Diastereoselective One-Step Synthesis of 2-Keto-3-deoxy-d- glycero-d-galacto-nononic acid (KDN) Analogues as Templates for the Development of Influenza Drugs

Article abstract of DOI:10.1002/adsc.201700678

Novel sialic acid scaffolds have great significance in the development of influenza neuraminidase inhibitors. Here the enzymatic synthesis of a wide range of 2-keto-3-deoxy-d-glycero-d-galacto-nononic acid (KDN) analogues via aldol addition of pyruvate to d-mannose, d-glucose, d-galactose, 2-deoxy-d-glucose, d-arabinose, l-arabinose and l-rhamnose using a previously unstudied N-acetylneuraminic acid (Neu5Ac) aldolase derived from the bacterium Dyadobacter fermentas is exemplified. Several of the synthesized KDN analogues showed comparable or better inhibitory activity than unstudied Neu5Ac against the mutated influenza neuraminidases (A/California/04/2009 and A/Anhui/1/2005), which both show resistance to Neu5Ac-based neuraminidase inhibitors, demonstrating that these compounds are promising templates for the development of anti-influenza drugs. (Figure presented.).

Full text of DOI:10.1002/adsc.201700678

Title: Diastereoselective One-step Synthesis of 2-Keto-3-deoxy-D-
glycero-D-galacto-nononic acid (KDN) Analogues as Templates
for the Development of Influenza Drugs
Authors: Pedro Laborda, Su-Yan Wang, Ai-Min Lu, Meng He, Xu-Chu
Duan, Ying-Juan Qian, Yong-Sam Jung, Li Liu, and Josef
Voglmeir
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: Adv. Synth. Catal. 10.1002/adsc.201700678
Link to VoR: http://dx.doi.org/10.1002/adsc.201700678

Advanced Synthesis & Catalysis
10.1002/adsc.201700678
COMMUNICATION
DOI: 10.1002/adsc.201((will be filled in by the editorial staff))
Diastereoselective One-step Synthesis of 2-Keto-3-deoxy-D-
glycero-D-galacto-nononic acid (KDN) Analogues as Templates
for the Development of Influenza Drugs
a
a
b
a
a
Pedro Laborda, Su-Yan Wang, Ai-Min Lu, Meng He, Xu-Chu Duan, Ying-Juan
c
c
a,d
a,e
Qian, Yong-Sam Jung, Li Liu, * and Josef Voglmeir *
a
Glycomics and Glycan Bioengineering Research Center, College of Food Science and Technology, Nanjing Agricultural
University, China
b
College of Sciences, Nanjing Agricultural University, China
Antiviral Unit, Department of Veterinary Medicine, Nanjing Agricultural University, China
Email: lichen.liu@njau.edu.cn, Tel: + 86-25-84399512, Fax: + 86-25-84399553
Email: josef.voglmeir@njau.edu.cn, Tel: + 86-150-6227-0463, Fax: + 86-25-84399553
c
d*
e*
Received: ((will be filled in by the editorial staff))
Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/adsc.201######.
Abstract. Novel sialic acid scaffolds have great
significance in the development of influenza neuraminidase
inhibitors. Here the enzymatic synthesis of a wide range of
Neu5Ac is used as the standard template for the
development of effective small molecule neuraminidase
inhibitors including the above-mentioned commercially
available drugs (Figure 1). However, some naturally-
occurring mutations of the influenza virus, such as the
H274Y mutation in H1N1 and H5N1 virus strains, have
shown significant levels of resistance towards these drugs
generating the necessity to develop new synthetic
2
-keto-3-deoxy-D-glycero-D-galacto-nononic acid (KDN)
analogues via aldol addition of pyruvate to D-mannose, D-
glucose, D-galactose, 2-deoxy-D-glucose, D-arabinose, L-
arabinose and L-rhamnose using a previously unstudied N-
acetylneuraminic acid (Neu5Ac) aldolase derived from the
bacterium Dyadobacter fermentas was exemplified. Several
of the synthesized KDN analogues showed comparable or
better inhibitory activity than unstudied Neu5Ac against the
mutated influenza neuraminidases (A/California/04/2009
and A/Anhui/1/2005), which both show resistance to
Neu5Ac-based neuraminidase inhibitors, demonstrating
that these compounds are promising templates for the
development of anti-influenza drugs.
[6]
inhibitors to compete against these reported resistances.
The creation of new sialic acid scaffolds as templates for
the synthesis of new neuraminidase inhibitors may be a
suitable way to overcome this limitation.
Keywords: Aldol reaction; Diastereoselectivity; KDN;
Antiviral agents, Sialic acids.
In addition to the five major flu pandemics of the last
century, seasonal influenza outbreaks cause annual
epidemics that lead in many cases to hospitalization and
death, especially in children and the elderly.[ Two major
glycoproteins found on the influenza virus envelope are
hemagglutinin, responsible for viral attachment to terminal
N-acetylneuraminic acids (Neu5Ac, 1) of cell surface
receptors,[ and a neuraminidase able to cleave off newly
formed Neu5Ac-bound virions from the host cell to further
1]
2]
[
3]
enhance the viral mobility. The treatment of influenza
consist in the administration of neuraminidase inhibitors
®
®
such as zanamivir (Relenza ), oseltamivir (Tamiflu ),
®
®
®
laninamivir (Inavir ) or peramivir (Rapivab , Rapiacta or
Peramiflu ). Since the discovery that the Neu5Ac 2,3-
®
[4]
didehydro derivative DANA (2,3-didehydro-2-deoxy-N-
acetylneuraminic acid) can inhibit neuraminidases,
Figure 1. Current spectrum of influenza neuraminidase
inhibitors.
[
5]
1
This article is protected by copyright. All rights reserved.

Advanced Synthesis & Catalysis
10.1002/adsc.201700678
Aldolase enzymes play an important role in the
reaction. Biochemical characterization of DfNAL
(Supporting Figure S4) revealed that DfNAL showed the
highest activity at pH 8.0 and 65 °C. No metal ions were
essential for the enzymatic activity, but the presence of
Cu could slightly decrease the enzyme’s activity. Sodium
dodecyl sulfate inhibited DfNAL activity whereas other
additives, such as urea, triton X-100 or 2-mercaptoethanol,
[
7]
chemoenzymatic synthesis of sialic acid analogues
Scheme 1). Wong et al. reported the synthesis of KDO
(
and KDO analogues from D-threose, D-ribose and D-
erythrose using a KDO aldolase from Aureobacterium
barkerei.[ Furthermore, the activity of Neu5Ac aldolases
from E. coli and Peptoclostridium difficile were previously
II
8]
[
9]
studied towards a series of monosaccharides. Later,
Hilbert, Seeberger and coworkers reported the
macrophomate synthase-catalyzed aldol addition of
pyruvate enolate into several protected aldopentoses
obtaining the corresponding sialic acids as diastereomeric
had no effect in the enzymatic activity. Vmax, K
m
and kcat
values were determined to be 3.1±0.4 µM/s, 10.1±1.8 mM
-
1
and 36.5 s , respectively.
Neu5Ac was successfully synthetized from ManNAc with
94% conversion when 5 equivalents of pyruvate were
added in the reaction mixture. Surprisingly, DfNAL was
also able to catalyze the aldol addition of pyruvate into
mannose to provide sialic acid KDN (2) in a quantitative
manner (Scheme 2, top), after 12 h reaction time when 5
equivalents of pyruvate were used. The ability to observe
the enzymatic reaction product in a quantitative manner by
NMR encouraged us to try the enzymatic aldol reaction
using other hexoses than mannose (D-glucose and D-
galactose), deoxyhexoses, (2-deoxy-D-glucose and L-
rhamnose), and aldopentoses (L-arabinose and D-
arabinose) as substrates obtaining the corresponding KDN
[
10]
mixtures (Scheme 1 C).
Here, we report the synthesis of a wide range of 2-keto-3-
deoxy-D-glycero-D-galacto-nononic acid (KDN, 2)
analogues using
a
previously unstudied, highly
promiscuous N-acetylneuraminate lyase cloned from the
bacterium Dyadobacter fermentas and the potential of the
synthetized compounds to inhibit mutated influenza
neuraminidases in comparison.
derivatives
trihydroxypropyl]-hex-2-ulopyranosonic
4S,5S,6R)-3-deoxy-6-[(1S,2R)-1,2,3-trihydroxypropyl]-
hex-2-ulopyranosonic acid (4), (5S,6R)-3,5-dideoxy-6-
(1R,2R)-1,2,3-trihydroxypropyl]-hex-2-ulopyranosonic
acid (5), (4R,5S,6R)-3-deoxy-6-[(1S,2S)-1,2-
dihydroxypropyl]-hex-2-ulopyranosonic acid (6a),
4S,5S,6R)-3-deoxy-6-[(1S,2S)- 1,2-dihydroxypropyl]-hex-
(4S,5S,6R)-3-deoxy-6-[(1R,2R)-1,2,3-
acid (3),
(
[
(
2
1
-ulopyranosonic acid (6b), (4S,5S,6S)-3-deoxy-6-[(1S)-
,2-dihyroxyethyl]-hex-2-ulopyranosonic acid (7), KDO
(
2
8a) and gluco-KDO (8b) in different proportions (Scheme
). DfNAL showed no activity towards other amino sugars
apart from ManNAc, such as glucosamine, N-
acetylglucosamine or kanosamine, or towards
disaccharides, such as lactose or maltose. Despite DfNAL
could catalyze the aldol reaction of D-arabinose or L-
arabinose, no activity was observed when other
aldopentoses like D-ribose or L-ribose were used as
substrates.
Scheme 1. Reported chemoenzymatic routes to new sialic
acid analogues. A: Enzymatic synthesis of C-5 modified
KDN was discovered in 1986 and several synthetic routes
to produce this sialic acid have been reported so far.
Three enzymatic routes to 2-keto-3-deoxy-D-manno-
[
12]
[
7]
Neu5Ac analogues.
B: Synthetic strategy to KDO
analogues.[ C: Synthetic route to KDO analogues.
8]
[10]
a)
b)
c)
octonic acid (KDO, 8a) using different aldolases have also
Reaction conditions:
KDO aldolase from Aureobacterium barkerei,
bacterial sialic acid aldolase,
[
8, 10, 13]
been described.
8b has been synthetized starting
[
13]
from protected D-glucose derivatives.
This is the first
macrophomate synthase.
time KDN analogues 3, 4, 5, 6a and 6b are reported.
To analyze the diastereoselectivity of the aldol reactions,
synthetized sialic acids were labeled with 1,2-
Recombinant Dyadobacter fermentas N-acetylneuraminic
[
11]
acid aldolase (DfNAL)
could successfully catalyze the
[
14]
diaminobenzene.
labeled sialic acids revealed that aldol reactions to sialic
acids 2, 3, 4, and occurs with complete
The HPLC-based analysis of the
retro-aldol reaction of Neu5Ac obtaining ManNAc and
pyruvate. The photometric assay used for the detection of
the DfNAL activity consisted in the selective N-acyl-D-
mannosamine dehydrogenase-catalyzed oxidation of
ManNAc to produce N-acetylmannominic acid in presence
5
7
diastereoselectivity whereas diastereomeric mixtures were
obtained using L-rhamnose, 6a/6b 70:30, and D-arabinose,
8a/8b 56:44, as substrates (Supporting Figure S5). 2, 3, 4,
+
of NAD which is reduced to NADH. The readout of
5
, 7 and major diastereoisomers, 6a and 8a, were isolated
formed NADH at 340 nm could be successfully applied to
quantitatively determine the conversion of the retro-aldol
by silica gel chromatography.
2
This article is protected by copyright. All rights reserved.

Advanced Synthesis & Catalysis
10.1002/adsc.201700678
C-4 of these structures. KDN analogues 6a and 8a are in
alternate chair conformation with the C-6-linked glycerol
[10, 13]
side-chain is located in equatorial position.
Curiously,
a triplet with coupling constants about 12 Hz could be also
observed for the proton linked to C-3 in axial position in
1
the
H NMR spectrum of 6a indicating an (R)
1
configuration on C-4 (Supporting Figure S12). The H
NMR spectrum of 8a is in accordance with the previously
described spectra of KDO confirming an (R) configuration
on C-4 (Supporting Figure S13).
The previously reported aldolase KdsA allowed the
synthesis of sialic acids with (R) configuration on C-4,
whereas the macrophomate synthase reported permitted the
synthesis of C-4 (S) diasteroisomer in a higher ratio.
[
13]
[
12]
[
10]
Although the substrate promiscuity of other bacterial
Neu5Ac aldolases towards D-glucose, 2-deoxy-D-glucose,
D-galactose, 2-deoxy-D-galactose, D-allose, D-lyxose, D-
arabinose, 2-deoxy-D-ribose, L-xylose and L-fucose was
described with efficiencies previously, the produced sialic
acids were not structurally characterized and the
diastereoselectivity of the enzymatic reaction was not
[9a, 9c]
studied.
Although the configuration on the generated
asymmetric center is commonly conserved regardless of
[
15]
the acceptor substrate in enzymatic aldol reactions,
DfNAL was able to change the configuration of this center,
presumably depending on the configuration of the
substituents on the C-3 of the substrate. Substrates with (R)
configuration on C-3 led to sialic acids with (S)
configuration on C-4, whereas sialic acids possessing (R)
configuration on C-4 were obtained with major proportion
when substrates with (S) configuration on C-3 were used.
The inhibitory activity of the obtained KDN and KDN
derivatives were tested against H274Y mutated H1N1
(
(
A/California/04/2009) and H274Y mutated H5N1
A/Anhui/1/2005) influenza A virus neuraminidases. A 5-
bromo-4-chloro-indolyl-β-D-galacto-pyranosyl-sialoside,
X-gal-α-2,3-Neu5Ac (9), was used as the influenza
neuraminidase substrate, yielding 5-bromo-4-chloro-
indolyl-β-d-galactopyranoside, which hydrolysis to X-gal
[
16]
(
10) can be easily followed by HPLC analysis (Scheme
3
). 9 was synthetized according to the method described by
Scheme 2. DfNAL-catalyzed synthesis of Neu5Ac (1),
KDN (2) and KDN analogues (3, 4, 5, 6a, 6b, 7, 8a and
[17]
Chen and co-workers.
All tested sialic acid analogues
showed inhibitory activity against H274Y mutated H1N1
and H274Y mutated H5N1 neuraminidases (Figure 2),
with 4 having the highest inhibitory activity. Although
8
b). Reaction conditions: commercial sugar (1.11 mmol),
sodium pyruvate (5.55 mmol), 50 mM Na PO /citrate
3
4
buffer pH 8.0, 37 °C, 12 h (reaction volume: 5 mL).
Yields: 1 89%, 2 86%, 3 21%, 4 29%, 5 32%, 6a 2%, 7
1
4%, 8a 23%.
The configuration of the newly generated asymmetric
center in C-4 of the purified compounds was elucidated by
1
13
1
H and C NMR (Supporting Figures S6-S10). In the H
NMR spectrum of 2, the signal corresponding with the
proton linked to C-3 in axial position appears as a triplet at
1
.72 ppm with coupling constants of 12.2 Hz due to the
coupling between geminal and vicinal axial-axial protons
indicating the (S) configuration of C-4 (Supporting Figure
S11). Compound 3, 4, 5 and 7 adopt the same chair
1
conformation in comparison with 2. H NMR spectra of
these KDN derivatives showed that the signals
corresponding to the proton linked to C-3 in axial position
appear as a triplet with similar coupling constants as the
ones observed for 2 demonstrating an (S) configuration on
Scheme 3. Neuraminidase inhibition assays were carried
out using X-gal-α-2,3-Neu5Ac (9) as neuraminidase
substrate yielding X-gal (10) and Neu5Ac (1).
3
This article is protected by copyright. All rights reserved.

Advanced Synthesis & Catalysis
10.1002/adsc.201700678
comparison with that observed for Neu5Ac demonstrating
the potential of these compounds as templates for the
development of new drugs.
Experimental Section
Gene cloning and construction of the expression vector
The oligonucleotide primers for amplifying the target
genes were designed based on the genomic DNA sequence
of D. fermentas (GenBank number WP 015812487.1)
sense
primer:
5’-
Figure 2. Screening of Neu5Ac (1) and synthetized KDN
analogues (2, 3, 4, 5, 6a, 7 and 8a) against H274Y mutant
H1N1 neuraminidase (A/California/04/2009, in white) and
H274Y mutant H5N1 neuraminidase (A/Anhui/1/2005,
black) using oseltamivir as control (C). The neuraminidase
inhibitor assays were performed at 1 mM concentrations.
GGAATTCCATATGAACTTACATTTAGAGGGCCTCA
TCG -3’ (containing an underlined NdeI restriction site),
anti-sense
CCGCTCGAGAAATGTATTTTTGGCCAAAACGG -3’
XhoI site underlined)). The genes were amplified by
primer:
5’-
(
polymerase chain reaction (PCR) using Primestar HS DNA
polymerase (Takara) and genomic DNA as templates
according to the manufacturer’s instructions. Briefly, the
PCR amplification was performed using 35 PCR cycles
consisting of denaturation at 95 °С for 10 s, annealing at
KDN derivative 4 could significantly enhance the
inhibitory activities compared with 1, 4 showed lower
inhibitory activities in comparison to the commercially
neuraminidase inhibitor oseltamivir (Supporting Figure
S14 and Figure S15).
5
5 °С for 30 s, and elongation at 72 °С for 1 min. The PCR
fragments were purified on an agarose gel and double-
digested by the simultaneous use of the corresponding
restriction endonucleases and ligated into a predigested
pet-30a(+) expression vector containing a coding region
for a C-terminal hexahistidine fusion tag. The recombinant
vectors were transformed into E. coli Mach1 T1 competent
cells (Invitrogen) and transformants were selected on
Luria-Bertani (LB) agar containing 50 µg/mL kanamycin.
Colonies containing the expected plasmid construct were
screened by DNA sequencing. The extraction,
A number of modifications have been successfully carried
out in 1 to enhance the inhibitory activity of this compound
against influenza neuraminidases: the dehydratation of 1
led to DANA,[17] whereas the replacing the hydroxyl group
at C-4 of DANA with a guanidine group led to
zanamivir.[
phosphonate led to Zanaphosphor.
5, 18]
Further replacing the carboxylic acid with a
[
19]
Several new drugs
with high inhibitory activity against influenza B strains
could show modifications at the hydroxyl group at C-7 of
zanamivir.[
20]
endonuclease
digestion,
ligation
and
plasmid
These alterations can be also a suitable and
transformation were carried out using standard methods.
The transformed strains containing the cloned genes were
stored in 20% glycerol solutions at -80 °C until further use.
interesting way to increase the inhibitory activity of the
herein presented KDN analogues in future (Scheme 4).
In summary, a previously uncharacterized bacterial N-
acetylneuraminate lyase from Dyadobacter fermentans was
applied in the diastereoselective one-step synthesis of sialic
acids. KDN and KDN derivatives from D-glucose, D-
galactose, 2-deoxy-D-glucose, L-rhamnose, D-arabinose
and L-arabinose were successfully obtained. The
recombinant enzyme allowed the synthesis of sialic acids
with (S) configuration on C-4 using carbohydrates with (R)
configuration on C-3 as the substrates, and vice versa.
KDN and most KDN derivatives showed higher inhibitory
activities against H274Y mutated H1N1 neuraminidase in
Expression and purification of recombinant DfNAL
The plasmid containing the expected DfNAL was
transformed into the E. coli BL21 (DE3) expression host
-
1
-1
and grown on a LB solid medium (10 g·L NaCl, 10 g·L
-
1
-1
Trypton, 5 g·L yeast extract and 5 g·L agarose)
-
1
containing 50µg·mL kanamycin. A single colony was
transferred into 5 mL fresh LB medium (10 g·L NaCl, 10
g·L Trypton and 5 g·L yeast extract) supplemented with
-
1
-
1
-1
Scheme 4. Possible structural modifications to enhance the inhibitory activity of KDN (2) and KDN analogues (3, 4, 5, 6a,
[5, 18]
[5, 18]
7
and 8a) against influenza. a) Dehydratation of C-2;
b) introduction of a guanidine group;
c) introduction of a
[
20]
[20]
phosphonate; d) modifications at C-7.
4
This article is protected by copyright. All rights reserved.

Advanced Synthesis & Catalysis
10.1002/adsc.201700678
5
0 µg·mL-1 kanamycin. 5 mL of the culture was used to
[3] a) J. S. Rossman, R. A. Lamb, Virology 2011, 411,
229-236; b) X. J. Xu, X. Y. Zhu, R. A. Dwek, J.
Stevens, I. A. Wilson, J. Virol. 2008, 82, 10493-
10501.
inoculate 400 mL of LB medium and shaking at 37 °C
until optical density (OD600) of the culture reached 0.5.
Then, 0.4 mL of
a 1 M IPTG (Isopropyl-β-D-
thiogalactopyranoside) were added to the medium to
induce the recombinant protein expression. After 16 h of
induction at 18 °С, cells were harvested by centrifugation
at 4,000 g for 10 min at 4 °С. The cell pellets were
suspended in 10 mL lysis buffer (100 mM NaCl, 50 mM
Tris, 1% Triton X-100, 1 mM PMSF, and pH 8.0) and
disrupted by sonification for 20 min. Cellular debris was
removed by centrifugation at 20,000 g for 20 min at 4 °С.
The supernatant containing the recombinant enzymes were
loaded onto a Ni-NTA column (Qiagen, Germany, 2 mL
column volume). The column was washed with washing
buffer (50 mM NaCl, 50 mM Tris, 10 mM imidazole,
adjusted to pH 8.0 with HCl) to remove unbound proteins.
Recombinant proteins were eluted using elution buffer (50
mM NaCl, 50 mM Tris, 500 mM imidazole, adjusted to pH
[4] a) S. Chamni, W. De-Eknamkul, Expert Opin. Ther.
Pat. 2013, 23, 409-423; b) A. J. Burnham, T.
Baranovich, E. A. Govorkova, Antivir. Res. 2013,
100, 520-534.
[5] W. P. Burmeister, B. Henrissat, C. Bosso, S.
Cusack, R. W. H. Ruigrok, Structure 1993, 1, 19-26.
[6] a) K. Thorlund, T. Awad, G. Boivin, L. Thabane,
BMC Infect. Dis. 2011, 11; b) S. Ludwig, R. Zell, M.
Schwemmle, S. Herold, Int. J. Med. Microbiol.
2014, 304, 894-901.
[7] a) S.-Y. Wang, P. Laborda, A.-M. Lu, X.-C. Duan,
H.-Y. Ma, L. Liu, J. Voglmeir, Catalysts 2016, 6,
212; b) C. M. Deijl, J. F. Vliegenthart, Biochem.
Bioph. Res. Co. 1983, 111, 668-674; c) H. Yu, X.
Chen, Org. Lett. 2006, 8, 2393-2396.
8
.0 with HCl). Eluted fractions were partially desalted by
[8] T. Sugai, G. J. Shen, Y. Ichikawa, C. H. Wong, J.
Am. Chem. Soc. 1993, 115, 413-421.
gel chromatography using prepacked PD-10 cartridges (GE
Healthcare).
[9] a) M. J. Kim, W. J. Hennen, H. M. Sweers, C. H.
Wong, J. Am. Chem. Soc. 1988, 110, 6481-6486; b)
C. C. Hsu, Z. Y. Hong, M. Wada, D. Franke, C. H.
Wong, Proc. Natl. Acad. Sci. U. S. A. 2005, 102,
9122-9126; c) Q. Chen, L. Han, X. Chen, Y. Cui, J.
Feng, Q. Wu, D. Zhu, Enzyme Microb. Tech. 2016,
92, 99-106.
The molecular mass and purity of the recombinant proteins
were monitored by 12% SDS-PAGE acrylamide gels after
Coomassie brilliant G-250 staining. The protein
concentration was determined using the quantification
method of Bradford with bovine serum albumin (BSA) as
quantification standard. The purified enzyme was stored at
-
80 °C in a 20% glycerol solution for further use.
[10] D. G. Gillingham, P. Stallforth, A. Adibekian, P. H.
Seeberger, D. Hilvert, Nat. Chem. 2010, 2, 102-105.
[11] The full-length open reading frame (ORF) encoding
a putative N-acetylneuraminate lyase (EC 4.1.3.3)
could be successfully cloned and was annotated as
Synthesis of Neu5Ac, KDN and KDN analogues
Reaction mixtures (5 mL) containing 222 mM of D-
mannose, D-glucose, D-galactose, 2-deoxy-D-glucose, L-
rhamnose, D-arabinose, L-arabinose or N-acetyl-D-
DfNAL
(Dyadobacter
fermentans
N-
mannosamine,
1110
mM
pyruvate,
sodium
acetylneuraminate lyase, Supporting information
Figure S1). Homology search revealed that DfNAL
(Uniprot ID C6VS55) shares 45% amino acid
identity to N-acetylneuraminate lyases from
Escherichia coli and Staphylococcus carnosus, 36%
with Pasteurella multocida and 24% with
Staphylococcus aureus isoforms. DfNAL shares
also reasonable amino acid identities with N-
acetylneuraminate lyases Homo sapiens (39%) and
Sus scrofa (32%).
phosphate/citrate buffer (50 mM, pH 8.0) and recombinant
enzyme (DfNAL, 760 U), were incubated for at 37 °С 12 h
reaction time. The corresponding sialic acids (1, 2, 3, 4, 5,
6
a, 7 and 8a) were isolated by silica gel chromatography
using a mixture AcOEt/MeOH/AcOH (2:1:1) as the eluent.
Reactions were monitored by thin-layer chromatography
(
TLC). TLC was performed by spotting 1 µL from reaction
mixture using AcOEt/MeOH/AcOH (2:1:1) as the eluent.
Compounds were stained using an orcinol based stain (2
-1
mg·mL orcinol in 20% H
2
SO
4
).
[12] L. S. Li, Y. L. Wu, Curr. Org. Chem. 2003, 7, 447-
4
75.
[
[
13] L. Q. Wen, Y. Zheng, T. H. Li, P. G. Wang, Bioorg.
Med. Chem. Lett. 2016, 26, 2825-2828.
14] H. L. Yao, L. P. Conway, M. M. Wang, K. Huang,
L. Liu, J. Voglmeir, Glycoconjugate J. 2016, 33,
Acknowledgements
This work was supported in part by the Natural Science
Foundation of China (grant numbers 31471703, A0201300537
and 31671854 to J.V. and L.L.), and the 100 Foreign Talents Plan
2
19-226.
[
15] a) X. Garrabou, L. Gomez, J. Joglar, S. Gil, T.
(grant number JSB2014012 to J.V.).
Parella, J. Bujons, P. Clapes, Chem.-Eur. J. 2010,
1
6, 10691-10706; b) P. Laborda, F. J. Sayago, C.
Cativiela, T. Parella, J. Joglar, P. Clapes, Org. Lett.
014, 16, 1422-1425; c) T. Gefflaut, C. Blonski, J.
References
2
[
1]
a) T. Szucs, J. Antimicrob. Chemoth. 1999, 44, 11-
5; b) R. E. Thomas, Vaccine 2014, 32, 6884-6901.
2] X. L. Xiong, J. W. McCauley, D. A. Steinhauer, in
Influenza Pathogenesis and Control - Vol I, Vol.
Perie, M. Willson, Prog. Biophys. Mol. Bio. 1995,
63, 301-340.
[16] Both 9 and 10 were detected by HPLC (absorption
1
[
wavelength: 300 nm). Reaction conditions:
3
2
85 (Eds.: R. W. Compans, M. B. A. Oldstone),
014, pp. 63-91.
neuraminidase inhibitor (1 mM), 9 (40 μM), CaCl
(5 mM), neuraminidase (H274Y mutated H1N1 10
2
5
-
5
This article is protected by copyright. All rights reserved.

Advanced Synthesis & Catalysis
10.1002/adsc.201700678
U; H274Y mutated H5N1 1.3ꇱ 10-5 U), 20 mM
Trisꇱ HCl buffer pH 7.5, 37 °C, 20 min (reaction
volume: 30 μL).
[
17] H. Yu, S. S. Huang, H. Chokhawala, M. C. Sun, H.
J. Zheng, X. Chen, Angew. Chem. Int. Edit. 2006,
4
5, 3938-3944.
18] M. Von Itzstein, W. Y. Wu, B. Jin, Carbohydr. Res.
994, 259, 301-305.
19] A. Vasella, R. Wyler, Helv. Chim. Acta 1991, 74,
51-463.
[
[
[
1
4
20] T. Honda, T. Masuda, S. Yoshida, M. Arai, Y.
Kobayashi, M. Yamashita, Bioorg. Med. Chem. Lett.
2
002, 12, 1921-1924.
6
This article is protected by copyright. All rights reserved.

Advanced Synthesis & Catalysis
10.1002/adsc.201700678
COMMUNICATION
Diastereoselective One-step Synthesis of 2-Keto-3-
deoxy-D-glycero-D-galacto-nononic
acid
(KDN)
Analogues as Templates for the Development of
Influenza Drugs
Adv. Synth. Catal. Year, Volume, Page – Page
Pedro Laborda, Su-Yan Wang, Ai-Min Lu, Meng He,
Xu-Chu Duan, Ying-Juan Qian, Yong-Sam Jung, Li
Liu,* Josef Voglmeir*
7
This article is protected by copyright. All rights reserved.