Anti-Trichomonas vaginalis activity of chalcone and amino-analogues

Article abstract of DOI:10.1007/s00436-018-6164-4

Trichomoniasis is the most common non-viral sexually transmitted disease worldwide and can lead to serious consequences in reproductive health, cancer, and HIV acquisition. The current approved treatment present adverse effects and drug resistance data on this neglected parasitic infection is underestimated. Chalcones are a family of molecules that present biological applications, such as activity against many pathogenic organisms including protozoan pathogens. Chalcone (1) and three amino-analogues (2–4) were synthesized by Claisen–Schmidt condensation reaction and had their activity evaluated against the parasitic protozoan Trichomonas vaginalis. This bioassay indicated the presence and position of the amino group on ring A was crucial for anti-T. vaginalis activity. Among these, 3′-aminochalcone (3) presented the most potent effect and showed high cytotoxicity against human vaginal cells. On the other hand, 3 was not able to exhibit toxicity against Galleria mellonella larvae, as well as the hemolytic effect on human erythrocytes. Trophozoites of T. vaginalis were treated with 3, and did not present significant reactive oxygen species (ROS) accumulation, but induced a significantly higher ROS accumulation in human neutrophils after co-incubation. T. vaginalis pyruvate:ferredoxin oxidoreductase (PFOR) and β-tubulin gene expression was not affected by 3.

Full text of DOI:10.1007/s00436-018-6164-4

Parasitology Research
https://doi.org/10.1007/s00436-018-6164-4
PROTOZOOLOGY - ORIGINAL PAPER
Anti-Trichomonas vaginalis activity of chalcone and amino-analogues
1
2
1
2
Márcia Rodrigues Trein & Lígia Rodrigues e Oliveira & Graziela Vargas Rigo & Mayara Aparecida Rocha Garcia
&
1
3
4
2
1
Brenda Petro-Silveira & Danielle da Silva Trentin & Alexandre José Macedo & Luis Octávio Regasini & Tiana Tasca
Received: 16 July 2018 /Accepted: 22 November 2018
#
Springer-Verlag GmbH Germany, part of Springer Nature 2018
Abstract
Trichomoniasis is the most common non-viral sexually transmitted disease worldwide and can lead to serious consequences in
reproductive health, cancer, and HIVacquisition. The current approved treatment present adverse effects and drug resistance data
on this neglected parasitic infection is underestimated. Chalcones are a family of molecules that present biological applications,
such as activity against many pathogenic organisms including protozoan pathogens. Chalcone (1) and three amino-analogues (2–
4) were synthesized by Claisen–Schmidt condensation reaction and had their activity evaluated against the parasitic protozoan
Trichomonas vaginalis. This bioassay indicated the presence and position of the amino group on ring A was crucial for anti-
T. vaginalis activity. Among these, 3′-aminochalcone (3) presented the most potent effect and showed high cytotoxicity against
human vaginal cells. On the other hand, 3 was not able to exhibit toxicity against Galleria mellonella larvae, as well as the
hemolytic effect on human erythrocytes. Trophozoites of T. vaginalis were treated with 3, and did not present significant reactive
oxygen species (ROS) accumulation, but induced a significantly higher ROS accumulation in human neutrophils after co-
incubation. T. vaginalis pyruvate:ferredoxin oxidoreductase (PFOR) and β-tubulin gene expression was not affected by 3.
.
.
.
.
Keywords Trichomonas vaginalis Trichomoniasis Chalcone Antiprotozoal Antiparasitic
Introduction
STD worldwide, and in 2008, about 280 million new cases
were reported (WHO 2012). Infection can lead to serious con-
sequences such as cervical cancer (Viikki et al. 2000) and
predisposition to prostate cancer (Sutcliffe et al. 2012).
Reproductive outcomes may also occur, such as pelvic inflam-
matory disease (Cherpes et al. 2006) and infertility (Grodstein
The flagellate protozoan Trichomonas vaginalis (Donné
1
836) is the etiological agent of trichomoniasis, a sexually
transmitted infection (STI) that represents a heavy burden on
public health. Trichomoniasis is the most common non-viral
Márcia Rodrigues Trein and Lígia Rodrigues e Oliveira contributed
equally to this work.
Handling Editor: Julia Walochnik
Electronic supplementary material The online version of this article
(https://doi.org/10.1007/s00436-018-6164-4) contains supplementary
material, which is available to authorized users.
3
*
Tiana Tasca
Departamento de Ciências Básicas da Saúde, Universidade Federal
tiana.tasca@ufrgs.br
de Ciências da Saúde de Porto Alegre, Porto Alegre, RS 90050-170,
Brazil
1
Laboratório de Pesquisa em Parasitologia, Faculdade de Farmácia,
Universidade Federal do Rio Grande do Sul, Av. Ipiranga 2752, Porto
Alegre, RS 90610-000, Brazil
4
Laboratório de Biofilmes e Diversidade Microbiana, Faculdade de
Farmácia, Universidade do Rio Grande do Sul, Av. Ipiranga 2752,
Porto Alegre, RS 90610-000, Brazil
2
Laboratory of Antibiotics and Chemotherapeutics, Institute of
Biosciences, Humanities and Exact Sciences (Ibilce), São Paulo State
University (Unesp), Rua Cristóvão Colombo 2265, São José do Rio
Preto, SP 15054-000, Brazil

Parasitol Res
et al. 1993), and also premature birth and low birth weight
Cotch et al. 1997). T. vaginalis also acts as a facilitating agent
for HIVand HPV transmission and acquisition (Kissinger and
Adamski 2013, Noël et al. 2010).
acetophenone derivatives and benzaldehydes (Scheme 1),
using the protocol described by Zeraik and coauthors, with
minor modifications (Zeraik et al. 2012). The structure of
compounds was confirmed by H NMR and C NMR spectra
analysis as presented in supplementary material.
(
1
13
Currently, 5-nitromidazoles (metronidazole and tinidazole)
are the only therapeutic agents for trichomoniasis approved by
the Food and Drug Administration (FDA, USA). However, be-
sides limitations such as adverse effects, these drugs present an
increasing number of infections that do not respond to treatment
due to drug resistance (Kirkcaldy et al. 2012). Also, the absence
of a surveillance system for this infection indicates that both
numbers on infected patients and data on resistance are probably
underestimated and, therefore, trichomoniasis is considered a
neglected parasitic infection (Secor et al. 2014). New alternatives
have been researched, and many substances have presented good
activity against T. vaginalis in vitro, but no treatment options
have progressed to clinical trials (Vieira et al. 2017).
Natural and synthetic chalcone analogues are privileged
structures to medicinal chemistry and present activities against
many pathogenic organisms, including protozoan pathogens,
with promising results and several proteins/enzymes as possi-
ble targets (Mahapatra et al. 2015). Besides antiparasitic,
chalcones present anti-inflammatory, antioxidant, anticancer,
antinociceptive, and antiplatelet activities and are considered
hepatoprotective agents (Karimi-Sales et al. 2018). The pro-
posed mechanisms of action include the inhibition of mito-
chondrial dehydrogenases and fumarate reductase causing an
interference with the structure and function of the mitochon-
dria of Leishmania species (Zhai et al. 1995, 1999; Chen et al.
In vitro culture of T. vaginalis
The T. vaginalis isolate 30236 (from the American Type
Culture Collection (ATCC), USA) was used in this study.
Parasites were cultured in vitro in a trypticase-yeast extract-
maltose (TYM) medium pH 6.0 supplemented with 10% (v/v)
heat-inactivated adult bovine serum, and incubated at 37 °C
(Diamond 1957). Trophozoites in the logarithmic phase of
growth and exhibiting more than 95% viability and normal
morphology were harvested, centrifuged, and resuspended in
new TYM medium for the experimental assays.
Screening of anti-T. vaginalis activity of chalcone
derivatives
The activity of chalcone derivatives against T. vaginalis was
performed in 96-well microtiter plates. Dimethyl sulfoxide
(DMSO) was used as a solubilization vehicle for the com-
pounds at 0.6% final concentration. Trichomonads suspension
5
at 2.0 × 10 trophozoites/milliliter density was incubated with
the compounds at 100 μM for 24 h in a humidified 5% CO2
incubator at 37 °C. The viability of parasites was assessed by
counting in Neubauer chamber using trypan blue (0.2%) as an
exclusion dye. Three controls were carried out: negative con-
trols with trophozoites in a supplemented culture medium on-
ly, vehicle control with DMSO at 0.6%, and metronidazole
control at 100 μM. Results were expressed as the percentage
of viable trophozoites compared to untreated parasites.
Compounds that presented the best activities were tested to
determine the half maximal inhibitory concentration (IC ).
2
001). The anticancer activity of chalcones might be caused
by the induction of apoptosis, DNA, and mitochondrial dam-
age, inhibition of kinases, angiogenesis, and tubulin polymer-
ization (Das and Manna 2016). Recently, two studies have
demonstrated the anti-T. vaginalis activity of metronidazole-
chalcone conjugates (Anthwal et al. 2014), and chalconyl
blended triazole allied organosilatranes (Singh et al. 2016).
Chalcone-derivatives potential activity against T. vaginalis
is a field yet to be explored. In this sense, this study presents
the anti-T. vaginalis potential of synthesized chalcone deriva-
tives and some biological effects of 3′-aminochalcone.
5
0
Determination of IC values
5
0
Material and methods
For the determination of the IC50 values of the most active
compound, the experiments were performed in similar condi-
tions in the screening experiments, with compound concentra-
tions ranging from 100 to 0.7812 μM. The IC50 values were
assessed using GraphPad Prism6 software through a nonlinear
regression model.
Chalcone-derivatives synthesis
Chalcone (1) and its amino-analogues (2–4) were synthesized
by Claisen–Schmidt aldol condensation reactions between
Scheme 1 Synthesis of chalcone
and its amino-analogues

Parasitol Res
Growth kinetics
120 h. Determination of larvae viability was made by the
evaluation of reorientation after being placed backwards,
mobility, and response to stimuli.
The aminochalcone with the best IC value was incubated with
50
T. vaginalis ATCC30236 for the evaluation of its effect on
5
growth kinetics. Parasite suspensions at 2.0 × 10 trophozoites/
Hemolysis assay
milliliter final density were incubated with the compound in the
IC ; negative and vehicle control (DMSO 0.6%) were also eval-
uated. The parasites were counted in a Neubauer chamber using
trypan Blue (0.2%) as an exclusion dye after 2, 4, 6, 12, 24, 48,
Hemolytic effect of the aminochalcone was evaluated against
erythrocytes obtained from a heparinized blood of healthy
human donors (documents, procedures, and project approved
by the Universidade Federal do Rio Grande do Sul Research
Ethical Committee under authorization CAAE
50
72, 96, and 120 h of incubation. Results were expressed as the
number of viable trophozoites per milliliter.
4
7423415.5.0000.5347). Erythrocytes were washed three
Cytotoxicity against vaginal epithelial cells (HMVII)
times in PBS, ressuspended to 1% density on saline pH 7.0,
and incubated with the compound in its IC50 and at 100 μM.
Experiment controls were: negative, vehicle (0.6% DMSO),
and positive (Triton X-100 0.1%). After 1 and 24 h of incu-
bation at 37 °C, supernatant absorbance was measured at
540 nm (Gauthier et al. 2009). Results were expressed as a
percentage of hemolysis compared to the positive control.
The compound that presented the best IC50 value was
tested for cytotoxicity against HMVII vaginal epithelial
cell lineage. The culture was maintained in RPMI-1640
medium supplemented with 20% fetal bovine serum.
The day before the experiment cells were seeded in a
9
6-well microtiter and kept overnight at 37 °C in humid-
ified 5% CO incubator to reach pre-confluence. After this
Determination of reactive oxygen species (ROS)
2
period, the medium was replaced by the molecule in con-
centrations ranging from 100 to 0.7812 μM in the supple-
mented medium. Triton X100 0.02% was added as a pos-
itive control and 0.6% DMSO as a vehicle control. The
plates were incubated for 48 h in a humidified 5% CO2
incubator at 37 °C. After this period, the cell viability was
evaluated by the MTT assay (Mosmann 1983). Briefly, the
medium was removed, a 0.5 mg/mL 3-(4,5-dimethyl-
thiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) so-
lution was added and incubated for 1 h and removed, and
the insoluble purple formazan was dissolved in DMSO
and the absorbance was read at 570 nm. The concentra-
tion required to kill 50% of the cells (CC ) was deter-
production in T. vaginalis
For the determination of induction of ROS production in tro-
phozoites by the compound, T. vaginalis suspensions at 5 ×
6
10 density were incubated with 10 μM of 2′,7′-
dichlorofluorescein diacetate (2′,7′-DCF-DA), an oxidation-
sensitive fluorescent probe, for 1 h at 37 °C. After this time,
the molecule at IC50 and at 100 μM was added and incubated
for an additional 1 h at 37 °C. Parasites treated with hydrogen
peroxide (5.0 mM) were used as a positive control. After in-
cubation, fluorescence was measured by flow cytometry (BD
FACSVerse™, Becton Dickinson) and 10,000 cells were gat-
ed and analyzed using BD FACSuite™ software (Becton
Dickinson). Results were expressed in fluorescence units.
5
0
mined using GraphPad Prism6 software, through a non-
linear regression model.
Determination of ROS production in neutrophils
In vivo toxicity against Galleria mellonella model
Human neutrophils were isolated as previously described
(Böyum 1968) with some modifications. Briefly, venous
blood of healthy volunteers (documents, procedures, and pro-
ject approved by the Universidade Federal do Rio Grande do
Sul Research Ethical Committee under authorization 19346)
was collected on heparin anticoagulant solution, centrifuged
(250×g, 10 min, 24 °C), and platelet-rich plasma discarded.
Leukocytes were obtained following erythrocyte sedimenta-
tion in 2.0% Dextran T-500 and centrifuged (525×g, 20 min,
24 °C) through a layering on Histopaque 1077. The
neutrophil-enriched pellet was subjected to a 15-s hypotonic
lysis to remove the remaining erythrocytes and centrifuged
(1000×g, 5 min, 24 °C). The purified neutrophils were resus-
pended in RPMI 1640 supplemented with 10% fetal bovine
serum and 10 mM HEPES for the experiments.
The aminochalcone with the best IC50 value was also
tested for toxicity in vivo using the Galleria mellonella
(
2
Linnaeus, 1758) larvae model. Larvae weighing 280 ±
0 mg were separated into three groups of ten for each
condition. Three concentrations were tested: 1 mg/kg,
0 mg/kg, and 50 mg/kg of larvae, and saline solution
1
was used as the vehicle. Larvae were injected through
the last left pro-leg with 10 μL of the solutions using a
Hamilton syringe (Sigma Aldrich®, USA) (Kavanagh and
Fallon 2010). Three control conditions were performed:
negative control (not injected larvae), vehicle control,
and positive control (larvae injected with DMSO only).
Larvae were kept in Petri dishes in an incubator at
3
7 °C and viability was observed in 24, 48, 72, 96, and

Parasitol Res
5
Parasites (5.0 × 10 trophozoites/milliliter) were treated with
Statistical analysis
the aminochalcone at 100 μM and IC . After 2 hours, tropho-
50
zoites were washed three times in PBS, counted in a hemocy-
tometer and resuspended in RPMI medium. Neutrophils (1.0 ×
All experiments were performed with three independent sam-
ples, in triplicates. Results were expressed as means ± SD.
Statistical analysis was conducted using the Student’s t test
for comparison between two groups. Statistical significance
was considered at p < 0.05.
5
4
10 ) were cocultured with treated trophozoites (1.0 × 10 ) on 96-
well microplates at 37 °C in 5.0% CO -humidified incubator for
2
30 min. After incubation, the medium was removed and cells
were resuspended in PBS with 10 μM 2′,7′-DCF-DA and incu-
bated at 37 °C for 15 min. Hydrogen peroxide (5.0 mM) was
added 5 min before reading as positive control for ROS produc-
tion. The neutrophils fluorescence was measured by flow cytom-
etry (FACSVerse, Becton Dickinson). Ten thousand cells were
gated and analyzed using the BD FACSuite™ software (Becton
Dickinson). Results were expressed in fluorescence units.
Results
Chalcone derivatives synthesis
In this study, chalcone derivatives were synthesized by
Claisen–Schmidt base-catalyzed aldol condensation reactions.
These reactions were feasible and versatile, allowing the syn-
thesis of library of compounds, with high chemodiversity
RT-PCR for pyruvate:ferredoxin oxidoreductase
(PFOR) and β-tubulin
(
Zhuang et al. 2017). Chalcones 1, 2, 3, and 4 were obtained
6
Trophozoites (4 × 10 trophozoites/milliliter) were treated for
in yields of 78%, 82%, 55%, and 60%, respectively. Structures
1
2 and 24 h with the aminochalcone at IC , then the total
1
13
5
0
of 1–4 were confirmed by H NMR and C NMR spectra
analysis. All chalcones are known compounds and their NMR
data were confirmed by comparison with literature data. For
chalcones 1 and 4 were compared with Santos and co-authors
RNA was extracted using TriZol™ following the manufac-
turer’s instructions and was stored at − 80 °C until use.
Quantity and purity of the RNA were determined using spec-
trophotometric method, and only the high-quality samples, in
which the A260/A280 was 1.8 and A260/A230 was 2.0, were
used for subsequent qRT-PCR analyses. Samples were
pretreated with DNAse, to ensure that there was no contami-
nation with genomic DNA in the qRT-PCR analysis.
Real-time PCR reactions were performed in the Rotor-Gene
QTM (Qiagen, Netherlands) equipment using GoTaqTM 1-Step
RT-qPCR kit (Promega, USA) in a final volume of 12 μL. Each
PCR reaction contained 5 μL of 2X Go Taq qPCR Master Mix,
(2017) (Santos et al. 2017), while chalcones 2 and 3 were
compared with Iqbal and collaborators (2014) (Iqbal et al.
2
a pair of doublets with coupling constants values of 15.0 Hz.
In the C NMR spectrum, the most downfield signals with
chemical shifts ranging from 186.5 to 191.0 ppm were attrib-
uted to the carbonyl of the α,β-unsaturated ketone moiety. For
all compounds, NMR data (chemical shifts, integrations, mul-
tiplicities, and coupling constants) corresponded with the pro-
posed structures.
1
014). The most typical signals in the H NMR spectra were
13
2
00 nM of DNATopII, and PFOR primers, and 100 nM of β-
tubulin primer, 0.2 μL Go Script RT Mix, and 50 ng of RNA.
The qRT-PCR cycling conditions were as follows: reverse tran-
scription for 15 min at 37 and 95 °C for 10 min, followed by
Chalcone derivatives anti-T. vaginalis activity
4
0 cycles of denaturation at 95 °C for 10 s and annealing at 64 °C
The compounds had their activity screened against
T. vaginalis ATCC 30236 (JH 31A #4, from the American
Type Culture Collection, USA) tested at 100 μM. (Fig. 1).
Chalcone (compound 1) was inactive showing a percentage
of viability value equals to 122 ± 21. Amino-analogues of 1
for 30 s, with fluorescence data collection recording at this step,
and extension at 72 °C for 30 s. The melting curve analyses were
performed by raising the temperature at the end of each run in by
1
°C per 5 s from 64 to 95 °C. Parallel reactions without RNA
template were used as a negative control. Primers used were:
DNATopII forward (F): 5’ATCGGTGTCGGTTGGTCAAG3’
and reverse (R): 5’TGGCTGTTTGACACCGTCTTT3’; β-
tubulin F: 5’TCCGTGGCCGTATGTCATCT3’, R:
5
5
(
2–4) exhibited antiprotozoal activities. Aminochalcone 3
displayed IC50 of 29 μM. Chalcones 2 and 4 with an amino
group at positions 2′ and 4′, respectively, exhibited inferior
potency against T. vaginalis, showing the percentage of via-
bility values of 50 ± 10 and 10 ± 3, respectively.
’GCTGTTGTGTTGCCGATGAA3’; PFOR F:
’CTCGTTTGGGGTGCTACATT3’, R: 5’TCCTGATC
CCAAACCTTGAG3’ (dos Santos et al. 2015).
The values of the cycle threshold (Ct) for each reaction were
calculated by the Rotor-Gene Q series software 2.1.0 and these
values were used to determine the average Ct for each sample.
The relative change in gene expression was analyzed using the
Compound 3 affects T. vaginalis growth kinetics
For the evaluation of the effect of compound 3 on growth
kinetics, trophozoites incubated with the molecule at IC50
were counted over time, up to 120 h. The results
2-ΔΔCt method (Livak and Schmittgen 2001).

Parasitol Res
Fig. 1 Anti-T. vaginalis activity
of chalcone derivatives against
ATCC 30236 isolate. Data are
presented as mean ± standard
deviation compared to control
(considering the trophozoite
viability as 100%). Results are
representative of three
independent experiments
performed in triplicate assays
demonstrate trophozoites viability is affected by the com-
pound over time (Fig. 2).
Compound 3 does not induce hemolysis in human
erythrocytes
Human erythrocytes were incubated with compound 3 for 1
and 24 h and the hemolysis rate at 100 μM and IC50 did not
present any significant difference form the negative control
group (p > 0.05) (Table 2).
Compound 3 is toxic to vaginal epithelial cells in vitro
Compound 3, which presented the highest potency against
T. vaginalis, had its cytotoxicity against HMVII cells assessed.
A nonlinear regression model was used in order to determine
the CC50 value, which is 21 μM. The selectivity index is the
ratio between the values of CC50 and IC50 and indicates
whether the compound toxicity is selective against the para-
site, and SI for compound 3 is 0.72.
Compound 3 does not induce ROS accumulation
in T. vaginalis trophozoites
Trophozoites treated with 3 were evaluated for ROS accumu-
lation by flow cytometry. Results indicate that the compound
did not induce ROS accumulation in the trophozoites in any
significant manner (Fig. 3).
Galleria mellonella larvae injected with compound 3
maintained viability
T. vaginalis induced ROS production in neutrophils is
increased by compound 3
Galleria mellonella larvae injected with 3 at 1 mg/kg,
1
0 mg/kg, and 50 mg/kg showed no significant increase in
mortality up to 120 h of observation at all conditions tested
p > 0.05) (Table 1).
ROS production by neutrophils incubated with T. vaginalis
trophozoites pretreated with compound 3 was increased in a
significant manner (Fig. 4). On the other hand, neutrophils
(
Fig. 2 Kinetic growth curve of
trophozoites treated with
compound 3 in 29 μM in
comparison to untreated parasites
(control) and parasites with 0.6%
DMSO (vehicle). The initial in-
5
oculum was 2.0 × 10 trophozo-
ites/mL. Results are presented as
mean ± standard deviation of
three independent experiments in
triplicate

Parasitol Res
Table 1 Mortality (%) of
Galleria mellonella
larvae treated with the
compound 3
with amino group in positions 2′ and 4′ exhibited a less potent
activity against T. vaginalis showing the percentage of viabil-
ity values equal to 50 ± 10 and 10 ± 3, respectively.
Altogether, these data suggest that the presence and position
on ring A of the amino group improved antiprotozoal activity.
Amino group substitutions in the chalcone framework have
been shown to play a central role in the bioactivity. Thus,
aminochalcone 3 was selected for subsequent bioassays. In
growth kinetics evaluation, parasites counting at 24 h con-
firmed that compound 3 at this concentration reduce parasites
to 50% of the control.
Conditions
Mortality (%)
Negative control
Vehicle control
DMSO 100%
6.7 ± 11.5
0 ± 0
100 ± 0
10 ± 10
0 ± 0
3
50 mg/kg
1
1
0 mg/kg
mg/kg
0 ± 0
Results are presented as mean ± standard
deviation of three independent experi-
ments in triplicate
Since the compound showed high cytotoxicity, resulting in
a selectivity index of 0.72 which suggests low selectivity of
the molecule for the parasites in comparison to human cells,
Galleria mellonella model was used to access in vivo toxicity.
Results indicate that 3 is not toxic in living complex organ-
isms. The use of in vitro models for toxicity is advanced since
live animals represent an ethical challenge; however, no
in vitro model can mimic the complexity of a live biological
organism. In this sense, this insect model possesses many
attractive features as experimental model when compared with
mammals, including the fact that G. mellonella larvae are
cheaper and easier to maintain, they can be maintained at
incubated only with 3 presented significant reduction in ROS
production at 100 μM concentration.
PFOR and β-tubulin gene expression are not affected
by compound 3
Trophozoites treated for 12 and 24 h did not appear to express
PFOR gene nor β-tubulin differently different form control
group in a significant manner (Table 3).
37 °C and they are not submitted to ethical restriction. Its great
Discussion
acceptance by the scientific community is evidenced by the
increasing number of scientific publications in international
journals using this invertebrate for infectious research.
Larvae possess an innate immune system that is structurally
and functionally similar to that of mammals (Browne et al.
2013), and gastrointestinal and hepatic systems of insect and
mammals present similarities and, in this context, the insect fat
body is an organ that functions in metabolism and is similar to
the liver of mammals (Büyükguzel et al. 2013). Also, there are
enzymes, which are involved in drug detoxification, located in
the fat body and there are data indicating cytochrome P450
enzymes behave like their counterparts in mammals
(Feyereisen, 1999). Ignasiak and Maxwell (2017) reported
that the toxicity determined in G. mellonella model correlates
well with toxicity in rats and mice.
Trichomoniasis is the most common non-viral STI worldwide
and it can lead to serious health consequences. Treatment is
still restricted to two drugs, metronidazole and tinidazole.
Taking into account the increasing incidence of resistance to
these drugs, treatment has become a challenge, therefore, the
increasing need to search for new therapeutic alternatives
(
Vieira et al. 2017). In recent years, chalcone-based com-
pounds have shown a wide range of biological activities, in-
cluding activity against pathogenic agents, especially proto-
zoa, and T. vaginalis (Anthwal et al. 2014, Singh et al. 2016).
The 3′-aminochalcone (compound 3) exhibited potent ac-
tivity against T. vaginalis (IC = 29 μM) demonstrating the
5
0
importance of the 3′ position of ring A. While aminochalcones
Chalcone 3 is a potential cationic amphiphilic agent, due to
its ring A being substituted by the basic and hydrophilic
group, as well as ring B and α,β-unsaturated ketone bridge,
two hydrophobic moieties. These structural features can be
responsible for the promiscuous disruptor effects on
biomembranes. The capacity of the disrupting cell membrane
may be considered a primary mechanism of cell death, since
membrane integrity is essential for the maintenance of cellular
structural integrity, therefore, required for cell survival. The
hemolysis assay was performed to investigate if the active
compounds have this effect on the trophozoites. The fact that
compound 3 did not have a hemolytic effect suggests that it
does not affect cell membrane integrity. Taking into account
that the trophozoites death was probably not caused by
Table 2 Hemolytic effect of compound 3 100 and 29 μM on human
erythrocytes
Conditions
Hemolysis rate (%)
1
h
24 h
100 ± 0
Triton 0.1%
Negative control
Vehicle
100 ± 0
9.51 ± 1.0
9.25 ± 0.8
9.10 ± 0.7
9.00 ± 0.3
9.90 ± 0.7
10.13 ± 0.5
9.75 ± 0.9
10.64 ± 1.6
3
100 μM
9 μM
2
Results are presented as mean ± standard deviation of three independent
experiments in triplicate

Parasitol Res
Fig. 3 ROS production by
T. vaginalis trophozoites treated
with the compound 3 at 100 and
2
8.97 μM. Hydrogen peroxide
(5.0 mM) was used as positive
control of ROS production. Bars
represent the mean ± standard
deviation of at least three
independent experiments
membrane disruption, other mechanisms responsible for the
chalcone activity were investigated. The hemolysis assay also
provides an indication that the molecule presents compatibil-
ity with human erythrocytes, in contrast with the cytotoxic
effect observed against the vaginal epithelial cells.
Aminochalcone 3 bearing aniline moiety as ring A, which is
a recognized inductor moiety of reactive oxygen species (ROS)
overproduction leads to oxidative stress and consequent cell
damage (Wang et al. 2016). Compound 3 did not induce ROS
accumulation in the trophozoites or the scavenging system of
the parasite was efficient, thus indicating that this is not the
mechanism of action of this molecule on T. vaginalis. The mode
of action of metronidazole and tinidazole is based on produc-
tion of toxic nitro-radical anions through electron donation by
the parasite’s redox pathway (Kulda 1999), and in the search for
new alternatives for trichomoniasis, it is a good approach to find
compounds with different therapeutic targets, aiming to reduce
the possible occurrence of cross-resistance. Our results indicat-
ed 3 did not act on trophozoites by mode of action of 5-
nitroimidazole drugs, thus the effect of 3 towards unexplored
molecular targets can reduce the occurrence of cross-resistance
with broadly used drugs.
Neutrophils are the main immune cell recruited on the site
of infection by T. vaginalis. As part of the immune response to
trichomoniasis, ROS accumulation in these cells is induced by
T. vaginalis (Song et al. 2008). For this reason, we compared
ROS production in neutrophils induced by trophozoites treat-
ed and non-treated with 3. Since aminochalcone 3 activates
ROS production in neutrophils stimulated by treated tropho-
zoites, it seems to enhance this important feature of the im-
mune response. Neutrophils incubated only with 3 presented a
significant reduction in ROS production at the highest con-
centration, which may be due to the antioxidant and anti-
inflammatory potential already described for chalcone-based
compounds (Popoola et al. 2015).
Table 3 Relative gene expression of PFOR and β-tubulin of
T. vaginalis trophozoites treated with compound 3
Fig. 4 ROS accumulation in neutrophils incubated with compound 3, and
neutrophils cocultured with treated and non-treated T. vaginalis tropho-
zoites. N, non treated neutrophils; N + 3100 μM, N + 3 29 μM, neutro-
phils incubated with compound 3 at different concentrations; N + TV,
neutrophils coincubated with non-treated T. vaginalis trophozoites; N +
TV + 3100 μM, N + TV + 3 29 μM, neutrophils incubates with
T. vaginalis trophozoites treated with the compound in different concen-
trations. a Significant reduction, b significant increase (p < 0.05).
Hydrogen peroxide (5.0 mM)–treated neutrophils presented 3154.2 ±
-
ΔΔCt
Time
Relative gene expression (2
)
1
2 h 24 h
Gene
β-tubulin
1.21 ± 0.03
1.17 ± 0.15
2.74 ± 2.72
0.91 ± 0.61
PFOR
All values are based in the standardized control 2-ΔΔCt value of 1.0.
4
45.3 fluorescence units
DNATopII was used as reference gene

Parasitol Res
conjugates with potential to counter drug resistance in
Trichomonas vaginalis. Eur J Med Chem 79:89–94
Böyum A (1968) Isolation of mononuclear cells and granulocytes from
human blood. Isolation of monuclear cells by one centrifugation,
and of granulocytes by combining centrifugation and sedimentation
at 1 g. Scand J Clin Lab Invest Suppl 97:77–89
Browne N, Heelan M, Kavanagh K (2013) An analysis of the structural
and functional similarities of insect hemocytes and mammalian
phagocytes. Virulence 4(7):597–603
Büyükgüzel E, Büyükgüzel K, Snela M, Erdem M, Radtke K, Ziemnicki
K, Adamski Z (2013) Effect of boric acid on antioxidant enzyme
activity, lipid peroxidation, and ultrastructure of midgut and fat body
of Galleria mellonella. Cell Biol Toxicol 29(2):117–129
The bioreduction of metronidazole in its active form by
T. vaginalis has been related to hydrogenosomal enzyme ac-
tivity including pyruvate:ferredoxin oxidoreductase (PFOR)
and alterations of expression of PFOR are present in
metronidazole-resistant isolates (Land et al. 2001). As part
of the investigation of the mechanism of death induced by
compound 3, we evaluated whether the compound affects
the gene expression of this enzyme. As demonstrated by the
results, trophozoites treated for 12 and 24 h did not appear to
express this gene differently form control group in a signifi-
cant manner (Table 3).
Chen M, Zhai L, Christensen SB, Theander TB, Kharazmi A (2001)
Inhibition of fumarate reductase in Leishmania major and
L. donovani by chalcones. Antimicrob Agents Chemother 45:
Chalcones are widely evaluated for their antitumoral po-
tential and it has been demonstrated that many of these mol-
ecules target tubulin polymerization (Mirzaei and Emami
2
023–2029
Cherpes TL, Wiesenfeld HC, Melan MA, Kant JA, Cosentino LA, Meyn
LA, Hillier SL (2006) The associations between pelvic inflammato-
ry disease, Trichomonas vaginalis infection, and positive herpes
simplex virus type 2 serology. Sex Transm Dis 33:747–752
Cotch MF, Pastorek JG 2nd, Nugent RP, Hillier SL, Gibbs RS, Martin
DH, Eschenbach DA, Edelman R, Carey JC, Regan JA, Krohn MA,
Klebanoff MA, Rao AV, Rhoads GG (1997) Trichomonas vaginalis
associated with low birth weight and preterm delivery. The Vaginal
Infections and Prematurity Study Group. Sex Transm Dis 24(6):
2
016). Besides the importance of microtubules in the mainte-
nance of cell shape and organization, motility, and cell divi-
sion, β-tubulin may be specifically involved in T. vaginalis
cytoadherence, which is part of the pathogenesis of the para-
site (Alderete and Garza 1985). As β-tubulin is an important
factor for parasite survival and pathogenesis, the influence of
the aminochalcone on β-tubulin gene expression of
T. vaginalis was investigated. Our results demonstrate no in-
fluence of the molecules on this gene expression of parasites
treated with compound 3 for 12 and 24 h (Table 3), therefore
this also may not be the molecular target of this compound.
Overall, this study showed the potent activity of 3′-
aminochalcone against T. vaginalis, responsible for a
neglected parasitic infection with high worldwide incidence
and serious health outcomes. The increasing number of drug
resistance among patients highlights the urgent necessity of
new options to treat trichomoniasis, and chalcones and 3′-
aminochalcone, presented high potential to challenge this
public health problem.
3
53–360
Das M, Manna K (2016) Chalcone scaffold in anticancer armamentarium:
a molecular insight. J Toxicol 2016:7651047
Diamond LS (1957) The establishment of various trichomonads of ani-
mals and man in axenic cultures. J Parasitol 43:488–490
dos Santos O, de Vargas Rigo G, Frasson AP, Macedo AJ, Tasca T (2015)
Optimal reference genes for gene expression normalization in
Trichomonas vaginalis. PLoS One 10:e0138331
Feyereisen R (1999) Insect P450 enzymes. Annu Rev Entomol 44:
507–533
Gauthier C, Legault J, Girard-Lalancette K, Mshvildadze V, Pichette A
(2009) Haemolytic activity, cytotoxicity and membrane cell perme-
abilization of semi-synthetic and natural lupane- and oleanane-type
saponins. Bioorg Med Chem 17:2002–2008
Grodstein F, Goldman MB, Cramer DW (1993) Relation of tubal infer-
tility to history of sexually transmitted diseases. Am J Epidemiol
1
37:577–584
Funding Conselho Nacional de Desenvolvimento Científico e
Tecnológico (CNPq/Brazil), Marine Biotechnology Program (A.J.M.,
RedeMarAtivo, grant 408578/2013–0) and Universal Program (D.S.T.,
grant 443150/2014–1) supported this study. A.J.M., L.O.R, and T.T.
thank CNPq for researcher fellowships (grants 303353/2016–3, 306251/
Ignasiak K, Maxwell A (2017) Galleria mellonella (greater wax moth)
larvae as a model for antibiotic susceptibility testing and acute tox-
icity trials. BMC Res Notes 10(1):428
Iqbal H, Prabhakar V, Sangith A, Chandrika B, Balasubramanian R
(
2014) Synthesis, anti-inflammatory and antioxidant activity of
ring-A-monosubstituted chalcone derivatives. Med Chem Res 23:
383–4394
2
016–7, 312292/2017–1, respectively).
4
Compliance with ethical standards
Karimi-Sales E, Mohaddes G, Alipour MR (2018) Chalcones as putative
hepatoprotective agents: preclinical evidence and molecular mecha-
nisms. Pharmacol Res 129:177–187
Kavanagh K, Fallon JP (2010) Galleria mellonella larvae as models for
studying fungal virulence. Fungal Biol Rev 24:79–83
Conflict of interest The authors declare that they have no conflict of
interest.
Kirkcaldy RD, Augostini P, Asbel LE, Bernstein KT, Kerani RP,
Mettenbrink CJ, Pathela P, Schwebke JR, Secor WE, Workowski
KA, Davis D, Braxton J, Weinstock HS (2012) Trichomonas
vaginalis antimicrobial drug resistance in 6 US cities, STD surveil-
lance network, 2009-2010. Emerg Infect Dis 18:939–943
Kissinger P, Adamski A (2013) Trichomoniasis and HIV interactions: a
review. Sex Transm Infect 89:426–433
Publisher’s Note Springer Nature remains neutral with regard to jurisdictional
claims in published maps and institutional affiliations.
References
Alderete JF, Garza GE (1985) Specific nature of Trichomonas vaginalis
parasitism of host cell surfaces. Infect Immun 50:701–708
Kulda J (1999) Trichomonads, hydrogenosomes and drug resistance. Int J
Parasitol 29:199–212
Anthwal A, Rajesh UC, Rawat MS, Kushwaha B, Maikhuri JP, Sharma
VL, Gupta G, Rawat DS (2014) Novel metronidazole-chalcone
Land KM, Clemens DL, Johnson PJ (2001) Loss of multiple
hydrogenosomal proteins associated with organelle metabolism

Parasitol Res
and high-level drug resistance in trichomonads. Exp Parasitol 97:
02–110
blended triazole allied organosilatranes as giardicidal and
trichomonacidal agents. Eur J Med Chem 108:287–300
1
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression
data using real-time quantitative PCR and the 2(−Delta Delta C(T))
method. Methods 25:402–408
Mahapatra DK, Bharti SK, Asati V (2015) Chalcone scaffolds as anti-
infective agents: structural and molecular target perspectives. Eur J
Med Chem 101:496–524
Mirzaei H, Emami S (2016) Recent advances of cytotoxic chalconoids
targeting tubulin polymerization: synthesis and biological activity.
Eur J Med Chem 121:610–639
Mosmann T (1983) Rapid colorimetric assay for cellular growth and
survival: application to proliferation and cytotoxicity assays. J
Immunol Methods 65:55–63
Song HO, Shin MH, Ahn MH, Min DY, Kim YS, Ryu JS (2008)
Trichomonas vaginalis: reactive oxygen species mediates caspase-3
dependent apoptosis of human neutrophils. Exp Parasitol 118:59–65
Sutcliffe S, Neace C, Magnuson NS, Reeves R, Alderete JF (2012)
Trichomonosis, a common curable STI, and prostate
carcinogenesis–a proposed molecular mechanism. PLoS Pathog 8:
e1002801
Vieira PB, Tasca T, Secor WE (2017) Challenges and persistent questions
in treatment of trichomoniasis. Curr Top Med Chem 17:1249–1265
Viikki M, Pukkala E, Nieminen P, Hakama M (2000) Gynaecological
infections as risk determinants of subsequent cervical neoplasia.
Acta Oncol 39:71–75
World Health Organisation (2012) Global incidence and prevalence of
selected curable sexually transmitted infections – 2008. WHO,
Geneva
Wang Y, Gao H, Na XL, Dong SY, Dong HW, Yu J, Jia L, Wu YH (2016)
Aniline induces oxidative stress and apoptosis of primary cultured
hepatocytes. Int J Environ Res Public Health 13:1188
Noël JC, Fayt I, Romero-Munoz MR, Simon P, Engohan-Aloghe C
(2010) High prevalence of high-risk human papillomavirus infection
among women with Trichomonas vaginalis infection on monolayer
cytology. Arch Gynecol Obstet 282:503–505
Popoola OK, Marnewick JL, Rautenbach F, Ameer F, Iwuoha EI,
Hussein AA (2015) Inhibition of oxidative stress and skin aging-
related enzymes by prenylated chalcones and other flavonoids from
Helichrysum teretifolium. Molecules 20:7143–7155
Santos MB, Pinhanelli VC, Garcia MAP, Silva G, Baek SJ, França SC,
Fachin AL, Martins M (2017) Antiproliferative and pro-apoptotic
activities of 2′- and 4′-aminochalcones against tumor canine cells.
Eur J Med Chem 138:884–889
Secor WE, Meites E, Starr MC, Workowski KA (2014) Neglected para-
sitic infections in the United States: trichomoniasis. Am J Trop Med
Hyg 90:800–804
Singh G, Arora A, Mangat SS, Rani S, Kaur H, Goyal K, Sehgal R,
Maurya IK, Tewari R, Choquesillo-Lazarte D, Sahoo S, Kaur N
Zhai L, Blom J, Chen M, Christensen SB, Kharazmi A (1995) The
antileishmanial agent licochalcone a interferes with the function of
parasite mitochondria. Antimicrob Agents Chemother 39:2742–2748
Zhai L, Chen M, Blom J, Theander TG, Christensen SB, Kharazmi A
(1999) The antileishmanial activity of novel oxygenated chalcones
and their mechanism of action. J Antimicrob Chemother 43:793–803
Zhuang C, Zhang W, Sheng C, Zhang W, Xing C, Miao Z (2017)
Chalcone: a privileged structure in medicinal chemistry. Chem
Rev 117:7762–7810
Zeraik ML, Ximenes VF, Regasini LO, Dutra LA, Silva DH, Fonseca
LM, Coelho D, Machado SA, Bolzani VS (2012) 4'-
Aminochalcones as novel inhibitors of the chlorinating activity of
myeloperoxidase. Curr Med Chem 19:5405–5413
(
2016) Design, synthesis and biological evaluation of chalconyl