Interaction of bisbenzimidazole-substituted carbazole derivatives with G-quadruplexes and living cells

Article abstract of DOI:10.1039/c5ra11543d

G-quadruplex (G4) ligands have potential as chemotherapeutic agents because of the important roles of G4s in regulation of genomic function. Previously, we have developed a fluorescent probe (termed as BPBC) with excellent selectivity to parallel G4s, which possesses a V-shaped bisbenzimidazole-substituted carbazole planar core and two methylpiperazine side arms. Here, we further investigated the interactions of BPBC derivatives with different DNA and living cells. The spectral analysis showed that non-substituted bisbenzimidazole-substituted carbazole (7c) and bisdimethylamino-substituted 7c (7b) exhibited good selectivity to parallel G4s. The binding affinities of BPBC derivatives to parallel G4s were BPBC > 7b 7c. BPBC and 7b entered living cells and mainly located in the cytoplasma and nucleoli; 7c mainly located in the lysosome. BPBC exhibited the highest cytotoxicity with IC₅₀ around 1 μM. Our results suggest that the bisbenzimidazole-substituted carbazole core is the key factor for selectively binding BPBC derivatives to parallel G4s; the side arms can change their affinity to specific G4s, as well as their interaction with cells. Further optimization of the side arms will provide the opportunity to obtain chemotherapeutic agents targeting specific G4s in cells.

Full text of DOI:10.1039/c5ra11543d

RSC Advances
View Article Online
View Journal | View Issue
PAPER
Interaction of bisbenzimidazole-substituted
carbazole derivatives with G-quadruplexes and
Cite this: RSC Adv., 2015, 5, 75911
living cells†
Yongbiao Wei,ab Xin Zhang,a Linlin Wang,a Ying Liu,a Tao Bing,a Xiangjun Liua
a
*
and Dihua Shangguan
G-quadruplex (G4) ligands have potential as chemotherapeutic agents because of the important roles of
G4s in regulation of genomic function. Previously, we have developed a fluorescent probe (termed as
BPBC) with excellent selectivity to parallel G4s, which possesses
a V-shaped bisbenzimidazole-
substituted carbazole planar core and two methylpiperazine side arms. Here, we further investigated the
interactions of BPBC derivatives with different DNA and living cells. The spectral analysis showed that
non-substituted bisbenzimidazole-substituted carbazole (7c) and bisdimethylamino-substituted 7c (7b)
exhibited good selectivity to parallel G4s. The binding affinities of BPBC derivatives to parallel G4s were
BPBC > 7b S 7c. BPBC and 7b entered living cells and mainly located in the cytoplasma and nucleoli; 7c
mainly located in the lysosome. BPBC exhibited the highest cytotoxicity with IC50 around 1 mM. Our
results suggest that the bisbenzimidazole-substituted carbazole core is the key factor for selectively
binding BPBC derivatives to parallel G4s; the side arms can change their affinity to specific G4s, as well
as their interaction with cells. Further optimization of the side arms will provide the opportunity to obtain
chemotherapeutic agents targeting specific G4s in cells.
Received 16th June 2015
Accepted 28th August 2015
DOI: 10.1039/c5ra11543d
www.rsc.org/advances
G-quartet plane by p–p stacking and the side chains interact
with the phosphate backbone, loops or grooves of G4s.11,12
Introduction
Recently, some ligands with V-shaped planar core have been
reported to have good selectivity to G4s over single and double-
stranded DNA.13–15 The V-shaped planar core has been consid-
ered crucial for G4 binding.16,17 In previous work, we have
reported a light up uorescent probe, BPBC (Fig. 1), which has
excellent selectivity to parallel G4s over other G4 structures.
BPBC also possesses a V-shaped bisbenzimidazole-substituted
carbazole planar core that is slightly larger than the dimension
of G-quartet surface.18 However, it is unclear whether this bis-
benzimidazole substituted carbazole core is essential for the
selectivity of BPBC to parallel G4s. Therefore further compar-
ison of the binding properties of BPBC derivatives will provide
deep insights into the molecular design of G4 ligands. Addi-
tionally, G4 ligands have the potential to act as the
G-quadruplex (G4) is a kind of characteristic secondary struc-
ture of nucleic acids that contain repetitive tandem guanines.
This structure is composed of layers of G-quartets (a planar
arrangement of four guanine bases stabilized by eight Hoogs-
teen hydrogen bonds) and loops. G4-forming sequences are
highly prevalent in the human genome,1 especially in promoter
regions of oncogenes and telomere ends,2 as well as in partic-
ular RNA domains, such as the rst introns, 50- and
30-untranslated regions and telomeric RNA.3,4 Accumulating
evidence has suggested that G4s are involved in many biological
processes.5,6 Due to the signicant roles in biological systems,
G4s have become promising targets for drug discovery,7 there-
fore, great efforts have been made to design and synthetize
specic G4 ligands in the past decade.8–10
Usually G4 ligands consist of a p-conjugated planar core and
side chains attached to it. The planar core interacts with
aBeijing National Laboratory for Molecular Sciences, Key Laboratory of Analytical
Chemistry for Living Biosystems, Institute of Chemistry, Chinese Academy of
Sciences, Beijing, 100190, China. E-mail: sgdh@iccas.ac.cn; Fax: +86-10-62528509;
Tel: +86-10-62528509
bDepartment of Pharmaceutical Chemistry, School of Pharmaceutical Sciences,
Guangxi Medical University, No. 22, Shuangyong Road, Nanning 530021, Guangxi,
PR China
† Electronic supplementary information (ESI) available: Further details are given
in Fig. S1–6. For MS and 1H NMR spectra. See DOI: 10.1039/c5ra11543d
Fig. 1 Structures of 7a–c.
This journal is © The Royal Society of Chemistry 2015
RSC Adv., 2015, 5, 75911–75917 | 75911

View Article Online
RSC Advances
Paper
chemotherapeutic anticancer agents through disturbing the DNA (Table 1) included a single stranded DNA (ss-DNA), a
functions of G4s in cells. The investigation on the interaction of duplex sequence (ds-DNA) formed by ss-DNA and its comple-
BPBC and its derivatives with cancer cells will provide helpful mentary sequence; four parallel G4 sequences, (EAD,19
information for the drug design based on bisbenzimidazole c-myc,20,21 Pu22, c-kit2 22); and two antiparallel G4 sequences
substituted carbazole derivatives.
(thrombin binding aptamer TBA23 and 22AG24).
In this paper, two derivatives of BPBC (7a), 7b and 7c were
As shown in Fig. 2, with the addition of 6-fold excess of
synthesized. The binding properties of these three compounds different DNA, the absorption bands of 7a–c increased, sug-
to different DNA forms were compared; and their cellular gesting that there were certain interactions between DNA and
uptake, intracellular localization, and cytotoxicity toward 7a–c. The parallel G4s (EAD, Pu22, c-kit2 and c-Myc) caused
different tumor cells were investigated.
signicant red-shi or emergence of new peaks in the absorp-
tion spectra of 7a–c (Fig. 2 le), but antiparallel G4s (TBA,
22AG), ss-DNAs and ds-DNA caused much smaller change of the
absorption spectra of 7a–c (Fig. 2 right), suggesting that 7a–c
had much stronger interaction with parallel G4s than with other
DNA forms, which was consistent with the results of BPBC
reported previously.18 The change extent of absorption spectra
(red-shi) of 7a–c upon the addition of different DNA was in the
order 7a > 7b S 7c, this order was consistent with the number
of amino groups in these compounds, suggesting that there
were interactions between side amino groups of 7a/7b and DNA.
Results and discussion
Design of BPBC derivatives
In order to investigate the contribution of the bisbenzimida-
zole-substituted carbazole planar core and side arms on the G4
binding of BPBC, two compounds were synthesized (Fig. 1),
including the non-substituted bisbenzimidazole-substituted
carbazole (7c), a bis-dimethylamino substituted 7c (7b). The
synthetic routes of these compounds are shown in the Experi-
mental section.
Fluorescence spectra of 7b and 7c in the presence of different
DNA
Absorption and uorescence spectra of 7b and 7c
BPBC has a tendency to self-aggregate in aqueous medium and
to disaggregate in ethanol.18 In order to compare the aggrega-
tion behavior of 7b and 7c, their absorption and emission
spectra were collected in mixed solvents of ethanol and water.
The absorption bands of these compounds were broad in water.
Along with the increasing of ethanol, these bands enhanced,
became sharp and accompanied with blue shi, which could be
considered as the transition of these compounds from aggre-
gated form to monomeric form (see Fig. S1 of the ESI†). Similar
with BPBC, 7b and 7c, exhibited very low uorescence in water,
and their uorescence emission was signicantly enhanced
accompanying slight blue-shi with the increase of ethanol (see
Fig. S1 of the ESI†). In addition, because of the electron-
donating ability of amino groups, BPBC and 7b showed longer
absorption and emission wavelength than 7c.
The excitation and emission spectra showed that 7b and 7c
exhibited very weak uorescence in the absence of DNA (Fig. 3).
Their uorescence greatly increased upon the addition of
parallel G4s (EAD, Pu22, c-kit2 and c-Myc). But the addition of
other forms of DNA only caused weak uorescence or almost no
Absorption spectra of 7a–c in the presence of different DNA
The interaction between 7a–c and different DNA was investi-
gated by absorption spectra and emission spectra. The used
Table 1 Oligonucleotides used in this study
Name
Oligonucleotide sequence (50 to 30)
G4 structure
ss-DNA
ds-DNA
CCAGTTCGTAGTAACCC
CCAGTTCGTAGTAACCC
Single stranded
Double stranded
GGGTTACTACGAACTGG
EAD
CTGGGTGGGTGGGTGGGA
TGAGGGTGGGGAGGGTGGGGAA
TGAGGGTGGGTAGGGTGGGTAA
CGGGCGGGCGCGAGGGAGGG
GGTTGGTGTGGTTGG
Parallel
Parallel
Parallel
Parallel
Antiparallel
Antiparallel
c-Myc
Pu22
c-kit2
TBA
Fig. 2 Absorption spectra of 7a–c (10 mM) in the presence of different
kinds of DNA (60 mM), dash lines represent the spectra of compounds
in the absence of DNA.
22AG
AGGGTTAGGGTTAGGGTTAGGG
75912 | RSC Adv., 2015, 5, 75911–75917
This journal is © The Royal Society of Chemistry 2015

View Article Online
Paper
RSC Advances
Table 2 Apparent binding equilibrium constants (Ka)
Ka [106 Mꢁ1
]
7a
7b
7c
c-Myc
EAD
Pu22
c-kit2
3.57 ꢂ 0.11
2.5 ꢂ 0.09
1.67 ꢂ 0.15
0.56 ꢂ 0.31
1.19 ꢂ 0.35
0.21 ꢂ 0.14
1.5 ꢂ 0.02
0.34 ꢂ 0.81
0.75 ꢂ 0.23
0.58 ꢂ 0.27
0.68 ꢂ 0.34
0.51 ꢂ 0.59
Fig. 3 Normalized excitation spectra (top) and emission spectra
(bottom) of 7b and 7c (1 mM) in the presence of different DNA (6 mM).
The excitation spectra of 7b and 7c were collected with lem ¼ 490 and
450 nm. The emission spectra of 7b and 7c were excited with lex ¼ 385
and 375 nm.
Fig. 5 CD based melting curves of c-myc and TBA in the presence and
absence of 7a. The CD signals of c-myc and TBA was collected at
260 nm and 295 nm respectively.
uorescence, which agreed well with that of BPBC. This result
suggested that 7b and 7c can discriminate between parallel G4s
and antiparallel G4s.
compounds, the CD spectra of parallel G4s (EAD, Pu22)
exhibited a characteristic positive peak at 265 nm and a negative
peak at 240 nm; antiparallel G4 (TBA and 22AG) showed a
characteristic positive peak at 295 nm and a negative band at
260 nm (see Fig. S5 of the ESI†). The addition of 7b or 7c to G4
solutions did not caused the conformational transition; only
enhanced the characteristic CD peaks of parallel G4s (EAD and
Pu22), and slightly change the characteristic CD peaks of anti-
parallel G4s (TBA and 22AG) indicating that the binding of 7b,
7c did not cause signicant conformational transition of these
G4s, which is similar with 7a. The further CD-based melting
study showed that 7a enhanced and maintained the CD signal
of the parallel structure of c-myc until the temperature reached
over 65 ꢀC and then greatly slowed down the decrease of this CD
signal with the temperature raise. However 7a only slightly
retarded the decrease of CD signal of the antiparallel structure
of TBA (Fig. 5). This result suggests that 7a can selectively
stabilize the parallel structure of c-myc, which may imply the
potential biological function of 7a.
In order to evaluate the binding ability of 7a–c to different
types of DNA, the uorescence titration experiment was per-
formed (Fig. S2–4 of the ESI†). The titration curves (Fig. 4)
revealed that 7b and 7c had selectivity to parallel G4s over other
forms of DNA, which is consistent with 7a. The titration curves
were tted to an independent-site model25 (eqn (1), materials
and methods); the apparent binding constants (Ka) of 7a–c to
parallel G4s were calculated as shown in Table 2. 7c showed
relatively low binding affinity to all parallel G4s, which may due
to its lack of side arms. 7a exhibited much higher binding
affinity to c-Myc and higher affinity to EAD and Pu22; 7b
exhibited higher affinity to Pu22, c-Myc, and lower affinity to
EAD; this difference between 7a and 7c might due to the
different interactions of their side arms with the loops or
grooves of these G4s.
CD spectroscopy
All the above spectral results of 7a–c in the absence and
presence of different DNA suggest that the bisbenzimidazole-
The CD spectra of G4s were measured to study the effect of 7b,
7c on the conformational of G4s. In the absence of the
Fig. 4 Fluorometric titration curves of 7b and 7c (1 mM) with different DNA.
This journal is © The Royal Society of Chemistry 2015
RSC Adv., 2015, 5, 75911–75917 | 75913

View Article Online
RSC Advances
Paper
Table 3 In vitro cytotoxicity of compounds 7a–c against five human
tumor cell lines
substituted carbazole core structure (7c) is the determinant of
the selectivity of 7a–c to parallel G4s. As this core structure can
stack on end G-quartet by p–p interaction, and is slightly larger
than the dimension of G-quartet plane,18 which makes the side
arms on this core approach the groove and loop regions and
interact with them. Since the grooves and loops are various
depending on the G4 sequences, the different side arms on the
core structure may cause different interaction with the different
G4s, resulting in different affinity and selectivity to parallel G4s.
G4 structures are prevalent in DNA or RNA, a general ligand
binding to all G4 structures may disturb the normal function of
G4s and result in toxic side-effects as a chemotherapeutic
anticancer agents. Our results show the potential to design or
screen highly selective ligands for a certain specic parallel G4
by optimizing the side arms on 7c.
IC50 (mM)
Compound
7a
7b
7c
MCF-7
HCT-8
PC-3
A549
A549 T
1.592 ꢂ 0.04
8.193 ꢂ 0.65
2.115 ꢂ 0.47
62.97 ꢂ 0.24
74.22 ꢂ 2.72
17.53 ꢂ 0.48
68.54 ꢂ 1.42
0.4457 ꢂ 0.17
1.359 ꢂ 0.08
0.9984 ꢂ 0.28
0.4986 ꢂ 0.06
2.305 ꢂ 0.72
15.371 ꢂ 1.47
8.059 ꢂ 0.34
21.93 ꢂ 1.75
low uorescence emission and weak binding of these
compounds to DNA except for parallel G4s. Because G4
formation in gene occurs transitorily when the double-
stranded DNA is actively denatured during transcription and
replication,27 the uorescence of 7a and 7b upon binding to
Cellular uptake, intracellular localization of 7a, 7b and 7c
G4 ligands have the potential to act as the chemotherapeutic G4s might be hardly observed. The uorescence in cells
anticancer agents. In order to investigate the potential of including in nucleoli may be due to that these compounds
bisbenzimidazole-substituted carbazole derivatives as located in a low polar environment just like they dissolved in
chemotherapeutic anticancer agents in therapy and to ethanol solution (Fig. S1†).
obtain the information for drug design, we further compared
the cellular uptake, localization and cytotoxicity of these Cytotoxicity assay
compounds. The confocal imaging showed that all of these
three compounds entered living cells (Fig. 6 and S6†). 7a and
The cytotoxicity of 7a–c was tested with ve cancer cell lines
(PC-3, MCF7, HCT-8, A549T, and A549) using CCK-8 assay.
7b with amino side arms exhibited higher cellular uptake
Aer exposed cells to different concentrations of 7a–c for 48 h,
than 7c based on the uorescence intensity in cells. The co-
the IC50 values of compounds 7a–c were measured. As shown
staining with Lyso-Tracker Red (lysosome probe) showed
in Table 3, 7a exhibited strong cytotoxicity with IC50 around 1
mM to all the tested cell lines and 7c showed much lower
that 7a and 7b mainly located in whole cytoplasm and
nucleoli, and 7c mainly located in lysosome. These results
cytotoxicity than 7a. The order of the cytotoxicity was 7a > 7b >
suggest that the side arms of 7a and 7b increased the cellular
7c, which was consistent with that of the binding ability to G4s
uptake and changed the cellular localization. Our previous
and the cellular uptake of these compounds. Although
results have shown that DNA-binding dyes with multiple
currently we do not know whether the cytotoxicity of these
amino groups mainly locate in nucleus, especially in
compounds was caused by their G4 binding, the cytotoxicity
results suggest that the bisbenzimidazole-substituted carba-
zole derivatives hold the potential as anticancer reagents. The
nucleoli.26 However almost no uorescence of 7a and 7b was
observed in nucleus except in nucleoli, which may due to the
further investigation will focus on the mechanism of cytotox-
icity of BPBC.
Conclusions
In summary, the interaction of three bisbenzimidazole-
substituted carbazole derivatives (7a–c) with G-quadruplexes
and living cells was investigated. Same as BPBC (7a), bisben-
zimidazole-substituted carbazole core of BPBC (7c) and
bisdimethylamino-substituted 7c (7b) exhibited good selec-
tivity to parallel G4s. BPBC showed the strongest binding
affinity to the tested parallel G4s, and 7b showed better affinity
to some of parallel G4s than 7c. Confocal imaging showed that
BPBC and 7b could enter into living cells and mainly located in
cytoplasma and nucleoli; 7c was mainly found in lysosome.
Cytotoxicity assay showed that 7a–c exhibited cytotoxicity to
cancer cells, in which 7a exhibited the highest cytotoxicity with
IC50 around 1 mM. These results conrmed that bisbenzimi-
dazole-substituted carbazole planar core is the essential
element for the specic binding of BPBC derivatives; the
Fig. 6 Confocal images of MCF-7 cells stained by 7a, 7b or 7c (10 mM)
(lex ¼ 405 nm) and Lyso-Tracker Red (lex ¼ 559 nm).
75914 | RSC Adv., 2015, 5, 75911–75917
This journal is © The Royal Society of Chemistry 2015

View Article Online
Paper
RSC Advances
side arms can affect their binding ability and selectivity to
special G4s and change their cellular uptake, localization and
cytotoxicity.
Chemistry
General procedures (Scheme 1)
Experimental
Oligonucleotides
All oligonucleotides were purchased from Sunbiotech Co., Ltd
(Beijing, China). Oligonucleotides were dissolved in Tris–HCl
buffer (10 mM Tris–HCl, 100 mM NaCl, 20 mM KCl and 0.1 mM
EDTA, pH ¼ 7.4) except for 22AG. 22AG, was dissolved in
(10 mM Tris–HCl, 100 mM NaCl, 0.1 mM EDTA pH ¼ 7.4). The
concentration of oligonucleotides was determined based on
their absorbance at 260 nm. Oligonucleotides were prepared by
heating at 95 ꢀC for 10 min followed with rapidly cooling to 4 ꢀC,
and kept at 4 ꢀC overnight.
Scheme 1 Synthetic route of 7a–c. Reagents and conditions: (a)
K2CO3, DMF, 110 ꢀC; (b) H2, Pd/C (5%); (c) NaH, DMF, CH3I, r.t; (d)
POCl3, DMF, ClCH2CH2Cl, 90 ꢀC; (e) Na2S2O5, EtOH, reflux.
Materials and reagents
3,6-Diformyl-9-methylcarbazole. To DMF (2.92 g, 40 mmol) at
0
ꢀC, phosphorus oxychloride (6 g, 40 mmol) was added
Carbazole, 5-chloro-2-nitroaniline and palladium on activated
carbon were obtained from J&K Co., Ltd. Other reagents were
purchased from Beijing Chemical Plant (Beijing). Distilled-
deionized water was used throughout this work. All chemical
reagents were used without further purication. Lyso-Tracker
Red kit was bought from Beyotime Institute of Biotechnology
(Jiangsu, China). Stock solution of 7a–c (10 mM) was prepared
in DMSO.
dropwise. The solution was allowed to warm to room tempera-
ture, and 9-methylcarbazole (3) (724 mg, mmol) in
4
1,2-dichloroethane (6 mL) was added. The reaction mixture was
heated to 90 ꢀC and kept at this temperature for 24 h. The
reaction mixture was poured into water and extracted with
chloroform. The chloroform layer was washed with water, and
the solvent was removed to yield a deeply colored product, which
was puried on a silica gel column using hexane/ethyl acetate
(7 : 3) as eluent, yielding 260 mg (27.4%) of desired product. 1H
NMR (400 MHz, CDCl3) d 10.14 (s, 2H), 8.66 (s, 2H), 8.10 (dd, J ¼
8.5, 1.4 Hz, 2H), 7.55 (d, J ¼ 8.5 Hz, 2H), 3.97 (s, 3H).
Cell lines
A549 (non-small cell lung cancer) and MCF-7 (breast cancer) cell
lines were purchased from Cell Resource Center of Shanghai
Institute for Biological Sciences (Chinese Academy of Sciences,
Shanghai, China). PC-3 (prostate cancer) cell lines was
purchased from typical culture preservation commission cell
bank, Chinese Academy of Sciences (Shanghai, China). A549T
(Taxol-resistant A549 subline) cell line was purchased from
Shanghai Aiyan Biological Technology Co. Ltd (Shanghai,
China). HCT-8 (colon cancer) was purchased from Cell Culture
Center of Institute of Basic Medical Sciences (Chinese Academy
of Medical Sciences, Beijing, China). Cells were grown in RPMI
1640 Medium (Hyclone) supplemented with 10% fetal bovine
serum (FBS, Gibco) at 37 ꢀC in a 5% CO2 humidied
atmosphere.
N1,N1-Dimethyl-4-nitrobenzene-1,3-diamine, 5b. 5-Chloro-2-
nitro-aniline (25.0 g, 144.9 mmol) was dissolved in DMF
(200 mL). Dimethylamine 40 wt% in H2O solution (46 mL) was
added into the reaction mixture and then K2CO3 (36 g) was
added. The solution was slowly heated to 150 ꢀC and stirred for
12 h. The reaction mixture was poured into excess ice water. The
yellow precipitant was ltered and washed with water. The
desired product (25.2 g) was obtained in 96% yield. 1H NMR
(400 MHz, CDCl3) d 8.00 (d, J ¼ 9.7 Hz, 1H), 6.19 (s, 2H), 6.13
(dd, J ¼ 9.7, 2.6 Hz, 1H), 5.74 (d, J ¼ 2.6 Hz, 1H), 3.05 (s, 6H).
4 N,N-Dimethylamino-phenylenediamine, 6b. 5b (1 g, 181 g
molꢁ1, 5.5 mmol) was dissolved in 160 mL MeOH/EtOAc (1 : 1)
solvent. 10% Pd/C (110 mg) and NaBH4 (416 mg, 11.0 mmol)
was slowly added. The reaction mixture was stirred for about 1
h, aer which TLC showed absence of starting material. NH4Cl
(400 mg) was added into the reaction mixture and ltered
through Celite to remove Pd/C. The ltrate was directly used to
further reaction without any purication because this diamino-
compound would be oxidatively decomposed during purica-
tion steps.
Instruments
1H NMR spectra spectra were recorded at 400 MHz. Low-
resolution ESI-mass spectra (MS) were obtained on a LC-MS
2010A (Shimadzu) instrument using standard conditions.
MALD-TOF MS were obtained on a Bruker Daltonics ex-
Analysis. Fluorescence emission spectra were recorded on a
Hitachi F-4500 uorescence spectrouorometer (Kyoto,
Japan). CD spectra (230–400 nm) were recorded on a Jasco
J-815 circular dichroism spectropolarimeter (JASCO Ltd)
at a rate of 500 nm minꢁ1 using 400 mL of 1 cm fused
quartz cells. Each spectrum was the average of three scans.
2,20-(9-Methyl-9H-carbazole-3,6-diyl)bis(N,N-dimethyl-1H-benzo-
[d]imidazol-5-amine), 7b. To a freshly prepared solution of
compound 6b was added 0.5 equiv. of the compound 3, and to
this solution was added sodium metabisulte (Na2S2O5,
1 equiv.) dissolved in a minimum quantity of water. The reaction
This journal is © The Royal Society of Chemistry 2015
RSC Adv., 2015, 5, 75911–75917 | 75915

View Article Online
RSC Advances
Paper
mixture was reuxed for 7–8 h with stirring, then cooled to room condition is 10 mM Tris–HCl, 20 mM KCl, 100 mM NaCl and
temperature, and ltered through Celite. Ethanol was then 0.1 mM EDTA.
removed under reduced pressure to yield the required crude
CD based melting study. Each DNA was dissolved in PBS
product. This crude product was then puried by column (10 mM phosphate buffer, 2.7 mM KCl, 137 mM NaCl, pH 7.4) at
chromatography (EtOAc : MeOH ¼ 2 : 1) on silica gel to yield the the nal concentration of 4.0 mM and submitted to the
1
required product yield (20%). H NMR (400 MHz, DMSO-d6) d annealing procedure (heating to 90 ꢀC and slowly cooling at
9.05 (s, 2H), 8.31 (d, J ¼ 8.6 Hz, 2H), 7.82 (d, J ¼ 8.7 Hz, 2H), 7.49 room temperature). Before each experiment, the samples were
(d, J ¼ 8.5 Hz, 2H), 6.92–6.81 (m, 4H), 4.03 (s, 3H), 2.97 (s, 12H). equilibrated at 10 ꢀC for 30 min. CD melting curves were
13C NMR (101 MHz, DMSO) d 154.94, 147.21, 146.15, 138.93, obtained by monitoring the variation of CD signals at 295 nm
ꢀ
137.82, 126.55, 123.18, 123.26, 120.47, 115.78, 115.83, 112.78, (for TBA) or 260 nm (for c-myc) from 30 to 90 C. The heating
ꢁ1
ꢀ
105.89, 41.27, 29.60. HRMS (ESI)/HRMS-ESI m/z: calcd for rate was 0.5 C min
.
C31H29N7 [M + H]+ 500.25180, found 500.25637.
Confocal imaging. Cells were seeded in a 35 mm ꢃ 12 mm
3,6-Bis(1H-benzo[d]imidazol-2-yl)-9-methyl-9H-carbazole, 7c. To style cell culture dish (F 20 mm glass bottom) and cultured for
a solution of benzene-1,2-diamine was added 0.5 equiv. of the 24 h in a humided incubator at 37 ꢀC with 5% CO2. Aer
compound 3, and to this solution was added sodium meta- removing the medium, cells were incubated with 1 mL of fresh
bisulte (Na2S2O5, 1 equiv.) dissolved in a minimum quantity of medium containing compounds (10 mM) and Lyso-Tracker Red
water. A subsequent synthetic procedure similar to that used for (5 mM) was cultured for 2 h. Prior to imaging, cells were washed
the preparation of compound 7a18 provided compound 7c (yield with phosphate buffered saline (PBS) (pH 7.4) three times, and
25%) as a white powder. 1H NMR (400 MHz, DMSO-d6) d 12.91 (s, then imaged under an OLYMPUS FV1000-IX81 confocal micro-
2H), 9.14 (s, 2H), 8.38 (d, J ¼ 8.5 Hz, 2H), 7.84 (d, J ¼ 8.6 Hz, 2H), scope (Olympus Corporation, Japan). Fluorescent images were
7.84 (d, J ¼ 8.6 Hz, 2H), 7.68 (d, J ¼ 6.2 Hz, 2H), 7.56 (d, J ¼ 6.5 observed using a 100ꢃ objective lens and the images were
Hz, 2H), 7.22 (s, 2H), 4.02 (s, 3H). 13C NMR (101 MHz, DMSO) d processed using the Olympus FV10-ASW 1.6 viewer soware.
152.94, 142.51, 135.43, 125.34, 122.87, 122.59, 122.15, 119.34, The excitation wavelengths were 405 nm and uorescence
119.06, 117.83, 115.09, 110.47, 109.84, 29.86. HRMS (ESI) calcd signals were collected from 425–475 nm. The Lyso-Tracker Red
for C27H19N5 [M + H]+ 414.16740, found 414.17167.
were excited at 559 nm, and monitored at 610–660 nm.
In vitro cytotoxicity studies. The cytotoxicity of compounds
UV-vis spectra measurement. The absorbance spectra were
recorded in Tris–HCl buffer mentioned above on a double beam 7a–c was evaluated by Cell Counting Kit-8 (CCK-8) kit (Dojindo
spectrophotometer UH5300 (HITACHI, Japan).
Laboratories, Kumamoto, Japan). In brief, MCF7, HCT-8, PC-3,
Fluorimetric titrations. Fluorimetric titrations of the dye A549 or A549 T cells (5 ꢃ 103 well) were seeded into 96-well
ꢀ
7a–c with the oligonucleotides were performed in Tris–HCl plates and incubated at 37 C for 18 h. Cells were then treated
buffer mentioned above. 1 mM 7a–c was mixed with DNA at with the indicated concentrations of compounds, respectively.
different concentrations; aer standing for 30 min at room The plates were incubated at 37 ꢀC for an additional 48 h. Then
temperature in the dark, the uorescence spectra were the medium was replaced with 100 mL of fresh medium
collected. The data from the uorimetric titrations were (without FBS and penicillin/streptomycin) containing 10 mL of
analyzed according to the independent-site model25 by non- CCK-8 reagent. Aer incubation at 37 C/5% CO2 for 1 h, the
ꢀ
linear tting to eqn (1),28 in which F0 is the background uo- absorbance at 450 nm was measured on a SpectraMax M5
rescence intensity of 7a–c in the absence of DNA, Fmax is the (Molecular Devices, CA, USA). The cell viability rate (VR) was
uorescence intensity upon saturation, and n is the putative calculated according to the eqn (2):
number of binding sites on a given DNA. The parameters, Q and
A, were found by Levenberg–Marquardt tting routine in the
Origin 8.5 soware, whereas n was varied to obtain a better t.
A ꢁ A0
VR ¼
ꢃ 100%
(2)
AS ꢁ A0
where A is the absorbance of the experimental group, As is the
absorbance of the control group and A0 is the absorbance of the
blank group (no cells).
ꢁ
ꢂ
qffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
ꢀ
Q ꢁ 1
2
F F0 ¼ 1 þ
A þ 1 þ x ꢁ ðA þ 1 þ xÞ ꢁ 4x
(1)
2
1
CDNA
; Q ¼
Cdye
Fmax
F0
Acknowledgements
A ¼
; x ¼ n
KaCdye
We gratefully acknowledge the nancial support from Grant 973
Program (2011CB935800, 2011CB911000 and 2013CB933700),
NSF of China (21275149, 21375135, 21205124 and 21321003)
and NSF of Guangxi Province of China (2013GXNSFBA019158).
Circular dichroism spectroscopy. CD spectra were recorded
on a JASCO J-815 spectrometer in the wavelength range
200–400 nm using a 10 mm path length quartz cuvette. The
scanning speed of the instrument was set to 500 nm minꢁ1, and
the response time used was 0.5 s. Each spectrum was the
average of three scans. All the strand concentration of
oligonucleotides used for measurement was 4 mM. The buffer
Notes and references
1 A. K. Todd, M. Johnston and S. Neidle, Nucleic Acids Res.,
2005, 33, 2901–2907.
75916 | RSC Adv., 2015, 5, 75911–75917
This journal is © The Royal Society of Chemistry 2015

View Article Online
Paper
RSC Advances
2 J. L. Huppert and S. Balasubramanian, Nucleic Acids Res., 16 A. De Cian and J. L. Mergny, Nucleic Acids Res., 2007, 35,
2007, 35, 406–413. 2483–2493.
3 J. Eddy and N. Maizels, Nucleic Acids Res., 2008, 36, 1321– 17 S. Bhattacharya, P. Chaudhuri, A. K. Jain and A. Paul,
1333. Bioconjugate Chem., 2010, 21, 1148–1159.
4 J. L. Huppert, A. Bugaut, S. Kumari and S. Balasubramanian, 18 B. Jin, X. Zhang, W. Zheng, X. J. Liu, C. Qi, F. Y. Wang and
Nucleic Acids Res., 2008, 36, 6260–6268. D. H. Shangguan, Anal. Chem., 2014, 86, 943–952.
5 T. A. Brooks, S. Kendrick and L. Hurley, FEBS J., 2010, 277, 19 X. H. Cheng, X. J. Liu, T. Bing, R. Zhao, S. X. Xiong and
3459–3469. D. H. Shangguan, Biopolymers, 2009, 91, 874–883.
6 P. Agarwala, S. Pandey and S. Maiti, Biochim. Biophys. Acta, 20 A. T. Phan, V. Kuryavyi, H. Y. Gaw and D. J. Patel, Nat. Chem.
Gen. Subj., 2014, 1840, 3503–3510. Biol., 2005, 1, 167–173.
7 S. Balasubramanian, L. H. Hurley and S. Neidle, Nat. Rev. 21 J. X. Dai, M. Carver, L. H. Hurley and D. Z. Yang, J. Am. Chem.
Drug Discovery, 2011, 10, 261–275. Soc., 2011, 133, 17673–17680.
8 T. M. Ou, Y. J. Lu, J. H. Tan, Z. S. Huang, K. Y. Wong and 22 S. T. D. Hsu, P. Varnai, A. Bugaut, A. P. Reszka, S. Neidle and
L. Q. Gu, Chemmedchem, 2008, 3, 690–713.
9 S. N. Georgiades, N. H. Abd Karim, K. Suntharalingam and
R. Vilar, Angew. Chem., Int. Ed., 2010, 49, 4020–4034.
10 J. H. Guo, L. N. Zhu, D. M. Kong and H. X. Shen, Talanta,
2009, 80, 607–613.
S. Balasubramanian, J. Am. Chem. Soc., 2009, 131, 13399–
13409.
23 L. Martino, A. Virno, A. Randazzo, A. Virgilio, V. Esposito,
C. Giancola, M. Bucci, G. Cirino and L. Mayol, Nucleic
Acids Res., 2006, 34, 6653–6662.
11 A. K. Jain and S. Bhattacharya, Bioconjugate Chem., 2011, 22, 24 A. Ambrus, D. Chen, J. X. Dai, T. Bialis, R. A. Jones and
2355–2368. D. Z. Yang, Nucleic Acids Res., 2006, 34, 2723–2735.
12 L. N. Zhu, S. J. Zhao, B. Wu, X. Z. Li and D. M. Kong, PLoS 25 F. H. Stootman, D. M. Fisher, A. Rodger and J. R. Aldrich-
One, 2012, 7, e35586. Wright, Analyst, 2006, 131, 1145–1151.
13 B. Jin, X. Zhang, W. Zheng, X. Liu, J. Zhou, N. Zhang, F. Wang 26 J. Zhou, A. Chang, L. L. Wang, Y. Liu, X. J. Liu and
and D. Shangguan, Anal. Chem., 2014, 86, 7063–7070. D. H. Shangguan, Org. Biomol. Chem., 2014, 12, 9207–9215.
14 C. C. Chang, J. Y. Wu and T. C. Chang, J. Chin. Chem. Soc., 27 N. Maizels, Nat. Struct. Mol. Biol., 2006, 13, 1055–1059.
2003, 50, 185–188.
28 X. Xie, B. Choi, E. Largy, R. Guillot, A. Granzhan and
15 C. C. Chang, I. C. Kuo, I. F. Ling, C. T. Chen, H. C. Chen,
P. J. Lou, J. J. Lin and T. C. Chang, Anal. Chem., 2004, 76,
4490–4494.
M. P. Teulade-Fichou, Chem.–Eur. J., 2013, 19, 1214–1226.
This journal is © The Royal Society of Chemistry 2015
RSC Adv., 2015, 5, 75911–75917 | 75917