Arabidopsis thaliana β-Glucosidases BGLU45 and BGLU46 hydrolyse monolignol glucosides

Article abstract of DOI:10.1016/j.phytochem.2006.05.022

In higher plants, β-glucosidases belonging to glycoside hydrolase (GH) Family 1 have been implicated in several fundamental processes including lignification. Phylogenetic analysis of Arabidopsis thaliana GH Family 1 has revealed that At1g61810 (BGLU45), At1g61820 (BGLU46), and At4g21760 (BGLU47) cluster with Pinus contorta coniferin β-glucosidase, leading to the hypothesis that their respective gene products may be involved in lignification by hydrolysing monolignol glucosides. To test this hypothesis, we cloned cDNAs encoding BGLU45 and BGLU46 and expressed them in Pichia pastoris. The recombinant enzymes were purified to apparent homogeneity by ammonium sulfate fractionation and hydrophobic interaction chromatography. Among natural substrates tested, BGLU45 exhibited narrow specificity toward the monolignol glucosides syringin (K_m, 5.1 mM), coniferin (K_m, 7 mM), and p-coumaryl glucoside, with relative hydrolytic rates of 100%, 87%, and 7%, respectively. BGLU46 exhibited broader substrate specificity, cleaving salicin (100%), p-coumaryl glucoside (71%; K_m, 2.2 mM), phenyl-β-d-glucoside (62%), coniferin (8%), syringin (6%), and arbutin (6%). Both enzymes also hydrolysed p- and o-nitrophenyl-β-d-glucosides. Using RT-PCR, we showed that BGLU45 and BGLU46 are expressed strongly in organs that are major sites of lignin deposition. In inflorescence stems, both genes display increasing levels of expression from apex to base, matching the known increase in lignification. BGLU45, but not BGLU46, is expressed in siliques, whereas only BGLU46 is expressed in roots. Taken together with recently described monolignol glucosyltransferases [Lim et al., J. Biol. Chem. (2001) 276, 4344-4349], our enzymological and molecular data support the possibility of a monolignol glucoside/β-glucosidase system in Arabidopsis lignification.

Full text of DOI:10.1016/j.phytochem.2006.05.022

PHYTOCHEMISTRY
Phytochemistry 67 (2006) 1651–1660
www.elsevier.com/locate/phytochem
Arabidopsis thaliana b-Glucosidases BGLU45 and BGLU46
hydrolyse monolignol glucosides
1
2
Luis L. Escamilla-Trevi n˜ o , Wei Chen , Marcella L. Card, Ming-Che Shih,
*
Chi-Lien Cheng, Jonathan E. Poulton
Department of Biological Sciences, The University of Iowa, 108 Biology Building, Iowa City, IA 52242, USA
Received 9 May 2006; accepted 15 May 2006
Available online 30 June 2006
Dedicated to Professor Rodney Croteau on the occasion of his 60th birthday.
Abstract
In higher plants, b-glucosidases belonging to glycoside hydrolase (GH) Family 1 have been implicated in several fundamental pro-
cesses including lignification. Phylogenetic analysis of Arabidopsis thaliana GH Family 1 has revealed that At1g61810 (BGLU45),
At1g61820 (BGLU46), and At4g21760 (BGLU47) cluster with Pinus contorta coniferin b-glucosidase, leading to the hypothesis that their
respective gene products may be involved in lignification by hydrolysing monolignol glucosides. To test this hypothesis, we cloned
cDNAs encoding BGLU45 and BGLU46 and expressed them in Pichia pastoris. The recombinant enzymes were purified to apparent
homogeneity by ammonium sulfate fractionation and hydrophobic interaction chromatography. Among natural substrates tested,
BGLU45 exhibited narrow specificity toward the monolignol glucosides syringin (K
glucoside, with relative hydrolytic rates of 100%, 87%, and 7%, respectively. BGLU46 exhibited broader substrate specificity, cleaving
salicin (100%), p-coumaryl glucoside (71%; K , 2.2 mM), phenyl-b-D-glucoside (62%), coniferin (8%), syringin (6%), and arbutin
6%). Both enzymes also hydrolysed p- and o-nitrophenyl-b-D-glucosides. Using RT-PCR, we showed that BGLU45 and BGLU46 are
m m
, 5.1 mM), coniferin (K , 7 mM), and p-coumaryl
m
(
expressed strongly in organs that are major sites of lignin deposition. In inflorescence stems, both genes display increasing levels of
expression from apex to base, matching the known increase in lignification. BGLU45, but not BGLU46, is expressed in siliques, whereas
only BGLU46 is expressed in roots. Taken together with recently described monolignol glucosyltransferases [Lim et al., J. Biol. Chem.
(
2001) 276, 4344–4349], our enzymological and molecular data support the possibility of a monolignol glucoside/b-glucosidase system in
Arabidopsis lignification.
2006 Elsevier Ltd. All rights reserved.
ꢀ
Keywords: Arabidopsis thaliana; Brassicaceae; Heterologous expression; Monolignol glucosides; b-Glucosidases; Pichia pastoris; Lignification
1
. Introduction
plants, including strengthening and water-proofing cell
walls, providing mechanical support for the plant body,
and contributing to defense against microbial attack (Boer-
jan et al., 2003). In angiosperms, this complex heteropoly-
mer is derived principally from the monolignols
p-coumaryl alcohol, coniferyl alcohol, and sinapyl alcohol
by dehydrogenative polymerization. Although the intracel-
lular biosynthesis of these lignin monomers is largely
understood (Anterola and Lewis, 2002; Humphreys and
Chapple, 2002; Boerjan et al., 2003; Nair et al., 2004), their
transport across the plasma membrane to sites of lignin
Accounting for almost one-third of the organic carbon
in the biosphere, lignin performs several functions in higher
*
Corresponding author. Tel.: +1 319 335 1322; fax: +1 319 335 1069.
E-mail address: jonathan-poulton@uiowa.edu (J.E. Poulton).
Present address: The Samuel Roberts Noble Foundation, 2510 Sam
1
Noble Parkway, Ardmore, OK 73401, USA.
2
Present address: Department of Biological Sciences, Fujian Agriculture
and Forestry University, Fuzhou City, Fujian Province 350002, China.
0
031-9422/$ - see front matter ꢀ 2006 Elsevier Ltd. All rights reserved.
doi:10.1016/j.phytochem.2006.05.022

1652
L.L. Escamilla-Trevi n˜ o et al. / Phytochemistry 67 (2006) 1651–1660
deposition within the apoplast remains to be elucidated. It
is generally believed that monolignols traverse the plasma
membrane via Golgi-mediated secretion or ABC transport-
ers (Samuels et al., 2002; Ehlting et al., 2005). Alterna-
tively, these monolignols might be glucosylated by
specific intracellular glucosyltransferases to their corre-
sponding 4-O-b-D-glucosides (i.e. p-coumaryl alcohol glu-
coside (CAG), coniferin, and syringin, respectively)
level, Dharmawardhana et al. (1999) reported the cloning
and heterologous expression of a cDNA encoding P. con-
torta xylem coniferin b-glucosidase. Belonging to glycoside
hydrolase (GH) Family 1 (Coutinho and Henrissat, 1999),
this hydrolase was active toward coniferin, syringin, and
the chromogenic substrates o-nitrophenyl-b-D-glucoside
(oNPGlc) and p-nitrophenyl-b-D-glucoside (pNPGlc).
With its genome completely sequenced (Arabidopsis
Genome Initiative, 2000), Arabidopsis thaliana represents
an excellent species with which to gain further information
about the potential involvement of a monolignol gluco-
side/b-glucosidase system in angiosperm lignification. While
Arabidopsis is not usually noted for monolignol glucoside
accumulation, coniferin and syringin accumulated in light-
grown primary and secondary roots (Hemm et al., 2004).
Furthermore, using a functional genomic approach, Lim
et al. (2001) showed that the genes UGT72E2 and UGT72E3
encode two UDP-Glc-dependent glucosyltransferases that
glucosylate sinapyl alcohol and coniferyl alcohol in vitro.
More recently, we reported that Arabidopsis GH Family 1
contains 48 members (Xu et al., 2004). Of these, 47 share a
common evolutionary origin and were assigned new gene
names (BGLU1–BGLU47), whereas the remaining family
member (sfr2) belongs to a distinct lineage. Interestingly,
our phylogenetic analysis indicated that BGLU45
(At1g61810), BGLU46 (At1g61820), and BGLU47
(At4g21760) cluster with the P. contorta b-glucosidase, sug-
gesting that these gene products may play a role in lignifica-
tion. To test this hypothesis, we expressed BGLU45 and
BGLU46 in the Pichia pastoris expression system in order
to analyze the substrate specificities of the corresponding
recombinant hydrolases. Additionally, we investigated the
organ-level expression of these genes by relative RT-PCR.
Both the expression patterns of BGLU45 and BGLU46
and the substrate specificities of their encoded hydrolases
are largely consistent with a role in Arabidopsis lignification.
(
Whetten et al., 1998). Serving as transport forms to the
cell exterior, these glucosides would be subsequently hydro-
lysed at lignification sites in the apoplast by specific mono-
lignol glucoside b-glucosidases. A transport mechanism
involving monolignol glucosylation is attractive, because,
by increasing the solubility and decreasing the reactivity
of monolignols, it would facilitate their export while pre-
venting their polymerization in undesirable locations.
Especially in the case of gymnosperms, considerable cor-
relative evidence has accumulated for the participation of
such a monolignol glucoside/b-glucosidase system in ligni-
fication. Monolignol glucosides have been isolated from
many gymnosperms and angiosperms, predominantly from
cambial tissues (for comprehensive list of references, see
Steeves et al., 2001). Pulse-labeling studies revealed that
coniferin is rapidly synthesized from radiolabeled L-phenyl-
alanine in spruce (Picea abies) seedlings and turns over
with a half-life of approximately 60 h (Marcinowski and
Grisebach, 1977). Coniferin is a lignin precursor in several
species (e.g. Brown, 1966; Kratzl et al., 1957; Terashima
et al., 1997; Fukushima, 2001), and both coniferin and
syringin stimulate lignification in different tissue cultures
(
Sarkanen and Ludwig, 1971). With respect to the enzy-
mology of glucosylation–deglycosylation, UDP-Glc-
dependent glucosyltransferases (EC 2.4.1.111) exhibiting
pronounced specificities toward monolignols have been
purified and characterized from Paul’s scarlet rose cell cul-
tures (Ibrahim and Grisebach, 1976), lignifying stem seg-
ments of Forsythia ovata (Ibrahim, 1977), spruce cambial
sap (Schmid and Grisebach, 1982), and Pinus banksiana
cambium (Savidge and F o¨ rster, 1998). Furthermore, in a
survey conducted by Ibrahim (1977), coniferyl alcohol glu-
cosyltransferase activity was detected in crude homoge-
nates of all gymnosperms tested; among angiosperms,
woody species exhibited higher enzyme activities than her-
baceous species. As for the hydrolysis of monolignol gluco-
sides, b-glucosidases (EC 3.2.1.126) showing specificity
toward these substrates have been characterized from both
gymnosperm and angiosperm sources, namely spruce (P.
abies) seedlings (Marcinowski and Grisebach, 1978), chick
pea (Cicer arietinum) cell suspension cultures and seedlings
2. Results and discussion
2.1. Heterologous expression of BGLU45 and BGLU46
Phylogenetic analysis of sequenced glycoside hydrolase 1
family members showed that the Arabidopsis proteins
BGLU45, BGLU46, and BGLU47 cluster with the P. con-
torta b-glucosidase that exhibits pronounced specificity
toward coniferin and syringin (Dharmawardhana et al.,
1995, 1999; Xu et al., 2004). Therefore, we hypothesized
that these enzymes might play a role in Arabidopsis lignin
biosynthesis by hydrolysing monolignol b-glucosides. To
test this hypothesis, our primary strategy was to express
two of these putative hydrolases (BGLU45 and BGLU46)
in an appropriate expression system, purify them to homo-
geneity, and assay their activities toward a spectrum of
different b-glucosidic substrates including monolignol b-
glucosides. Because our NetNGlyc predictions suggested
that these enzymes might be glycosylated in planta and
(
H o¨ sel et al., 1978; Surholt and H o¨ sel, 1981), soybean (Gly-
cine max) cell cultures, hypocotyls, and roots (H o¨ sel and
Todenhagen, 1980), and the differentiating xylem of P.
banksiana (Leinhos et al., 1994) and lodgepole pine (Pinus
contorta) (Dharmawardhana et al., 1995). In some cases
(
Marcinowski et al., 1979; Burmeister and H o¨ sel, 1981;
Samuels et al., 2002), their apoplastic location was demon-
strated by immunofluorescent techniques. At the molecular

L.L. Escamilla-Trevi n˜ o et al. / Phytochemistry 67 (2006) 1651–1660
1653
therefore unlikely to be expressed in active and soluble form
in Escherichia coli (Xu et al., 2004), we chose the P. pastoris
expression system for this task. The latter system has found
wide usage, because this yeast utilizes most of the post-
translational modification pathways typically associated
with higher eukaryotes and is easy to use (Cregg et al.,
fractionation and hydrophobic interaction chromatogra-
phy (HIC). Purification progress was monitored by SDS–
PAGE with Coomassie Blue staining and by assaying
protein content and b-glucosidase activity. These two steps
achieved 8.8-fold and 13.7-fold purification for BGLU45
(Table 1) and BGLU46 (Table 2), respectively, and con-
firmed the usefulness of HIC for b-glucosidase purification
(e.g. Cicek et al., 2000; Czjzek et al., 2001). However, both
purified hydrolases appeared on SDS–PAGE gels as
smears rather than sharp bands (Fig. 1). Peptide fingerprint
analysis verified that different regions of each smear repre-
sented the same polypeptide but with different degrees of
glycosylation (data not shown). Such differential glycosyla-
tion has been reported for several other heterologous pro-
teins expressed in P. pastoris (Tschopp et al., 1987; Scorer
et al., 1993; Montesino et al., 1998).
1
993). Furthermore, it has been successfully employed to
express several b-glucosidases, including the Prunus serotina
cyanogenic b-glucosidases amygdalin hydrolase and pruna-
sin hydrolase (Zhou et al., 2002), Brassica napus myrosinase
(
Hartel and Brandt, 2002), and the Arabidopsis b-mannosi-
dase/b-glucosidase BGLU44 (Xu et al., 2004).
cDNAs encoding the mature proteins (i.e. excluding any
signal peptide, as predicted by SignalP V2.0) were cloned into
the expression vector pPICZaB. This vector encodes the Sac-
charomyces cerevisiae a-factor signal sequence allowing
secretion of the desired recombinant protein into the culture
medium. It also encodes the zeocin resistance selection mar-
ker, permitting selection of multicopy transformants. After
integrating the constructs into the P. pastoris genome using
electroporation as transformation method, we tested the
expression levels of approximately 20 individual P. pastoris
transformants for each gene by assaying the b-glucosidase
activities of supernatants of 3–4-day-old, methanol-induced
cultures toward the chromogenic substrates pNPGlc or
oNPGlc. Culture supernatants from control transformants
2.3. Analysis of substrate specificities of recombinant
BGLU45 and BGLU46
The substrate specificities of the purified recombinant
BGLU45 and BGLU46 were investigated with the ultimate
goal of identifying the endogenous substrates of these
(
containing the vector without insert) were assayed in paral-
lel, because endogenous glycosidases are co-secreted into the
culture medium. One of these contaminating P. pastoris
hydrolases, an exo-1,3-b-glucanase (GH Family 5) that
cleaves pNPGlc, has been purified to homogeneity and char-
acterized (Xu et al., 2006). Those BGLU45 and BGLU46
transformants exhibiting highest b-glucosidase activities
were chosen for culture scale-up and enzyme purification.
2.2. Purification and characterization of recombinant
BGLU45 and BGLU46
Fig. 1. SDS–PAGE analysis of purified recombinant BGLU45 and
BGLU46. For each enzyme, lane M indicates the position of protein
markers, while lanes 1–3 show three successive fractions (3–5 lg protein/
Recombinant BGLU45 and BGLU46 were purified
from their respective culture supernatants by (NH ) SO
4
lane) from the Toyopearl Butyl-650M linear 1–0 M (NH
Resolved polypeptides were stained with Coomassie Blue.
4 2 4
) SO gradient.
4
2
Table 1
Purification of recombinant BGLU45 from Pichia pastoris culture supernatant
a
Purification step
Protein (mg)
Activity (units)
Specific activity (units/mg)
Purification (fold)
Recovery (%)
Culture supernatant
29
2.83
0.156
119.5
43.2
5.6
4.1
15.3
35.9
1
3.7
8.8
100
36.2
4.7
5
0–70% (NH
4
)
2
SO
4
Toyopearl Butyl-650M
a
One unit (nkat) of enzyme activity is defined as 1 nmol of liberated ONP/s.
Table 2
Purification of recombinant BGLU46 from Pichia pastoris culture supernatant
a
Purification step
Protein (mg)
Activity (units)
Specific activity (units/mg)
Purification (fold)
Protein yield (%)
Culture supernatant
25.5
7.22
0.87
1116
909
521
43.8
126
599
1
2.9
13.7
100
81.5
46.7
4
0–60% (NH
4
)
2
SO
4
Toyopearl Butyl-650M
a
One unit (nkat) of enzyme activity is defined as 1 nmol of liberated PNP/s.

1654
L.L. Escamilla-Trevi n˜ o et al. / Phytochemistry 67 (2006) 1651–1660
enzymes and thereby their biological roles in vivo. First,
the glycone and linkage specificities of BGLU45 and
BGLU46 were examined by assaying their activities toward
several b- and a-linked p-nitrophenyl (pNP)-sugars (Table
Table 4
Substrate specificity of recombinant BGLU45 and BGLU46 toward
selected natural and non-chromogenic substrates
Substrate
BGLU45
relative
activity (%)
BGLU46
relative
activity (%)
3
). As expected, both enzymes showed nearly absolute pref-
erence for the glycone glucose. The sole exception was the
hydrolysis of pNPGal by BGLU46 at 21% of the rate of
pNPGlc degradation. pNPGal hydrolysis by plant b-gluco-
sidases has been frequently noted (e.g. H o¨ sel et al., 1978;
Opassiri et al., 2004; Xu et al., 2004). Both recombinant
enzymes exhibited negligible activity toward pNP-a-D-
glucopyranoside and pNP 1-thio-b-D-glucopyranoside,
reflecting a requirement for a b-linked O-glycosyl moiety
in their substrates. Table 3 also shows that, among chro-
mogenic substrates tested, oNPGlc was most rapidly
hydrolysed by BGLU45 and BGLU46 with relative rates
of 619% and 449%, respectively, of the rate of pNPGlc deg-
radation. pNPGlc was also a substrate for other monolig-
nol glucoside b-glucosidases, and, where tested, oNPGlc
was hydrolysed 2–7-fold faster than pNPGlc (Marcinowski
and Grisebach, 1978; Surholt and H o¨ sel, 1981; Leinhos
et al., 1994; Dharmawardhana et al., 1995).
Syringin
Coniferin
p-Coumaryl alcohol glucoside
Salicin
(R)-Amygdalin
Sinigrin
100
87
6.9
0
0
0
0
0
0
0
6
8
71
100
5
0
9
62
6
0
4
-Methylumbelliferyl b-D-glucoside
Phenyl b-D-glucoside
Arbutin (hydroquinone b-D-glucoside)
Methyl b-D-glucoside
D(+)Cellobiose
b-Gentiobiose
D(+)Maltose
0
0
0
0
0
0
0
0
Sucrose
The purified hydrolases were incubated at their optimum pH (pH 5.5) with
potential substrates provided at 10 mM final concentration. The rate of
glucose production was assayed by the Megazyme glucose assay procedure
in conjunction with a standard curve. For BGLU45, reaction rates are
expressed as
a percentage of the rate of syringin hydrolysis
(
100% = 72 nkat/mg protein). For BGLU46, reaction rates are expressed
To probe the aglycone specificities of the recombinant
enzymes, their activities were tested toward a collection
of b-glucosides largely of plant origin (Table 4). BGLU45
exhibited absolute specificity for the three monolignol glu-
cosides, with syringin being most rapidly hydrolysed
as a percentage of the rate of salicin hydrolysis (100% = 328 nkat/mg
protein).
substrate preference reflects the composition of dicotyle-
donous angiosperm lignins, which consist principally of S
and G units (derived from sinapyl and coniferyl alcohols,
respectively) with traces of H units (derived from p-coum-
aryl alcohol) (Boerjan et al., 2003). Literature Km values
for monolignol glucosides range widely between 0.18 mM
and 5 mM, so the observed BGLU45 Km values for conif-
erin (7 mM) and syringin (5.1 mM) lie at the high end of
that range. The close similarity in enzymatic properties
between BGLU45 and other known monolignol glucoside
b-glucosidases, together with the remarkable absolute spec-
ificity of BGLU45 toward monolignol glucosides among
natural substrates tested, strongly supports our hypothesis
that this enzyme plays a role in Arabidopsis lignification.
When tested against the same spectrum of potential b-
glucosidic substrates, BGLU46 exhibited broader specificity
than BGLU45, showing significant activity toward the phe-
nolic glucosides salicin (328 nkat/mg protein = 100%),
CAG (71%), phenyl-b-D-glucoside (62%), coniferin (8%),
syringin (6%), and arbutin (6%) (Table 4). However, the
enzyme failed to hydrolyse the glucosinolate sinigrin,
methyl-b-D-glucoside, and the disaccharides cellobiose, b-
gentiobiose, maltose, and sucrose. The Km for CAG was
2.2 mM. Given the breadth of BGLU46 substrate specific-
ity, it is currently difficult to identify unequivocally the bio-
logical role(s) played by this enzyme. However, several
possibilities should be considered. First, BGLU46 may play
a role in lignification. By its preference for CAG over syrin-
gin and coniferin, BGLU46 is unique among hydrolases
reported to cleave monolignol glucosides, and it is tempting
to speculate that CAG hydrolysis is the principal role for this
(
72 nkat/mg protein = 100%) followed by coniferin (87%)
and CAG (7%). No activity was detectable toward any
other natural substrate tested. High activity toward syrin-
gin and coniferin with relatively poor utilization of CAG
is a hallmark of known monolignol glucoside b-glucosi-
dases (Marcinowski and Grisebach, 1978; H o¨ sel et al.,
1
1
978; Surholt and H o¨ sel, 1981; H o¨ sel and Todenhagen,
980; Dharmawardhana et al., 1995). Furthermore, this
Table 3
Glycone and linkage specificities of recombinant Arabidopsis BGLU45
and BGLU46
Substrate
BGLU45
relative
BGLU46
relative
activity (%)
activity (%)
p-Nitrophenyl b-D-glucopyranoside
p-Nitrophenyl 1-thio-b-D-glucopyranoside
p-Nitrophenyl a-D-glucopyranoside
p-Nitrophenyl N-acetyl-b-D-glucosaminide
p-Nitrophenyl b-D-galactopyranoside
p-Nitrophenyl b-D-mannopyranoside
p-Nitrophenyl b-D-xylopyranoside
p-Nitrophenyl b-L-fucopyranoside
p-Nitrophenyl b-L-arabinopyranoside
o-Nitrophenyl b-D-glucopyranoside
100
0
100
0
0
0
0.1
0
0.4
0
21
0
0
2
0
0
0
0
619
449
The purified hydrolases were incubated at their optimum pH (pH 5.5) with
potential substrates provided at 10 mM final concentration. Enzyme
activity was determined by measuring the rate of PNP (or ONP) pro-
duction spectrophotometrically at 400 nm with subsequent use of standard
curves. Reaction rates are expressed here as a percentage of that observed
with PNPG (BGLU45, 100% = 5 nkat/mg protein; BGLU46, 100% =
2
89 nkat/mg protein).

L.L. Escamilla-Trevi n˜ o et al. / Phytochemistry 67 (2006) 1651–1660
1655
enzyme in vivo. If true, BGLU46 would be a key player in
the biosynthesis of H units, which are present at low levels
in Arabidopsis lignin (Dharmawardhana et al., 1992; Franke
et al., 2002; Goujon et al., 2003a; Rogers et al., 2005a) and
are usually laid down preferentially in early stages of second-
ary wall formation (Boerjan et al., 2003). Thus, this enzyme
could functionally complement BGLU45, which prefers
syringin and coniferin over CAG. However, one should keep
in mind that, although BGLU46’s low relative activities
toward syringin and coniferin may lead one to discount
them as significant substrates in vivo, the hydrolytic rates
toward these substrates (20–26 nkat/mg protein) are of the
same order of magnitude on a per mg protein basis as those
seen with BGLU45 for the same monolignol glucosides. Sec-
ondly, it is possible that BGLU46 is involved in arbutin and/
or salicin metabolism. The fact that these glucosides have
not yet been demonstrated in Arabidopsis should not be
regarded as conclusive proof of their absence. Indeed, two
lines of evidence suggest that arbutin or related compounds
may exist in Arabidopsis: (i) homologs of the plant glucosyl-
transferase arbutin synthase exist in this species (At1g01420
and At4g01070; Hefner et al., 2002), and (ii) both arbutin
and salicin are transported by the Arabidopsis sucrose trans-
porter AtSUC2 (expressed in Xenopus oocytes) with K0.5
values similar to that of sucrose (Chandran et al., 2003).
Finally, BGLU46 may play a role in the biosynthesis of
the polyphenolic domain of suberin. In Arabidopsis, this
polymer is found in the endodermis and periderm of roots
1992; Turner and Somerville, 1997; Zhong et al., 1997;
Rogers and Campbell, 2004; Ehlting et al., 2005; Rogers
et al., 2005b). In mature plants, inflorescence stems consti-
tute the most lignified organ, with the extent of lignification
increasing basipetally as the xylem vessels and interfascicu-
lar fibers become progressively more differentiated. Typical
of herbaceous dicotyledonous angiosperms, Arabidopsis
synthesizes guaiacyl-rich, syringyl-guaiacyl lignin, but the
relative proportions of these units vary according to devel-
opmental stage and tissue type (Chapple et al., 1992; Meyer
et al., 1998). For example, the syringyl lignin content of the
rachis increases from <6 mol% in apical regions to
>26 mol% near its base. Furthermore, histochemical stain-
ing of mature stems indicated that xylem elements of the
vascular bundles contain only guaiacyl lignin, whereas
the adjacent interfascicular fibers contain large amounts
of syringyl units. Lignin is also found to lesser extent in
the xylem of Arabidopsis roots, hypocotyls, and leaves
(Dharmawardhana et al., 1992). This polymer plays a key
role in fruit dehiscence and seed dispersal in the lignified
valve and margin layers of the siliques (Spence et al.,
1996; Liljegren et al., 2000; Liljegren et al., 2004). Finally,
under certain growth conditions, a vascular cambium may
form in the hypocotyl resulting in extensive amounts of lig-
nified secondary xylem fibers and vessel elements (Chaffey
et al., 2002).
Several recent studies have demonstrated that the
expression of Arabidopsis lignin biosynthetic genes is
strongly correlated with sites of lignin deposition (Goujon
et al., 2003b; Raes et al., 2003; Ehlting et al., 2005). Unfor-
tunately, BGLU45 and BGLU46 were not included in those
investigations. If these two genes indeed participate in lig-
nification, one might predict that their expression patterns
would similarly reflect those of lignin deposition. To test
this prediction, we used RT-PCR methodology with
gene-specific primers to measure the relative steady-state
mRNA levels of BGLU45 and BGLU46 in various Arabid-
opsis organs. Each inflorescence stem was divided into
three regions reflecting different degrees of lignification.
As Fig. 2 shows, BGLU45 and BGLU46 were expressed
in stems with increasing levels of expression from apex to
(
Franke et al., 2005), an organ in which BGLU46 is highly
expressed (Schmid et al., 2005; also, see below).
In addition to the three main monolignols, lignin may
contain small amounts of other monomers, such as coniferyl
aldehyde and sinapyl aldehyde (Boerjan et al., 2003; Kim
et al., 2003). Interestingly, these hydroxycinnamyl
aldehydes, which also serve as precursors of ferulic acid
and sinapic acid (Nair et al., 2004), are glycosylated
in vitro to their 4-O-glucosides by Arabidopsis glucos-
yltransferases UGT72E1 and UGT72E2 but not by
UGT72E3 (Lim et al., 2005). Whether these glucosides serve
as transport forms to the apoplast is unknown. In this con-
text, it would have been informative to test these compounds
as substrates for recombinant BGLU45 and BGLU46, but
unfortunately they were not available for our studies.
To determine whether variation in protein glycosylation
might alter the specific activity and/or the substrate speci-
ficity of these hydrolases, purified BGLU45 and BGLU46
with different glycosylation degrees (i.e. different HIC frac-
tions) were tested against several substrates. No differences
in the specific activity or substrate specificity were observed
between fractions (data not shown), from which we con-
clude that the glycosylation patterns conferred by P. pasto-
ris cells do not affect enzyme activity.
Fig. 2. Relative RT-PCR analysis of BGLU45 and BGLU46 expression
patterns. Lane 1, light-grown roots; lane 2, dark-grown roots; lane 3,
leaves; lane 4, siliques; lane 5, flowers; lane 6, stems (top); lane 7, stems
2
.4. Organ-level expression of BGLU45 and BGLU46 genes
(
middle); lane 8, stems (bottom). In each lane, constitutive bATPase gene
expression (upper band, 350 bp), target gene expression (lower band:
BGLU45, 200 bp; BGLU46, 236 bp). The numbers under individual lanes
indicate the relative intensities of the target bands (see Section 4).
The localization and timing of lignin deposition in A.
thaliana have been well documented (e.g. Chapple et al.,

1656
L.L. Escamilla-Trevi n˜ o et al. / Phytochemistry 67 (2006) 1651–1660
base. For BGLU45, the relative expression levels in the top,
4. Experimental
middle, and basal sections were non-detectable, 1.0, and
1
.1, respectively; for BGLU46, they were 1.3, 3.6, and
4.1. Plant materials and growth conditions
1
6.6, respectively. Correlating with the increase of lignifica-
tion toward the base of the rachis (Meyer et al., 1998), the
BGLU45 and BGLU46 expression patterns support our
hypothesis that these genes participate in lignification. In
roots and siliques, BGLU45 and BGLU46 exhibit organ-
specific expression. Whereas BGLU45 expression was not
detectable in roots, the BGLU46 gene expressed strongly
in both light-exposed and dark-grown root cultures. In
contrast, BGLU45, but not BGLU46, was expressed in
the siliques, where it may be involved in lignification of
the aforementioned lignified valve and margin layers of this
organ (Spence et al., 1996). Surprisingly, we detected no
expression of either gene in rosette leaves or flowers,
despite the presence of xylem elements in these organs. This
unexpected finding raises the questions whether BGLU45
and BGLU46 expression lies below the level of detection
in our analyses or whether lignification in these organs
involves other members of Arabidopsis GH Family 1. It
should be noted that our expression data are supported
by the recently reported gene expression map of Arabidop-
sis development, which showed that BGLU45 was mainly
expressed in stems and seeds, whereas BGLU46 was mostly
expressed in the roots and stems (Schmid et al., 2005).
A. thaliana ecotype Columbia seeds were treated for 3
days with 10 mM KNO at 4 ꢁC in the dark before being
3
sown in sterilized Jiffy-mix Plus (Jiffy Products of America,
Batavia, IL):perlite (3:1 (v/v)). Seedlings were grown at
20 ꢁC under continuous cool-white fluorescent light
ꢀ2
ꢀ1
(100 lmol m
s ). At appropriate times, rosette leaves,
flowers, stems, and siliques were harvested into liquid
nitrogen and stored at ꢀ80 ꢁC. To obtain root cultures,
seeds were sterilized using a combination of washes with
70% (v/v) ethanol, 15% (v/v) sodium hypochlorite, and
sterile water before receiving cold-dark treatment for 72 h
in liquid culture medium (MS + 1% (w/v) sucrose). Subse-
quently, the seedlings were grown with continuous agita-
tion (100 rpm) for 20 days at room temperature under
continuous light or in darkness.
4.2. Biochemicals and chromatography materials
Toyopearl Butyl-650M was obtained from Tosoh Bio-
science (Montgomeryville, PA), and glycosidic substrates
were purchased from Sigma (St. Louis, MO).
4.3. Isolation and sequencing of cDNAs encoding BGLU45
and BGLU46
3
. Conclusions
Total RNA was isolated from rosette shoots using the
Trizol Reagent (Gibco-BRL, Cleveland) following manu-
facturer’s instructions. Subsequently, poly(A ) RNA was
Several lines of evidence support the involvement of a
+
monolignol glucoside/b-glucosidase system in Arabidopsis
lignification, including: (i) the demonstration of UDP-
Glc-dependent glucosyltransferases (UGT72E2 and
UGT72E3) that glucosylate the monolignols coniferyl alco-
hol and sinapyl alcohol (Lim et al., 2001), (ii) the hydrolysis
of monolignol glucosides by BGLU45 and BGLU46;
among natural substrates tested, monolignol glucosides
are the sole substrates for BGLU45, and, although
BGLU46 showed broader substrate specificity, it readily
cleaved CAG and, to a lesser extent, coniferin and syringin,
prepared by the Oligotex mRNA Mini Kit (Qiagen Inc.,
Valencia, CA) and used in double-stranded cDNA synthe-
sis with the SMART cDNA Library Construction Kit (BD
Biosciences Clontech, Palo Alto, CA). These cDNA popu-
lations served as templates in PCR amplification of regions
encoding the mature b-glucosidases; such regions were
based on GenBank-predicted sequences and amended for
likely signal sequences. PCR primers were designed to
include appropriate restriction sites to facilitate subcloning
and, where required, additional bases to maintain the
desired open reading frame (Table 5). Amplification was
carried out using the KOD HiFi DNA Polymerase (Nova-
gen, Madison, WI) according to the supplier’s recommen-
dations. For sequence verification, PCR products were
cloned into the pCR2.1-TOPO vector (Invitrogen, Carls-
bad, CA) for transformation into E. coli TOP10 competent
cells (Invitrogen). Prior to cloning, blunt-ended PCR prod-
ucts resulting from KOD HiFi DNA Polymerase amplifica-
tion reactions were incubated for 30 min at 70 ꢁC with 5
units of Taq DNA polymerase (Promega) and 0.2 mM
dATP to add overhang adenine nucleotides. Plasmids were
isolated using the Wizard Plus Minipreps DNA Purifica-
tion System (Promega), and their inserts were sequenced
in both directions at the Center for Comparative Genomics
(University of Iowa) using a 373S Fluorescent Automated
(
iii) the predicted targeting of these hydrolases to the apop-
last (Xu et al., 2004), and (iv) the demonstration of
BGLU45 and BGLU46 expression in Arabidopsis organs
that are major sites of lignin deposition. Future studies
might utilize in situ hybridization to investigate whether
BGLU45 and BGLU46 are expressed solely in lignifying
cells within individual organs or whether, like the P. abies
coniferin b-glucosidase (Marcinowski et al., 1979), they
exhibit more generalized expression patterns. Immunocyto-
chemical approaches could be used to confirm the pre-
dicted apoplastic location of these hydrolases. Finally,
our current data does not allow us to conclude whether
monolignol glucosides are obligatory lignin precursors in
Arabidopsis. This issue might be addressed by investigating
to what extent lignification is affected in single and double
BGLU45 and BGLU46 T-DNA insertion lines.

L.L. Escamilla-Trevi n˜ o et al. / Phytochemistry 67 (2006) 1651–1660
1657
Table 5
Sequences of primers used for cloning and RT-PCR
0
0
Gene name
Purpose
Sequence (5 to 3 )
BGLU45
Cloning
RT-PCR
Cloning
RT-PCR
RT-PCR
F: CCCGGGTCGTCATCAAAGTTCTTCGAAG
R: CCGCGGTTAATAATTATCTACGATATCTCTTCG
F: TGGTCGTCATCAAAGTTCTTC
R: GCTCTATCTGCATTGTTCTTG
BGLU46
F: CTGCAGGAACTTCAGATGATTCATCTCCATTTC
R: CCGCGGTTATTTATCTATTTGATCTTCTATATTC
F: TTGCCAACTTTGCAATTCTG
R: ATGTCTCCATTGCTTCCATC
bATPase
F: GATCATGACATCTCTCGAGG
R: TGGTAAGGAGCAAGGAGATC
F, forward primer; R, reverse primer. Underlined nucleotides indicate restriction sites.
Sequencer (Perkin–Elmer Applied Biosystems, Foster City,
CA).
and tested for b-glucosidase activity using oNPGlc and
coniferin (BGLU45) or pNPGlc (BGLU46) as substrates.
In addition to undertaking the usual boiled-enzyme and
no-substrate controls, culture supernatants of cells trans-
formed with empty vector (pPICZaB) were also assayed
to assess endogenous b-glucosidase levels.
4.4. Construction of expression vectors and transformation
of P. pastoris
After sequence confirmation, inserts encoding the
mature b-glucosidases were excised from their respective
TOPO vectors by appropriate restriction enzymes, gel puri-
fied using the GFX PCR DNA and Gel Band Purification
Kit (Amersham Biosciences), and cloned into the P. pasto-
ris expression vector pPICZaB (Invitrogen). Subsequent
transformation of competent E. coli TOP10 cells yielded
zeocin-resistant transformants, which were selected on
low salt Luria–Bertani plates containing 25 lg/ml zeocin
and verified by PCR screening. Desired plasmids were iso-
lated using the Wizard Plus Minipreps DNA Purification
System (Promega) and linearized by PmeI digestion,
thereby allowing integration of the vector DNA into the
Pichia chromosome by homologous recombination.
Approximately 10 lg of linearized plasmid DNA were used
to transform P. pastoris X-33 host cells (Invitrogen) by
electroporation following supplier’s recommendations
using a Bio-Rad Gene Pulser (conditions: 1.5 kV, 25 lF,
4.5. Expression and purification of recombinant BGLU45 in
P. pastoris
A single colony was selected to inoculate 50 ml of
BMGY medium containing 100 lg/ml zeocin. This starter
culture was grown in a shaking incubator (275 rpm) at
30 ꢁC, until the OD600 reached 16. Subsequently, 5 ml of
this culture was used to inoculate 400 ml of BMGY that
was incubated in a shaking incubator (225 rpm) at 30 ꢁC,
until the OD
reached 15–20 (12–16 h). Cells were col-
00
6
lected by centrifugation, washed with sterile H O, and
2
resuspended in BMMY (400 ml) supplemented with 1%
(w/v) of casamino acids containing 0.75% (v/v) methanol.
The culture was incubated at 30 ꢁC for 72 h in 2.8-liter
Erlenmeyer flasks with addition of methanol to the same
final concentration every 24 h. After removal of cells by
centrifugation, recombinant BGLU45 was purified at
4 ꢁC from 405 ml of the 72-h culture supernatant using b-
glucosidase activity toward oNPGlc or coniferin to moni-
tor purification progress. Ammonium sulfate fractionation
was conducted according to standard methods to obtain
the following saturation fractions: 0–50%, 50–70%, and
70–100%. Pellets were redissolved in HIC buffer (20 mM
His–HCl buffer, pH 5.5). The 50–70% fraction, which
exhibited the highest b-glucosidase activity was diluted
twice with 2 M (NH ) SO and applied to a Toyopearl
200 X). Transformants were then cultured at 30 ꢁC for
2–4 days on yeast extract peptone dextrose plates contain-
ing 100, 500, or 1000 lg/ml zeocin.
To identify transformants exhibiting highest b-glucosi-
dase activity, 10–20 individual Pichia colonies for each
gene (preferring the transformants obtained from the high-
est zeocin concentration plates) were cultured for 24 h in a
rollodrum incubator (50 rpm) at 30 ꢁC in buffered glycerol-
complex medium (BMGY). Cells were collected by centri-
fugation and resuspended in buffered methanol-complex
medium (BMMY) containing 0.5% MeOH (v/v) to induce
b-glucosidase expression. Cultures were sampled at 24, 48,
4
2
4
Butyl-650 M column (8 · 1.5 cm) pre-equilibrated with
HIC buffer containing 1 M (NH ) SO . After extensive
4
2
4
washing with pre-equilibration buffer, bound proteins were
eluted with a linear 1–0 M (NH ) SO gradient (150 ml,
7
2, and 96 h of expression. After removing cells by centri-
4
2
4
fugation, the supernatants were analyzed by SDS–PAGE
total volume) in HIC buffer.

1658
L.L. Escamilla-Trevi n˜ o et al. / Phytochemistry 67 (2006) 1651–1660
4.6. Expression and purification of recombinant BGLU46 in
P. pastoris
a range of a- and b-linked pNP-sugars (10 mM final con-
centration). To determine hydrolase activity toward non-
chromogenic substrates, these enzymes were incubated
for 30 or 60 min at 30 ꢁC in 100-ll assays that contained
10 mM substrate and 100 mM sodium acetate buffer (pH
5.5). After terminating the reaction by boiling for 2 min,
liberated glucose was determined by the glucose oxidase
procedure (Megazyme International Ireland Ltd.) in con-
junction with a standard curve. All assays were performed
in duplicate or triplicate under conditions that ensured lin-
earity with respect to both time and enzyme concentration.
A single colony was selected to inoculate BMGY med-
ium (3 ml) containing 100 lg/ml zeocin and incubated for
4 h in a rollodrum incubator (50 rpm) at 30 ꢁC. An ali-
2
quot (1 ml) was taken to inoculate 100 ml of BMGY, which
was held in a shaking incubator (275 rpm) at 30 ꢁC until
the OD600 reached 15–20. After collection of cells by centri-
fugation, they were washed with sterile water, resuspended
in BMMY (100 ml) containing 0.75% (v/v) MeOH, and
incubated at 30 ꢁC for 48 h in 1-liter Erlenmeyer flasks with
addition of methanol to the same final concentration every
4.10. RT-PCR analysis of BGLU45 and BGLU46 expression
2
4 h. After removal of cells by centrifugation, recombinant
BGLU46 was purified at 4 ꢁC from 170 ml of the 48-h cul-
ture supernatant, monitoring purification progress by
assaying b-glucosidase activity toward oNPGlc. Ammo-
nium sulfate fractionation was conducted according to
standard methods to obtain the 40–60% fraction, which
was subjected to HIC as described for BGLU45
purification.
Total RNA was extracted from various Arabidopsis
organs using the Trizol method (Invitrogen, Carlsbad,
CA). Subsequently, 2 lg of RNA was reverse transcribed
using N random primers and M-MuLV reverse transcrip-
9
tase (New England Biolabs, MA). The PCRs (25 ll, total
volume) contained 0.5 lM gene-specific primers, 0.2 mM
each of dNTPs, 1.5 units of Taq DNA polymerase (New
England Biolabs, MA), and buffer supplied with the
enzyme. Gene-specific primers were designed using the Pri-
mer3 program (http://frodo.wi.mit.edu/cgi-bin/primer3/
primer3_www.cgi). Products were separated on 2% (w/v)
agarose gels and visualized under UV light after ethidium
bromide staining. The control gene used was bATPase
(At5g08680). The intensities of the amplified product bands
were determined using the program ImageJ 1.32 (NIH).
The value of the target band in each line was divided by
the value of the control band, and the lowest value among
these ratios was set to unity.
4
.7. Protein methodology
Protein samples were fractionated on 12% (w/v) SDS–
polyacrylamide gels according to Laemmli (1970) and visu-
alized by staining with Coomassie Brilliant Blue R-250
(
Sigma). Protein determination was performed using a pro-
tein assay kit (Bio-Rad Laboratories) with bovine serum
albumin serving as standard.
4.8. Verification of identity of recombinant BGLU45 and
BGLU46
Acknowledgments
To verify their authenticity, purified recombinant
BGLU45 and BGLU46 proteins were digested in excised
gel bands with trypsin (Promega), and the resulting prote-
olytic fragments were analyzed by MALDI-TOF mass
spectrometry using a Bruker Daltonics Biflex III mass spec-
trometer at the Molecular Analysis Facility of the Univer-
sity of Iowa. The search engine Mascot (Matrix Science
Ltd.) was used to match the peptide mass fingerprint data
with potential candidates in the protein databases.
We are grateful to Drs. Norman G. Lewis and Laurence
B. Davin (Washington State University) for their generous
gifts of monolignol glucosides. We acknowledge the expert
technical assistance of the Center for Comparative Genom-
ics (Department of Biological Sciences) and the Molecular
Analysis Facility at the University of Iowa. This work was
supported by the Arabidopsis 2010 Program of the
National Science Foundation (MCB-0114666).
4
.9. BGLU45 and BGLU46 enzyme assays
References
During enzyme purification, b-glucosidase activity was
determined by measuring the rate of nitrophenol liberation
from oNPGlc (BGLU45) or pNPGlc (BGLU46) in 250-ll
assays containing 10 mM glucoside, 100 mM sodium ace-
tate buffer, pH 5.5 (pH optimum for both hydrolases),
and enzyme. After incubation at 30 ꢁC for 30 or 60 min,
reactions were terminated by adding 1 ml of 0.47 M
Na CO , and the released o- or p-nitrophenol was deter-
mined spectrophotometrically at 400 nm in conjunction
with a standard curve. The sugar and linkage specificities
of purified BGLU45 and BGLU46 were investigated using
Anterola, A.M., Lewis, N.G., 2002. Trends in lignification: a comprehen-
sive analysis of the effects of genetic manipulations/mutations on
lignification and vascular integrity. Phytochemistry 61, 221–294.
Arabidopsis Genome Initiative, 2000. Analysis of the genome sequence of
the flowering plant Arabidopsis thaliana. Nature 408, 796–815.
Boerjan, W., Ralph, J., Baucher, M., 2003. Lignin biosynthesis. Annu.
Rev. Plant Biol. 54, 519–546.
Brown, S.A., 1966. Lignins. Annu. Rev. Plant Physiol. 17, 223–244.
Burmeister, G., H o¨ sel, W., 1981. Immunohistochemical localization of b-
glucosidases in lignin and isoflavone metabolism in Cicer arietinum L.
seedlings. Planta 152, 578–586.
2
3

L.L. Escamilla-Trevi n˜ o et al. / Phytochemistry 67 (2006) 1651–1660
1659
Chaffey, N., Cholewa, E., Regan, S., Sundberg, B., 2002. Secondary xylem
development in Arabidopsis: a model for wood formation. Physiol.
Plantarum 114, 594–600.
Chandran, D., Reinders, A., Ward, J.M., 2003. Substrate specificity of the
Arabidopsis thaliana sucrose transporter AtSUC2. J. Biol. Chem. 278,
pea (Cicer arietinum L.) cell suspension cultures. Eur. J. Biochem. 84,
487–492.
H o¨ sel, W., Todenhagen, R., 1980. Characterization of a beta-glucosidase
from Glycine max which hydrolyses coniferin and syringin. Phyto-
chemistry 19, 1349–1353.
4
4320–44325.
Humphreys, J.M., Chapple, C., 2002. Rewriting the lignin roadmap. Curr.
Opin. Plant Biol. 5, 224–229.
Ibrahim, R.K., 1977. Glucosylation of lignin precursors by uridine
diphosphate glucose: coniferyl alcohol glucosyltransferase in higher
plants. Z. Pflanzenphysiol. 85, 253–262.
Ibrahim, R.K., Grisebach, H., 1976. Purification and properties of UDP-
glucose:coniferyl alcohol glucosyltransferase from suspension cultures
of Paul’s scarlet rose. Arch. Biochem. Biophys. 176, 700–708.
Kim, H., Ralph, J., Lu, F., Ralph, S.A., Boudet, A.-M., MacKay, J.J.,
Sederoff, R.R., Ito, T., Kawai, S., Ohashi, H., Higuchi, T., 2003. NMR
analysis of lignins in CAD-deficient plants. Part 1. Incorporation of
hydroxycinnamaldehydes and hydroxybenzaldehydes into lignins. Org.
Biomol. Chem. 1, 268–281.
Chapple, C.C., Vogt, T., Ellis, B.L., Somerville, C.R., 1992. An Arabid-
opsis mutant defective in the general phenylpropanoid pathway. Plant
Cell 4, 1413–1424.
Cicek, M.D., Blanchard, J., Bevan, D.R., Esen, A., 2000. The aglycone
specificity determining sites are different in 2,4-dihydroxy-7-methoxy-
1
,4-benzoxazin-3-one (DIMBOA)-glucosidase (maize b-glucosidase)
and dhurrinase (sorghum b-glucosidase). J. Biol. Chem. 275, 20002–
0011.
2
Coutinho, P.M., Henrissat, B., 1999. Carbohydrate-Active Enzymes
server at URL: http://afmb.cnrs-mrs.fr/CAZY/.
Cregg, J.M., Vedvick, T.S., Raschke, W.C., 1993. Recent advances in
expression of foreign genes in Pichia pastoris. Biotechnology 11, 905–
¨
910.
Kratzl, K., Billek, G., Klein, E., Buchtela, L., 1957. Uber das Verhalten
Czjzek, M., Cicek, M., Zamboni, V., Burmeister, W.P., Bevan, D.R.,
Henrissat, B., Esen, A., 2001. Crystal structure of a monocot (maize
ZMGlu1) b-glucosidase and its complex with p-nitrophenyl-b-D-
thioglucoside. Biochem. J. 354, 37–46.
Dharmawardhana, D.P., Ellis, B.L., Carlson, J.E., 1992. Characterization
of vascular lignification in Arabidopsis thaliana. Can. J. Bot. 70, 2238–
von markiertem Coniferin in der verholzenden Pflanze. Monatsh.
Chem. 88, 721–734.
Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly
of the head of bacteriophage T4. Nature 227, 680–685.
Leinhos, V., Udagama-Randeniya, P.V., Savidge, R.A., 1994. Purification
of an acidic coniferin-hydrolysing b-glucosidase from developing
xylem of Pinus banksiana. Phytochemistry 37, 311–315.
Liljegren, S.J., Ditta, G.S., Eshed, Y., Savidge, B., Bowman, J.L.,
Yanofsky, M.F., 2000. SHATTERPROOF MADS-box genes control
seed dispersal in Arabidopsis. Nature 404, 766–770.
2244.
Dharmawardhana, D.P., Ellis, B.L., Carlson, J.E., 1995. A beta-glucosi-
dase from lodgepole pine xylem specific for the lignin precursor
coniferin. Plant Physiol. 107, 331–339.
Dharmawardhana, D.P., Ellis, B.L., Carlson, J.E., 1999. cDNA cloning
and heterologous expression of coniferin beta-glucosidase. Plant Mol.
Biol. 40, 365–372.
Ehlting, J., Mattheus, N., Aeschliman, D.S., Li, E., Hamberger, B., Cullis,
I.C., Zhuang, J., Kaneda, M., Mansfield, S.D., Samuels, L., Ritland,
K., Ellis, B.L., Bohlmann, J., Douglas, C.J., 2005. Global transcript
profiling of primary stems from Arabidopsis thaliana identifies candi-
date genes for missing links in lignin biosynthesis and transcriptional
regulators of fiber differentiation. Plant J. 42, 618–640.
Franke, R., Hemm, M.R., Denault, J.W., Ruegger, M.O., Humphreys,
J.M., Chapple, C., 2002. Changes in secondary metabolism and
deposition of an unusual lignin in the ref8 mutant of Arabidopsis. Plant
J. 30, 47–59.
Liljegren, S.J., Roeder, A.H.K., Kempin, S.A., Gremski, K., Østergaard,
L., Guimil, S., Reyes, D.K., Yanofsky, M.F., 2004. Control of fruit
patterning in Arabidopsis by INDEHISCENT. Cell 116, 843–853.
Lim, E.-K., Li, Y., Parr, A., Jackson, R., Ashford, D.A., Bowles, D.J.,
2001. Identification of glucosyltransferase genes involved in sinapate
metabolism and lignin synthesis in Arabidopsis. J. Biol. Chem. 276,
4344–4349.
Lim, E.-K., Jackson, R.G., Bowles, D.J., 2005. Identification and
characterisation of Arabidopsis glucosyltransferases capable of glu-
cosylating coniferyl aldehyde and sinapyl aldehyde. FEBS Lett. 579,
2802–2806.
Marcinowski, S., Grisebach, H., 1977. Turnover of coniferin in pine
seedlings. Phytochemistry 16, 1665–1667.
Franke, R., Briesen, I., Wojciechowski, T., Faust, A., Yephremov, A.,
Nawrath, C., Schreiber, L., 2005. Apoplastic polyesters in Arabidopsis
surface tissues – a typical suberin and a particular cutin. Phytochem-
istry 66, 2643–2658.
Fukushima, K., 2001. Regulation of syringyl to guaiacyl ratio in lignin
biosynthesis. J. Plant Res. 114, 499–508.
Marcinowski, S., Grisebach, H., 1978. Enzymology of lignification. Cell-
wall-bound b-glucosidase for coniferin from spruce (Picea abies)
seedlings. Eur. J. Biochem. 87, 37–44.
Marcinowski, S., Falk, H., Hammer, D.K., Hoyer, B., Grisebach, H.,
1979. Appearance and localization of a b-glucosidase hydrolyzing
coniferin in spruce (Picea abies) seedlings. Planta 144, 161–165.
Meyer, K., Shirley, A.M., Cusumano, J.C., Bell-Lelong, D.A., Chapple,
C.C.S., 1998. Lignin monomer composition is determined by the
expression of a cytochrome P450-dependent monoxygenase in Arabid-
opsis. Proc. Natl. Acad. Sci. USA 95, 6619–6623.
Goujon, T., Sibout, R., Pollet, B., Maba, B., Nussaume, L., Bechtold, N.,
Lu, F., Ralph, J., Mila, I., Barri e` re, Y., Lapierre, C., Jouanin, L.,
2
003a. A new Arabidopsis mutant deficient in the expression of O-
methyltransferase impacts lignins and sinapoyl esters. Plant Mol. Biol.
1, 973–989.
5
Montesino, R., Garcia, R., Quintero, O., Cremata, J.A., 1998. Variation
in N-linked oligosaccharide structures on heterologous proteins
secreted by the methylotrophic yeast Pichia pastoris. Protein Expr.
Purif. 2, 197–207.
Goujon, T., Sibout, R., Eudes, A., MacKay, J., Jouanin, L., 2003b. Genes
involved in the biosynthesis of lignin precursors in Arabidopsis
thaliana. Plant Physiol. Biochem. 41, 677–687.
Hartel, F.V., Brandt, A., 2002. Characterization of a Brassica napus
myrosinase expressed and secreted by Pichia pastoris. Protein Expr.
Purif. 24, 221–226.
Hefner, T., Arend, J., Warzecha, H., Siems, K., Stockigt, J., 2002. Arbutin
synthase, a novel member of the NRD1 beta glycosyltransferase
family, is a unique multifunctional enzyme converting various natural
products and xenobiotics. Bioorg. Med. Chem. 10, 1731–1741.
Hemm, M.R., Rider, S.D., Ogas, J., Murry, D.J., Chapple, C., 2004. Light
induces phenylpropanoid metabolism in Arabidopsis roots. Plant J. 38,
Nair, R.B., Bastress, K.L., Ruegger, M.O., Denault, J.W., Chapple,
C., 2004. The Arabidopsis thaliana REDUCED EPIDERMAL
FLUORESCENCE1 gene encodes an aldehyde dehydrogenase
involved in ferulic acid and sinapic acid biosynthesis. Plant Cell
16, 544–554.
Opassiri, R., Hua, Y., Wara-Aswapati, O., Akiyama, T., Svasti, J., Esen,
A., Ketudat Cairns, J.R., 2004. Beta-glucosidase, exo-beta-glucanase
and pyridoxine transglucosylase activities of rice BGlu1. Biochem. J.
379, 125–131.
7
65–778.
Raes, J., Rohde, A., Christensen, J.H., Van de Peer, Y., Boerjan, W.,
2003. Genome-wide characterization of the lignification toolbox in
Arabidopsis. Plant Physiol. 133, 1051–1071.
H o¨ sel, W., Surholt, E., Borgmann, E., 1978. Characterization of b-
glucosidase isoenzymes possibly involved in lignification from chick

1660
L.L. Escamilla-Trevi n˜ o et al. / Phytochemistry 67 (2006) 1651–1660
Rogers, L.A., Campbell, M.M., 2004. The genetic control of lignin
deposition during plant growth and development. New Phytologist
Steeves, V., F o¨ rster, H., Pommer, U., Savidge, R., 2001. Coniferyl alcohol
metabolism in conifers – I. Glucosidic turnover of cinnamyl aldehydes
by UDPG:coniferyl alcohol glucosyltransferase from pine cambium.
Phytochemistry 57, 1085–1093.
Surholt, E., H o¨ sel, W., 1981. Identification of coniferin-specific-glucosi-
dases in Cicer arietinum L. seedlings. Z. Pflanzenphysiol. 101, 207–214.
Terashima, N., Atalla, R.H., Vanderhart, D.L., 1997. Solid-state NMR-
spectroscopy of specifically C-13-enriched lignin in wheat-straw from
coniferin. Phytochemistry 46, 863–870.
Tschopp, J.F., Brust, P.F., Cregg, J.M., Stillman, C.A., Gingeras, T.R.,
1987. Expression of the lacZ gene from two methanol-regulated
promoters in Pichia pastoris. Nucleic Acids Res. 15, 3859–3876.
Turner, S.R., Somerville, C.R., 1997. Collapsed xylem phenotype of
Arabidopsis identifies mutants deficient in cellulose deposition in the
secondary cell wall. Plant Cell 9, 689–701.
Whetten, R.W., McKay, J.J., Sederoff, R.R., 1998. Recent advances in
understanding lignin biosynthesis. Annu. Rev. Plant Physiol. Plant
Mol. Biol. 49, 585–609.
Xu, Z., Escamilla-Trevi n˜ o, L.L., Zeng, L., Lalgondar, M., Bevan, D.R.,
Winkel, B.S.J., Mohamed, A., Cheng, C.-L., Shih, M.-C., Poulton,
J.E., Esen, A., 2004. Functional genomic analysis of Arabidopsis
thaliana glycoside hydrolase family 1. Plant Mol. Biol. 55, 343–367.
Xu, Z., Shih, M.-C., Poulton, J.E., 2006. An extracellular exo-b-(1,3)-
glucanase from Pichia pastoris: purification, characterization, molec-
ular cloning, and functional expression. Protein Expr. Purif. 47, 118–
127.
164, 17–30.
Rogers, L.A., Dubos, C., Cullis, I.F., Surman, C., Poole, M., Willment, J.,
Mansfield, S.D., Campbell, M.M., 2005a. Light, the circadian clock,
and sugar perception in the control of lignin biosynthesis. J. Expt.
Botany 56, 1651–1663.
Rogers, L.A., Dubos, C., Surman, C., Willment, J., Cullis, I.F., Mansfield,
S.D., Campbell, M.M., 2005b. Comparison of lignin deposition in
three ectopic lignification mutants. New Phytologist 168, 123–140.
Samuels, A.L., Rensing, K.H., Douglas, C.J., Mansfield, S.D., Dharm-
awardhana, D.P., Ellis, B.L., 2002. Cellular machinery of wood
production: differentiation of secondary xylem in Pinus contorta var.
latifolia. Planta 216, 72–82.
Sarkanen, K.V., Ludwig, C.H., 1971. Lignins: Occurrence, Formation,
Structure, and Reactions. Wiley Interscience, New York.
0
Savidge, R.A., F o¨ rster, H., 1998. Seasonal activity of uridine 5 -diphos-
phoglucose:coniferyl alcohol glucosyltransferase in relation to cambial
growth and dormancy in conifers. Can. J. Bot. 76, 486–493.
Schmid, G., Grisebach, H., 1982. Enzymic synthesis of lignin precursors.
Purification and properties of UDP-glucose:coniferyl alcohol gluco-
syltransferase from cambial sap of spruce (Picea abies L.). Eur. J.
Biochem. 123, 363–370.
Schmid, M., Davison, T.S., Henz, S.R., Pape, U.J., Demar, M., Vingron,
M., Sch o¨ lkopf, B., Weigel, D., Lohmann, J., 2005. A gene expression
map of Arabidopsis development. Nat. Genet. 37, 501–506.
Scorer, C.A., Buckholz, R.G., Clare, J.J., Romanos, M.A., 1993. The
intracellular production and secretion of HIV-1 envelope protein in the
methylotrophic yeast Pichia pastoris. Gene 136, 111–119.
Spence, J., Vercher, Y., Gates, P., Harris, N., 1996. ‘Pod shatter’ in
Arabidopsis thaliana, Brassica napus and B. juncea. J. Microsc. 181,
Zhong, R., Taylor, J.J., Ye, Z.-H., 1997. Disruption of interfascicular fiber
differentiation in an Arabidopsis mutant. Plant Cell 9, 2159–2170.
Zhou, J., Hartmann, S., Shepherd, B.K., Poulton, J.E., 2002. Investi-
gation of the microheterogeneity and aglycone specificity-conferring
residues of black cherry prunasin hydrolases. Plant Physiol. 129,
1252–1264.
195–203.