Trimethoprim resistance of dihydrofolate reductase variants from clinical isolates of Pneumocystis jirovecii

Article abstract of DOI:10.1128/AAC.01161-13

Pneumocystis jirovecii is an opportunistic pathogen that causes serious pneumonia in immunosuppressed patients. Standard therapy and prophylaxis include trimethoprim (TMP)-sulfamethoxazole; trimethoprim in this combination targets dihydrofolate reductase (DHFR). Fourteen clinically observed variants of P. jirovecii DHFR were produced recombinantly to allow exploration of the causes of clinically observed failure of therapy and prophylaxis that includes trimethoprim. Six DHFR variants (S31F, F36C, L65P, A67V, V79I, and I158V) showed resistance to inhibition by trimethoprim, with K_i values for trimethoprim 4-fold to 100-fold higher than those for the wild-type P. jirovecii DHFR. An experimental antifolate with more conformational flexibility than trimethoprim showed strong activity against one trimethoprim-resistant variant. The two variants that were most resistant to trimethoprim (F36C and L65P) also had increased K_m values for dihydrofolic acid (DHFA). The catalytic rate constant (k_cat) was unchanged for most variant forms of P. jirovecii DHFR but was significantly lowered in F36C protein; one naturally occurring variant with two amino acid substitutions (S106P and E127G) showed a doubling of k_cat, as well as a K_m for NADPH half that of the wild type. The strongest resistance to trimethoprim occurred with amino acid changes in the binding pocket for DHFA or trimethoprim, and the strongest effect on binding of NADPH was linked to a mutation involved in binding the phosphate group of the cofactor. This study marks the first confirmation that naturally occurring mutations in the gene for DHFR from P. jirovecii produce variant forms of DHFR that are resistant to trimethoprim and may contribute to clinically observed failures of standard therapy or prophylaxis. Copyright

Full text of DOI:10.1128/AAC.01161-13

Trimethoprim Resistance of Dihydrofolate Reductase Variants from
Clinical Isolates of Pneumocystis jirovecii
a
b,c
b,c
a
d
S. F. Queener, V. Cody, J. Pace, P. Torkelson, A. Gangjee
a
Department of Pharmacology and Toxicology, Indiana University School of Medicine, Indianapolis, Indiana, USA ; Structural Biology Department, Hauptman Woodward
b
Medical Research Institute, Buffalo, New York, USA ; Structural Biology Department, School of Medicine and Biological Sciences, State University of New York at Buffalo,
c
d
Buffalo, New York, USA ; Division of Medicinal Chemistry, Graduate School of Pharmaceutical Sciences, Duquesne University, Pittsburgh, Pennsylvania, USA
Pneumocystis jirovecii is an opportunistic pathogen that causes serious pneumonia in immunosuppressed patients. Standard
therapy and prophylaxis include trimethoprim (TMP)-sulfamethoxazole; trimethoprim in this combination targets dihydrofo-
late reductase (DHFR). Fourteen clinically observed variants of P. jirovecii DHFR were produced recombinantly to allow explo-
ration of the causes of clinically observed failure of therapy and prophylaxis that includes trimethoprim. Six DHFR variants
(
S31F, F36C, L65P, A67V, V79I, and I158V) showed resistance to inhibition by trimethoprim, with K values for trimethoprim
i
4-fold to 100-fold higher than those for the wild-type P. jirovecii DHFR. An experimental antifolate with more conformational
flexibility than trimethoprim showed strong activity against one trimethoprim-resistant variant. The two variants that were
most resistant to trimethoprim (F36C and L65P) also had increased K values for dihydrofolic acid (DHFA). The catalytic rate
m
constant (kcat) was unchanged for most variant forms of P. jirovecii DHFR but was significantly lowered in F36C protein; one
naturally occurring variant with two amino acid substitutions (S106P and E127G) showed a doubling of kcat, as well as a K for
m
NADPH half that of the wild type. The strongest resistance to trimethoprim occurred with amino acid changes in the binding
pocket for DHFA or trimethoprim, and the strongest effect on binding of NADPH was linked to a mutation involved in binding
the phosphate group of the cofactor. This study marks the first confirmation that naturally occurring mutations in the gene for
DHFR from P. jirovecii produce variant forms of DHFR that are resistant to trimethoprim and may contribute to clinically ob-
served failures of standard therapy or prophylaxis.
neumocystis jirovecii is an opportunistic pathogen that has for patient 32 (M52I E63G and T144A K171E). The authors of this
P
decades been a leading cause of serious or fatal pneumonia in study concluded that patients who had received prophylaxis with
immunosuppressed patients, including those with AIDS, organ an antifolate (trimethoprim or pyrimethamine) were more likely
transplantation, or congenital immune deficiencies. The standard to harbor P. jirovecii isolates containing variant DHFR (6/15) than
therapy and prophylaxis for pneumonia caused by P. jirovecii has patients who had received no prophylaxis or prophylaxis with
been cotrimoxazole, which includes sulfamethoxazole and trim- dapsone, atovaquone, or pentamidine (2/18). These authors
ethoprim (TMP). Sulfamethoxazole targets dihydropteroate syn- noted that mutations creating amino acid substitutions in DHFR
thase (DHPS). Mutations leading to amino acid substitutions in did occur in patients who failed prophylaxis with pyrimethamine
DHPS have been linked to resistance to sulfamethoxazole (1). or sulfadoxine but five of the seven patients also harbored muta-
Mutations leading to amino acid substitutions in dihydrofolate tions in dihydropteroate synthase (DHPS). Thus, a linkage of
reductase of Pneumocystis jirovecii have also been observed world- DHFR mutations to failure of prophylaxis was suggested but not
wide for over a decade, but attempts to link clinical outcomes to proven by this study.
these mutations have been inconclusive (2–10).
A study of P. jirovecii isolates from 32 patients in Japan ob-
The broadest array of variant forms of dihydrofolate reductase served two independent mutated alleles (Table 1; amino acid sub-
(DHFR) in clinical isolates of P. jirovecii was observed in patients stitutions A67V and C166Y) of DHFR from P. jirovecii (3, 4). The
in a European study (2) in which 16 nonsynonymous mutations in authors of this study noted that these mutations did not align with
the gene for DHFR occurred (Table 1). In isolates from some regions in other forms of DHFR that were connected to trim-
patients, two alleles were observed, which suggested to the authors ethoprim or pyrimethamine resistance. Clinically, these two pa-
that coinfections with multiple genotypes of P. jirovecii existed. tients had not received prophylaxis with either drug before pre-
For example, the mutation leading to the amino acid substitution senting with Pneumocystis pneumonia (PCP), and both were
F36C appeared in one allele, and the mutation leading to the successfully treated with cotrimoxazole.
amino acid substitution L65P appeared in a second independent
allele in P. jirovecii from the same patient (patient 7). True double
mutations also occurred in this population; for example, the mu-
tations producing the amino acid substitutions T14A and P26Q in
P. jirovecii DHFR (pjDHFR) appeared in one allele in an isolate
from patient 31, and the mutations producing the amino acid
substitutions S106P and E127G appeared in one allele in an isolate
from patient 33. Additionally, the isolate from patient 33 also had
a mutation giving rise to the single variant R170G. Similarly, dou-
ble variants were also observed in single alleles in P. jirovecii from
A study from South Africa independently reported the muta-
Received 30 May 2013 Returned for modification 20 June 2013
Accepted 21 July 2013
Published ahead of print 29 July 2013
Address correspondence to S. F. Queener, queenes@iupui.edu.
Copyright © 2013, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AAC.01161-13
4990 aac.asm.org
Antimicrobial Agents and Chemotherapy p. 4990–4998
October 2013 Volume 57 Number 10

Trimethoprim Resistance of P. jirovecii DHFR Variants
TABLE 1 Amino acid substitutions in DHFR found in clinical isolates
of Pneumocystis jirovecii
among patients who did receive prophylaxis that included an in-
hibitor of DHFR suggest a selection pressure is exerted on DHFR
by exposure to trimethoprim or pyrimethamine (2). Therefore,
Specific amino acid
a
Type of change in DHFR
substitution(s)
Reference(s) the question remains of whether mutations in the gene for DHFR
create resistance to trimethoprim and thus may also contribute to
therapeutic failure. This study is designed to address this question
at the molecular level.
Single amino acid substitutions
L13S
N23S
S31F
6
6
6
2
b
F36C
S37T
M52L
R59G
L65P
A67V
V79I
D153V
I158V
C166Y
R170G
Y197L
2
6
5
2
3–6
2
2
2
3, 4
2
MATERIALS AND METHODS
Construction and expression of mutant Pneumocystis jirovecii DHFR.
Mutations were introduced into the cDNA of pjDHFR, and the entire
coding sequence was verified by the Roswell Park Cancer Center (Buffalo,
NY). DNA oligonucleotides were obtained from Integrated DNA Tech-
nologies (Coralville, IA) and used without further purification. Plasmid
DNA was purified using the plasmid minikit (Qiagen). Mutagenesis was
performed using the QuikChange site-directed mutagenesis kit (Strat-
agene) following manufacturer’s protocol: 50-␮l reactions with a general
PCR template: 1 cycle of 95°C for 30 s, followed by 16 cycles of 95°C for 30
s, and 55°C for 30 s (with the annealing temperature modified according
b
c
2
to the melting temperature [T ] of the respective primer pair) and 68°C
m
Double amino acid substitutions
arising from a single allele
T14A P26Q
M52I E63G
T144A K171E
S106P E127G
2
2
2
2
for 1 min. The primer sequences are as follows: N23S, forward, 5=GGCT
TGAAAAGTGATCTTCC3=, and reverse, 5=GGAAGATCACTTTTCAAG
CC3=; T14A, forward, 5=CGTTGCATTGGCATTATCTCG3=, and re-
verse, 5=CGAGATAATGCCAATGCAACG3=; S31F, forward, 5=GGAAAT
TGAAGTTTGATATGATG3=, and reverse, 5=CATCATATCAAACTTCA
ATTTCC3=; F36C, forward, 5=GATGTTTTGCAGTCGAGTTAC3=, and
reverse, 5=GTAACTCGACTGCAAAACATC3=; S37T, forward, 5=GTCT
GATATGATGTTTTTTAAGCGAGT3=, and reverse, 5=CCAGATGTAAC
TCGCTTAAAAAAC3=; L65P, forward, 5=GGGAAAGTCTTCCAGCTCA
TTCTAGG3=, and reverse, 5=CCTAGAATGAGCTGGAAGACTTTCCC
3=; A67V, forward, 5=GGAAAGTCTTCCTGTTCATTCTAGG3=, and
reverse, 5=CCTAGAATGAACAGGAAGACTTTCC3=; V79I, forward, 5=C
GACTAATAATAACATTAATTCG3=, and reverse, 5=CGAATTAATGTT
ATTATTAGTCG3=; D153V, forward, 5=GTTGACTGTGTAGTATTTTT
CCC3=, and reverse, 5=GGGAAAAATACTACACAGTCAAC3=; I158V,
forward, 5=GATGTATTTTTCCCTGTTGATTTTTCG3=, and reverse, 5=
CGAAAAATCAACAGGGAAAAATACAT3=; C166Y, forward, 5=GGAG
TTCTCAGTCATATTTGCCTTGG3=, and reverse, 5=CCAAGGCAAATA
TGACTGAGAACTCC3=; R170G, forward, 5=GCCTTGGGGAAAGCAA
GATC3=, and reverse, 5=GATCTTGCTTTCCCCAAGGC3=; T144A,
forward, 5=CGTATTATAGCTGCTGTAATTC3=, and reverse, 5=GGATT
d
d
c
a
P. jirovecii DHFR variants containing the amino acid substitutions shown in boldface
type were produced recombinantly in quantities sufficient for kinetic analysis. The
following additional DHFR variants were created as single amino acid substitutions
from observed clinical double variants: S106P, T144A, and M52I. The following
additional DHFR variants were created as double amino acid substitutions from
observed clinical single variants: F36C L65P, A67V C166Y, and R59G A67V. (All of the
additional DHFR variants listed were available in sufficient quantities for testing except
for the M52I variant.)
b
Mutations leading to the amino acid substitutions F36C and L65P were observed in
two independent DHFR alleles in P. jirovecii from a single patient.
c
Mutations leading to the double substitution S106P E127G in P. jirovecii DHFR were
observed in one allele; a second allele in the same patient coded for the single
substitution R107G.
d
Two separate alleles, each creating double amino acid substitutions in P. jirovecii
DHFR, were observed in a single patient.
tion leading to amino acid substitution A67V and the previously
unknown R59G substitution in DHFR from P. jirovecii (5). These ACAGCAGCTATAATACG3=; K171E, forward, 5=CCTTGGAGAGAGC
patients had not received prophylaxis with antifolates before de- AAGATCATTCG3=, and reverse, 5=CGAATGATCTTGCTCTCTCCAAG
veloping Pneumocystis pneumonia. Resistance to clinical agents G3=; P26Q, forward, 5=GATCTTCAGTGGAAATTGAAG3=, and reverse,
5
=CTTCAATTTCCACTGAAGATC3=; E127G, forward, 5=GGTGGAGG
was suggested by these authors to be more likely linked to changes
in DHPS than in DHFR.
GTTGTATAAGG3=, and reverse, 5=CCTTATACAACCCTCCACC3=;
and S106P, forward, 5=GCACTATTGCCACAGATTTATG3=, and re-
verse, 5=CATAAATCTGTGGCAATAGTGC3=.
A study of patients in Portugal (6) reported the known P. ji-
rovecii DHFR A67V variant as well as four additional previously
unknown variants: L13S, N23S, S31F, and M52L (Table 1). There
was no evidence of mixed infections with P. jirovecii of different
genotypes. This study specifically evaluated the relationship be-
The original wild-type pjDHFR (pET-SUMO vector) (Invitrogen) was
used for PCR and all subsequent mutagenesis experiments. Three double
mutant proteins (T14A P26Q, T144A K171E, and S106P E127G) were
created by using the parental template DNA having one confirmed single-
tween failure of prophylaxis with cotrimoxazole and the presence residue mutation and using primers for the second desired mutation dur-
of polymorphisms in DHFR but found no linkage. These authors ing PCR.
also noted that 17 of the 35 patients with DHFR polymorphisms
both synonomous and nonsynonomous) were successfully
treated for PCP with cotrimoxazole.
Studies from other sites have failed to find nonsynonomous
mutations in DHFR from P. jirovecii, suggesting failure of therapy
is not uniquely linked to mutations in DHFR (7–10). Although
DHPS mutations apparently contribute to clinical failure by con-
ferring resistance to sulfamethoxazole (1, 2), the appearance of
Expression and purification of DHFR. The expression and purifica-
tion of recombinant wild-type P. jirovecii DHFR and the clinically ob-
served variants were carried out as previously described (11). Clinical
isolates of P. jirovecii have shown amino acid substitutions at 22 unique
sites in DHFR (the Met at position 52 was replaced by Leu or Ile in differ-
ent patients); 15 of the observed variants were single amino acid substitu-
tions, and four other variants included double amino acid substitutions in
the same allele (Table 1). Of these, protein has been expressed for 11 of the
single-amino-acid variant forms and three of the naturally occurring dou-
(
mutations in both DHPS and DHFR in clinical isolates and the bly substituted variants in quantities sufficient for kinetic study (Table 2).
apparently more frequent development of DHFR mutations In addition, five single amino acid changes observed clinically were com-
October 2013 Volume 57 Number 10
aac.asm.org 4991

Queener et al.
a
TABLE 2 Kinetic properties of mutated DHFR matching clinical isolates of Pneumocystis jirovecii
Ki, nM (n)
Km, ␮M (n)
Ϫ1
kcat, s (n)
DHFR form
Wild type
TMP
OAAG324
DHFA
NADPH
38 Ϯ 6.5 (10)
2.6 Ϯ 0.3 (14)
2.1 Ϯ 0.2 (22)
18 Ϯ 1.4 (5)
33 Ϯ 2 (25)
Variants
T14A P26Q
N23S
S31F
F36C
107 Ϯ 38 (6)
44 Ϯ 4.4 (9)
8.5 Ϯ 1.1 (5)
4.8 Ϯ 0.5 (10)
13 Ϯ 2† (6)
17.5 Ϯ 3† (3)
32 Ϯ 11.9† (2)
21 Ϯ 4.9 (2)
2.0 Ϯ 0.2 (3)
0.7 Ϯ 0.1 (9)
7.6 Ϯ 1.1 (9)
216 Ϯ 93† (3)
8.0 Ϯ 0.8† (9)
12 Ϯ 2.3† (6)
3.7 Ϯ 0.4 (6)
10 Ϯ 2.5 (6)
30 Ϯ 15† (3)
24.1 (1)
6.6 Ϯ 0.5 (2)
7.2 Ϯ 0.6† (12)
11 Ϯ 2† (8)
56 Ϯ 20† (4)
54 Ϯ 7.5† (2)
269 Ϯ 109† (2)
2 Ϯ 0.3 (3)
9 Ϯ 1† (10)
4.3 Ϯ 0.6 (11)
39 Ϯ 5† (2)
4.2 Ϯ 0.9 (7)
4.9 Ϯ 0.7 (5)
19 Ϯ 2.1† (8)
7.5 Ϯ 3.0 (4)
5.9 Ϯ 1.7 (5)
56 Ϯ 12† (8)
17 Ϯ 3.0† (7)
10 Ϯ 3 (2)
42 Ϯ 5.1 (2)
25 Ϯ 3 (2)
17.1 (1)
18.1 (1)
32 Ϯ 3.6 (2)
19 Ϯ 3 (2)
44 Ϯ 1 (2)
28 Ϯ 2 (12)
27 Ϯ 3 (9)
2 Ϯ 0.5† (4)
27 Ϯ 1 (2)
9 Ϯ 3† (2)
35 Ϯ 3 (7)
17 Ϯ 2† (9)
26 Ϯ 2 (11)
5 Ϯ 1† (2)
37 Ϯ 3 (7)
46 Ϯ 7 (3)
61 Ϯ 2† (6)
70 Ϯ 12 (3)
20 Ϯ 3 (3)
13 Ϯ 1† (5)
28 Ϯ 3 (7)
11 (1)
419 Ϯ 48† (6)
3800 Ϯ 1200† (4)
849 Ϯ 210† (4)
15100 Ϯ 1990† (2)
26 Ϯ 4 (3)
346 Ϯ 86† (7)
140 Ϯ 46† (6)
1710 Ϯ 230† (3)
135 Ϯ 27† (7)
59 Ϯ 10 (7)
60 Ϯ 13 (3)
192 Ϯ 32† (10)
71 Ϯ 21 (3)
113 Ϯ 40 (8)
233 Ϯ 64† (8)
154 Ϯ 37 (2)
46 Ϯ 9 (6)
L65P
F36C L65P
b
S37T
A67V
A67V C166Y
R59G A67V
21 Ϯ 1.3 (3)
16 Ϯ 2 (2)
b
20 Ϯ 1.0 (2)
219 Ϯ 56† (2)
27 Ϯ 1.6 (2)
22 Ϯ 3.1 (3)
9.0 Ϯ 1.1 (2)
12.9 Ϯ 1.2 (4)
16 Ϯ 0.1 (2)
64 Ϯ 11† (2)
18 Ϯ 1 (2)
b
V79I
S106P
c
S106P E127G
c
T144A
T144A K171E
D153V
I158V
C166Y
R170G
14 Ϯ 3.0† (6)
ND
4.5 Ϯ 1.3 (5)
13 Ϯ 2.1 (3)
35 Ϯ 2.3 (3)
5.9 Ϯ 0.8 (3)
63 Ϯ 10 (3)
a
Data are reported as means Ϯ standard errors of the means, except for cases in which n ϭ 2, for which the mean Ϯ range is reported. †, statistically significantly different from the
wild type (P Ͻ 0.05, Kruskal-Wallis and Dunn’s test; InStat 3).
b
The individual mutations leading to these single substitutions were observed independently in clinical isolates, but the dual substitution produced recombinantly has not yet been
observed in clinical samples.
c
These mutations have been observed in clinical samples also bearing other substitutions, but they have not been seen alone.
bined to form three double variants of amino acid substitutions not found
Ki values, which reflect binding of inhibitors to DHFR, were deter-
in the clinical samples (F36C L65P, A67V C166Y, and R59G A67V) to mined by measuring inhibition of the reaction at two to five different
evaluate the potential for synergy between combinations of these varia- concentrations of the substrate (DHFA). For the competitive inhibitors
tions. Furthermore, two single variants that were part of naturally occur- TMP and OAAG324 (Fig. 1) in this study, K could be calculated from the
i
ring double variants were expressed independently (S106P and T144A) to equation K ϭ IC /(1 ϩ S/K ), where IC is the 50% inhibitory concen-
i
50
m
50
evaluate their individual contributions to the kinetic parameters mea- tration. K was also independently calculated by the method of Dixon (13).
i
sured for the naturally occurring double variants.
Increases in the value of K reflect impaired binding of inhibitor to the
i
Kinetic analysis. The reaction scheme for P. jirovecii DHFR is pre- enzyme and therefore reflect resistance to the inhibitor. Statistical com-
sumed to follow the sequence determined for Pneumocystis carinii DHFR parisons were performed with InStat 2.03, using conservative nonpara-
(
pcDHFR) and other forms of the enzyme, in which NADPH is bound metric tests because variances among groups were not always equal.
ϩ
before the substrate (dihydrofolic acid) and exchange of NADP for
NADPH precedes release of the product tetrahydrofolate (12). Standard
DHFR assays contained 41 nM sodium phosphate buffer at pH 7.4, 8.9
mM 2-mercaptoethanol, 150 mM KCl, and saturating concentrations of
NADPH (117 ␮M) and dihydrofolic acid (DHFA). All components of the
assay except DHFA were preincubated at 37°C before the reaction was
initiated with the addition of DHFA. The progress of the reaction was
measured by continuous recording of changing absorbance at 340 nM
ϩ
(
conversion of NADPH to NADP ). Initial linear rates of enzyme activity
were measured; rates were linear under standard conditions for 1 to 5 min,
depending upon the enzyme form being assayed. Activity was linearly
related to the protein concentration under the selected conditions of as-
say.
Km values were determined by holding either the substrate or cofactor
at a constant, saturating concentration (determined for each variant) and
varying the other factor over a range of concentrations. Km values were
determined by fitting the data to the Michaelis-Menten equation with or
without substrate inhibition, using nonlinear regression methods to select
the best statistical fit (Prism 4.0). The value of kcat was determined from
the Vmax value and the total enzyme concentration, Etot, by the equation
kcat ϭ Vmax/Etot. The enzyme concentration was determined by titration FIG 1 Schematics of the pjDHFR inhibitors trimethoprim and OAAG 324
with methotrexate (11).
used in this study.
4992 aac.asm.org
Antimicrobial Agents and Chemotherapy

Trimethoprim Resistance of P. jirovecii DHFR Variants
Trimethoprim was retested against the wild-type P. jirovecii DHFR, confirmed in nature as a way to anticipate possible outcomes of
alongside the variant forms, as a control; by avoiding historical control future recombinant events in the organism. Thus, the doubly sub-
values, time was eliminated as a variable from the comparisons. Testing
stituted F36C L65P, R59G A67V, and A67V C166Y variants were
was also performed with the experimental antifolate OAAG324 (Fig. 1) to
assess whether resistance to one antifolate was likely to confer resistance to
created and tested (Table 2). The F36C L65P variant showed ex-
treme resistance to trimethoprim, with a K value 400-fold higher
i
the class. OAAG324 was chosen as the experimental antifolate because it
than that of the wild type; this doubly substituted variant had a Ki
differed significantly in structure from trimethoprim (14) and the com-
value for trimethoprim that was 4-fold higher than that for the
pound was already known to be longer and more flexible than trim-
F36C variant alone and 18-fold higher than that for the L65P
ethoprim, such that the dichlorophenyl ring can adopt alternate confor-
variant alone, suggesting additivity or synergy between the two
value for
mations within the active site (15).
Structural models of P. jirovecii DHFR. The deduced structure of P. substitutions. Likewise, the R59G A67V variant had a K
i
jirovecii DHFR was calculated by homology modeling to the crystal struc- trimethoprim five times higher than that of the singly substituted
ture of the P. carinii DHFR ternary complex with methotrexate and A67V variant. In contrast, the A67V C166Y variant had a K for
i
NADPH (15–17). The homology data for the pjDHFR complex with
OAAG324 (Fig. 1) and NADPH reveals that this compound is displaced
above the plane of the pyrido[2,3-d]pyrimidine ring compared to the
crystal structure data (15). Similar modeling of pjDHFR with TMP and
NADPH is consistent with the crystal structure of pcDHFR with TMP and
NADPH (18). Computer models of the variants observed in P. jirovecii
isolated from immunosuppressed patients were derived by substitution of
the amino acids shown in Table 1.
trimethoprim similar to that of the C166Y protein, which was
lower than the K for the A67V variant, suggesting that in this case
i
the effect of substitution at position 67 was offset by the substitu-
tion at position 166.
The kinetics toward the substrate and cofactor were examined
for each DHFR variant and compared to wild-type values (Table
2). Eight of the 14 clinically observed variants tested had statisti-
cally significantly elevated K values for DHFA, the amount rang-
ing from 3-fold (N23S) to 27-fold (F36C); only the S37T variant
m
RESULTS
Steady-state kinetic parameters. Among the 14 clinically ob- was identical to the wild type. Small apparent increases in K for
m
served variant forms of P. jirovecii DHFR studied, over 10-fold the T14A P26Q, V79I, T144A K171E, C166Y, and R170G variants
increases in experimentally determined K values for trim- were not statistically significant. Elevation in the Km value for
i
ethoprim relative to wild-type P. jirovecii DHFR were seen with DHFA reflects reduced binding of the substrate, and as might be
three variants: S31F, F36C, and L65P (Table 2). Among these expected, the two clinically observed variants with the greatest
DHFR variants, the F36C protein showed a K value for trim- resistance to the competitive inhibitor trimethoprim (F36C and
i
ethoprim 100-fold higher than that of the native P. jirovecii DHFR, L65P) also showed strong increases in the Km for DHFA. The
which would confer a greatly decreased ability of this form of artificially created F36C L65P double mutant showed the stron-
DHFR to bind trimethoprim.
gest effects on DHFA binding, with an increase in K for DHFA of
m
Of the remaining naturally occurring variant forms of P. jirove- 128-fold.
cii DHFR, five (A67V, V79I, D153V, I158V, and C166Y) showed
Fewer variants had significant changes in the Km value for
Ki values for trimethoprim 3- to 9-fold greater than that of the NADPH (Table 2). The clinically observed variant D153V had a
wild-type enzyme. Two singly substituted natural variants, the Km value over three times higher than that of the wild type, but the
N23S and S37T proteins, had K values for trimethoprim that were R59G A67V variant had a Km value for NADPH more than 10
i
indistinguishable from the wild type (Table 2). Three naturally times higher than that of the wild type, indicating a significant
occurring doubly substituted variants (T14A P26Q, S106P E127G, impairment in binding this essential cofactor.
and T144A K171E) tended to have higher K values for trim-
The value of kcat (measured as the ratio of Vmax for DHFA/Etot
ethoprim than the wild type, but the changes were not statistically in the presence of saturating concentrations of NADPH) was sig-
significant (Table 2). nificantly lowered from wild-type values for the clinically ob-
i
In order to answer the question of whether the apparent resis- served F36C, A67V, and D153V variants. The doubly substituted
tance of certain naturally occurring variant forms of P. jirovecii variants not found in clinical samples (F36C L65P and R59G
DHFR to trimethoprim affected all classes of DHFR inhibitors A67V) also showed lower kcat values than the wild type, but the
equally, we also tested these variants against the experimental an- A67V C166Y variant was similar to the wild type. Ten of the clin-
tifolate OAAG324 (Fig. 1), which is, like trimethoprim, a compet- ically observed variants (T14A P26Q, N23S, S31F, L65P, S37T,
itive inhibitor of P. jirovecii DHFR (14). The N23S, S37T, R170G, V79I, T144A K171E, I158V, C166Y, and R170G) also had kcat
and S106P E127G variants were just as sensitive as the wild type to values similar to the wild type, but the clinically observed doubly
OAAG324, the same pattern seen with trimethoprim; however, substituted S106P E127G variant showed an interesting increase
the A67V variant showed a greater sensitivity to OAAG324 than in kcat relative to the wild type (Table 2).
did wild-type DHFR, a pattern very different from the 9-fold in-
Models of ligand interactions among variant forms of Pneu-
crease in K for trimethoprim seen with the A67V protein. Among mocystis jirovecii DHFR. Although a crystal structure is not yet
i
the natural variants, only the L65P and T144A K171E proteins available for the DHFR from P. jirovecii, a simulated structure has
showed a greater than 10-fold increase in K value for OAAG324 been produced by homology modeling based on the crystal struc-
i
relative to the wild type.
ture of P. carinii DHFR (15). Using this type of constructed model
The apparent coexistence of two separate alleles for P. jirovecii for P. jirovecii DHFR, the positions of the various amino acid
DHFR in the same patient (2) would seem to set up the possibility substitutions evaluated in this study may be located within the
for recombination to produce double mutants. The detection of protein (Fig. 2).
naturally occurring true double mutants confirmed that by some
The naturally occurring L65P and F36C single variants both
process, double mutations were in fact being generated. These had profound effects on the ability of the variant DHFR to bind to
facts led us to produce double mutants that have not yet been trimethoprim, as reflected by the greatly increased K value for
i
October 2013 Volume 57 Number 10
aac.asm.org 4993

Queener et al.
FIG 2 Homology model of Pneumocystis jirovecii DHFR (green), with
NADPH (yellow) and trimethoprim (cyan). The locations of the 22 individual FIG 4 Model of the ternary complex of pjDHFR (green) with trimethoprim
sites where amino acid substitutions have been observed in clinical samples (cyan) and NADPH (yellow) showing the fit of OAAG324 (purple) and its
(2–6) are indicated in violet and by the residue number.
interactions with the variants F36C and L65P, shown with their van der Waals
surface dots (natural residues are in red, variants in green). Also labeled is
Asp32. Note that the native L65 comes into close contact with OAAG324,
whereas the P65 variant is further away.
trimethoprim. These effects are consistent with the structural
placement of the variant amino acids in the wall of the pocket
binding trimethoprim (or the substrate DHFA) in P. jirovecii which the dichlorophenyl ring was near the cofactor binding site
DHFR (Fig. 3). Because both variants potentially alter space (15).
within the pocket binding trimethoprim, the model may explain
The R59G A67V variant, which has not been observed in clin-
the additive effects seen with the constructed double mutant. The ical isolates, showed lowered binding of trimethoprim,
profound effects on the binding of trimethoprim, an inhibitor OAAG324, DHFA, and NADPH (elevated K and K values), as
i
m
competitive with DHFA, suggested that alterations in the kinetics well as a lower value for the catalytic rate constant, kcat (Table 2).
of DHFA should also exist, and those were observed; these results The amino acid substitution at position 67, which is on a loop
are again consistent with the position of the variants in the wall of pointing away from the active site (Fig. 5), had modest effects
the pocket that would bind DHFA. OAAG324 is longer and more alone but in combination with the substitution of glycine for ar-
flexible than trimethoprim which may explain why the binding of ginine at position 59 had a much more profound change on the
this compound was less affected by these mutations than was kinetics of the enzyme. Position 59 is within a region of the en-
binding to trimethoprim (15). Structural data for the complex of zyme that interacts with the phosphate of NADPH, as is evident
OAAG324 with human DHFR revealed the antifolate conforma- both from the crystal structure of P. carinii DHFR with TMP and
tion was flexible and that the dichlorophenyl ring could occupy a NADPH (18) and from the homology model of P. jirovecii DHFR
position as shown in Fig. 4 and an alternate conformation in (Fig. 6). No interaction can take place when glycine is at position
5
9; thus, the observed large increase in the K for NADPH in the
m
FIG 3 Model of pjDHFR with trimethoprim and NADPH showing the loca- FIG 5 Model of pjDHFR with trimethoprim and NADPH showing the loca-
tion of the F36C and L65P variants. The natural residues at positions 36 and 65 tion of the A67V and R59G variants highlighted with their van der Waals
are shown in green.
surfaces.
4994 aac.asm.org
Antimicrobial Agents and Chemotherapy

Trimethoprim Resistance of P. jirovecii DHFR Variants
FIG 8 Interaction of variant T144A in the homology model for pjDHFR
(
cyan) with NADPH (yellow) and trimethoprim (cyan). The green dot surface
FIG 6 Model of pjDHFR with trimethoprim and NADPH (green) superim-
posed on the crystal structure of pcDHFR (yellow) (18) with NADPH showing
the position of R59 (with their van der Waals surfaces) in the two structures
and their interactions with the phosphate of the NADPH.
residue is Thr144, and the cyan dot surface is A144. Asp32 is also shown.
been seen (2). In this doubly substituted variant, the loss of the
R59G A67V variant is consistent with the impaired ability to bind large positively charged side chain of lysine (K) and the substitu-
the cofactor NADPH predicted by the structural models.
tion of the smaller negatively charged side chain of glutamic acid
The amino acid in position 127 is also implicated in binding to (E) make the enzyme less resistant to trimethoprim but more
NADPH: the hydrogen bond that may occur when glutamic acid is resistant to OAAG324 (Table 2). It is not immediately obvious
in that position cannot be formed when mutation places a glycine from the structure why binding of OAAG324 should be impaired
at that position (Fig. 7). The prediction of decreased NADPH in this doubly substituted variant, unless the approach to the
binding was not borne out, in that the naturally occurring doubly pocket is impeded for the larger molecule (Fig. 9).
substituted S106P E127G variant showed no statistical difference
In two other cases, the structure suggested the possibility of
in the K for NADPH from the wild-type enzyme. The amino acid strong effects on enzyme function with single amino acid substi-
m
substitution S106P puts proline at bottom of the helical turn, tutions, but these were not observed. For example, the N23S pro-
which tightens the turn, but it is far from the active site (Fig. 7) and tein, a variant with kinetic properties very similar to wild type, is in
alone has little effect on the binding of NADPH (Table 2). How loop 23 in pcDHFR (loop 20 in Escherichia coli), the loop that
these two amino acid substitutions might interact to explain the opens and closes over NADPH during the catalytic cycle (16).
kinetic observations would require that the singly substituted Likewise position 31 sits near the substrate binding site, but sub-
E127G variant be produced and analyzed.
The amino acid at position 144 plays a role in binding trim- modest effects on the K
stitution of phenylalanine for serine at that site produced only
values for substrate and cofactor while
m
ethoprim through interactions with the hydroxyl group of the producing statistically significant resistance to both trimethoprim
threonine usually found at that position (Fig. 8). Conversion of and OAAG324.
threonine to alanine prevents that interaction and lowers binding
Most of the observed mutations in the gene for P. jirovecii
to trimethoprim (Table 2). This single mutation has not yet been DHFR produced amino acid substitutions in external regions of
reported in clinical samples, but the T144A K171E variant has the enzyme (Fig. 2). Little could be predicted for the expected
kinetic parameters of many of these variants (e.g., C166Y, I158V,
D153V, S106P, A67V, and S37T), and indeed the changes ob-
served were generally modest.
FIG 7 Model of pjDHFR with trimethoprim and NADPH showing the vari- FIG 9 Comparison of homology models for the K171E T144A double variant
ants at E127G and S106P (highlighted with their van der Waals surfaces). Note for pjDHFR with NADPH and TMP (green) and pjDHFR modeled with the
the interaction of the E127 with the adenine ring of NADPH.
inhibitor OAAG324 and NADPH (yellow).
October 2013 Volume 57 Number 10
aac.asm.org 4995

Queener et al.
DISCUSSION
co-trimoxazole (trimethoprim-sulfamethoxazole) (3). This pa-
tient was known to carry native dihydropteroate synthase
This study marks the first confirmation that mutations observed
in the DHFR gene in P. jirovecii from clinical isolates produce
variant forms of DHFR that have reduced sensitivity to trim-
ethoprim, a key component of standard prophylaxis and therapy
for infections caused by P. jirovecii. The fact that not all observed
variants are linked to selected resistance to trimethoprim may
argue that the clinical studies in part reflect the natural occurrence
of polymorphisms in the gene for DHFR of P. jirovecii. Although it
is known that Pneumocystis may be transmitted between patients,
how much this process has contributed to the diversity of variant
forms of P. jirovecii DHFR is not known (19–21).
(
DHPS), the target enzyme for sulfamethoxazole, and thus the
therapy may have succeeded as essentially monotherapy with sul-
famethoxazole. It is interesting to speculate on the potential for
drug failure for patients who might carry variant forms of DHFR
resistant to trimethoprim as well as a variant form of DHPS rela-
tively resistant to sulfamethoxazole. For example, the patient from
whom the trimethoprim-resistant L65P and F36C DHFR variants
were derived also harbored a variant form of DHPS known to
confer a degree of resistance to sulfamethoxazole (2); unfortu-
nately, no clinical outcome data were available for this patient.
One interesting implication of this study is that the patterns
of resistance seem to be unique to each antifolate. Both trim-
ethoprim and OAAG324 are competitive inhibitors of P. jirovecii
The array of reported variant forms of P. jirovecii DHFR may
be considered a snapshot of the distribution of mutations at the
time the patients were originally seen: 1993 to 1996 (2), 1994 to
2
000 (3, 4), 2000 to 2003 (5), and 1995 to 2004 (6). Therefore, it is DHFR, but they are different enough in structure that they reveal
logical to consider which of those variant forms of P. jirovecii subtle changes in the binding site with several variant forms of P.
DHFR possess qualities that would suggest they would survive in jirovecii DHFR. For example, the F36C L65P double mutant
the absence of selective pressure exerted by antifolate prophylaxis. showed no added resistance over the single mutants toward
One measure of fitness could be the catalytic efficiency of the OAAG324, but there appeared to be additive or synergistic effects
enzyme, usually measured as the ratio of kcat to K for DHFA. The on trimethoprim binding. Likewise, the A67V variant showed sta-
m
Ϫ1
Ϫ6
catalytic efficiency of wild-type P. jirovecii DHFR is 16 s
M
.
tistically significant resistance to trimethoprim (an increase in K
),
i
The clinically observed variants found most often in patients were but the K
for OAAG324 is statistically lower (Mann-Whitney
i
the S37T protein (four patients in one study [2]) and the A67V nonparametric test) than with the wild type, suggesting improved
protein (four patients in three studies [3–6]). The catalytic effi- binding of OAAG324.
Ϫ1 Ϫ6
ciency of the S37T variant was 17 s
M
, almost identical to that
Finally, it is interesting to note that some but not all of the sites
of the wild-type enzyme; in contrast, the catalytic efficiency of the for mutations observed in P. jirovecii DHFR are also sites for mu-
Ϫ1 Ϫ6
A67V variant was only 2 s
is required for persistence of a mutation in the population, then ethoprim. For example, the S31F amino acid substitution that
the N23S, S31F, V79I, R170G, T14A P26Q, S106P E127G, and produces a roughly 10-fold increase in K for TMP in P. jirovecii
T144A K171E variants might be predicted to persist, with calcu- DHFR is in the same relative position as the A26T amino acid
M
. If a catalytic efficiency of at least tations seen in pathogenic bacteria that are resistant to trim-
2
i
Ϫ1
Ϫ6
lated catalytic efficiencies ranging from 2.5 to 8.8 s
contrast, those variants with very high K values for DHFA and trimethoprim resistance in a laboratory setting (22). In E. coli, this
M
. In substitution seen in the DHFR from Escherichia coli selected for
m
catalytic efficiencies at or below 1 (e.g., F36C, L65P, and D153V) substitution produced about an 18-fold increase in K
might not be expected to persist unless strong selective pressure ethoprim, measured by extinction of tryptophan fluorescence of
was being applied through exposure to trimethoprim. These pre- the pure protein; this substitution also lowered the K values for
for trim-
d
m
dictions could be tested by genotyping clinical isolates of P. jirove- DHFA and NADPH by half and increased the kcat about 8-fold. In
cii collected after 2004, the last date of collection of the variants contrast, the S31F substitution in P. jirovecii DHFR increased the
used in this study.
K
m
for DHFA but had only minor effects on the K
m
for NADPH or
The study of naturally occurring or selected variants of DHFR
kcat. Thus, each DHFR form showed different kinetic responses to
from P. jirovecii is important for understanding the outcomes of amino acid changes at the same site that conferred resistance to
current therapeutic strategies for treating human disease. Previ- trimethoprim.
ous work demonstrated that prophylaxis with antifolates may be
Other amino acid substitutions observed in P. jirovecii DHFR
linked to an increased selection of variant forms of P. jirovecii tend to cluster in regions where amino acid substitutions also
DHFR within those patients, but these clinical studies were not occur in trimethoprim-resistant pathogenic bacteria. For exam-
able to show definitive linkage between the presence of these vari- ple, a helical region that includes an amino acid involved in bind-
ant forms of DHFR and clinical outcomes (2, 6). Our results ex- ing folates occurs in P. jirovecii DHFR between amino acids 30 and
plain that observation: not all variant forms in those clinical sam- 38; the S31F and F36C substitutions that we demonstrated confer
ples in fact confer resistance to trimethoprim. Insufficient trimethoprim resistance to P. jirovecii DHFR fall in this region,
published clinical data exist to allow us to link individual patient but neither changes the amino acid directly involved in folate
outcomes to the presence of specific mutants. For example, 17 of binding (aspartate at position 32). The corresponding helical re-
3
5 patients with polymorphisms in the gene for P. jirovecii DHFR gion (amino acids 27 to 33) in Staphylococcus aureus DHFR con-
were successfully treated with co-trimoxazole, but the outcomes tains the H30N substitution observed in strains of the bacteria that
for individual patients were not reported (6); of the five amino are resistant to trimethoprim (23). The corresponding helical re-
acid variants produced by these polymorphisms, we were able to gion in E. coli DHFR also spans residues 27 to 33 in the protein, a
study three (N23S, S31F, and A67V). Our results suggest that of region that includes the W30R substitution that confers resistance
these three variants, the S31F and A67V proteins might show clin- to trimethoprim (22); another substitution linked to trim-
ical resistance to trimethoprim. However, a patient who carried ethoprim resistance, A26T, occurs just at the beginning of the
the A67V P. jirovecii DHFR variant was successfully treated with helical region. As with the DHFR from P. jirovecii, none of these
4996 aac.asm.org
Antimicrobial Agents and Chemotherapy

Trimethoprim Resistance of P. jirovecii DHFR Variants
amino acid substitutions directly affects the aspartate residue in
this region implicated in folate binding.
3. Takahashi T, Endo T, Nakamura T, Sakashita H, Kimura K, Ohnishi K,
Kitamura Y, Iwamoto A. 2002. Dihydrofolate reductase gene polymor-
phisms in Pneumocystis carinii f. sp. Hominis in Japan. J. Med. Microbiol.
The amino acid substitution of alanine for threonine at posi-
tion 144 in P. jirovecii DHFR, as discussed earlier in this section,
affects binding to folates and folate analogs. In the sequence T(H/
V)I at positions 144 to 146 (P. jirovecii DHFR numbering), both T
and I are conserved in the DHFR proteins from E. coli, S. aureus,
and Streptococcus pneumoniae. Trimethoprim-resistant E. coli
shows a substitution of valine for isoleucine (I115V) at this site in
DHFR. Trimethoprim-resistant S. pneumoniae shows a mutation
that affects the center residue in this triad (H120Q), although
substitutions at positions 100 (I100L) and 135 (L135F) (S. pneu-
moniae numbering) are more likely to contribute most of the tri-
methoprim resistance observed (24, 25).
5
1:510–515.
4. Takahashi T. 2009. Mutations of drug target molecules in Pneumocystis
jirovecii isolates and future investigations. Jpn. J. Med. Mycol. 50:67–73.
5. Robberts FJL, Chalkley LJ, Weyer K, Goussard P, Liebowitz LD. 2005.
Dihydropteroate synthase and novel dihydrofolate reductase gene muta-
tions in strains of Pneumocystis jirovecii from South Africa. J. Clin. Micro-
biol. 43:1443–1444.
6
. Costa MC, Esteves F, Antunes F, Matos O. 2006. Genetic characteriza-
tion of the dihydrofolate reductase gene of Pneumocystis jirovecii isolates
from Portugal. J. Antimicrob. Chemother. 58:1246–1249.
7
. Ma L, Borio L, Masur H, Kovacs JA. 1999. Pneumocystis carinii dihy-
dropteroate synthase but not dihydrofolate reductase gene mutations cor-
relate with prior trimethoprim-sulfamethoxazole or dapsone use. J. Infect.
Dis. 180:1969–1978.
Mutations in regions involved in NADPH binding are also
found not only in trimethoprim-resistant P. jirovecii DHFR but
also in trimethoprim-resistant DHFR from pathogenic bacteria.
For example, one NADPH binding site corresponds to amino ac-
ids 59 to 61 (RKT) in P. jirovecii DHFR. Amino acid substitutions
L65P and A67V in P. jirovecii DHFR flank this NADPH binding
8. Siripattanapipong S, Leelavoova S, Mungthin M, Worapong J, Tan-
Ariya P. 2008. Study of DHPS and DHFR genes of Pneumocystis jirovecii in
Thai HIV-infected patients. Med. Mycol. 46:389–392.
9. Esteves F, Gaspar J, De Sousa B, Antunes F, Mansinho K, Matos O.
2011. Clinical relevance of multiple single-nucleotide polymorphisms in
Pneumocystis jirovecii pneumonia: development of a multiplex PCR-
single-base-extension methodology. J. Clin. Microbiol. 49:1810–1815.
region, as does the amino acid substitution H45R in trim- 10. Munoz C, Zuluaga A, Restrepo A, Tobon A, Cano LE, Gonzalez A.
2
012. Molecular dignosis and detection of Pneumocystis jirovecii DHPS
ethoprim-resistant E. coli DHFR (22). Another NADPH binding
site corresponding to amino acids 124 to 127 in P. jirovecii DHFR
shows amino acid substitutions conferring trimethoprim resis-
tance in S. pneumoniae (I100L) (24) and in E. coli (I94L) (22), but
the only amino acid substitution in that region in P. jirovecii
DHFR was observed in a doubly substituted variant (S106P
E127G) that was not remarkable resistant to TMP.
and DHFR genotypes in respiratory specimens from Colombian patients.
Diagn. Microbiol. Infect. Dis. 72:204–213.
1. Cody V, Pace J, Makin J, Piraino J, Queener SF, Rosowsky A. 2009.
Correlations of inhibitor kinetics for Pneumocystis jirovecii and human
dihydrofolate reductase with structural data for human active site mutant
enzyme complexes. Biochemistry 48:1702–1711.
2. Margosiak SA, Appleman JR, Santi DV, Blakley RL. 1993. Dihydrofolate
reductase from the pathogenic fungus Pneumocystis carinii: catalytic prop-
erties and interaction with antifolates. Arch. Biochem. Biophys. 305:499–
508.
1
1
In summary, this study is the first to confirm that mutations
leading to key amino acid substitutions in DHFR from P. jirovecii
may produce high-level resistance to trimethoprim, a component 13. Segel IH. 1975. Enzyme kinetics: behavior and analysis of rapid equi-
librium and steady-state enzyme systems. Wiley-Interscience, New
York, NY.
of standard prophylaxis and therapy for infections caused by P.
jirovecii. The inability of prior studies to clearly link mutations in
1
4. Gangjee A, Adair OO, Queener SF. 2003. Synthesis and biological eval-
uation of 2,4-diamino-6-(arylaminomethyl)pyrido[2,3-d]-pyrimidines
as inhibitors of Pneumocystis carinii and Toxoplasma gondii dihydrofolate
reductase and as antiopportunistic infection and antitumor agents. J.
Med. Chem. 46:5074–5082.
5. Cody V, Pace J, Queener SF, Adair OO, Gangjee A. 2013. Kinetic and
structural analysis for potent antifolate inhibition of Pneumocystis jirove-
cii, Pneumocystis carinii, and human dihydrofolate reductase and their
active-site variants. Antimicrob. Agents Chemother. 57:2669–2677.
the gene for DHFR to clinical resistance to co-trimoxazole (trim-
ethoprim-sulfamethoxazole) is explained by our observation that
not all observed amino acid substitutions in P. jirovecii DHFR
found in clinical samples in fact confer resistance to trim-
ethoprim. The prediction based upon the results of this study is
that those patients with P. jirovecii DHFR bearing amino acid
substitution S31F, F36C, L65P, or A67V (and possibly V79I and
1
I158V) would be resistant to clinically administered trimethoprim 16. Cody V, Galitsky N, Rak D, Luft JR, Pangborn W, Queener SF. 1999.
Ligand induced conformational changes in the crystal structures of
and the success or failure of therapy would rest on the ability of the
coadministered sulfamethoxazole to inhibit its target dihydrop-
teroate synthase (DHPS).
Pneumcystis carinii dihydrofolate reductase complexes with folate and
ϩ
NADP . Biochemistry 38:4303–4312.
1
7. Cody V, Freindorf M, Furlani T, Queener SF, Gangjee A. 2009. Corre-
lations of the kinetic properties and computational QM/MM modeling of
potent dihydrofolate reductase inhibitors, abstr 2458. Abstr. 100th Annu.
Meet. Am. Assoc. Cancer Researchers.
8. Champness JN, Achari A, Ballantine SP, Bryant PK, Delves CJ, Stam-
mers DK. 1994. The structure of Pneumocystis carinii dihydrofolate re-
ductase to 1.9Å resolution. Structure 2:915–924.
9. Ripamonti C, Orenstein A, Kutty G, Huang L, Schuhegger R, Sing A,
Fantoni G, Atzori C, Vinton C, Huber C, Conville PS, Kovacs JA. 2009.
Restriction fragment length polymorphism typing demonstrates substan-
tial diversity among Pneumocystis jirovecii isolates. J. Infect. Dis. 200:
ACKNOWLEDGMENTS
V.C. thanks E. Steward and N. F. Mustafa for their efforts to clone and
express the recombinant pjDHFR clinical variants.
This research was supported in part by grants from the National Insti-
tutes of Health GM51670 (V.C.), CA09885 (A.G.), and AI098458 (A.G.).
Significant portions of this work were also supported by Biomedical Re-
search Grant funding from the Indiana University School of Medicine
1
1
(
S.F.Q.).
1616–1622.
REFERENCES
2
0. Choukri F, Menotti J, Sarfati C, Lucet JC, Nevez G, Garin YJF, Derouin
F, Totet A. 2010. Quantification and spread of Pneumocystis jirovecii in
the surrounding air of patients with Pneumocystis pneumonia. Clin. In-
fect. Dis. 51:259–265.
1
. Iliades P, Meshnick SR, Macreadie IG. 2005. Mutations in the Pneumo-
cystis jirovecii DHPS gene confer cross-resistance to sulfa drugs. Antimi-
crob. Agents Chemother. 49:741–748.
2
. Nahimana A, Rabodonirina M, Bille J, Francioli P, Houser PM. 2004. 21. Hauser PM, Nahimana A, Taffe P, Weber R, Francioli P, Bille J,
Mutations of Pneumocystis jirovecii dihydrofolate reductase associated
with failure of prophylaxis. Antimicrob. Agents Chemother. 48:4301–
Rabodonirina M. 2010. Interhuman transmission as a potential key pa-
rameter for geographical variation in the prevalence of Pneumocystis ji-
rovecii dihydropteroate synthase mutations. Clin. Infect. Dis. 51:e28–e33.
4
305.
October 2013 Volume 57 Number 10
aac.asm.org 4997

Queener et al.
2
2. Watson M, Liu JW, Ollis D. 2007. Directed evolution of trimethoprim 24. Maskell JP, Sefton AM, Hall LMC. 2001. Multiple mutations modulate
resistance in Escherichia coli. FEBS J. 274:2661–2671.
3. Dale GE, Broger C, D’Arcy A, Hartman PG, DeHoogt R, Jolidon S,
the function of dihydrofolate reductase in trimethoprim-resistant Strep-
tococcus pneumoniae. Antimicrob. Agents Chemother. 45:1104–1108.
2
Kompis I, Labhardt AM, Langen H, Locher H, Page MGP, Stuber D, 25. Pikis A, Donkersloot JA, Rodriguez WJ, Keith JM. 1998. A conservative
Then RL, Wipf B, Oefner C. 1997. A single amino acid substitution in
Staphylococcus aureus dihydrofolate reductase determines trimethoprim
resistance. J. Mol. Biol. 266:23–30.
amino acid mutation in the chromosomal dihydrofolate reductase confers
trimethoprim resistance in Streptococcus pneumoniae. J. Infect. Dis. 178:
700–706.
4998 aac.asm.org
Antimicrobial Agents and Chemotherapy