ 178.3, 164.1, 162.3, 154.2,
45 153.8, 149.3, 139.2, 138.6, 134.8, 131.3, 129.6, 129.0, 128.6,
127.5, 119.8, 119.1, 114.9, 105.6, 60.9, 56.2, 54.9.; MS (ESI):
514 [M+H]+; HRMS (ESI) calcd for C28H25O4N5F [M+H]+
514.18851; found: 514.18922.
dimethoxybenzyl)-1H-1,2,3-triazol-4-yl)methanone (23)
Light brown solid, yield 71%, Mp: 215-217 ºC.; 1H NMR (300
95 MHz, CDCl3) δ 9.62 (s, 1H), 8.11 (s, 1H), 7.88 (d, J = 7.8 Hz,
2H), 7.82 (d, J = 8.5 Hz, 2H), 7.53 (t, J = 7.8 Hz, 2H), 7.42-
7.29 (m, 3H), 6.98 – 6.89 (m, 2H), 6.87 (d, J = 5.8 Hz, 1H),
5.54 (s, 2H), 3.91 (s, 3H), 3.88 (s, 3H). 13C NMR (75 MHz,
CDCl3) δ 178.3, 154.0, 149.7, 149.2, 139.2, 134.8, 130.8,
100 129.5, 127.9, 127.3, 125.9, 121.2, 119.8, 111.6, 56.0, 54.5.; MS
(ESI): 500 [M+H]+; HRMS (ESI) calcd for C27H23O3N5Cl
[M+H]+ 500.14839; found: 500.14937.
(3-(4-chlorophenyl)-1-phenyl-1H-pyrazol-4-yl)(1-(3,4,5-
trimethoxybenzyl)-1H-1,2,3-triazol-4-yl)methanone (24)
105 Light brown solid, yield 81%, Mp: 193-195 ºC.; 1H NMR (500
MHz, CDCl3) δ 9.61 (s, 1H), 8.15 (s, 1H), 7.88 – 7.84 (m, 2H),
7.81 (d, J = 8.4 Hz, 2H), 7.51 (t, J = 7.3 Hz, 2H), 7.42 – 7.38
(m, 3H), 6.54 (s, 2H), 5.49 (s, 2H), 3.86 (s, 6H), 3.84 (s, 3H).
13C NMR (75 MHz, CDCl3) δ 178.5, 154.0, 153.8, 149.2,
110 139.1, 138.7, 134.8, 134.7, 131.0, 130.8, 129.6, 129.0, 128.0,
127.7, 127.4, 119.8, 119.2, 105.6, 60.8, 56.2, 54.8.; MS (ESI):
530 [M+H]+; HRMS (ESI) calcd for C28H25O4N5Cl [M+H]+
530.15996; found: 530.15994.
(3-(4-chlorophenyl)-1-phenyl-1H-pyrazol-4-yl)(1-(4-
50 fluorobenzyl)-1H-1,2,3-triazol-4-yl)methanone (19)
Light yellow solid, yield 69%, Mp: 188-190 ºC.; 1H NMR (500
MHz, CDCl3) δ 9.59 (s, 1H), 8.13 (s, 1H), 7.85 (d, J = 8.0 Hz,
2H), 7.79 (d, J = 8.3 Hz, 2H), 7.51 (t, J = 7.7 Hz, 2H), 7.39 (d,
J = 8.3 Hz, 2H), 7.31 (dd, J = 8.3, 5.2 Hz, 2H), 7.27-7.08 (m,
55 3H), 5.55 (s, 2H). 13C NMR (75 MHz, CDCl3) δ 178.2, 164.7,
161.4, 153.9, 139.1, 134.8, 131.0, 130.7, 130.1, 129.5, 128.0,
127.7, 127.4, 119.7, 119.2, 116.5, 116.2, 54.1.; MS (ESI): 458
[M+H]+; HRMS (ESI) calcd for C25H18ON5ClF [M+H]+
(1-(4-fluorobenzyl)-1H-1,2,3-triazol-4-yl)(3-(4-
115 methoxyphenyl)-1-phenyl-1H-pyrazol-4-yl)methanone (25)
Light yellow solid, yield 81%, Mp: 171-173 ºC.; 1H NMR (300
10 | Journal Name, [year], [vol], 00–00
This journal is © The Royal Society of Chemistry [year]

View Article Online
DOI: 10.1039/C5OB00842E
Page 11 of 14
Organic & Biomolecular Chemistry
MHz, CDCl3) δ 9.59 (s, 1H), 8.13 (s, 1H), 7.89 (d, J = 7.7 Hz,
= 7.4 Hz, 1H), 6.96 (d, J = 8.8 Hz, 2H), 6.54 (s, 2H), 5.46 (s,
60 2H), 3.87 (s, 6H), 3.83 (s, 6H). 13C NMR (75 MHz, CDCl3) δ
178.3, 160.1, 154.9, 153.8, 149.5, 139.3, 139.3, 138.6, 135.4,
134.7, 130.8, 129.5, 129.0, 127.4, 125.0, 119.7, 119.0, 113.3,
105.6, 60.8, 56.2, 55.3, 54.2.; MS (ESI): 526 [M+H]+; HRMS
(ESI) calcd for C29H28O5N5 [M+H]+ 526.20850; found:
65 526.20865.
2H), 7.83 (d, J = 8.8 Hz, 2H), 7.52 (t, J = 7.8 Hz, 2H), 7.40 (d,
J = 7.4 Hz, 1H), 7.37 – 7.29 (m, 2H), 7.11 (t, J = 8.6 Hz, 2H),
6.98 (d, J = 8.8 Hz, 2H), 5.57 (s, 2H), 3.87 (s, 3H). 13C NMR
(75 MHz, CDCl3+DMSO-d6) δ 177.5, 163.4, 160.2, 159.1,
153.4, 148.1, 138.2, 133.6, 129.7, 129.5, 128.6, 127.1, 126.6,
124.1, 118.6, 118.2, 115.2, 112.3, 54.3, 52.4.; MS (ESI): 454
[M+H]+; HRMS (ESI) calcd for C26H21O2N5F [M+H]+
454.16738; found: 454.16706.
5
(1-(4-fluorobenzyl)-1H-1,2,3-triazol-4-yl)(1-phenyl-3-(3,4,5-
trimethoxyphenyl)-1H-pyrazol-4-yl)methanone (31)
10 (1-(4-chlorobenzyl)-1H-1,2,3-triazol-4-yl)(3-(4-
Light yellow solid, yield 70%, Mp: 161-163 ºC.; 1H NMR (300
MHz, CDCl3) δ 9.58 (s, 1H), 8.16 (s, 1H), 7.93 – 7.83 (m, 2H),
70 7.53 (t, J = 7.8 Hz, 2H), 7.40 (d, J = 7.4 Hz, 1H), 7.38 – 7.32
(m, 2H), 7.19 (s, 2H), 7.10 (t, J = 8.6 Hz, 2H), 5.56 (s, 2H),
3.92 (s, 6H), 3.90 (s, 3H). 13C NMR (75 MHz, CDCl3+DMSO-
d6) δ 177.5, 163.4, 160.2, 159.1, 153.4, 148.1, 138.2, 133.6,
129.7, 129.5, 128.6, 127.1, 126.6, 124.1, 118.6, 118.2, 115.2,
75 112.3, 54.3, 52.4.; MS (ESI): 514 [M+H]+; HRMS (ESI) calcd
for C28H25O4N5F [M+H]+ 514.18851; found: 514.18805.
(1-(4-chlorobenzyl)-1H-1,2,3-triazol-4-yl)(1-phenyl-3-(3,4,5-
trimethoxyphenyl)-1H-pyrazol-4-yl)methanone (32)
methoxyphenyl)-1-phenyl-1H-pyrazol-4-yl)methanone (26)
Light yellow solid, yield 77%, Mp: 182-184 ºC.; 1H NMR (500
MHz, CDCl3) δ 9.57 (s, 1H), 8.12 (s, 1H), 7.84 (d, J = 8.45
Hz, 2H), 7.80 (d, J = 8.85 Hz, 2H), 7.51 (t, J = 7.9 Hz, 2H),
15 7.40 – 7.36 (m, 3H), 7.27 – 7.23 (m, 2H), 6.96 (d, J = 8.7 Hz,
2H), 5.55 (s, 2H), 3.85 (s, 3H). 13C NMR (75 MHz,
CDCl3+DMSO-d6) δ 177.5, 159.1, 153.5, 148.3, 138.3, 133.7,
132.1, 129.8, 128.9, 128.4, 127.2, 126.8, 124.1, 118.7, 118.3,
112.4, 54.4, 52.5.; MS (ESI): 470 [M+H]+; HRMS (ESI) calcd
20 for C26H21O2N5Cl [M+H]+ 470.13783; found: 470.13810.
(3-(4-methoxyphenyl)-1-phenyl-1H-pyrazol-4-yl)(1-(4-
(trifluoromethyl)benzyl)-1H-1,2,3-triazol-4-yl)methanone (27)
Light yellow solid, yield 79%, Mp: 172-174 ºC.; 1H NMR (300
MHz, CDCl3) δ 9.60 (s, 1H), 8.19 (s, 1H), 7.89 (d, J = 7.9 Hz,
25 2H), 7.83 (d, J = 8.5 Hz, 2H), 7.68 (d, J = 8.0 Hz, 2H), 7.53 (t,
J = 7.6 Hz, 2H), 7.43-7.32 (m, 3H), 6.98 (d, J = 8.4 Hz, 2H),
5.66 (s, 2H), 3.87 (s, 3H). 13C NMR (75 MHz, CDCl3+DMSO-
d6) δ 177.7, 159.3, 153.8, 138.5, 137.7, 133.9, 130.0, 128.9,
127.9, 127.5, 126.8, 125.3, 124.3, 118.9, 118.4, 112.6, 54.6,
30 52.8.; MS (ESI): 504 [M+H]+; HRMS (ESI) calcd for
C27H21N5O2F3 [M+Na]+ 504.16356; found: 504.16388.
Light yellow solid, yield 78%, Mp: 173-175 ºC.; 1H NMR (300
80 MHz, CDCl3) δ 9.57 (s, 1H), 8.17 (s, 1H), 7.88 (d, J = 7.8 Hz,
2H), 7.53 (t, J = 7.8 Hz, 2H), 7.43 – 7.35 (m, 3H), 7.29-7.23
(m, 2H), 7.19 (s, 2H), 5.55 (s, 2H), 3.92 (s, 6H), 3.90 (s, 3H);
13C NMR (75 MHz, CDCl3) δ 178.2, 154.7, 152.7, 139.1,
138.6, 135.2, 134.9, 132.2, 129.7, 129.5, 127.9, 127.6, 119.8,
85 119.2, 106.8, 60.8, 56.2, 53.7.; MS (ESI): 530 [M+H]+; HRMS
(ESI) calcd for C28H25O4N5Cl [M+H]+ 530.15896; found:
530.15909.
(1-phenyl-3-(3,4,5-trimethoxyphenyl)-1H-pyrazol-4-yl)(1-(4-
(trifluoromethyl)benzyl)-1H-1,2,3-triazol-4-yl)methanone (33)
90 Light yellow solid, yield 75%, Mp: 202-204 ºC.; 1H NMR (300
MHz, CDCl3) δ 9.59 (s, 1H), 8.22 (s, 1H), 7.89 (d, J = 7.6 Hz,
2H), 7.67 (d, J = 8.1 Hz, 2H), 7.53 (t, J = 7.8 Hz, 2H), 7.41 (m,
3H), 7.19 (s, 2H), 5.66 (s, 2H), 3.92 (s, 6H), 3.90 (s, 3H). 13C
NMR (75 MHz, CDCl3) δ 178.0, 154.6, 152.7, 149.6, 139.2,
95 138.8, 137.7, 134.9, 129.5, 128.5, 127.6, 126.3, 119.8, 119.2,
107.0, 60.8, 56.2, 53.7.; MS (ESI): 564 [M+H]+; HRMS (ESI)
calcd for C29H25O4N5F3 [M+H]+ 564.18532; found: 564.18579.
(1-(4-methoxybenzyl)-1H-1,2,3-triazol-4-yl)(1-phenyl-3-
(3,4,5-trimethoxyphenyl)-1H-pyrazol-4-yl)methanone (34)
100 Light brown solid, yield 75%, Mp: 196-198 ºC.; 1H NMR (300
MHz, CDCl3) δ 9.57 (s, 1H), 8.10 (s, 1H), 7.88 (d, J = 7.9 Hz,
2H), 7.59 – 7.46 (m, 2H), 7.39 (t, J = 7.4 Hz, 1H), 7.33 – 7.24
(m, 2H), 7.19 (s, 2H), 6.93 (d, J = 8.6 Hz, 2H), 5.53 (s, 2H),
3.92 (s, 6H), 3.91 (s, 3H), 3.82 (s, 3H). 13C NMR (75 MHz,
105 CDCl3) δ 178.3, 160.1, 154.8, 152.6, 149.2, 139.1, 138.5,
134.9, 130.0, 129.5, 127.6, 127.3, 125.5, 119.7, 119.2, 114.7,
106.7, 60.8, 56.1, 55.3, 54.0.; MS (ESI): 526 [M+H]+; HRMS
(ESI) calcd for C29H28O5N5 [M+H]+ 526.20850; found:
526.20848.
(1-(4-methoxybenzyl)-1H-1,2,3-triazol-4-yl)(3-(4-
methoxyphenyl)-1-phenyl-1H-pyrazol-4-yl)methanone (28)
Light brown solid, yield 73%, Mp: 165-167 ºC.; 1H NMR (300
35 MHz, CDCl3) δ 9.57 (s, 1H), 8.06 (s, 1H), 7.86 (d, J = 7.8 Hz,
2H), 7.81 (d, J = 8.8 Hz, 2H), 7.50 (t, J = 7.8 Hz, 2H), 7.36 (t, J
= 7.4 Hz, 1H), 7.30 – 7.23 (m, 4H), 7.06-6.94 (m, 2H), 5.51 (s,
2H), 3.85 (s, 3H), 3.81 (s, 3H). 13C NMR (126 MHz, CDCl3) δ
178.4, 160.2, 154.8, 149.4, 139.3, 134.7, 130.7, 129.9, 129.5,
40 127.4, 125.6, 125.0, 119.7, 119.0, 114.6, 113.3, 55.3, 54.0.; MS
(ESI): 466 [M+H]+; HRMS (ESI) calcd for C27H24O3N5
[M+H]+ 466.18737; found: 466.18702.
(1-(3,4-dimethoxybenzyl)-1H-1,2,3-triazol-4-yl)(3-(4-
methoxyphenyl)-1-phenyl-1H-pyrazol-4-yl)methanone (29)
45 Light brown solid, yield 76%, Mp: 181-183 ºC.; 1H NMR (300
MHz, CDCl3) δ 9.57 (s, 1H), 8.10 (s, 1H), 7.90 – 7.77 (m, 4H),
7.50 (t, J = 7.8 Hz, 2H), 7.36 (t, J = 7.4 Hz, 1H), 6.96 (d, J =
8.8 Hz, 2H), 6.90 – 6.80 (m, 3H), 5.49 (s, 2H), 3.88 (s, 3H),
3.85 (s, 3H), 3.84 (s, 3H). 13C NMR (75 MHz, CDCl3) δ 178.4,
50 160.1, 154.8, 149.6, 139.3, 134.7, 130.7, 129.5, 127.3, 126.0,
125.0, 121.2, 119.7, 119.1, 113.3, 111.5, 56.0, 55.2, 54.4.; MS
(ESI): 496 [M+H]+; HRMS (ESI) calcd for C28H26O4N5
[M+H]+ 496.19793; found: 496.19768.
(3-(4-methoxyphenyl)-1-phenyl-1H-pyrazol-4-yl)(1-(3,4,5-
55 trimethoxybenzyl)-1H-1,2,3-triazol-4-yl)methanone (30)
Light yellow solid, yield 71%, Mp: 175-177 ºC.; 1H NMR (500
MHz, CDCl3) δ 9.60 (s, 1H), 8.15 (s, 1H), 7.87 (d, J = 8.5 Hz,
2H), 7.80 (d, J = 8.8 Hz, 2H), 7.51 (t, J = 7.4 Hz, 2H), 7.37 (t, J
110 (1-(3,4-dimethoxybenzyl)-1H-1,2,3-triazol-4-yl)(1-phenyl-3-
(3,4,5-trimethoxyphenyl)-1H-pyrazol-4-yl)methanone (35)
Light brown solid, yield 71%, Mp: 170-172 ºC.; 1H NMR (300
MHz, CDCl3) δ 9.57 (s, 1H), 8.11 (s, 1H), 7.84 (t, J = 15.4 Hz,
2H), 7.56 – 7.44 (m, 2H), 7.43 – 7.33 (m, 2H), 7.19 (s, 2H),
115 6.98 (d, J = 8.2 Hz, 1H), 6.94 - 6.89 (m, 1H), 5.52 (s, 2H), 3.94
(s, 3H), 3.91 (s, 6H), 3.89 (s, 3H), 3.86 (s, 3H). 13C NMR (126
This journal is © The Royal Society of Chemistry [year]
Journal Name, [year], [vol], 00–00 | 11

View Article Online
DOI: 10.1039/C5OB00842E
Organic & Biomolecular Chemistry
Page 12 of 14
MHz, CDCl3) δ 190.9, 178.4, 154.8, 152.7, 149.6, 139.2, 134.9,
independent experiments.
In vitro Migration Assay
The wound-healing assay is a proven method to study astrocyte
cell migration. U87MG cells (5x105 cells/well) were cultured
in 6 well plates as confluent monolayers for 24 h. The
monolayers were then scratched with 200 µL pipette tip. The
65 wounded monolayers were washed twice with PBS to remove
non-adherent cells. Then, media containing the test compounds
17, 23 and 29 at their IC50 concentrations were added to each
well. Cells which migrated across the inflicted wound were
photographed under the phase contrast microscope (Nikon) at 0
70 h and 24 h time interval after treatment in three or more
randomly selected fields. The cells that migrated to the
wounded areas were counted and the percentage of migrated
cells in each experimental condition was calculated in
comparison to control cells (DMSO exposed cells).
129.5, 127.6, 125.9, 121.3, 119.8, 119.3, 111.5, 110.4, 109.1,
106.9, 60.7, 56.0, 54.5.; MS (ESI): 556 [M+H]+; HRMS (ESI)
calcd for C30H30O6N5 [M+H]+ 556.21906; found: 557.19275.
(1-phenyl-3-(3,4,5-trimethoxyphenyl)-1H-pyrazol-4-yl)(1-
(3,4,5-trimethoxybenzyl)-1H-1,2,3-triazol-4-yl)methanone (36)
Light yellow solid, yield 71%, Mp: 162-164 ºC.; 1H NMR (500
MHz, CDCl3) δ 8.45 (s, 1H), 7.77 (d, J = 8.0 Hz, 2H), 7.49 (d,
J = 9.1 Hz, 2H), 7.35 (t, J = 7.2 Hz, 1H), 7.27 (dd, J = 11.1, 8.9
10 Hz, 1H), 6.98 (s, 2H), 6.28 (s, 2H), 5.52 (s, 2H), 3.94 (s, 6H),
3.91 (s, 3H), 3.86 (s, 6H), 3.81 (s, 3H). 13C NMR (126 MHz,
CDCl3) δ 178.3, 154.8, 153.8, 152.7, 149.4, 139.2, 138.7,
135.0, 129.5, 127.6, 119.8, 119.3, 106.9, 105.6, 60.1, 56.2,
54.8.; MS (ESI): 586 [M+H]+ and [M+Na] + 608; HRMS (ESI)
15 calcd for C31H32O7N5 [M+H]+ 586.2301; found: 586.2314.
Cell culture
60
5
HT-29 (colon), PC-3 (prostate), A549 (lung) and U87MG
(brain) cancer cells were purchased from ATCC (Manassas,
VA) and HaCaT cells were purchased from Lifetchnologies.
20 The PC-3, A549 and HaCaT cells were grown in RPMI 1640
medium (GIBCO-Invitrogen, NY) with 10% fetal bovine serum
(FBS) and supplemented with glutamine (2 mmol/L), penicillin
G (100 µg/mL), and streptomycin (100 µg/mL) at 37 ºC under
5% CO2. HT-29 and U87MG cells were maintained in
25 Dulbecco’s modified Eagle’s medium (DMEM) containing
10% fetal bovine serum (FBS), 1% penicillin/ streptomycin at
37 ºC under 5% CO2. The medium was changed every two
days. After reaching 80 - 90% confluence, cells were treated
with 0.25% trypsin-EDTA for further passage. For all the
30 experiments cells were used at passages 4–10.
75 Cell cycle analysis
U87MG cells (1x106 cells /well) in 6 well plate were treated
with IC50 concentrations of the compounds 17, 23 and 29. After
24 h treatment, both floating and trypsinised cells were
harvested and washed with PBS. The cells were fixed with 70
80 % ethanol for 30 min at 4 ºC. After fixation, cells were washed
with PBS and stained with Propidium Iodide staining buffer (PI
(200 µg), 0. 1 % (v/v) Triton X-100, 2 mg DNAse-free RNAse
A (Sigma) in 10 mL PBS) for 15 min at room temp in dark.
The samples were then analyzed for Propidium Iodide-DNA
85 fluorescence from 10000 events by flow cytometry using
FACS Canto-II (Becton Dickinson, USA).
Hoechst staining
Human Brain cancer U87MG cells (5X104 cells/well) at their
growth phase were seeded in 12 well plates and allowed to
90 adhere for 24 h. The culture medium containing the test
compounds 17, 23 and 29 at their IC50 concentration were
added to the cells and incubated for 24 h at 37 ºC. After 24 h,
culture medium was removed; cells were washed with PBS and
fixed with 4 % para formaldehyde solution at 4 ºC for 10 min.
95 The cells were washed twice with PBS and stained with
Hoechst 33242 (5 µg/mL) for 30 min at room temp. The excess
dye was removed by washing twice with PBS and cells were
examined for morphological changes under fluorescence
microscope using 350 nm excitation and 460 nm emission
100 (Nikon, magnification 10X).
MTT assay
MTT assay was carried out on HT-29, U87MG, A549 and PC-
3 cells to test the cytotoxicity of the synthesized pyrazolo-
triazole compounds (7-36). The cells under study were
35 harvested, counted and seeded into a 96 well plate at a density
of 3000-5000 cells per well depending on their doubling times.
The cells were allowed to adhere for 24 h at 37˚C and 5 %
CO2. After 24 h incubation, the culture media was removed,
100 µL of test chemical dissolved in dimethyl sulphoxide
40 (DMSO) and culture medium was added to the cells, culture
medium containing DMSO only (without test compounds) was
used for the control cells. Then, the cells were incubated with
compounds for 48 h under the same conditions. After 48 h, the
culture medium containing compounds was removed and 100
45 µL of culture media containing 5 mg/ml MTT (Thiazoyl blue
tetrazolium bromide) was added to each well and cells were
further incubated for 4 hours. After 4 hours incubation the
media containing MTT was aspirated and 100 µL DMSO was
added to each well to solubilize the crystallized formazan
50 product. The plates were read on a plate reader at 570 nm and a
reference wavelength of 630 nm. The absorbance readings for
630 nm were subtracted from the 570 nm readings and the
results were adjusted by dividing the average by the DMSO
control to adjust for any toxicity that may have occurred in this
55 control treatment set. The Percentage inhibition was calculated
as 100-[(Mean OD of treated cell x 100)/Mean OD of vehicle
treated cells (DMSO)]. The IC50 Values were calculated using
Probit Software. All the tests were repeated in at least three
Acridine Orange/Ethidium Bromide (AO/EB) staining
U87 MG cells were grown in 24 well plates (50,000 cells/well)
for 24 h and were treated with and without IC50 concentration
of compounds 17, 23 and 29 for 24 h. After treatment, cells
105 were washed twice with phosphate buffer saline (PBS) and
fixed with 4 % para formaldehyde at 4 ºC for 10 min. Then, the
cells were incubated with 0.5 mL of PBS solution containing
mixture of Acridine Orange and Ethidium Bromide (1:1, 100
µg/mL) in dark for 10 min at 37 ºC. The stained cells were
110 washed with PBS to remove the excess dye and the cells were
observed immediately under fluorescence microscope (Nikon).
Annexin V-FITC/Propidium Iodide dual staining assay
Cells were seeded at 1x106/well into 6-well plates, and treated
with IC50 concentrations of the compounds 17, 23, 29 and 5-
115 Flurouracil (5-FU) for 24 h. The cells were washed with cold
PBS and then cells were collected and resuspend Binding
12 | Journal Name, [year], [vol], 00–00
This journal is © The Royal Society of Chemistry [year]

View Article Online
DOI: 10.1039/C5OB00842E
Page 13 of 14
Organic & Biomolecular Chemistry
Buffer (0.1 M Hepes/ NaOH (pH 7.4), 1.4 M NaCl, 25 mM
mM), 2 µL of 10X random primers in 3.2 uL of nuclease free
60 water. The PCR cycles used for Reverese Transcription were:
25 ºC for 10 min followed by 37 ºC for 2 h, 85 ºC for 5 min and
finally hold at 4 ºC. The resulting cDNA was stored at −20 °C
until use. Further, PCR was carried out in a volume of 10 µL
reaction mixtures in PCR fast reaction tubes (Applied
65 Biosystems), contained 2.5 µL of DI water, 5 µL of TaqMan
Universal Master Mix (Applied Biosystems), 0.5 µL (300 nM)
of assay primers (Eurofins, Germany) and 2 µL of cDNA. The
specific gene primers (Bax, Bcl-2 and the internal control gene
β-actin) were used to amplify the target genes. The sequences
70 of the human genome based primers; probes used for RT-PCR
are
CaCl2) at a concentration of 5x105 cells/mL and incubated with
Annexin V-FITC and Propidium Iodide for 15 min in dark. The
cells were analysed immediately by BD-C6 accuri
Flowcytometer.
5
DNA Fragmentation Assay
U87MG cells were grown in presence of compounds 17, 23, 29
and 5-Flurouracil (5-FU) with their IC50 conc for 24 h. Cells
were harvested and genomic DNA was extracted using
10 standard protocol. DNA was resuspended in 50 µL of TBE
buffer. The DNA samples were electrophoresed on 1.5 %
agarose gel and visualized by ethidium bromide staining and
photographed by ChemiDoc (BioRad, Milano,Italy).
Measurement of Mitochondrial Membrane Potential
15 (MMP)
β-actin (CCTTTGCCGATCCGCCGCCCGTCCA),
Bax (CTGGTGCTCAAGGCCCTGTGCACCA),
U87MG cells were cultured in 6 well plates at a density of
5x105 cells/mL and allowed to grow over night. The cells were
treated with the test compounds 17, 23, 29 and 5-Flurouracil
(5-FU) with their IC50 concentration for 24 h. After 24 h
20 treatment, the adherent cells were collected by trypsinsation,
washed with PBS and resuspended in solution of PBS
containing Rhodamine-123 (10 µg/mL). After incubation for
30 min at room temp, cells were washed twice with PBS and
resuspended in PBS. The samples were analyzed for
25 fluorescence using spectroflourimeter
Bcl-2 (CGGAGGCTGGGATGCCTTTGTGGAA),
o
75
The PCR cycles used were: 1 cycle of 95 C for 3 min to
activate the enzyme, followed by 40 cycles of 95 oC for 1
o
second (denaturation) and 60 C for 20 seconds (annealing and
extension). Fold change in mRNA expression levels were
determined by the comparative CT method. CT of β-actin was
80 used as an internal control. PCR products were run on a 1.5 %
agarose gel containing ethidium bromide and viewed under UV
light. Signal intensities for the PCR products were analyzed
using Quantiscan software (Biosoft, Cambridge, MA, USA).
Measurement of Reactive Oxygen Species (ROS) levels
Intracellular ROS levels were measured by using Carboxy-2’,
7’-dichlorofluorescin diacetate (Carboxy-DCFDA). U87MG
cells were plated in 6 well plates at a density of 5x105 cells/mL
30 and allowed to grow overnight. The cells were incubated with
the IC50 concentrations of the compounds 17, 23, 29 and 5-
Flurouracil (5-FU) for 24 h. After treatment, the medium was
replaced with the culture medium containing DCFDA (10 µM)
and further incubated for 30 min at room temperature in dark.
35 Cells were washed with PBS, collected from the plate and
resuspended in PBS at 5x104 cells/mL. The fluorescence
intensity of the 2’, 7’-dichlorofluorscein formed by the
hydrolysis of Carboxy-DCFDA from each sample was
analyzed by spectroflourimeter at an excitation and emission
40 wavelength of 488 and 525nm, respectively. Qualitative
cellular fluorescence images were captured by using Nikon
ECLIPSETE2000-S fluorescence microscope.
85 References
1. R. Seigel, D. Naishadham, A. Jemal, CA Cancer J. Clin.
2013, 63, 11-30.
2. G. Kibria, H. Hatakeyama, H. Harashima, Arch. Pharm.
90
95
Res. 2014, 37, 4-15.
3. S. Fulda, Int. J. Cancer 2009, 124, 511-515.
4. J.C. Reed, Nat. Rev. Drug Disc. 2002, 1, 111-121.
5. H. Kumar, D. Saini, S. Jain, N. Jain, Euro. J. Med. Chem.
2013, 70, 248-258.
6. V. Kumar, K. Kaur, G.K. Gupta, A.K. Sharma, Eur. J. Med.
Chem. 2013, 69, 735-753.
7. J.J. Dong, Q.S. Li, S.F. Wang, C.Y. Li, X. Zhao, H.Y. Qiu,
M.Y. Zhao, H.L. Zhu, Org. Biomol. Chem. 2013, 11, 6328-
6237.
100
105
110
115
120
8. A. Kamal, A.B. Shaik, S. Polepalli, V.S. Reddy, G.B.
Kumar, S. Gupta, K.V. Krishna, A. Nagabhushana, R.K.
Mishra, N. Jain, Org. Biomol. Chem. 2014, 12, 7993-8007.
9. C. Wasylyk, H. Zheng, C. Castell, L. Debussche, M.C.
Multon, B. Wasylyk, Cancer Res. 2008, 68, 1275-1283.
10. C.H. Jin, M. Krishnaiah, D. Sreenu, K.S. Rao, V.B.
Subrahmanyam, C.Y. Park, J.Y. Son, Y.Y. Sheen, D.K.
Kim, Bioorg. Med. Chem. 2011, 19, 2633-2640.
RT-PCR
45 U87MG Cells (1X106 cells/well) in 6 well plates were exposed
to the compounds 17, 23, 29 and 5-Flurouracil (5-FU) with
their IC50 concentrations. After 24h incubation time, total RNA
from the cells was extracted using TRIZOL reagent (Life
Technologies, Carlsbad, CA, 12183-555) according to the
50 manufacturer’s protocol. The obtained RNA was solubilized in
50 µL of DEPC water and stored at −80 °C. RNA
concentration was determined using a Nano drop (Thermo
Scientific, USA) by measuring the optical density at 260 nm
and 280 nm. This method yielded an average of 30 µg total
55 RNA from 106 cells. cDNA synthesis from RNA was
performed in a total volume of 20 µL reaction mixture
containing 1 µg of RNA in 10 µL nuclease free water along
with 2 µL of 10X RT buffer, 0.8 µL of 25X dNTP Mix (100
11. L. Dalla Via, A.M. Marini, S. Salerno, C. La Motta, M.
Condello, G. Arancia,E. Agostinelli, A. Toninello, Bioorg.
Med. Chem. 2009, 17, 326-336.
12. Y. Yao, C. Liao, Z. Li, Z. Wang, Q. Sun, C. Liu, Y. Yang,
Z. Tu, S. Jiang, Eur. J. Med.Chem. 2014, 86, 639-652.
13. H. Xian-Feng Huang, L. Xiang, Z. Yong, S. Guo-Qiang, H.
Qi-Long, L. Qing-Shan, Y. Xian-Hui, W. Yao, Z. Hai-
Liang, Bioorg. Med. Chem. 2012, 20, 4895-4900.
14. M.R. Michaelides, PCT Int. Appl. WO 2010065825, 2010.
15. S.G. Agalave, S.R. Maujan, V.S. Pore, Chem. Asian J.
2011, 6, 2696-2718.
16. M.P. Zavelevich, L.M. Kuiava, V.F. Chekhun, D.Y.
Blokhin, A.S. Kiselyov, M.N. Semenova, V.V. Semenov,
Bioorg. Med. Chem. 2014, 22, 738-755.
This journal is © The Royal Society of Chemistry [year]
Journal Name, [year], [vol], 00–00 | 13

View Article Online
DOI: 10.1039/C5OB00842E
Organic & Biomolecular Chemistry
Page 14 of 14
17. J.A. Stefely, R. Palchaudhuri, P.A. Miller, R.J. Peterson,
G.C. Moraski, P.J. Hergenrother, M.J. Miller, J. Med.
Chem. 2010, 53, 3389-3395.
18. A. Kamal, A.V. Subba Rao, M.V. Vishnuvardhan, T.
Srinivas Reddy, K. Swapna, C. Bagul, N.V. Subba Reddy,
V. Srinivasulu, Org. Biomol. Chem. 2015, 13, 4879-4895.
19. W.S. Horne, M.K. Yadav, C.D. Stout, M.R. Ghadiri, J. Am.
Chem. Soc. 2004, 126, 15366-15367.
20. M.J. Soltis, H.J. Yeh, K.A. Cole, N. Whittaker, R.P. Wersto,
E.C. Kohn, Drug Metab. Dispos. 1996, 24, 799-806.
21. O. Prakash, K. Pannu, A. Kumar, Molecules 2006, 11, 43-
48.
22. M. Holtje, A. Hoffmann, F. Hofmann, C. Mucke, G. Grosse,
N. Van Rooijen, H. Kettenmann, I. Just, G. Ahnert-Hilger,
J. Neurochem. 2005, 95, 1237-1248.
23. T. Mosmann, J. Immunol. Meth. 1983, 65, 55-63.
24. A. Kamal, B. Shaik, V.L. Nayak, B. Nagaraju,,J.S. Kapure,
M.S. Malik, T.B. Shaik, B. Prasad, Bioorg. Med. Chem.
2014, 22, 5155-5167.
25. C.D. Fan, H. Su, J. Zhao, B.X. Zhao, S.L. Zhang, J.Y. Miao,
Eur. J. Med. Chem. 2010, 45, 1438-1446.
26. Q. Hou, T.B. Zhao, H.L. Zhang, H.X. Lu, Q.X. Zhang, L.
Sun, Z. Fan, Mol. Immunol. 2008, 45, 1044-1055.
27. D.V. Krysko, F. Roels, L. Leybaert, K.D. Herede, J.
Histochem, Cytochem. 2001, 49, 1277-1284.
28. R.D. Miao, Y. Han, L.Z. An, J.B. Yang, Q. Wang, Cell Biol.
Int. 2008, 32, 217-223.
29. D. Trachootham, J. Alexandre, P. Huang, Nat. Rev. Drug
Discovery 2009, 8, 579-591.
5
10
15
20
25
30
35
30. C.P. LeBel, H. Ischiropoulos, S.C. Bondy, Chem. Res.
Toxicol. 1992, 5, 227-231.
31. M. Raff, Nature, 1998, 396, 119-122.
32. R. Kim, Biochem. Biophys Res. Comm. 2005, 333, 336-343.
33. X. Li, X. Lu, M. Xing, X.H. Yang, T.T. Zhao, H.B. Gong,
H.L. Zhu, Bioorg. Med. Chem. Lett. 2012, 22, 3589-3593.
40
aMedicinal Chemistry and Pharmacology, bIICT-RMIT
Research Centre, CSIR-Indian Institute of Chemical
Technology, Hyderabad, 500007, India
45
50
55
60
E-mail: ahmedkamal@iict.res.in
Phone: (+)91-40-27193157; Fax: (+)91-40-27193189;
cIan Potter NanoBioSensing Facility, Nano Biotechnology
Research Laboratory, School of Applied Sciences, RMIT
University, Melbourne, VIC, 3000, Australia
dHealth Innovations Research Institute, RMIT University,
Melbourne, Australia
eCentre for Advanced Materials and Industrial Chemistry,
RMIT University, Melbourne 3000, Australia
E-mail: ravi.shukla@rmit.edu.au
Phone: 0061 3 9925 2970; Fax: 0061 3 9925 2882
†Electronic Supplementary Information (ESI) available:
[details of
1H and 13C NMR spectra of the new
compounds]. See DOI: 10.1039/b000000x/
14 | Journal Name, [year], [vol], 00–00
This journal is © The Royal Society of Chemistry [year]