A novel serine hydroxymethyltransferase from marine bacterium Alcanivorax sp. and its application on enzymatic synthesis of L-serine

Article abstract of DOI:10.1016/j.molcatb.2014.07.013

A novel glyA gene from the marine bacterium Alcanivorax sp. was cloned and expressed in Escherichia coli BL21 (DE3). The recombinant glyA encodes a polypeptide of 418 amino acids, which was designated as AdSHMT that shows the highest identity (70%) with a SHMT from Shewanella algae. The purified enzyme showed a single band at about 45 kDa by SDS-PAGE analysis. It was found that AdSHMT exhibited the maximal activity at 50 °C and pH 7.0. The K _m, V_max, and K_cat values of AdSHMT against dl-threo-3-phenylserine were calculated to be 0.097 mol/L, 3.255 μmol/min/mg and 2.451/s, respectively. More importantly, RP-HPLC detection showed that the AdSHMT achieved an 88.37% molecular conversion rate in catalyzing glycine to l-serine, with the final concentration of l-serine being 353.15 mM in the reaction at 35°C and 22nd hour when the initial concentration of the substrate (glycine) was 0.399 M. The molecular conversion rate of the AdSHMT from the Alcanivorax sp. was 1.26-fold that of the EcSHMT from the E. coli, which is currently applied in industrial production. Therefore, AdSHMT has the potential for industrial applications due to its high enzymatic conversion rate.

Full text of DOI:10.1016/j.molcatb.2014.07.013

Journal of Molecular Catalysis B: Enzymatic 109 (2014) 17–23
Contents lists available at ScienceDirect
Journal of Molecular Catalysis B: Enzymatic
journal homepage: www.elsevier.com/locate/molcatb
A novel serine hydroxymethyltransferase from marine bacterium
Alcanivorax sp. and its application on enzymatic synthesis of L-serine
Shaohui Yuan1, Wei Jiang1, Lin Chen, Yiming Guo, Ziduo Liu∗
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, China
a r t i c l e i n f o
a b s t r a c t
Article history:
A novel glyA gene from the marine bacterium Alcanivorax sp. was cloned and expressed in Escherichia coli
BL21 (DE3). The recombinant glyA encodes a polypeptide of 418 amino acids, which was designated as
AdSHMT that shows the highest identity (70%) with a SHMT from Shewanella algae. The purified enzyme
showed a single band at about 45 kDa by SDS-PAGE analysis. It was found that AdSHMT exhibited the max-
imal activity at 50 ◦C and pH 7.0. The Km, Vmax, and Kcat values of AdSHMT against dl-threo-3-phenylserine
were calculated to be 0.097 mol/L, 3.255 ␮mol/min/mg and 2.451/s, respectively. More importantly, RP-
HPLC detection showed that the AdSHMT achieved an 88.37% molecular conversion rate in catalyzing
glycine to l-serine, with the final concentration of l-serine being 353.15 mM in the reaction at 35 ◦C and
22nd hour when the initial concentration of the substrate (glycine) was 0.399 M. The molecular con-
version rate of the AdSHMT from the Alcanivorax sp. was 1.26-fold that of the EcSHMT from the E. coli,
which is currently applied in industrial production. Therefore, AdSHMT has the potential for industrial
applications due to its high enzymatic conversion rate.
Received 27 November 2013
Received in revised form 14 July 2014
Accepted 25 July 2014
Available online 4 August 2014
Keywords:
SHMT
Characterization
Fermentation
l-Serine enzymatic production
RP-HPLC
© 2014 Published by Elsevier B.V.
1. Introduction
most promising method for l-serine manufacturing. In the l-serine
production by the enzymatic method, the key reaction within the
l-Serine is one of the twenty standard amino acids. Meanwhile,
it is required for glycine, l-cysteine, l-tryptophan, phospholipids
and hemes synthesis [1]. Additionally, l-serine has an essential
role in the generation of activated one-carbon (C1) units that are
required in a variety of metabolic processes including purine and
pyrimidine biosynthesis [2]. l-Serine is also required for phar-
maceutical purposes [3]. The total annual demand for l-serine is
reported to be 300 tons [3], suggesting that l-serine has a great
potential for application in our life, and the demand of l-serine will
be greater with social and economic development.
central metabolism is the reversible interconversion of l-serine
and tetrahydrofolate (THF) to glycine and N5,N10-methylene-THF
catalyzed by serine hydroxymethyltrasferase (SHMT; EC 2.1.2.1)
[7]. Therefore, a high molecular conversion rate of SHMT for the
industrial production of l-serine has always attracted the atten-
tion of researchers, and the highest molecular conversion rate
(87%) in enzymatic production of l-serine was obtained in 1986
from a SHMT from the recombinant bacterium Klebisells aerogenes
[6].
SHMT is a pyridoxal 5ꢀ-phosphate (PLP)-dependent enzyme
[8,9], which is encoded by the glyA gene [10] and has been charac-
terized from different organisms, such as bacteria [11], plants [12]
and a few mammalian livers [13–15]. For example, SHMT belongs
to the abundant proteins in Bacillus subtilis [16], Escherichia coli
[17], Corynebacterium glutamicum [18] and Lactococcus lactis [19].
SHMT has also been shown to be involved in de novo biosynthesis of
thymidylate in the mammals [20]. In plants, the enzyme cooperates
with the glycine decarboxylase (GDC) to mediate photorespiratory
glycine–serine interconversion [21,22].
In the current study, a glyA gene from the marine bacterium
Alcanivorax sp. was cloned and expressed in E. coli, and then
the recombinant AdSHMT enzyme was purified and characterized.
Additionally, the correlation of the AdSHMT enzyme production
and activity with the fermentation time of recombinant E. coli was
l-Serine is usually produced by fermentation [4], chemical syn-
thesis [5] and enzymatic methods [6]. Among these methods, the
enzymatic method has the advantages of simple process, short
cycle, strong specificity and high yield, and thus has become the
Abbreviations: SHMT, serine hydroxymethyltransferase; PLP, pyridoxal 5ꢀ-
phosphate; THF, tetrahydrofolate; GDC, glycine decarboxylase; LB, Luria-Bertani;
IPTG, isopropyl-␤-d-1-thiogalactopyranoside; GST, glutathione S-transferase;
SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; CTAB,
cetyltrimethyl ammonium bromide; RP-HPLC, reversed phase high performance
liquid chromatography; ORF, opening reading frame; OPA, orthophthalaldehyde.
∗
Corresponding author. Tel.: +86 27 87281429; fax: +86 27 87280670.
E-mail address: lzd@mail.hzau.edu.cn (Z. Liu).
These authors contributed equally to this work.
1
http://dx.doi.org/10.1016/j.molcatb.2014.07.013
1381-1177/© 2014 Published by Elsevier B.V.

18
S. Yuan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 17–23
investigated. The molecular conversion rate of AdSHMT in l-serine
2.4. Enzyme assay and biochemical characterization
enzymatic production was also evaluated.
The purified enzyme was used for general characterization of the
AdSHMT properties. The SHMT activity was measured as described
by Lee and Hsiao [24], with modifications. The 0.3 ml reaction mix-
ture (pH 7.0) consisted of 10 ␮l of the purified enzyme and 290 ␮l
of Na2HPO4 (0.2 M)-citric acid (0.1 M) buffer containing 50 mM dl-
threo-3-phenylserine and 50 ␮M PLP. After 1 h reaction at 50 ◦C,
the benzaldehyde absorption was measured at 279 nm [25]. One
unit (U) enzyme activity was defined as the amount of enzyme
which catalyzed the release of 1 ␮mol benzaldehyde per minute.
All enzyme activity assays were performed in triplicate and the
specific enzyme activity was expressed as the number of units per
mg protein.
The optimum temperature of the enzyme activity was deter-
mined in the temperature range of 30–70 ◦C at a 5 ◦C interval in
a Na2HPO4-citric acid buffer (pH 7.0). The optimum pH for the
purified enzyme activity was determined at various pH values
by using 0.2 M Na2HPO4/0.1 M citric acid buffer (pH 4.0–8.0) and
0.05 M glycine–NaOH buffers (pH 8.0–10.0). The thermostability of
the enzyme was determined at the optimal pH by incubating the
enzyme at a temperature range of 35–55 ◦C (at a 5 ◦C interval) for
10, 20 and 30 min, and then the residual activity was measured
using a standard assay. The effect of pH on the enzyme stability
was determined under the standard assay conditions by incubating
the enzyme in a range of buffers (pH 6.0–8.0) in the absence of the
substrate at 4 ◦C for 24 h, and then the residual activity was mea-
sured. The effects of different metal ions (3 mM) and other chemical
reagents (1%) on the recombinant enzyme activity were evaluated
at 50 ◦C for 45 min with a substrate buffer solution (pH 7.0), and the
remaining activity was measured under standard conditions. The
activity assayed in the absence of metal ions or chemical reagents
was defined as 100%.
2. Materials and methods
2.1. Strains, plasmids, mediums and materials
The E. coli strains DH5a and BL21 (DE3) were used as hosts to
clone and express the target gene, respectively. The vectors, pGEX-
6p-1 and pET-15b, were used to express the SHMT gene. The marine
bacterium was cultured in marine agar 2216 medium. Luria-Bertani
(LB) medium containing ampicillin (100 ␮g/ml) was used to culture
E. coli DH5a and E. coli BL21.
All the Taq DNA polymerases, T4 DNA ligases, restriction
enzymes, and DNA markers were purchased from TaKaRa Com-
pany (Dalian, China). The primers and fragments were synthesized
and sequenced, respectively, by GenScript Co. (Nanjing, China).
The protein molecular weight marker was purchased from TIAN-
GEN Co. (Germany) and THFA was synthesized in our laboratory
as described by Scrimeour and Vitols [23]. The Kits including DNA
purification, Protein Quantification and the GST Bind Purification
were purchased from Axygen Co. (USA), Pharmacia Co. (Sweden)
and Sangon Biotech Co. (China), respectively. Unless otherwise
stated, all the other chemical materials used in this study were
purchased from Sigma Company (USA).
2.2. Cloning of the glyA gene encoding the SHMT
The glyA gene encoding AdSHMT was amplified by PCR
from genomic DNA of the Alcanivorax sp. The two pairs of
primers used were designed by the sequence of the glyA gene
from the Alcanivorax sp. genomic information in the NCBI
(National center for biotechnology information) database (AC
no. cp 003466) (http://www.ncbi.nlm.nih.gov/) as follows: (F1-
glyA-BamHI: 5ꢀ-CGGGATCCATGTTCCCCAAATCCATGTCCAT-3ꢀ; R1-
glyA-XhoI: 5ꢀ-CCGCTCGAGTTAGCGCTCATAGACCGGCAACC-3ꢀ and
F2-glyA-NdeI: GGAATTCCATATGATGTTCCCCAAATCCATGTCCA; R2-
glyA-BamH1: CGGGATCCTTAGCGCTCATAGACCGGCAACC). After
PCR, the amplified products were cloned into pGEX-6p-1 and pET-
15b vector, respectively. Similarly, the glyA gene (Gene ID: 947022)
from E. coli was cloned into vector pET-15b. Finally, the clones were
transformed into E. coli strain DH5a and confirmed by sequencing.
The three recombinant plasmids were designated as pGEX-6p-
AdglyA, pET-15b-AdglyA, and pET-15b-EcglyA, respectively.
2.5. Enzyme kinetic analysis
The Km, Vmax, and Kcat values of the purified AdSHMT enzyme
were determined by measuring the enzymatic activity under the
optimum temperature and pH conditions at a substrate concentra-
tion range of 20–140 mM. The data were plotted according to the
Lineweaver–Burk method.
2.6. Fermentation time and enzyme activity
The recombinant plasmid, pET-15b-AdglyA, was transformed
into E. coli BL21 (DE3). A single colony was picked out from LB solid
medium plate and the transformant was grown overnight at 37 ◦C
in the LB liquid medium supplemented with 100 mg/ml ampicillin.
The culture was then inoculated into fresh LB medium (1:100 dilu-
tion) containing 100 mg/ml ampicillin and grown at 37 ◦C for 4 h.
When the OD600 rose to around 0.6, IPTG was added to a final con-
centration of 0.1 mM, and the culture was incubated at 18 ◦C for
36 h. Subsequently, an equal volume of culture fluid was collected
at a 4 h interval and stored at −4 ◦C until the end of fermentation.
Finally, the optical densities of cultures were measured at OD600
under the same conditions. The enzyme activities of the cultures
were determined in the same way as described above, except that
0.03% (w/v) cetyltrimethyl ammonium bromide (CTAB) was added
when the culture cells were used in the reaction system directly.
The expression levels of the recombinant protein were analyzed by
12% SDS-PAGE.
2.3. Expression and purification of the recombinant enzyme
The E. coli strain BL21 (DE3) was transformed with the recombi-
nant plasmid pGEX-6p-AdglyA for AdSHMT expression. Initially, a
single colony was inoculated into the LB liquid medium containing
ampicillin (100 ␮g/ml) and grown 14–16 h at 37 ◦C. Subsequently,
the culture was transferred into the fresh LB liquid medium (1:100
dilution) with ampicillin (100 ␮g/ml) for 4–5 h. Then at an optical
density (OD600) of 0.4–0.6, isopropyl-␤-d-1-thiogalactopyranoside
(IPTG) was added into the medium at a final concentration of
0.1 mM, followed by an overnight incubation of the mixture at
18 ◦C. Finally, the cells were collected by centrifugation and dis-
rupted with High Pressure Homogenizer (NS100IL 2K, Niro Soavi,
Germany). The recombinant AdSHMT enzyme was purified by the
glutathione S-transferase (GST) fusion protein purification system
(GE Healthcare, Sweden). The concentration of the protein was
determined by the method of Bradford using the Bradford reagent,
and the molecular mass of the purified protein was assessed by 12%
sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-
PAGE).
2.7. Enzymatic production of l-serine
The recombinant expression plasmids pET-15b-AdglyA and pET-
15b-EcglyA were introduced separately into E. coli BL21 (DE3) for

S. Yuan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 17–23
19
l-serine production. The two engineering bacteria were inocu-
lated, induced and incubated with the same method and under the
same conditions in l-serine production. At the end of fermentation,
the bacterial cells were collected by centrifugation at 6000 rpm
for 5 min, and then washed twice with phosphate buffer (0.2 M,
pH 8.0). After that, the wet cells were divided into equal parts
(450 mg for each) and frozen overnight at −80 ◦C. Subsequently,
the AdSHMT (expressed by pET-15b-AdglyA) were thawed at 37 ◦C
and re-suspended with phosphate buffer (0.2 M, pH 8.0) in a 15 ml
reaction system (I, II, III and IV) containing phosphate buffer (0.2 M,
pH 8.0), formaldehyde (23.8 mM), THFA (4 mM), PLP (0.3 mM) and
ˇ-mercaptoethanol (0.4 M). The concentrations of the glycine in the
four reaction systems (I, II, III and IV) were 0.266, 0.399, 0.533 and
0.666 M, respectively.
The enzymatic reactions were performed in a rotary shaker at
35 ◦C and 160 rpm for 24 h. 100 ␮l was sampled at a 2 h interval
for 24 h and stored at −80 ◦C, and the formaldehyde was added to
these reaction systems at a 1 h interval at a final concentration of
23.8 mM. The optimum conversion concentration of glycine was
determined in reaction system II. Meanwhile, EcSHMT (expressed
by pET-15b-EcglyA) was used for l-serine production through the
enzymatic reactions in reaction system II under the same con-
ditions. Finally, the l-serine and glycine concentration of all the
samples were determined by RP-HPLC with pre-column derivati-
zation.
2.8. Sample preparation and RP-HPLC detection of l-serine and
glycine concentrations
Fig. 1. 12% SDS-PAGE analysis of the purified AdSHMT. Lane M: protein marker. The
protein molecular weight ladder is Unstained Protein Molecular Weight Marker
(Fermentas, Canada). Lane 1: purified AdSHMT without GST. Lane 2: total protein in
recombinant bacterium (harboring pGEX-6p-AdglyA) induced by 0.1 mM IPTG.
All the samples were prepared as follows: the standard
amino acid and the sample of enzymatic reaction (40 ␮l) were
diluted separately with ultrapure water within a concentration
of 50–300 pmol/␮l. Subsequently, 100 L of as-prepared enzymatic
reaction and standard amino acid solutions were added sepa-
rately into a 1.5 ml centrifuge tube, with the centrifuge tube
containing 600 ␮l of borate buffer (0.4 M, pH 10.4) and 300 ␮l
of OPA (4 mg/ml) as derivatization reagent. After that, the mix-
ture was filtered through an organic membrane (0.22 ␮m) and
then was thoroughly mixed. Finally, the sample was analyzed with
RP-HPLC.
encoded a polypeptide of 418 amino acids with a predicted
molecular mass of 45.2 kDa. When the amino acid sequence of the
putative protein was compared with the sequences of the other
glyA genes coding in the NCBI database by a protein BLAST search,
the amino acid sequence of AdSHMT protein showed the greatest
sequence identity with that of the known SHMT proteins from (70%)
Shewanella algae (GenBank: KC784941) and (69%) E. coli. (GenBank:
NP 417046).
The l-serine and glycine from the enzymatic reaction sam-
ples were analyzed on a column of Agilent Eclipse XDB-C18
(250 mm × 4.6 mm, 5 ␮m) by RP-HPLC (1260 infinity quaternary
LC system, Agilent Technologies) with the detector set at 340 nm
excitation and 450 nm emission. The detection system was run as
follows: the sample (5 ␮l) was injected into the chromatograph at
a flow rate of 1 ml/min at 32 ◦C (column temperature), and the col-
umn was eluted with moving phases A and B by decreasing solvent
A from 90% to 72% and increasing solvent B from 10% to 28% at a con-
stant rate during the first 12 min, followed by an increase of solvent
B from 28% to 30% at a constant rate in the next 8 min (12–20 min).
Finally, the equilibration time was set as 5 min for the next run.
Solvent A (pH 5.8) was composed of 25 mM sodium acetate buffer
supplemented with tetrahydrofuran (95/5, v/v), and the compo-
sition of Solvent B was similar, except that tetrahydrofuran was
replaced by the methanol [26].
3.2. Expression and purification of AdSHMT
After the recombinant plasmid pGEX-6p-AdglyA was expressed
in E. coli strain BL21 (DE3) and purified by affinity chromatography,
the recombinant AdSHMT was harvested and resolved to a single
band of about 45 kDa by the SDS-PAGE analysis (Fig. 1). The con-
centration of the purified enzyme was determined to be 0.4 mg/ml
by the Bradford method.
3.3. Enzyme characterization
AdSHMT exhibited the optimal activity at around 50 ◦C (Fig. 2a),
and retained over 80% activity between 40 and 55 ◦C. The enzyme
could also maintain more than 65% of the maximal activity after
30 min incubation at 35 and 40 ◦C, but at a temperature above 45 ◦C,
the enzyme activity declined rapidly (Fig. 2b). The optimal pH value
for the AdSHMT activity was found to be 7.0 (Fig. 2c), and over 60%
of the maximal activity was retained after treatment at pH 6.0–7.5
and 4 ◦C for 24 h. However, the enzyme displayed less than 20% of
its maximal activity at pH 8.0 (Fig. 2d).
3. Results
3.1. Gene cloning and sequence analysis
The DNA fragment, obtained as described in Section 2, was found
to code for an opening reading frame (ORF) (1257 bp) starting with
an ATG codon and terminating with a TAA codon after sequencing
analysis. The G+C content of the ORF was 63.4%, and the sequence
The AdSHMT activity was affected by most of the metal ions and
several chemical reagents tested. Compared with the control, the
enzyme activity was strongly inhibited by Cu2+ and SDS (1%), but

20
S. Yuan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 17–23
Fig. 2. Effects of temperature and pH on the activity and stability of the purified AdSHMT. (a) The optimum temperature. The enzyme activity was measured at a temperature
range of 30–70 ◦C, and the maximal activity was taken as 100%. (b) Effect of temperature on the enzyme stability. The thermal stability was determined by incubating the
enzyme at 35 (᭹), 40 (ꢀ), 45 (ꢁ), 50 (ꢂ) and 55 ◦C (ꢃ) for 10, 20 and 30 min. The activity of the enzyme without incubation was defined as 100%. (c) The optimum pH. The
activity was measured at a pH range of 4.0–10.0, and the maximal activity was taken as 100%. (d) Effect of pH on the enzyme stability. The enzyme stability was determined
by incubating the enzyme at a different pH value at 4 ◦C for 24 h, and the residual activities were measured at pH 7.0. The activity of the enzyme without incubation was
defined as 100%. Error bars represent the standard deviation. Results represent the average of three parallel experiments.
Fig. 3. The effects of different metal ions (3 mM) and other chemical reagents (1%) including SDS and CTAB on the purified AdSHMT activity. Assays were performed under
optimum conditions. The activity of the enzyme without metal ions or chemical reagents was defined as 100%. The error bars represent the standard deviation.
increased in the presence of Mn2+. Besides, Mg2+, K+, Na+ and EDTA
had no significant effect on the enzyme activity (Fig. 3).
3.6. Enzymatic reaction of l-serine production
The following values of the enzymatic production of l-serine
were acquired by RP-HPLC detection (Fig. 5). The optimum concen-
tration of the substrate (glycine) was 0.399 M based on the l-serine
conversion rates of the AdSHMT at 35 ◦C and the 22nd hour in the
four reaction systems (I–IV), which were 77.97, 88.37, 69.87 and
52.45%, respectively (Fig. 6a). Under the same conditions, the max-
imum molecular conversion rate of the AdSHMT was 1.26-fold that
of the EcSHMT (70.25%) at the 22nd hour (Fig. 6b). The l-serine
concentrations of two systems were 353.15 mM and 280.74 mM,
respectively (Fig. 6c).
3.4. Kinetic analysis
When dl-threo-3-phenylserine was used as the substrate, the
values of kinetic parameters in terms of Km, Vmax and Kcat were
calculated to be 0.097 mol/L, 3.255 ␮mol/min/mg and 2.451/s,
respectively, using the Michaelis equation.
3.5. Correlation of fermentation time with AdSHMT activity
The cell concentration and the enzyme activity increased rapidly
between 4 and 8 h, and gently subsequently. On the whole, they
reached a stable state after 16 h, and still remained in a good state
at 36 h (Fig. 4a). Meanwhile, the expression of the AdSHMT enzyme
was stable from the 4th to 36th hour by the SDS-PAGE analysis
(Fig. 4b).
4. Discussion
Generally, the methylotrophic microorganisms were isolated
from terrestrial environments. In this study, the glyA gene from the

S. Yuan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 17–23
21
Fig. 4. The correlation of fermentation time with AdSHMT activity, and SDS-PAGE analysis of the AdSHMT expression level. (a) The correlation of fermentation time with
AdSHMT activity. The OD600 at each time point (᭹) and the enzyme activity (ꢀ) of cultures were measured under the same conditions. (b) The expression analysis of AdSHMT
by SDS-PAGE at each time point. Lane M: protein marker. Lanes 1–9: the expression levels of AdSHMT at the 4th–36th hour at a 4 h interval with the band at about 45 kDa.
The error bars represent the standard deviation.
Fig. 5. HPLC analysis of the l-serine concentration. (a) l-serine and glycine standards. (b) Detection of l-serine synthesis by AdSHMT in the enzymatic reaction system II at
the 22nd hour.
deep-sea bacterium Alcanivorax sp. was cloned and expressed in E.
coli. To the best of our knowledge, this is the first study of its kind
to analyze the protein AdSHMT and the conversion rate of AdSHMT
in the enzymatic production of l-serine. The results indicate that
AdSHMT has a high potential for industrial applications.
SHMT, which is a ubiquitous enzyme found in Archaea, Eubacte-
ria and Eukarya, belongs to the ␣-family of PLP-dependent enzymes
[27,28]. For the industrial production today, SHMT is useful in the
synthesis of the l-serine using glycine and formaldehyde, but the
structure of SHMT is rather conserved during evolution [29]. Thus,
before finding a better way to improve the production efficiency of
l-serine, it is necessary to analyze the characteristics of the enzyme.
To this end, we performed the biochemical characterization of
the AdSHMT enzyme. The enzyme is resistant to the inactivation
induced by several metal ions and chemical reagents. Zhen-yu Zuo
et al. maintained that the activity of a SHMT enzyme in l-serine
production can be enhanced by directed evolution [25,30] to better
fit industrial applications.
In the process of l-serine production, gaining large amounts
of enzyme with high activity is the key. As shown in Fig. 4a, the
biomass increased to a high yield after about 20 h of fermenta-
tion. Meanwhile, the enzyme activity also reached a maximum, and
showed no significant increase at a later time perhaps due to the
protein expression peak at 20th hour. This observation can help
reduce the costs greatly and increase productivity in the actual
industrial production for the accurate time to obtain a high cell
concentration.
The result of the enzymatic production of l-serine shows that
different initial concentrations of glycine, whether too high or too
low, will affect l-serine production in the same reaction system

22
S. Yuan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 17–23
Fig. 6. The l-serine molecular conversion rates and SDS-PAGE analysis of AdSHMT and EcSHMT. (a) The maximum molecular conversion rate of AdSHMT at a different
substrate (glycine) concentration. HPLC was used to analyze the l-serine concentration followed by the calculation of the molecular conversion rates in enzymatic reaction
systems I ( ), II (
), III (
) and IV (
) at 35 ◦C and 22nd hour. (b) Comparison of l-serine molecular conversion between AdSHMT and EcSHMT at the optimum substrate
(glycine) concentration. HPLC was used to analyze the l-serine molecular conversion rates in the AdSHMT (
) and EcSHMT ( ) enzymatic reaction systems at a substrate
(glycine) concentration of 0.399 M. (c) Comparison of the l-serine concentrations between AdSHMT and EcSHMT reaction systems. HPLC was used to analyze the l-serine
concentration in the AdSHMT (ꢀ) and EcSHMT (ꢁ) enzymatic reaction systems at 35 ◦C and at the 20th, the 22th and the 24th hour. (d) SDS-PAGE analysis of the induced
AdSHMT and EcSHMT. Engineering bacteria pET-15b-AdglyA and pET-15b-EcglyA were treated under the same conditions. Lane M: protein marker. Lane 1: AdSHMT (about
45 kDa) from the Alcanivorax sp. Lane 2: EcSHMT (about 45 kDa) from the E. coli. The error bars represent the standard deviation.
(Fig. 6a). This phenomenon may be related with the reaction itself,
because in this reaction, the pathway can interchange between ser-
ine and glycine in the presence of the SHMT and the other two
cofactors of THF and PLP [31]. A too high or too low initial glycine
concentration resulted in a low conversion rate of the AdSHMT
in the enzymatic l-serine production, indicating that an appropri-
ate concentration of glycine (0.399 M in the current study) can be
beneficial to the enzymatic l-serine production.
Researchers usually pay more attention to the conversion rate
of the enzyme in the actual industrial production. In previous stud-
ies, Hsiao et al. [6] used a SHMT enzyme from a recombinant strain
of Klebsiella aerogenes as a crude extract to study the production
of l-serine, resulting in a serine titer of 160 g/L with a 70% molec-
ular conversion rate of glycine. However, in the current study, the
l-serine conversion rate was as high as 88.37% in the enzymatic
reaction. While the expression level of AdSHMT was very similar to
that of EcSHMT under the same conditions (Fig. 6d), the molecular
conversion rate of the AdSHMT was 1.26-fold that of the EcSHMT,
which is currently applied in the industrial production.
AdSHMT has the potential to be further transformed by directed
evolution, based on the reduction of the Km (97 mM) and the Km
values from 33.4 to 24.5 mM as described by Zuo et al. [25].
5. Conclusion
The results show that the purified AdSHMT has the optimal
activity at 50 ◦C and pH 7.0. Moreover, the enzyme is resistant to the
inactivation induced by several metal ions and chemical reagents.
The maximum molecular conversion rate of the AdSHMT was 1.26-
fold that of the EcSHMT, and the high conversion rate of the AdSHMT
in enzymatic l-serine production suggests that this enzyme has the
potential for industrial applications.
Acknowledgment
This study was supported by grants from China National Natural
Sciences Foundation (No. J1103510).
In addition, we obtained a novel SHMT from the deep-sea bac-
terium Alcanivorax sp., while almost all the microorganisms used
in the studies reported were from the terrestrial environment. To
date, only a few reports have been published on l-serine produc-
tion from glycine and methanol by methylotrophic bacteria with
the serine pathway [32,33]. Although the glyA gene from Alcanivo-
rax sp. encoding SHMT was reported [34], this is the first report
about the characteristics and the conversion rate of AdSHMT in l-
serine production. Additionally, the kinetic analysis indicates that
References
[1] G. Stauffer, Escherichia coli and Salmonella: Cellular and Molecular Biology, 2nd
ed., ASM Press, Washington, 1996, pp. 506–513.
[2] A.E. Beaudin, E.V. Abarinov, D.M. Noden, C.A. Perry, S. Chu, S.P. Stabler, R.H.
Allen, P.J. Stover, Am. J. Clin. Nutr. 93 (2011) 789–798.
[3] M. Stolz, P. Peters-Wendisch, H. Etterich, T. Gerharz, R. Faurie, H. Sahm, H.
Fersterra, L. Eggeling, Appl. Environ. Microbiol. 73 (2006) 750–755.
[4] Y. Morinaga, S. Yamanaka, K. Takinami, Agric. Biol. Chem. 45 (1981) 1419–1424.
[5] L. Bassignani, B. Biancini, A. Brandt, V. Caciagli, G.E. Bianchi, L. Re, A. Rossodivita,
P. Zappelli, Chem. Ber. 112 (1979) 148–160.

S. Yuan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 17–23
23
[6] H.-Y. Hsiao, T. Wei, K. Campbell, Biotechnol. Bioeng. 28 (1986) 857–867.
[20] D.D. Anderson, P.J. Stover, PLoS ONE 4 (2009) e5839.
[7] R. Netzer, P. Peters-Wendisch, L. Eggeling, H. Sahm, Appl. Environ. Microbiol.
70 (2004) 7148–7155.
[21] H. Bauwe, M. Hagemann, A.R. Fernie, Trends Plant Sci. 15 (2010) 330–336.
[22] L.M. Voll, Plant Physiol. 140 (2005) 59–66.
[8] R. Blakley, Biochem. J. 61 (1955) 315.
[23] K. Scrimgeour, K.S. Vitols, Biochemistry 5 (1966) 1438–1443.
[24] T.K. Lee, H.-y. Hsiao, Enzyme Microb. Technol. 8 (1986) 523–526.
[25] Z.-Y. Zuo, Z.-L. Zheng, Z.-G. Liu, Q.-M. Yi, G.-L. Zou, Enzyme Microb. Technol. 40
(2007) 569–577.
[9] V. Schirch, S. Hopkins, E. Villar, S. Angelaccio, J. Bacteriol. 163 (1985) 1–7.
[10] P. Simic, J. Willuhn, H. Sahm, L. Eggeling, Appl. Environ. Microbiol. 68 (2002)
3321–3327.
[11] D. Barra, F. Martini, S. Angelaccio, F. Bossa, F. Gavilanes, D. Peterson, B. Bullis, L.
Schirch, Biochem. Biophys. Res. Commun. 116 (1983) 1007–1012.
[12] D.N. Rao, N.A. Rao, Plant Physiol. 69 (1982) 11–18.
[26] Y. Zhao, Z. Xie, Y. Niu, H. Shi, P. Chen, L. Yu, Food Chem. 134 (2012) 180–188.
[27] P.K. Mehta, P. Christen, D. Purich, Adv. Enzymol. Relat. Areas Mol. Biol: Mech.
Enzyme Action Part B 1 (1998) 129–184.
[13] E.H. Blackburn, F.J.R. Hird, I.K. Jones, Arch. Biochem. Biophys. 152 (1972)
265–271.
[28] N. Appaji Rao, R. Talwar, H.S. Savithri, Int. J. Biochem. Cell Biol. 32 (2000)
405–416.
[14] L. Schirch, A. Diller, J. Biol. Chem. 246 (1971) 3961–3966.
[15] R.J. Ulevitch, R.G. Kallen, Biochemistry 16 (1977) 5350–5354.
[16] K. Büttner, J. Bernhardt, C. Scharf, R. Schmid, U. Mäder, C. Eymann, H. Antel-
mann, A. Völker, U. Völker, M. Hecker, Electrophoresis 22 (2001) 2908–2935.
[17] J.X. Yan, A.T. Devenish, R. Wait, T. Stone, S. Lewis, S. Fowler, Proteomics 2 (2002)
1682–1698.
[29] A. Siglioccolo, F. Bossa, S. Pascarella, Int. J. Biol. Macromol. 46 (2010) 37–46.
[30] K.E. Jaeger, T. Eggert, A. Eipper, M.T. Reetz, Appl. Microbiol. Biotechnol. 55
(2001) 519–530.
[31] R.L. Blakley, Front. Biol. 13 (1969) 189–218.
[32] T. Hagishita, T. Yoshida, Y. Izumi, T. Mitsunaga, Biosci. Biotechnol. Biochem. 60
(1996) 1604–1607.
[18] S. Schaffer, B. Weil, V.D. Nguyen, G. Dongmann, K. Günther, M. Nickolaus, T.
Hermann, M. Bott, Electrophoresis 22 (2001) 4404–4422.
[19] A. Guillot, C. Gitton, P. Anglade, M.Y. Mistou, Proteomics 3 (2003) 337–354.
[33] P.H. Shen, H.J. Chao, C.J. Jiang, Z.D. Long, C.H. Wang, B. Wu, Appl. Biochem.
Biotechnol. 160 (2010) 740–750.
[34] Q. Lai, W. Li, Z. Shao, J. Bacteriol. 194 (2012) 6674.