Identification of a flavonoid 7-O-glucosyltransferase from Andrographis paniculata

Article abstract of DOI:10.1080/10286020.2019.1680644

Andrographis paniculata is an important traditional medicinal herb in which flavonoids are part of the primary specialized metabolites. A flavonoid glucosyltransferase with broad substrate spectrum (named ApUGT3) was successfully identified by screening homologous glycosyltransferase genes from A. paniculata. The enzyme displayed glycosylation activity toward multiple flavonoids in?vitro, and the major products were identified as 7-O-glucosides. Phylogenetic analysis revealed that ApUGT3 is the first reported glycosyltransferase from the Acanthaceae family that belongs to cluster I, suggesting that ApUGT3 is a new flavonoid glycosyltransferase of this subcluster. This enzyme is potentially useful as powerful glycosylation catalysts to modify flavonoid-like compounds and improve their biological activities. (Figure presented.).

Full text of DOI:10.1080/10286020.2019.1680644

Journal of Asian Natural Products Research
ISSN: 1028-6020 (Print) 1477-2213 (Online) Journal homepage: https://www.tandfonline.com/loi/ganp20
Identification of a flavonoid 7-O-
glucosyltransferase from Andrographis paniculata
Yuan Li, Wei Gao & Lu-Qi Huang
To cite this article: Yuan Li, Wei Gao & Lu-Qi Huang (2019): Identification of a flavonoid 7-O-
glucosyltransferase from Andrographisꢀpaniculata, Journal of Asian Natural Products Research,
DOI: 10.1080/10286020.2019.1680644
To link to this article: https://doi.org/10.1080/10286020.2019.1680644
Published online: 18 Nov 2019.
Submit your article to this journal
View related articles
View Crossmark data
Full Terms & Conditions of access and use can be found at
https://www.tandfonline.com/action/journalInformation?journalCode=ganp20

JOURNAL OF ASIAN NATURAL PRODUCTS RESEARCH
https://doi.org/10.1080/10286020.2019.1680644
Identification of a flavonoid 7-O-glucosyltransferase
from Andrographis paniculata
a,b
c
b
Yuan Li , Wei Gao and Lu-Qi Huang
a
State Key Laboratory of Bioactive Substance and Function of Natural Medicines, Institute of Materia
Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100050,
b
China; National Resource Center for Chinese Materia Medica, China Academy of Chinese Medical
c
Sciences, Beijing 100700, China; School of Pharmaceutical Sciences, Capital Medical University,
Beijing 100069, China
ABSTRACT
ARTICLE HISTORY
Andrographis paniculata is an important traditional medicinal
herb in which flavonoids are part of the primary specialized
metabolites. A flavonoid glucosyltransferase with broad substrate
spectrum (named ApUGT3) was successfully identified by screen-
ing homologous glycosyltransferase genes from A. paniculata.
The enzyme displayed glycosylation activity toward multiple
flavonoids in vitro, and the major products were identified as 7-O-
glucosides. Phylogenetic analysis revealed that ApUGT3 is the first
reported glycosyltransferase from the Acanthaceae family that
belongs to cluster I, suggesting that ApUGT3 is a new flavonoid
glycosyltransferase of this subcluster. This enzyme is potentially
useful as powerful glycosylation catalysts to modify flavonoid-like
compounds and improve their biological activities.
Received 10 May 2019
Accepted 9 October 2019
KEYWORDS
Flavonoid;
7
-O-glucosyltransferase;
Andrographis paniculata
1. Introduction
The medicinal plant Andrographis paniculata from the Acanthaceae family, known as
Chuanxinlian in Chinese, has been widely used to treat fever, diarrhea, upper respiratory
CONTACT Wei Gao
Beijing 100069, China; Lu-Qi Huang
weigao@ccmu.edu.cn
School of Pharmaceutical Sciences, Capital Medical University,
National Resource Center for Chinese Materia
huangluqi01@126.com
Medica, China Academy of Chinese Medical Sciences, Beijing 100700, China
ß 2019 Informa UK Limited, trading as Taylor & Francis Group

2
Y. LI ET AL.
tract infections, active ulcerative colitis, and other disorders [1–4]. It has already been
listed as a dietary supplement in the United States Pharmacopoeia. Flavonoids and their
glycosides are some of the main specialized metabolites in A. paniculata [5–7]. The fla-
vonoids in A. paniculata have similar structural backbones, which include two phenyl
groups and a heterocyclic ring connected by a fatty chain or oxygen heterocycles [8]. As
shown in recent studies, the administration of a combination of quercetin and dasatinib
removes senescent cells from mouse tissues, restores physiological functions, and pro-
longs the life span of aging mice [9]. These findings were also confirmed in humans
[10]. However, the chemical synthesis of flavonoid glycosides is restricted by the intro-
duction of protective groups, the requirement for toxic and explosive catalysts, low yield,
and side effects [11–12].
Glycosylation is one of the frequently occurring modifications in nature that yields
natural products with promising applications in new drug development. The enzymes
that catalyze glycosylation reactions are members of the glycosyltransferase (GT)
superfamily [13]. GTs are important because they confer pharmacological properties
to the compound, leading substantial changes in solubility, stability, toxicity or bio-
activity, and improved pharmacokinetic parameters of metabolites [14–16]. GTs are
encoded by a multi-gene family, accounting for approximately 1%–2% genes in
higher plants, making the characterization of the target genes that are involved in the
biosynthesis of specific glycosylated compounds difficult and complex. Transcriptome
sequencing technologies are powerful tools to initially screen new genes. In our
previous study, nine GTs were screened from the transcriptome databases of
A. paniculata [17]. However, the functions of most UGTs from A. paniculata have
not been characterized.
In this study, a UGT gene, isolated by transcriptome sequencing from the leaves of
Andrographis paniculata (ApUGT3), was cloned, heterologously expressed, and its
recombinant enzyme was purified from E. coli. An analysis of the substrate spectrum
revealed that ApUGT3 exhibited substrate promiscuity and used flavonoid com-
pounds as substrates. The enzyme is potentially useful for modifying flavonoid-like
compounds to improve their biological activities and for synthetic biology.
2. Results and discussion
2.1. Isolation and identification of ApUGT3
The cDNA sequence of ApUGT3 (1365bp, GenBank accession number: MH379335)
was deduced to encode a 454-amino acid protein, with a relative molecular weight
(MW) of 49.246kDa and isoelectric point (pI) of 6.04. A BLASTP search was per-
formed to identify homologues of the ApUGT3 gene. Amino acid sequences of
ApUGT3 and other corresponding sequences downloaded from GenBank were aligned
using DNAMAN software. ApUGT3 showed the highest identity (63.47%) with a
UDP-glucuronosyltransferase and a UDP-glucosyltransferase from Handroanthus impe-
tiginosus. ApUGT3 also shared 60.98% identity with a flavonoid glucosyltransferase
from Perilla frutescens, and 60.88% identity to a flavonoid glycosyltransferase from
Scutellaria baicalensis. The multiple sequence alignment revealed the conservation of

JOURNAL OF ASIAN NATURAL PRODUCTS RESEARCH
3
the plant secondary product glycosyltransferase motif (PSPG) in ApUGT3 and other
plant UGTs.
2.2. Phylogenetic analysis
A neighbor-joining phylogenetic tree constructed based on the putative ApUGT3 pro-
tein and other reported flavonoid glycosyltransferases revealed that ApUGT3 was
grouped into cluster I (Figure 1). The enzymes in this cluster are capable of catalyz-
ing the glycosylation of flavonoid compounds with various structures, such as flavo-
nols and anthocyanidin substrates. [18]. Based on the results, ApUGT3 was assigned
as a putative glycosyltransferase capable of catalyzing the glycosylation of flavonoid
compounds with various structures.
2
.3. Heterologous expression and product identification
Twenty-one structurally diverse flavonoid compounds were selected as substrates,
including flavones (1–6), flavonols (7 and 8), flavanones (9–11), isoflavones (12–20),
and a dihydrochalcone (21) with UDPG as the sugar donor in vitro to explore the
promiscuous catalytic activity of ApUGT3 in flavonoid glycosylation (Figure 2).
Glycoside productions were verified using UPLC-PDA and UPLC-Q-TOF-MS analy-
ses. ApUGT3 exhibited a rather high conversion rate when incubated with flavonols
and produced one predominant glycosylated product and multiple minor hydroxyl
substitutions on various types of flavonoids. The major products were identified as 7-
O-glucosides by comparing the retention time (t), UV spectra (kmax), and parent
–
ions ([M-H] ) of the glycosylated products with the corresponding authentic stand-
ards (Figure 3) and the published data [19]. For some flavones and flavonols (1, 3,
and 8), trace amount of di-glucosides were also detected. In addition, ApUGT3 was
sufficiently flexible enough to glycosylate the C-7 hydroxyl group of flavonoids with
substituents at C5, C6, C8, C3’, C4’, and C5’ at the A ring or the B ring. The conver-
sion rate also varied with the position of hydroxyl substitutions. Moreover, ApUGT3
displayed the greatest activity toward flavonols. Upon removal of the 3-hydroxyl
group, the enzyme exhibited a relatively low activity.
3
. Experimental
.1. Chemicals and plant materials
Methanol and acetonitrile (HPLC grade) were purchased from Fisher Scientific Co.
Loughborough, UK). Formic acid (HPLC grade) and UDP-glucose were purchased from
3
(
Sigma-Aldrich (St. Louis, MO, USA). Standard flavonoid compounds and their glucosides
were purchased from J & K Scientific Ltd. (Beijing, China), Chengdu Biopurify
Phytochemicals Ltd. (Chengdu, China), and BioBioPha (Kunming, China). Newly har-
vested seeds of A. paniculata were collected from Zhangzhou, Fujian Province, China.
Plants were grown in a controlled environmental chamber with a constant temperature
ꢀ
of 25 ± 2 C under 16-h light:8-h dark photoperiod. The leaves of four-week-old hydro-
ponic seedlings were treated with methyl jasmonate (50 lM) for 48 h.

4
Y. LI ET AL.
Figure 1. Phylogenetic tree of ApUFGTs and other plant UGTs. The tree was constructed using MEGA
.0 software with a 1000 bootstrap value. Clusters (I, II, III , III , and IV) are shown in boldface letters.
7
a
b
ApUGT3 is shown in red letters. The GenBank accession numbers and sources for the respective pro-
tein sequences are as follows: PfF3GT (BAA19659) from Perilla frutescens, FiF3GT (AAD21086) from
Forsythia intermedia, VvF3GT (AAB81682) from Vitis vinifera, CsUGT78A14 (ALO19888) from Camellia
sinensis, ZmF3GT(X13502) from Zea mays, V GT6 (NM_001280903) from Vitis vinifera, UGT78G1
V
(
(
(
XP_003610163) from Medicago truncatula, DicGT3 (BAD52005) from Dianthus caryophyllus, HvF3GT
CAA33729) from Hordeum vulgare, AtUGT74F1 (NP973682) from Arabidopsis thaliana, CsGT45
FJ194947) from Crocus sativus, UGT75A2 (AB360613) from Lycium barbarum, VhA5GT (BAA36423) from
Verbena hybrida, UGT75L6 (AB555731) from Gardenia jasminoides, UGT75L5 (AB360620) from Lycium
barbarum, NtGT2 (BAB88935) from Nicotiana tabacum, AtF7GT (AAL90934) from Arabidopsis thaliana,
FaGT7 (Q2V6J9) from Fragaria ananassa, FaGT6 (Q2V6K0) from Fragaria ananassa, NtGT3 (BAB88934)
from Nicotiana tabacum, DcF3GT (BAD52004) from Dianthus caryophyllus, UGT71G1 (AAW56092) from
Medicago truncatula, PfUGT57 (BAG31949) from Perilla frutescens, PlUGT1 (A0A067YB04) from Pueraria
lobata, SlUGT1 (AB362989) from Scutellaria laeteviolacea, ThF7GT (BAH14961) from Torenia hybrid culti-
0
var, PfUGT50 (AB362991) from Perilla frutescens, AmC4 GT (AB198665) from Antirrhinum majus,
AmUGTcg10 (AB362988) from Antirrhinum majus, UGT89C1 (AAP31923) from Arabidopsis thaliana,
SiF1,6GlcT (AB333799) from Sesamum indicum, PhA3GRT (CAA50376) from Petunia x hybrida, and
IpA3G2GT (BAD95882) from Ipomoea purpurea.
3.2. RNA isolation, cDNA synthesis, and gene cloning
Total RNA was isolated (Thermo Fisher Scientific, California, USA), and the quality
was detected using a Nanodrop2000 spectrophotometer (Thermo Fisher Scientific,

JOURNAL OF ASIAN NATURAL PRODUCTS RESEARCH
5
Figure 2. Exploring the promiscuous catalytic activity of recombinant ApUGT3. (A) Percent conver-
sion of glycosylated products catalyzed by ApUGT3. The colors in the bar graphs (Prod. a and Prod.
b) represent different ratios of diverse glycosylated products in the total product yield of each
compound. Error bars in the figure indicate ± SDs. (B) Structures of the library members and corre-
sponding glycosylated products.
California, USA). The first-strand cDNAs were synthesized using the PrimeScript
RT Reagent Kit with gDNA Eraser (Takara, Dalian, China) and then served as
0
templates for PCR. The primers used in this study were ApUGT3-F (5 -
TCCAGGGGCCCGAATTCGGAATGGGTTACCACTCCCACATC -3’) and ApUGT3-
0
R (5 - AGTGCGGCCGCAAGCTTGTCATTTGGAAATGCCAATTATT -3’). The PCR
products were purified and cloned into a N-terminal MBP fusion expression vector HIS-
MBP-pET28a (provided by Dr. Xiaohong Zhang (Karmanos Cancer Institute, United
States); HIS, histidine; MBP, maltose-binding protein) using a pEASY-Uni Seamless
Cloning and Assembly Kit (TransGen Biotech, Beijing, China), then transformed into
Trans1 T1 phage-resistant chemically competent cells (TransGen Biotech), and cultured in
ꢀ
Luria–Bertani (LB) medium at 37 C in the dark. Positive clones were sequenced.
3
.3. Sequence analysis
Amino acid sequences for previously identified UGTs were obtained from the NCBI
database, and the phylogenetic tree was constructed with MEGA7.0 software using
the neighbor-joining method [20]. Branch support was estimated using a bootstrap
analysis with 1000 replicates.
3
.4. Expression and purification of recombinant ApUGT3
The expression plasmid was transformed into Escherichia coli Transetta (DE3)
expressing competent cells (TransGen Biotech). The monoclonal colonies were

6
Y. LI ET AL.
Figure 3. In vitro enzyme assay for determining the activity of ApUGT3 using apigenin (1), kaemp-
ferol (8), hesperetin (9), naringenin (10), homoeriodictyol (11), genistein (14), calycosin (17), and glyci-
tein (20) as substrates. (A) UPLC chromatogram of 1 and enzyme-catalyzed products 1a and 1b.
Insertions indicate the typical negative ion mass spectra of 1a and 1b. (B) UPLC chromatogram of 8
and enzyme-catalyzed products 8a and 8b. Insertions indicate the typical negative ion mass spectra
of 8a and 8b. (C) UPLC chromatogram of 9 and enzyme-catalyzed product 9a. Insertions indicate the
typical negative ion mass spectra of 9a. (D) UPLC chromatogram of 10 and enzyme-catalyzed product
1
0a. Insertions indicate the typical negative ion mass spectra of 10a. (E) UPLC chromatogram of 11
and enzyme-catalyzed product 11a. Insertions indicate the typical negative ion mass spectra of 11a.
F) UPLC chromatogram of 14 and enzyme-catalyzed product 14a. Insertions indicate the typical
(
negative ion mass spectra of 14a. (G) UPLC chromatogram of 17 and enzyme-catalyzed product 17a.
Insertions indicate the typical negative ion mass spectra of 17a. (H) UPLC chromatogram of 20 and
enzyme-catalyzed product 20a. Insertions indicate the typical negative ion mass spectra of 20a.

JOURNAL OF ASIAN NATURAL PRODUCTS RESEARCH
7
Table 1. UPLC methods used in this study.
Method
A
Solvent A
Solvent B
Flow rate
Gradient
Analysis of substrates
0.1% formic acid
CH
3
CN
0.4 mL/min
95%–83% A (0–3 min),
3%–65% A (3–12 min),
1–3, 7, 9,
11, 17
8
6
5%––40% A (12–14.5 min)
B
C
0.1% formic acid
0.1% formic acid
CH
CH
3
CN
CN
0.4 mL/min
0.4 mL/min
95%–75% A (0–6 min),
5%–60% A (6–15 min)
95%–83% A (0–10 min),
3%–65% A (10–20 min)
4–6, 8, 10,
14, 18, 21
12, 13, 15,
16, 19, 20
7
3
8
identified and transferred to Luria–Bertani (LB) media for heterologous expression
induced by isopropyl b-D-thiogalactoside (IPTG) using previously described
methods [17].
3.5. Enzyme assay and product identification
All assays and incubations were performed in 100 ll of 50 mM Tris-HCl (pH ¼ 8.0)
containing 8 lg of purified proteins, 200 lM aglycone, and 3200 lM UDP-glucose.
ꢀ
The reactions were incubated at 30 C for 12 h and terminated by the addition of
200 ll of methanol. The products of the reactions were filtered through a 0.22-lm
nylon syringe filter and analyzed using a Waters Acquity UPLC-I-Class system
(
2
4
Waters Corp., Milford, MA) with an Acquity UPLC BEH C18 column (1.7 mm,
ꢀ
.1 mm ꢁ 50 mm). The column temperature was set to 40 C, and the flow rate was
00 lL/min. Mobile phase A was a 0.1% formic acid aqueous solution, and mobile
phase B was acetonitrile. Gradient programs were used to analyze the reaction mix-
tures (Table 1). The total conversion rate was calculated to be one percent of the sum
of the peak areas of the substrate and product(s). The experiment was performed in
the ESI (–) mode as previously described [17].
Disclosure statement
No potential conflict of interest was reported by the authors.
Funding
This work was financially supported by National Natural Science Foundation of China
(81891010, 81891013, 81673547), the Key project at central government level: The ability estab-
lishment of sustainable use for valuable Chinese medicine resources (Grant No. 2060302), and
the Support Project of High-level Teachers in Beijing Municipal Universities in the Period of
1
3th 5-year Plan (CIT&TCD20170324), and National Program for Special Support of Eminent
Professionals.
References
[
1] T. Jayakumar, C.Y. Hsieh, J.J. Lee, and J.R. Sheu, Evid. Based Complement Altern. Med.
013, 846740 (2013).
2] J.T. Coon and E. Ernst, Planta Med. 70, 293 (2004).
2
[

8
Y. LI ET AL.
[
[
[
[
[
3] W.J. Sandborn, S.R. Targan, V.S. Byers, D.A. Rutty, H. Mu, X. Zhang, and T. Tang,
Am. J. Gastroenterol. 108, 90 (2013).
4] X.Y. Hu, R.H. Wu, M. Logue, C. Blondel, L.Y.W. Lai, B. Stuart, A. Flower, Y.T. Fei, M.
Moore, J. Shepherd, J.P. Liu, and G. Lewith, PLoS One 12, e0181780 (2017).
5] R.Y. Koteswara, G. Vimalamma, C.V. Rao, and Y.M. Tzeng, Phytochemistry 65, 2317
(
2004).
6] W. Li, X. Xu, H. Zhang, C. Ma, H. Fong, R. van Breemen, and J. Fitzloff, Chem.
Pharm. Bull. 55, 455 (2007).
7] M.K. Reddy, M.V. Reddy, D. Gunasekar, M.M. Murthy, C. Caux, and B. Bodo,
Phytochemistry 62, 1271 (2003).
[
[
8] F.M.L. Falcone, S.P. Rius, and P. Casati, Front Plant Sci. Plant 3, 222 (2012).
9] M. Xu, T. Pirtskhalava, J.N. Farr, B.M. Weigand, A.K. Palmer, M.M. Weivoda, C.L.
Inman, M.B. Ogrodnik, C.M. Hachfeld, D.G. Fraser, J.L. Onken, K.O. Johnson, G.C.
Verzosa, L.G.P. Langhi, M. Weigl, N. Giorgadze, N.K. LeBrasseur, J.D. Miller, D. Jurk,
R.J. Singh, D.B. Allison, K. Ejima, G.B. Hubbard, Y. Ikeno, H. Cubro, V.D. Garovic, X.
Hou, S.J. Weroha, P.D. Robbins, L.J. Niedernhofer, S. Khosla, T. Tchkonia, and J.L.
Kirkland, Nat. Med. 24, 1246 (2018).
[
10] J.N. Justice, A.M. Nambiar, T. Tchkonia, N.K. LeBrasseur, R. Pascual, S.K. Hashmi, L.
Prata, M.M. Masternak, S.B. Kritchevsky, N. MusI, and J.L. Kirkland, EBioMedicine 40,
554 (2019).
[
[
[
11] A. Bertrand and D. Olivier, Helv. Im. Acta 82, 2201 (1999).
12] C.R. Bertozzi and L.L. Kiessling, Science 291, 2357 (2001).
13] D.M. Liang, J.H. Liu, H. Wu, B.B. Wang, H.J. Zhu, and J.J. Qiao, Chem. Soc. Rev. 44,
8
350 (2015).
14] B.F. De, J. Maertens, J. Beauprez, W. Soetaert, and M.M. De, Biotechnol. Adv. 33, 288
2015).
[
(
[
[
15] V. Kren and L. Mart ꢀı nkov ꢀa , CMC 8, 1303 (2001).
16] C. Xu, K.L. Liberatore, C.A. MacAlister, Z. Huang, Y.H. Chu, K. Jiang, C. Brooks, M.
Ogawa-Ohnishi, G. Xiong, M. Pauly, E.J. Van, Y. Matsubayashi, K.E. van der, and Z.B.
Lippman, Nat. Genet. 47, 784 (2015).
[
17] Y. Li, H.X. Lin, J. Wang, J. Yang, C.J.S. Lai, X. Wang, B.W. Ma, J.F. Tang, Y. Li, X.L.
Li, J. Guo, W. Gao, and L.Q. Huang, Org. Lett. 20, 5999 (2018).
[
[
18] T. Vogt and P. Jones, Trends. Plant. Sci. 5, 380 (2000).
19] K. Ablajan, Z. Abliz, X.Y. Shang, J.M. He, R.P. Zhang, and J.G. Shi, J. Mass Spectrom.
4
1, 352 (2006).
[
20] S. Kumar, G. Stecher, and K. Tamura, Mol. Biol. Evol. 33, 1870 (2016).