Inhibitor of the human telomerase reverse trancriptase (hTERT) gene promoter induces cell apoptosis via a mitochondrial-dependent pathway

Article abstract of DOI:10.1016/j.ejmech.2017.12.077

Telomerase is aberrantly expressed in many cancers and plays an important role in the development of cellular immortality and oncogenesis, which makes it a potential cancer therapeutic target for drug discovery. Here, we constructed a firefly luciferase r

Full text of DOI:10.1016/j.ejmech.2017.12.077

Accepted Manuscript
Inhibitor of the human telomerase reverse trancriptase (hTERT) gene promoter
induces cell apoptosis via a mitochondrial-dependent pathway
Yuyin Li, Guojun Pan, Yue Chen, Qian Yang, Tiantian Hao, Lianbo Zhao, Long Zhao,
Yusheng Cong, Aipo Diao, Peng Yu
PII:
S0223-5234(17)31108-X
10.1016/j.ejmech.2017.12.077
EJMECH 10055
DOI:
Reference:
To appear in: European Journal of Medicinal Chemistry
Received Date: 27 June 2017
Revised Date: 20 December 2017
Accepted Date: 22 December 2017
Please cite this article as: Y. Li, G. Pan, Y. Chen, Q. Yang, T. Hao, L. Zhao, L. Zhao, Y. Cong, A. Diao,
P. Yu, Inhibitor of the human telomerase reverse trancriptase (hTERT) gene promoter induces cell
apoptosis via a mitochondrial-dependent pathway, European Journal of Medicinal Chemistry (2018), doi:
10.1016/j.ejmech.2017.12.077.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT
Compound 8b
hTERT
Cancer cell
apoptosis
Cancer cell
proliferation

ACCEPTED MANUSCRIPT
Inhibitor of the human telomerase reverse
trancriptase (hTERT) gene promoter induces cell
apoptosis via a mitochondrial-dependent pathway
Yuyin Lia, 1, Guojun Panb, 1, Yue Chena, Qian Yanga, Tiantian Haob, Lianbo Zhaob,
Long Zhaob, Yusheng Congc, Aipo Diaoa, *, Peng Yub, *
a School of Biotechnology, Tianjin University of Science and Technology, Key
Lab of Industrial Fermentation Microbiology of the Ministry of Education,
Tianjin, 300457, China.
b
China International Science and Technology Cooperation Base of Food
Nutrition/Safety and Medicinal Chemistry, Sino-French Joint Lab of Food
Nutrition/Safety and Medicinal Chemistry, Tianjin University of Science and
Technology, Tianjin 300457, China.
c Institute of Aging Research, Hangzhou Normal University, School of Medicine,
Hangzhou, Zhejiang Province 311121, China
1 These authors contributed equally to this work.
* Corresponding author.
E-mail addresses: diaoaipo@tust.edu.cn (A. Diao), yupeng@tust.edu.cn (P. Yu)
Abstract:
Telomerase is aberrantly expressed in many cancers and plays an
important role in the development of cellular immortality and
oncogenesis, which makes it a potential cancer therapeutic target for drug
discovery. Here, we constructed a firefly luciferase reporter driven by the
human telomerase reverse trancriptase (hTERT) gene promoter to screen
for inhibitory compounds. Compound 5c was discovered and shown to
significantly inhibit the promoter activity of hTERT gene. Furthermore,
five analogs of compound 5c were synthesized, and compound 8b was
shown to be a more potent inhibitor of hTERT gene promoter activity and

ACCEPTED MANUSCRIPT
subsequent expression of hTERT mRNA and protein. The viability of
HeLa cells was inhibited by a knockdown of hTERT gene expression, and
the same effect was also observed by treating with compound 8b.
Moreover, our results indicated that compound 8b induced apoptosis of
HeLa cells, and activated caspase-9 and caspase-3 enzymes. Taken
together, these results suggested that compound 8b down-regulates the
expression of hTERT and induces mitochondrial-dependent apoptosis.
Keywords: hTERT; Inhibitor; Apoptosis; Synthesis
1. Introduction
Telomeres are specialized DNA structures located at the end of
chromosomes, and are essential for their stabilization by protecting
them from end-to-end fusion and DNA degradation[1]. In human cells,
telomeres are composed of (TTAGGG)n tandem repeats. Telomerase is a
unique ribonucleoprotein enzyme which is responsible for adding the
telomeric repeats onto the 3’ ends of chromosome[2], Telomerase
contains an internal RNA component [telomerase RNA (TR), or
telomerase RNA component] and a catalytic protein with
telomere-specific reverse transcriptase activity [telomerase reverse
trancriptase (TERT)]. TERT which synthesises de novo telomere
sequences by using TR as a template, is the rate-limiting component of
the telomerase complex, and its expression is correlated with telomerase

ACCEPTED MANUSCRIPT
activity [3]. Previous studies have shown that hTERT plays an important
role in the development of cellular immortality and oncogenesis[4-5]. It
has been shown that telomerase is aberrantly expressed in 85-90% of all
human tumors, but not in their adjacent normal cells [6-9], and it plays an
important role in the development of cellular immortality and
oncogenesis[4, 10]. This makes telomerase a potential drug screening
target for cancer therapy [11-13].
A number of studies have shown that targeting telomerase is a novel
approach to targeted cancer therapeutics [14-18]. There are many
potential ways to interfere with normal telomerase function, and each
approach has its own strengths and weaknesses. These strategies of
telomerase targeting in cancer treatment can be divided into two
categories. One is targeting telomerase directly by inhibiting the activity
of its catalytic subunit (hTERT) or its RNA template (hTER), leading to
inhibition of telomerase activity (TA), telomere shortening and inhibition
of cell proliferation. Recently, a novel dihydropyrazole-chromen
controlling hTERT was designed, and it occupied high antiproliferative
activity against MGC-803 cells [19]. Another strategy is by targeting the
telomerase subunit indirectly with G-quadruplex stabilizers, Tankyrase or
HSP90 inhibitors, thus blocking telomerase access to telomeres or
inhibiting binding of telomerase-associated proteins leading to telomere
uncapping and cell apoptosis. Treatment of tumor cells lines with various

ACCEPTED MANUSCRIPT
telomerase inhibitors in vitro and in vivo has shown not only inhibition of
TA or tumor cell proliferation, but also inhibition of tumor metastasis,
indicating their potential for treatment of metastatic cancers. For example,
phase I and II clinical trials with the telomerase inhibitor GRN163L were
successful in determining maximum tolerated doses (MTDs) and
dose-limiting toxicities (DLTs) in patients with chronic liver disease
(CLD), solid tumor malignancies and breast cancer. No major
cytotoxicity was observed and the inhibitor has now progressed into
phase III clinical trials.
Here, we have established a firefly luciferase reporter screening system
driven by hTERT gene promoter to screen potential compounds inhibiting
hTERT expression. We identified compound 8b that effectively inhibited
the expression of hTERT by screening an initial 400 compound library.
Further studies showed that compound 8b inhibited the cell viability of
HeLa cells and induced cell apoptosis via a mitochondrial-dependent
pathway. These results demonstrated that compound 8b is a potential
antitumor drug for tumors expressing high levels of hTERT.
2. Results and Discussion
2.1 Chemistry
As shown in Scheme 1, The key intermediates 4a-4c were readily
synthesized in three steps in 55-80% yields according to the known
literature procedures [20-21] which were converted into the 3-Oxime target

ACCEPTED MANUSCRIPT
compounds 5a-5c with NH2OH in the presence of Pyridine. 3-NOH
methylation of 5b afforded the desired 6b by using CH3I in basic
condition. Suzuki coupling reaction was employed to convert 4-bromo
isatin 4b into 4-(4-(trifluoromethyl)phenyl) isatin 7b and
4-(4-methoxyphenyl) isatin 7a respectively (Scheme 2). Compound 8a,
8b were prepared from 7a and 7b through an appropriate carbonyl group
derivatization reaction.
(Scheme 1)
(Scheme 2)
2.2. Biological Evaluation
Over 400 compounds were screened for their hTERT expression
inhibition using a firefly luciferase reporter screening system. Among
them, compound 282 (5c, see structure in Table. 1) was found to have
significant inhibitory effects on the hTERT gene promoter activity in a
dose-dependent manner (Fig. 1A and 1B).
(Fig.1)
In order to explore the structure-activity relationship of this type of
molecule against hTERT, a series of isatin derivatives (5a-5c, 6b, 8a and
8b) were synthesized and tested for their inhibitory effects on the hTERT
gene promoter activity in HeLa cells at concentrations of 1, 2, 4, 8, 16
µM, respectively.
As shown in table 1, compounds 5a-5c which possess either chloro,

ACCEPTED MANUSCRIPT
bromo or iodo groups on the C-4 position exhibited good inhibitory
effects. Compound 5b in particular has a potent EC50 value of 6 µM. As
can be seen in table 1, conversion of 5b into 3-methyoxyimino substituted
isatin destroyed the inhibitory activity, which indicated that the 3-oxime
group is essential for the hTERT inhibition.
Inspection of the activity data of the compounds bearing chloro, bromo,
methoxyphenyl and trifluoromethylphenyl groups at position C-4
suggested that a certain size of substitution at this orientation could
improve the inhibition. Moreover, 8b (4-trifluoromethylphenyl) was more
potent than 8a (4-methoxyphenyl).
(Table 1)
Since compound 8b could inhibit the hTERT gene promoter activity,
we next investigated whether it could down-regulate hTERT expression
in HeLa cells expressing high levels of endogenous hTERT. The RT-PCR
and Western blot assay results showed that compound 8b down-regulated
hTERT mRNA and protein levels (Fig. 2A-D). A dose curve (1, 2, 4, 8, 16
µM) and time course (12, 24, 36, 48 h) of hTERT expression inhibition
showed that compound 8b could down-regulate hTERT expression in a
time- and dose-dependent manner (Fig. 2C-F). Furthermore, we also
treated HeLa cells with compound 8b or DMSO control for 22
generations, and measured the relative length of telomeres using Q-PCR
[22-23]. As shown in Fig. 2G, compound 8b accelerated the shortening of

ACCEPTED MANUSCRIPT
telomeres. These results suggest that compound 8b is an efficient and
novel inhibitor of hTERT expression in cancer cells.
(Fig.2)
To investigate whether a knockdown of hTERT expression inhibits cell
viability, RNA interference was used to reduce hTERT expression in
HeLa cells. The hTERT-shRNAs were individually co-transfected with
lentiviral packaging plasmids into HEK293T cells, the virus-containing
supernatant was harvested and used to infect HeLa cells. Knockdown
efficiency of hTERT protein was analyzed by Western blot and results
showed that hTERT expression was significantly reduced after infection
with hTERT-shRNAs virus-containing supernatant (Fig. 3A). To analyze
the effects of endogenous hTERT knockdown on cell proliferation, MTT
and colony formation assays were performed. MTT assays showed that
hTERT-shRNAs transiently infected cell populations grew more slowly
compared to negative control shRNA cells (Fig. 3B). Colony formation
assays also showed that cells stably expressing hTERT-shRNA formed
fewer colonies compared to the control (Fig. 3C and 3D). These results
indicate that hTERT plays an important role in the process of cancer cell
proliferation and colony formation, and that depletion of hTERT in HeLa
cells inhibits cell proliferation
.
(Fig.3)
Compound 8b has been proven to be a potential inhibitor of hTERT

ACCEPTED MANUSCRIPT
expression (Fig 2), and knockdown of hTERT expression in HeLa cells
could inhibit cell viability (Fig 3). Thus we investigated whether
compound 8b has anti-cancer activity due to its ability for
down-regulating hTERT expression. HeLa cells that have high level
expression of endogenous hTERT, and L02 cells which have a lower
hTERT expression were treated with an increasing dose (1, 2, 4, 8 and 16
µM) of compound 8b for 48 h followed by MTT assay. The results
suggested that compound 8b dramatically inhibited the viability of HeLa
(Fig 4A). However, the L02 cells were not sensitive to compound 8b (Fig
4A). The compound 8b inhibited the viability of HeLa cells in a
time-dependent manner (Fig. 4B). Colony formation assays further
showed that cells treated with compound 8b formed fewer colonies
compared to the control (Fig. 4C and 4D). These results indicate that
compound 8b inhibits cancer cell proliferation through the
down-regulation of hTERT expression.
(Fig.4)
To elucidate the mechanism by which compound 8b decreased cell
proliferation in cancer cells containing high levels of hTERT, we
investigated the effects of compound 8b on cell apoptosis in HeLa cells.
Following treatment with compound 8b (5 µM) for 24 h, the cells were
stained with DAPI. As shown in Fig 5A, HeLa cells treated with
compound 8b exhibited chromatin condensation and cell shrinkage,

ACCEPTED MANUSCRIPT
which indicated a cell apoptosis phenotype. The control cells in contrast
showed round and homogeneous nuclei and a regular plasma membrane
shape. Similar results were also found using annexin V/PI staining with
24.5% apoptosis detected in the control cells and 59.7% apoptosis in
compound 8b treated HeLa cells, (Fig. 5B).
Apoptosis is triggered by two types of apoptotic caspases, namely
initiator caspases (e.g., caspase-2, -8, -9, and -10) and effector caspases
(e.g., caspase-3, -6, and -7) [24-25]. Initiator caspases cleave and activate
inactive proforms of effector caspases, and activated effector caspases
cleave other protein substrates to trigger the apoptotic process [26-27]. To
further assess compound 8b induced apoptotic pathway in HeLa cells, we
investigated the activity level of these effector caspases. The western
blotting results suggested that the level of cleaved caspase-3 increased
when cells were treated with compound 8b (Fig. 5c). Furthermore, the
results also showed that compound 8b obviously increased the cleaved
caspase-9 level (activity of initiator caspases) (Fig. 5c). Considering the
role of Bcl-2 family proteins in mitochondrion-dependent apoptosis, we
examined the effect of compound 8b on the expression of anti-apoptosis
protein Bcl-2 and pro-apoptosis protein Bax. As shown in Fig. 5c, Bcl-2
levels were markedly decreased and Bax levels were increased in HeLa
cells when cells were treated with compound 8b. These data suggest that
compound 8b can induce apoptosis in HeLa cells via a

ACCEPTED MANUSCRIPT
mitochondrial-dependent pathway.
(Fig.5)
The Bcl-2 family plays an important role in the regulation of the
intrinsic, mitochondrial apoptosis. Some Bcl-2 family members protect
the cell against death signals (eg. Bcl-2, Mcl-1 and Bcl-xL), while others,
such as Bax, Bak, lead to caspase-9 activation and mitochondrial
apoptosis. Previous studies suggest that telomerase activity plays a role in
cellular resistance to apoptosis [28] and that hTERT knockdown
suppresses the growth of cancer cells by inhibiting Bcl-2 [29-30].
Consistent with these studies, our results suggest that compound 8b,
which inhibits the expression of hTERT, induces cell apoptosis via a
mitochondrial-dependent pathway.
3. Conclusions
In conclusion, our results indicate that compound 8b is a novel and
efficient inhibitor of hTERT expression, and that inhibition of hTERT
expression could induce mitochondrial apoptosis. These results
demonstrate that compound 8b might be a promising anti-cancer drug for
hTERT high-expressing tumors. Further studies should help to uncover
the in-depth mechanisms for inhibition of compound 8b. This will drive
the synthesis of other analogs to more effectively inhibit hTERT
expression.

ACCEPTED MANUSCRIPT
4. Experimental section
4.1. Chemistry
All commercial materials and reagents were used without further
purification, unless otherwise stated. Solvents were distilled prior to use.
Reactions were carried out in oven-dried glassware under an inert
atmosphere (nitrogen or argon). For chromatography, 200-300 mesh silica
1
13
gel (Qingdao, China) was employed. H and CNMR spectra were
recorded at 400 MHz and 100 MHz with a Brucker ARX 400
1
spectrometer. The chemical shifts (δ) for H NMR spectra were given in
parts per million (ppm) referenced to the residual proton signal of the
duterated solvent (CDCl3 at δ = 7.26 ppm, DMSO-d6 at δ = 2.50 ppm);
coupling constants were expressed in hertz δ = 77.0 ppm), DMSO-d6 (δ =
40.0 ppm). The following abbreviations were used to describe NMR
signals: s = singlet, d = doublet, t = triplet, m = multiple, and dd = doublet
of doublets. HRMS were recorded on Bruker Daltonics, Inc. APEXIII 7.0
TESLA FTMS (ESI). Known products were characterized by comparison
to their corresponding 1H-NMR reported in the literatures.
4.2 General procedure
In a general procedure, a mixture of 4-chloroindoline-2,3-dione (4.4
mmol), K2CO3 (1.8 g), P-chlorobenzyl bromide (1.1 g) in DMF (10 mL)
was stirred at room temperature for 4 h under argon. Then the reaction

ACCEPTED MANUSCRIPT
was quenched by adding excess ice-water and stirred for 30 min. The
suspension was filtered and the residue was dried to afford
4-chloro-1-(4-chlorobenzyl)indoline-2,3-dione (1.34 g, 90%) as a red
solid without further purification. This was directly used in the next
step; NH2OH·HCl (1.5 mmol) was added to a solution of
4-chloro-1-(4-chlorobenzyl)indoline-2,3-dione (1.4 mmol) in Pyridine (5
mL) and the resulting mixture was heated to 110 °C and stirred for 2 h.
After cooling to room temperature, the resulting solution was poured into
aqueous HCl (1 M, 50 mL) and extracted with EtOAc (3×50 mL). The
combined organic layer was washed with brine (3×30 mL), dried over
Na2SO4, concentrated under reduced pressure and then recrystallized to
produce 5a (382 mg, 85%) as a yellow solid. The derivatives 5b, 5c were
prepared through this procedure by using 4-bromoindoline-2,3-dione and
4-iodoindoline-2,3-dione as material.
4.2.1 4-chloro-1-(4-chlorobenzyl)-3-(hydroxyimino)indolin-2-one（5a）
1H NMR (400 MHz, DMSO-d6): δ/ppm 13.73 (s, 1H, 3-NOH), 7.50 –
7.20 (m, 5H), 7.11 (d, J = 7.6 Hz, 1H), 6.95 (d, J = 7.6 Hz, 1H), 4.94 (s,
2H).13C NMR (101 MHz, DMSO-d6) δ/ppm 156.19-C2, 143.76, 141.90,
135.51, 132.59, 131.96, 129.62, 129.13, 127.69, 124.31, 116.54, 108.71,
42.26-CH2.
4.2.2 4-bromo-1-(4-chlorobenzyl)-3-(hydroxyimino)indolin-2-one
（5b）
1H NMR (400 MHz, DMSO-d6): δ/ppm 13.75 (s, 1H, 3-NOH), 7.44 –

ACCEPTED MANUSCRIPT
7.30 (m, 4H), 7.30 – 7.19 (m, 2H), 6.98 (dd, J = 7.6, 1.2 Hz, 1H), 4.93 (s,
2H).13C NMR (101 MHz, DMSO-d6) δ/ppm 156.25-C2, 143.94, 142.06,
135.46, 132.60, 132.05, 129.60, 129.13, 127.52, 118.24, 115.53, 109.12,
42.18-CH2.
4.2.3 1-(4-chlorobenzyl)-3-(hydroxyimino)-4-iodoindolin-2-one（5c）
1H NMR (400 MHz, DMSO-d6): δ/ppm 13.72 (s, 1H, 3-NOH), 7.58 –
7.48 (m, 1H), 7.39 (d, J = 8.8, 2H), 7.34 (d, J = 8.8 Hz, 2H), 7.05 (d, J =
8.0 Hz, 1H), 7.01 (d, J = 8.0 Hz, 1H), 4.92 (s, 2H); 13C NMR (101 MHz,
DMSO-d6) δ/ppm 156.49-C2, 143.65, 141.98, 135.50, 134.20, 132.58,
131.89, 129.60, 129.11, 121.38, 109.57, 87.61, 41.96-CH2.
4.2.4
1-(4-chlorobenzyl)-3-(hydroxyimino)-4-(4-methoxyphenyl)indolin-2-one
（8a）
A mixture of 4-bromo-1-(4-chlorobenzyl)indoline-2,3-dione (4b)
(351 mg, 1.0 mmol), (4-methoxyphenyl)boronic acid (167 mg, 1.1 mmol),
Pd(PPh3)4 (116 mg, 0.1 mmol) and Cs2CO3 (6.52 mg, 2.0 mmol) in DMF
(8 mL) was heated to 100 °C and stirred for 12 h under argon. After
cooling to room temperature, the reaction mixture was poured into
ice-water (60 mL) and extracted with DCM (3×30 mL). The combined
organic layers were washed with brine (3×30 mL), dried over Na2SO4 and
concentrated under reduced pressure. The crude product was purified by
column chromatography on silica gel (petroleum ether/ethyl acetate 5:1)

ACCEPTED MANUSCRIPT
1
to afford 7a (272 mg, 72%) as a red solid. H NMR (400 MHz, CDCl3):
δ/ppm 7.85 (s, 1H), 7.74 (d, J = 8.0, 1H), 7.66 – 7.42 (m, 6H), 7.07 – 7.02
(m, 2H), 6.91 (d, J = 8.0 Hz, 1H) 4.95 (s, 2H), 3.84 (s, 3H).
NH2OH·HCl (39 mg, 0.55 mmol) was added to a solution of 7a (190
mg, 0.5 mmol) in Pyridine (3 mL) and the resulting mixture was heated to
110 °C and stirred for 2 h. After cooling to room temperature, the
resulting solution was poured into aqueous HCl (1 M, 15 mL) and
extracted with EtOAc (3×10 mL). The combined organic layer was
washed with brine (3×15 mL), dried over Na2SO4, concentrated under
reduced pressure and recrystallized to produce 8a (149 mg, 76%) as a
1
yellow solid. H NMR (400 MHz, CDCl3): δ/ppm 7.51 – 7.44 (m, 3H),
7.35 – 7.29 (m, 4H), 7.05 (d, J = 8.0, 1H), 6.98 (d, J = 8.8 Hz, 2H), 6.66
13
(d, J = 8.0 Hz, 1H), 4.93 (s, 2H), 3.88 (s, 3H); C NMR (101 MHz,
CDCl3) δ/ppm 162.10-C2, 159.76-C3, 143.82, 141.77, 139.39, 134.17,
133.04, 131.02, 130.30, 130.27, 129.29, 128.78, 126.49, 115.12, 113.51,
108.37, 55.26-CH3O, 42.76-CH2; HRMS (ESI) m/z: Calcd for
C22H17ClN2O3Na [M+Na]+ 415.0820; found, 415.0804.
4.2.5
1-(4-chlorobenzyl)-3-(hydroxyimino)-4-(4-(trifluoromethyl)phenyl)indolin
-2-one
（8b）
A
mixture
of
4b
(351
mg,
1.0
mmol),
(4-trifluoromethylphenyl)boronic acid (209 mg, 1.1 mmol), Pd(PPh3)4

ACCEPTED MANUSCRIPT
(116 mg, 0.1 mmol) and Cs2CO3 (6.52 mg, 2.0 mmol) in DMF (8 mL)
was heated to 100 °C and stirred for 12 h under argon. After cooling to
room temperature, the reaction mixture was poured into ice-water (60 mL)
and extracted with DCM (3×30 mL). The combined organic layers were
washed with brine (3×30 mL), dried over Na2SO4 and concentrated under
reduced pressure. The crude product was purified by column
chromatography on silica gel (petroleum ether/ethyl acetate 5:1) to
1
produce 7b (312 mg, 75%) as a red solid. H NMR (400 MHz, CDCl3):
δ/ppm 8.34 (d, J = 7.6, 1H), 7.86 (d, J = 7.6 Hz, 1H), 7.79 (d, J = 7.6 Hz,
1H), 7.72 (d, J = 8.0, 2H), 7.66 (d, J = 7.6 Hz, 2H), 7.62 (d, J = 8.0 Hz,
1H), 7.54 (t, J = 8.0, 1H), 7.06 (d, J = 7.6 Hz, 1H), 6.78 (d, J = 8.0 Hz,
1H), 4.95 (s, 2H).
7b (208 mg, 0.5 mmol) in Pyridine (3 mL) and the resulting mixture
was heated to 110 °C and stirred for 2 h. After cooling to room
temperature, the resulting solution was poured into aqueous HCl (1 M, 15
mL) and extracted with EtOAc (3×10 mL). The combined organic layer
was washed with brine (3×15 mL), dried over Na2SO4, concentrated
under reduced pressure and recrystallized to produce 8b (153 mg, 71%)
1
as a yellow solid. H NMR (400 MHz, DMSO-d6): δ/ppm 13.10 (s, 1H,
3-NOH), 7.78 (d, J = 8.4 Hz, 2H), 7.71 (d, J = 8.0 Hz, 2H), 7.44 – 7.39
(m, 5H), 7.03 (d, J = 8.0 Hz, 1H), 6.94 (d, J = 8.0 Hz, 1H), 4.98 (s, 2H);
13C NMR (101 MHz, CDCl3) δ/ppm 164.11-C2, 145.80, 144.44, 140.34,

ACCEPTED MANUSCRIPT
133.88, 133.69, 132.22, 129.16, 128.77, 125.96, 124.04, 124.01, 113.37,
108.89, 43.27-CH2; HRMS (ESI) m/z: Calcd for C22H13ClF3N2O2 [M-H]-
429.0623; found, 429.0602.
4.2.6 4-bromo-1-(4-chlorobenzyl)-3-(methoxyimino)indolin-2-one
（6b）
K2CO3 (152 mg, 1.1 mmol) and CH3I (156 mg, 1.1 mmol) were
added to a stirred solution of 5b (366 mg, 1.0 mmol) in dry DMF (5 mL).
After the addition, the mixture was stirred at room temperature for 18 h.
The reaction was poured into aqueous HCl (1 M, 50 mL) and extracted
with EtOAc (3×20 mL). The organic layer was separated, washed with
saturated NaCl (3×40 mL) and dried over anhydrous Na2SO4. After
concentration to dryness under reduced pressure, the crude product was
purified by column chromatography on silica gel (petroleum ether/ethyl
acetate 10:1) to produce 6b (258 mg, 68%) as a red solid. 1H NMR (400
MHz, DMSO-d6): δ/ppm 7.41 – 7.30 (m, 4H), 7.29 – 7.24 (m, 2H), 6.99
(dd, J = 1.2, 7.6 Hz, 1H), 4.93 (s, 2H), 4.21 (s, 3H); 13C NMR (101 MHz,
CDCl3) δ/ppm 156.60, 143.71, 141.61, 133.84, 133.66, 131.33, 129.10,
128.81, 127.97, 117.96, 117.19, 107.96, 65.86, 42.86.
4.3. Biology evaluation
4.3.1 Materials and antibodies
All materials were from Sigma (St. Louis, MO, USA) unless
otherwise stated. Commercial antibodies were purchased from the
following sources: hTERT, anti-caspase-3 and β-actin (Santa Cruz

ACCEPTED MANUSCRIPT
Biotechnology, Santa Cruz, CA, USA). Fluorophore and HRP-conjugated
secondary antibodies were obtained from Invitrogen (Carlsbad, CA,
USA).
4.3.2 Cell culture
Cell lines were obtained from the American Type Culture Collection,
where they were characterized by DNA profiling. Cell lines were
passaged for less than six months in this study. HeLa cells were grown at
37 °C and 5% CO2 in Dulbecco's Modified Eagle Medium (DMEM)
medium, supplemented with 10% fetal bovine serum (FBS).
4.3.3. Screening of potential inhibitors of hTERT expression
HeLa cells were plated at 2 × 106 cells/well in a 6-well plate. After 24
h, cells were transfected with 2 µg of P-3996 plasmid (hTERT promoter
plasmid ) [31] or 2 µg of pGL2 vector plasmid per well plus 0.1 µg of
pCMV-β-galactosidase plasmid. After 24 h, the transfected cells were
plated onto the 96-well plates at a density of 5 × 103cells/well. 24 h later,
cells were treated with compounds at final concentrations of 5 µg/mL in
DMEM containing 3% FBS (v/v) for 24 h. Luciferase activity was
measured as described [32].
4.3.4 MTT assay
Cell
proliferation
was
determined
using
the
MTT
(3-[4,5-dimethylthiazol-2-yl]-2,5- diphenyltetrazolium bromide; thiazolyl
blue) assay. Cells were plated (5,000 cells/well) in triplicate with 200 µl

ACCEPTED MANUSCRIPT
of growth medium in 96-well plates and cultured for the indicated period.
Freshly prepared MTT was added at a final concentration of 0.5mg/ml in
PBS pH 7.4 and plates incubated in the dark for 4 hours at 37 °C. The
culture medium was then removed and the remaining blue precipitate was
solubilized in dimethylsulfoxide (DMSO). The absorbance was read at
570nm in a microplate reader, and all the MTT data were averaged from 3
independent experiments each in triplicates. The IC50 value, defined as
the drug concentration required to reduce cell survival to 50% determined
by the relative absorbance of MTT, was assessed by probit regression
analysis in SPSS statistical software [33].
4.3.5 Western blot
Cultured cells were washed twice in PBS before addition of ice cold
lysis buffer (50 mM Tris–HCl pH 7.5, 150 mM NaCl, 1 mM NaF, 1 mM
phenylmethylsulphonyl fluoride, 4 mg/ml leupeptin and 1 mg/ml
aprotinin, and 1% Nonidet P-40). Equal amounts of protein were loaded
into each well and separated by 7%, 10% or 12% SDS-PAGE gel,
followed by transfer to nitrocellulose membrane. These were blocked in
PBST buffer containing 5% non-fat dry milk for 1 hour at room
temperature. Blots were then incubated overnight at 4 °C with primary
antibodies. Secondary antibody incubation was carried out for 1 hour at
room temperature. Finally, Odyssey infrared laser imaging system
(LI-COR Biosciences, Lincoln, NE, USA) was used to image the

ACCEPTED MANUSCRIPT
experimental results.
4.3.6 RNA extract and RT-PCR
Total RNA was isolated from cultured cells using Trizol reagent
(Invitrogen, Carlsbad, CA, U.S.) according to the manufacturer’s
instructions. RNA was quantified by measuring the absorbance (A260 nm)
and samples were then stored at –80°C until use. One microgram of total
RNA was reverse transcribed with oligo (dT) primers using a reverse
transcription system. The single-stranded cDNA was amplified by PCR
using hTERT-specific primer and β-actin primer pairs. PCR was
performed for 30 cycles (each cycle consisting of 94°C for 30 s, 54°C for
30 s, and 72°C for 30 s). The PCR products were analyzed by
electrophoresis on a 1% agarose gel. Primer sequences used were as
follows:
hTERT-For
CGGAAGAGTGTCTGGAGCAA,
Rev
β-actin-For
Rev
GGATGAAGCGGAGTCTGGA;
GGAATTCATGTCAGAACCGGCTGG,
CTCCTTAATGTCACGCACGATTTC.
4.3.7 Telomere length measurement
Telomere length was measured by a modified quantitative real time
polymerase chain reaction (PCR)-based assay [22-23]. Briefly, the
telomere repeat copy number to single gene copy number (T/S) ratio was
determined using an Applied Biosystems StepOne™ thermocycler. The
telomere reaction mixture consisted of 1× Qiagen Quantitect Sybr Green

ACCEPTED MANUSCRIPT
Master Mix, 2.5mM of DTT, 270nM of Tel-1b primer
(GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT),
900nM of Tel-2b
(TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA).
and
primer
The
reaction proceeded for 1 cycle at 95°C for 5:00, followed by 40 cycles at
95°C for 15 seconds, and 54°C for 2 minutes. The 36B4 reaction
consisted of 1×Bestar Sybr Green Master Mix, 300nM of 36B4U primer
(CAGCAAGTGGGAAGGTGTAATCC), and 500nM of 36B4D primer
(CCCATTCTATCATCAACGGGTACAA). The 36B4 reaction proceeded
for 1 cycle at 95°C for 5 minutes, followed by 40 cycles at 95°C for 15
seconds, and 58°C for 1:10 minutes. All samples for both the telomere
and single-copy gene reactions were performed in duplicate, and the
threshold value for both reactions were set to 0.5. The relative telomere
length was calculated as telomere repeat copy number to single-copy
gene copy number (T/S ratio) in the study subjects as compared with that
of a reference DNA sample. The relative T/S ratio estimated by real time
PCR has been confirmed in previous work to be consistent with the
Southern blot data [22].
4.3.8 DAPI staining assay
Cell apoptosis was evaluated by 4,6-diamidino-2-phenylindole
(DAPI) staining. Cells were fixed in 5% paraformaldehyde,
permeabilized with 0.1% Triton-X-100 in PBS, stained for 10 min with

ACCEPTED MANUSCRIPT
DAPI (1 µg/mL), and analyzed by fluorescence microscopy. Cells were
considered apoptotic when the nuclei showed chromatin condensation
and fragmentation.
4.3.9 Apoptosis assay
Treated cells were collected and washed in PBS, and apoptosis was
detected using an Annexin V-FITC Apoptosis Detection Kit (Cat. No
KGA106 KeyGEN Bio-TECH, Nanjing, China) following the
manufacturer’s instructions. Cells were detected by flow cytometry and
data were analyzed using CFlow 1.0.264.15 software.
4.3.10 Statistical analysis
All the experiments were repeated at least three times, the average
values used as results and a set of representative figures shown as
illustration. Statistical analysis was performed using the χ2 test or Fisher's
exact test and Spearman's rank correlation coefficient analysis. P<0.05
indicated that the difference was significant, and P<0.01 indicated that the
difference was highly significant.
Conflict of interest statement
All the authors have declared no conflict of interest.
Acknowledgements
We are grateful to Dr. Edward McKenzie (University of Manchester,
UK) for critical reading of the manuscript. This research is supported by
the National Natural Science Foundation of China grant (81402952).

ACCEPTED MANUSCRIPT
Appendix A. Supplementary data
Supplementary data include MOL files and InChiKeys of the most
important compounds described in this article.
Reference
[1] E.H. Blackburn, C.W. Greider, J.W. Szostak, Telomeres and telomerase: the path from maize,
Tetrahymena and yeast to human cancer and aging, Nat Med, 12 (2006) 1133-1138.
[2] S.E. Holt, J.W. Shay, Role of telomerase in cellular proliferation and cancer, J Cell Physiol, 180
(1999) 10-18.
[3] T.M. Nakamura, G.B. Morin, K.B. Chapman, S.L. Weinrich, W.H. Andrews, J. Lingner, C.B.
Harley, T.R. Cech, Telomerase catalytic subunit homologs from fission yeast and human, Science, 277
(1997) 955-959.
[4] Z.Y. Shen, L.Y. Xu, E.M. Li, W.J. Cai, M.H. Chen, J. Shen, Y. Zeng, Telomere and telomerase in
the initial stage of immortalization of esophageal epithelial cell, World J Gastroenterol, 8 (2002)
357-362.
[5] M.P. Granger, W.E. Wright, J.W. Shay, Telomerase in cancer and aging, Crit Rev Oncol Hematol,
41 (2002) 29-40.
[6] J.W. Shay, S. Bacchetti, A survey of telomerase activity in human cancer, Eur J Cancer, 33 (1997)
787-791.
[7] N.W. Kim, Clinical implications of telomerase in cancer, Eur J Cancer, 33 (1997) 781-786.
[8] N.W. Kim, M.A. Piatyszek, K.R. Prowse, C.B. Harley, M.D. West, P.L. Ho, G.M. Coviello, W.E.
Wright, S.L. Weinrich, J.W. Shay, Specific association of human telomerase activity with immortal
cells and cancer, Science, 266 (1994) 2011-2015.
[9] L. Mansfield, A. Subramanian, H. Devalia, W. Jiang, R.F. Newbold, K. Mokbel, HTERT mRNA
expression correlates with matrix metalloproteinase-1 and vascular endothelial growth factor
expression in human breast cancer: a correlative study using RT-PCR, Anticancer Res, 27 (2007)
2265-2268.
[10] J. Lubin, J. Markowska, A. Markowska, J. Stanislawiak, T. Lukaszewski, Activity of telomerase
in ovarian cancer cells. Clinical implications, Clin Exp Obstet Gynecol, 36 (2009) 91-96.
[11] M.N. Helder, S. Jong, E.G. Vries, A.G. Zee, Telomerase targeting in cancer treatment: new
developments, Drug Resist Updat, 2 (1999) 104-115.
[12] K. Sekhri, Telomeres and telomerase: understanding basic structure and potential new therapeutic
strategies targeting it in the treatment of cancer, J Postgrad Med, 60 (2014) 303-308.
[13] S.A. Stewart, R.A. Weinberg, Telomerase and human tumorigenesis, Semin Cancer Biol, 10 (2000)
399-406.
[14] K.M. Burchett, Y. Yan, M.M. Ouellette, Telomerase inhibitor Imetelstat (GRN163L) limits the
lifespan of human pancreatic cancer cells, PLoS One, 9 (2014) e85155.
[15] Z.G. Dikmen, G.C. Gellert, S. Jackson, S. Gryaznov, R. Tressler, P. Dogan, W.E. Wright, J.W.
Shay, In vivo inhibition of lung cancer by GRN163L: a novel human telomerase inhibitor, Cancer Res,
65 (2005) 7866-7873.
[16] P.A. Waghorn, M.R. Jackson, V. Gouverneur, K.A. Vallis, Targeting telomerase with radiolabeled
inhibitors, Eur J Med Chem, 125 (2017) 117-129.

ACCEPTED MANUSCRIPT
[17] Q.P. Qin, J.L. Qin, T. Meng, W.H. Lin, C.H. Zhang, Z.Z. Wei, J.N. Chen, Y.C. Liu, H. Liang, Z.F.
Chen, High in vivo antitumor activity of cobalt oxoisoaporphine complexes by targeting G-quadruplex
DNA, telomerase and disrupting mitochondrial functions, Eur J Med Chem, 124 (2016) 380-392.
[18] J.B. Shi, L.Z. Chen, Y. Wang, C. Xiou, W.J. Tang, H.P. Zhou, X.H. Liu, Q.Z. Yao,
Benzophenone-nucleoside derivatives as telomerase inhibitors: Design, synthesis and anticancer
evaluation in vitro and in vivo, Eur J Med Chem, 124 (2016) 729-739.
[19] Y.Y. Chen, X.Q. Wu, W.J. Tang, J.B. Shi, J. Li, X.H. Liu, Novel dihydropyrazole-chromen:
Design and modulates hTERT inhibition proliferation of MGC-803, Eur J Med Chem, 110 (2016)
65-75.
[20] K.L. Han, Y.S. Li, Y.Z. Zhang, Y.O. Teng, Y. Ma, M.Y. Wang, R.L. Wang, W.R. Xu, Q.W. Yao,
Y.M. Zhang, H.J. Qin, H. Sun, P. Yu, Design, synthesis and docking study of novel tetracyclic
oxindole derivatives as alpha-glucosidase inhibitors, Bioorganic & Medicinal Chemistry Letters, 25
(2015) 1471-1475.
[21] H. Sun, Y. Li, X. Zhang, Y. Lei, W. Ding, X. Zhao, H. Wang, X. Song, Q. Yao, Y. Zhang, Y. Ma,
R. Wang, T. Zhu, P. Yu, Synthesis, alpha-glucosidase inhibitory and molecular docking studies of
prenylated and geranylated flavones, isoflavones and chalcones, Bioorg Med Chem Lett, 25 (2015)
4567-4571.
[22] R.M. Cawthon, Telomere measurement by quantitative PCR, Nucleic Acids Research, 30 (2002).
[23] H. Wang, H.L. Chen, X. Gao, M. McGrath, D. Deer, I. De Vivo, M.A. Schwarzschild, A.
Ascherio, Telomere length and risk of Parkinson's disease, Movement Disord, 23 (2008) 302-305.
[24] R.M. Siegel, Caspases at the crossroads of immune-cell life and death, Nat Rev Immunol, 6 (2006)
308-317.
[25] M.G. Grutter, Caspases: key players in programmed cell death, Curr Opin Struct Biol, 10 (2000)
649-655.
[26] W.C. Earnshaw, L.M. Martins, S.H. Kaufmann, Mammalian caspases: structure, activation,
substrates, and functions during apoptosis, Annu Rev Biochem, 68 (1999) 383-424.
[27] O. Julien, J.A. Wells, Caspases and their substrates, Cell Death Differ, 24 (2017) 1380-1389.
[28] E. Miri-Moghaddam, A. Deezagi, Z.S. Soheili, P. Shariati, Apoptosis and reduced cell
proliferation of HL-60 cell line caused by human telomerase reverse transcriptase inhibition by siRNA,
Acta Haematol, 124 (2010) 72-78.
[29] C. Park, G.Y. Kim, W.I. Kim, S.H. Hong, D.I. Park, N.D. Kim, S.J. Bae, J.H. Jung, Y.H. Choi,
Induction of apoptosis by (Z)-stellettic acid C, an acetylenic acid from the sponge Stelletta sp., is
associated with inhibition of telomerase activity in human leukemic U937 cells, Chemotherapy, 53
(2007) 160-168.
[30] Y.Q. Zhong, Z.S. Xia, Y.R. Fu, Z.H. Zhu, Knockdown of hTERT by SiRNA suppresses growth of
Capan-2 human pancreatic cancer cell via the inhibition of expressions of Bcl-2 and COX-2, J Dig Dis,
11 (2010) 176-184.
[31] Y.S. Cong, J. Wen, S. Bacchetti, The human telomerase catalytic subunit hTERT: organization of
the gene and characterization of the promoter, Hum Mol Genet, 8 (1999) 137-142.
[32] Y. Li, A. Guo, Y. Feng, Y. Zhang, J. Wang, L. Jing, Y. Yan, Z. Liu, L. Ma, A. Diao, Sp1
transcription factor promotes TMEPAI gene expression and contributes to cell proliferation, Cell Prolif,
(2016).
[33] Y. Li, L. Zhang, J. Zhou, S. Luo, R. Huang, C. Zhao, A. Diao, Nedd4 E3 ubiquitin ligase promotes
cell proliferation and autophagy, Cell Prolif, 48 (2015) 338-347.

ACCEPTED MANUSCRIPT
Figure legend
Scheme 1 Synthesis of isatin derivatives (5a-5c, 6b). Reagents and
conditions: (a) Na2SO4, NH2OH HCl, CCl3CH(OH)2, 2M HCl, H2O,
90℃, 2 h; (b) conc. H2SO4, 65℃, 30 min; (c) K2CO3, DMF, 60℃, 2 h;
(d) Pyridine, NH2OH HCl, 110℃, 2h; (e) CH3I, K2CO3, DMF, 25℃,
12h
Scheme 2 Synthesis of isatin derivatives (8a-8b). Reagents and
conditions: (a) Pd(PPh3)4, Cs2CO3, DMF, 100 ℃ ; (b) Pyridine,
NH2OH HCl,110℃, 2h.
Figure 1 Compound 5c inhibits hTERT gene promoter activity. (A) HeLa
cells were transfected with P-3996 plasmid or pGL2 vector per well plus
pCMV-β-galactosidase plasmid, then treated with the compounds (5µM).
Cells were treated with 0.1% (v/v) DMSO to act as the negative control.
Results are expressed as the fold activity over the activity of the negative
control. The screening assay was repeated three times and partial data are
shown. (B) HeLa cells were co-transfected with promoter-3996 or pGL2
vector and pCMV-β-galactosidase plasmid. 24 h after compound 5c (1, 2,
4, 8 and 16µM) treatment, luciferase activity was measured and
normalized using β-galactosidase activity. Results are expressed as the
fold activity over the activity of the negative control.

ACCEPTED MANUSCRIPT
Figure 2 Compound 8b inhibits hTERT expression in cancer cells (A)
HeLa cells were treated with 5µM of compound 8b for 24h and then
hTERT mRNA levels were analyzed using RT-PCR, β-actin was used as
an internal control to check the efficiency of cDNA synthesis and PCR
amplification. (B) Quantification of RT-PCR for hTERT mRNA levels
using ImageJ software. (C) HeLa cells were treated with compound 8b (1,
2, 4, 8 and 16µM) for 24 h, and 0.1% (v/v) DMSO was used as a negative
control. Cells were then lysed and hTERT expression was analyzed by
Western blot. (D) Quantification of Western blot for hTERT levels using
ImageJ software. (E) HeLa cells were treated with 5µM of compound 8b
for 12, 24, 36 and 48h and then cells were lysed and hTERT expression
was analyzed by Western blot. (F) Quantification of Western blot for
hTERT levels using ImageJ software. (G) HeLa cells were treated with
compound 8b or DMSO for 22 generations, and measured the relative
length of telomeres using Q-PCR (**P < 0.01 VS Control).
Figure 3 Knockdown of endogenous hTERT in HeLa cells by RNA
interference inhibits cell proliferation (A) HeLa cells were infected with
200 µl lentiviruses expressing shhTERT-1#, shhTERT-2# or the
scrambled control, and expression of hTERT was detected by Western
blot. (B) HeLa cells were infected with 200 µl lentiviruses expressing

ACCEPTED MANUSCRIPT
shhTERT-1#, shhTERT-2# or the scrambled control, and t cell
proliferation was analyzed by MTT assay at 1d, 2d and 3d post-infection.
(C) HeLa expressing shhTERT-1#, shhTERT-2# or the scrambled control
were used for colony formation assays after 3 weeks culture, then the
plates were photographed. (D) Quantification of the efficiency of colony
formation by statistical analysis.
Figure 4 Compound 8b inhibits HeLa cell proliferation (A) The HeLa
and L02 cells were treated with an increasing gradient concentration of
compound 8b (1, 2, 4, 8 and 16 µM) for 48 h followed by MTT analysis .
(B) HeLa cells were treated with 5 µM compound 8b for 24 or 48 h
followed by the MTT assay. (C) HeLa cells treated with 5 µM compound
8b were used for colony formation assay. The plates were photographed
after 3 weeks culture. (D) Quantification of the efficiency of colony
formation by statistical analysis.
Figure 5 Compound 8b induced cell apoptosis via a mitochondrial-
dependent pathway (A) HeLa cells were treated with compound 8b for
48h, and then stained with DAPI. The arrows highlight cells undergoing
apoptosis. (B) HeLa cells were treated with compound 8b for 48h, then
double-labeled with Annexin V/PI staining. Cells were detected by flow
cytometry and data were analyzed using CFlow 1.0.264.15 software. (C)

ACCEPTED MANUSCRIPT
HeLa cells were treated with compound 8b for 24h, and analyzed by
Western blot using antibodies against cleaved caspases 3, cleaved
caspases 9, Bax, Bcl-2 and β-actin.

ACCEPTED MANUSCRIPT
Table 1 The effect of 6 compound 5c analogs on hTERT gene promoter activity
Chemical
number
Chemical name
Chemical
structure
EC50
(µM)
13
4-chloro-1-(4-chlorobenzyl)-3-(hydroxyi
mino)indolin-2-one
5a
5b
5c
6b
8a
6
4-bromo-1-(4-chlorobenzyl)-3-(hydroxyi
mino)indolin-2-one
14
1-(4-chlorobenzyl)-3-(hydroxyimino)-4-i
odoindolin-2-one
None
4-bromo-1-(4-chlorobenzyl)-3-(methoxy
imino)indolin-2-one
12
1-(4-chlorobenzyl)-3-(hydroxyimino)-4-
(4-methoxyphenyl)indolin-2-one
5
1-(4-chlorobenzyl)-3-(hydroxyimino)-4-
8b
(4-(trifluoromethyl)phenyl)indolin-2-on
e