Molecular and biochemical characterisation of a serine acetyltransferase of onion, Allium cepa (L.)

Article abstract of DOI:10.1016/j.phytochem.2005.04.034

We have previously cloned a cDNA, designated SAT1, corresponding to a gene coding for a serine acetyltransferase (SAT) from onion (Allium cepa L.). The SAT1 locus was mapped to chromosome 7 of onion using a single-stranded conformation polymorphism (SSCP) in the 3′ UTR of the gene. Northern analysis has demonstrated that expression of the SAT1 gene is induced in leaf tissue in response to low S-supply. Phylogenetic analysis has placed SAT1 in a strongly supported group (100% bootstrap) that comprises sequences that have been characterised biochemically, including Allium tuberosum, Spinacea oleracea, Glycine max, Citrullus vulgaris, and SAT5 (AT5g56760) of Arabidopsis thaliana. This group can be divided further with the SAT1 of A. cepa sequence grouping strongly with the A. tuberosum sequence. Translation of SAT1 from onion generates a protein of 289 amino acids with a calculated molecular mass of 30,573 Da and pI of 6.52. The conserved G₂₇₇ and H₂₈₂ residues that have been identified as critical for l-cysteine inhibition are observed at G₂₇₂ and H₂₇₇. SAT1 has been cloned into the pGEX plasmid, expressed in E. coli and SAT activity of the recombinant enzyme has been measured as acetyl-CoA hydrolysis detected at 232 nm. A K_m of 0.72 mM was determined for l-serine as substrate, a K_m of 92 μM was calculated with acetyl-CoA as substrate, and an inhibition curve for l-cysteine generated an IC₅₀ value of 3.1 μM. Antibodies raised against the recombinant SAT1 protein recognised a protein of ca. 33 kDa in whole leaf onion extracts. These properties of the SAT1 enzyme from onion are compared with other SAT enzymes characterised from closely related species.

Full text of DOI:10.1016/j.phytochem.2005.04.034

PHYTOCHEMISTRY
Phytochemistry 66 (2005) 1407–1416
www.elsevier.com/locate/phytochem
Molecular and biochemical characterisation of a
serine acetyltransferase of onion, Allium cepa (L.)
a,
a
a
a,1
Michael T. McManus *, Susanna Leung , Anya Lambert , Richard W. Scott
,
b
Meeghan Pither-Joyce , Balance Chen , John McCallum
a
b
a
Institute of Molecular BioSciences, Massey University, Private Bag 11222, Palmerston North, New Zealand
New Zealand Institute for Crop & Food Research Limited, Private Bag 4704, Christchurch, New Zealand
b
Received 29 November 2004; received in revised form 21 April 2005
Abstract
We have previously cloned a cDNA, designated SAT1, corresponding to a gene coding for a serine acetyltransferase (SAT) from
onion (Allium cepa L.). The SAT1 locus was mapped to chromosome 7 of onion using a single-stranded conformation polymor-
phism (SSCP) in the 30 UTR of the gene. Northern analysis has demonstrated that expression of the SAT1 gene is induced in leaf
tissue in response to low S-supply. Phylogenetic analysis has placed SAT1 in a strongly supported group (100% bootstrap) that com-
prises sequences that have been characterised biochemically, including Allium tuberosum, Spinacea oleracea, Glycine max, Citrullus
vulgaris, and SAT5 (AT5g56760) of Arabidopsis thaliana. This group can be divided further with the SAT1 of A. cepa sequence
grouping strongly with the A. tuberosum sequence. Translation of SAT1 from onion generates a protein of 289 amino acids with
a calculated molecular mass of 30,573 Da and pI of 6.52. The conserved G277 and H282 residues that have been identified as critical
for L-cysteine inhibition are observed at G272 and H277. SAT1 has been cloned into the pGEX plasmid, expressed in E. coli and SAT
activity of the recombinant enzyme has been measured as acetyl-CoA hydrolysis detected at 232 nm. A Km of 0.72 mM was deter-
mined for L-serine as substrate, a Km of 92 lM was calculated with acetyl-CoA as substrate, and an inhibition curve for L-cysteine
generated an IC50 value of 3.1 lM. Antibodies raised against the recombinant SAT1 protein recognised a protein of ca. 33 kDa in
whole leaf onion extracts. These properties of the SAT1 enzyme from onion are compared with other SAT enzymes characterised
from closely related species.
ꢀ 2005 Elsevier Ltd. All rights reserved.
Keywords: Allium cepa (L.); Liliaceae; Onion; Recombinant enzyme; Serine acetyltransferase; Sulfur metabolism
1. Introduction
et al., 2002). The major form of S taken up by plants is
highly oxidised sulfate that is first activated and then re-
duced by the sequential activities of ATP sulfurylase
[EC 2.7.7.4], adenosine 50-phosphosulfate (APS) reduc-
tase [E.C. 1.8.99.2] and sulfite reductase [EC 1.8.7.1] to
produce sulfide. The final step in cysteine biosynthesis
is the incorporation of the reduced sulfide into O-acetyl
serine (OAS), to form cysteine.
The amino acid, L-cysteine, is the first organic sulfur
(S)-containing product of the reductive S-assimilation
pathway in higher plants. This reductive sulfur-assimila-
tion pathway in plants is now well characterised
(Hawkesford and Wray, 2000; Leustek et al., 2000; Hell
This final step is catalysed by two enzymes, serine
acetyltransferase (SAT; E.C. 2.3.1.30) that catalyses
the formation of OAS from acetyl-CoA and L-serine,
and O-acetylserine (thiol)lyase (OASTL; E.C. 4.2.99.8)
*
Corresponding author. Tel.: +64 6 3569099; fax: +64 6 3505688.
E-mail address: M.T.McManus@massey.ac.nz (M.T. McManus).
1
Present address: AgResearch Grasslands, Private Bag 11008,
Palmerston North, New Zealand.
0031-9422/$ - see front matter ꢀ 2005 Elsevier Ltd. All rights reserved.
doi:10.1016/j.phytochem.2005.04.034

1408
M.T. McManus et al. / Phytochemistry 66 (2005) 1407–1416
that catalyses the formation of L-cysteine by the incor-
poration of the reduced sulfide into OAS. These two ter-
minal enzymes co-operate to form a bi-enzyme complex,
termed cysteine synthase (Bogdanova and Hell, 1997),
and the structural domains that mediate the interaction
between these two enzymes have now been characterised
(Wirtz et al., 2001). This enzyme complex is of interest
for two reasons: (i) it represents a key mechanism for
cross-talk, via the generation of OAS, between S-assim-
ilation and carbon and nitrogen metabolism in plants
(Hesse et al., 2004), and (ii) the bi-enzyme complex acts
as an exquisite control point for the formation of cys-
teine. In the SAT–OASTL complex, SAT is active and
generates OAS, while the OASTL enzyme is inactive
but serves to stabilise SAT. Because OASTL is inactive
in the complex, the OAS is not channelled through the
complex, but is utilised by excess OASTL to form cys-
teine (Droux et al., 1998). However, given the impor-
tance of S nutrition in crop productivity, and in the
nutritional value of crops as both animal feeds and in
human nutrition, there is still comparatively little de-
tailed characterisation of the enzymes that comprise
the reductive S-assimilation pathway in a wide range
of higher plants.
While these studies with A. thaliana, A. tuberosum, C.
vulgaris, G. max, P. sativum, and S. oleracea have pro-
vided significant insight into the regulation of SAT, only
A. tuberosum is a significant accumulator of organosul-
fur compounds. Tissue disruption of Allium vegetables
like A. tuberosum and onion triggers enzymatic hydroly-
sis of alkyl cysteine sulfoxides (ACSOs) to form a com-
plex mixture of products with flavour and medicinal
properties (Randle and Lancaster, 2002). Therefore,
characterisation of the regulation of the S-assimilation
and downstream pathways that determine the nature
and extent of organosulfur compound accumulation is
required to inform breeding and production pro-
grammes for this economically important crop (Lancas-
ter et al., 2000; McCallum et al., 2001; McCallum et al.,
2005). As part of our longer-term aim to dissect the reg-
ulation of S-assimilation in onion, we report here on the
characterisation of a SAT enzyme from onion (Allium
cepa SAT1) including its feedback regulation by L-
cysteine.
2. Results
For SAT, characterisation, either as partially or puri-
fied protein, or as a recombinant enzyme, has been re-
ported for Allium tuberosum (Urano et al., 2000),
Arabidopsis thaliana (Noji et al., 1998; Howarth et al.,
2003), Citrullus vulgaris (Saito et al., 1995), Glycine
max (Chronis and Krishnan, 2004), Pisum sativum
(Droux, 2003), and Spinacea oleracea (Noji et al.,
2001). In earlier protein purification studies with leaf ex-
tracts of A. tuberosum, the SAT enzyme co-purified with
OASTL (Nakamura and Tamura, 1990), but has been
characterised as a separate, active enzyme from chloro-
plast preparations of S. oleracea (Ruffet et al., 1994) and
P. sativum (Droux, 2003). However, the expression of
SAT genes in E. coli to generate recombinant protein
has also provided a source of enzyme for characterisa-
tion studies. In a detailed study by Noji et al. (1998),
three SAT genes of A. thaliana were isolated and each
one shown to be targeted to either the chloroplast
(SAT-p; SAT1 as designated in Hell et al., 2002), the
mitochondrion (Sat-m; SAT3 as designated in Hell
et al., 2002), or the cytosol (SAT-c; SAT 5 as designated
in Hell et al., 2002). An important feature of this study
was the differential feedback regulation of the three SAT
genes by L-cysteine, in which SAT-c was feedback inhib-
ited, while the activity of SAT-m and SAT-p was unaf-
fected. Subsequent studies with recombinant enzymes
have identified L-cysteine-sensitive SAT isoforms from
A. tuberosum (Urano et al., 2000), C. vulgaris (Saito
et al., 1995), G. max (Chronis and Krishnan, 2004),
and S. oleracea (Noji et al., 2001), although only the iso-
form from spinach has been localised within the cell, and
shown to be targeted to the chloroplast.
2.1. Genetic mapping of the SAT1 locus
The SAT1 locus was mapped, using a single-stranded
conformation polymorphism (SSCP) in the 30 UTR of
the gene that segregated in the ÔW202AÕ · ÔTexas Grano
438Õ (WxT) F2 mapping population (Fig. 1). This poly-
morphism showed linkage to the SSCP marker API76
(McCallum et al., 2001) and two simple sequence repeat
(SSR) markers previously mapped to chromosome 7 in
the population ÔBYG15-23Õ · ÔAC43Õ used to develop
ACM091
0.0
API76
28.2
32.7
37.2
ACM157
SAT1
ACM134
47.3
Fig. 1. Linkage mapping of the SAT1 locus to chromosome 7 of onion
in the ÔW202A · Texas Grano 438Õ population. Loci in italics were
previously mapped to chromosome 7 of the ÔBYG15-23 · AC43Õ
genetic map (Martin et al., 2005).

M.T. McManus et al. / Phytochemistry 66 (2005) 1407–1416
1409
the onion linkage map (King et al., 1998; Martin et al.,
2005).
and a third group comprising a sequence from O. sativa,
and two from Zea mays (SATaseI and SATaseIII).
None of the gene products in this third group have been
characterised biochemically. The proposed or experi-
mentally deduced sub-cellular localisation is also shown,
but as yet very few sequences have been localised at the
sub-cellular level.
The A. cepa SAT1 sequence is also quite distinct from
the other A. thaliana sequences, with only 58% boot-
strap support to group with SAT-m (SAT3;
AT3g13110) and with SAT-p (SAT1; ATIg55920). A
second gene from the TIGR A. cepa Gene Index
(http://www.tigr.org; CF445069) was also used in the
phylogenetic analysis, and was found to group with
SAT1 and SAT3 of A. thaliana, rather than with the
A. cepa SAT1 gene under analysis in this study.
2.2. Regulation of SAT1 expression by S-supply
RNA was isolated from leaf tissue of onion of the
W202A cultivar at two developmental stages, designated
pre-bulbing (ca. 10-week-old seedlings) and at bulbing
(ca. 16-week-old seedlings). Plants were grown in either
low or sufficient sulfur, and northern analysis used to
determine the expression of the SAT1 gene in response
to S-supply (Fig. 2). In these experiments, there was
no discernable difference in the level of SAT1 expres-
sion, detected as an mRNA species of ca. 1.1 kb
(expected size: 1094 bp), in response to S-supply in
pre-bulbing leaf tissues, but in bulbing onions, the
expression of SAT1 was higher in leaves excised from
plants growing in low S.
2.4. Features of the deduced amino acid sequence
2.3. Phylogenetic analysis
Translation of the SAT1 gene from onion generates
a protein of 289 amino acids with a calculated molecu-
lar mass of 30,573 Da and pI of 6.52. An alignment of
the onion sequence with those more closely related se-
quences revealed by phylogenetic analysis, and for
which some biochemical characterisation has been re-
ported, is shown in Fig. 4. Comparison of the A. cepa
sequence with A. tuberosum reveals an identity of 97%
and a similarity of 100%, an identity of 66% and a sim-
ilarity of 76% to S. oleracea, and an identity of 70%
and a similarity of 85% with SAT5 of Arabidopsis.
Further comparisons reveal an identity of 75% and a
similarity of 87% with G. max, and an identity of
79% and a similarity of 90% with C. vulgaris. All of
these sequences contain the conserved G277 and H282
residues that have been identified in C. vulgaris as crit-
ical for L-cysteine inhibition (Inoue et al., 1999), with
Phylogenetic analysis was undertaken on 23 trans-
lated SAT sequences including the 5 genes of A. thaliana
(designated SAT1–SAT5; Hell et al., 2002) (Fig. 3). The
A. cepa SAT1 sequence is a member of a strongly sup-
ported group (100% bootstrap) that comprises se-
quences that have been characterised biochemically,
including A. tuberosum (GI: 7384806), S. oleracea (GI:
7433702), G. max (GI: 18252508), C. vulgaris (GI:
1361979) and SAT5 (AT5g56760) of A. thaliana, which
is equivalent to SAT-c, the cytosol-localised isoform as
shown by Noji et al. (1998). This group can be divided
further with the A. cepa SAT1 sequence grouping
strongly with the A. tuberosum sequence, a second group
comprising S. oleracea, Beta vulgaris, G. max, A. thali-
ana (SAT5), Nicotiana tabacum (SAT7) and C. vulgaris,
Fig. 2. Northern analysis of SAT1 expression in leaf tissues of onion in response to S-supply at the developmental stage, as indicated. Thirty
micrograms of total RNA was reduced in 2.2 M formaldehyde, separated through a 1% (w/v) agarose gel in 2.2 M formaldehyde, transferred to a
nylon membrane and probed with the 30-UTR region of the SAT1 gene. Details of hybridisation and washing conditions are described in Section 4.
Pre B = pre-bulbing; Post B = bulbing.

1410
M.T. McManus et al. / Phytochemistry 66 (2005) 1407–1416
Fig. 3. Amino acid sequence based phylogeny of selected SAT sequences. The phylogenetic tree (generated using parsimony) was constructed from
alignment of GenBank sequences with deduced amino acid sequences. Accession numbers for the sequences shown are: Allium cepa (putative
cytosolic) – GI 6601494, CF 445069_1; Allium tuberosum – GI 7384806; Arabidopsis thaliana, SAT1 – AT1g55920; Arabidopsis thaliana, SAT2 –
AT2g17640; Arabidopsis thaliana, SAT3 – AT3g13110; Arabidopsis thaliana, SAT4 – AT4g35640; Arabidopsis thaliana, SAT5 – AT5g56760; Beta
vulgaris – GI 28460066; Chlamydomonas reinhardtii – GI 20750301; Cicer arientum – GI 21615413; Citrullus vulgaris – GI 1361979; Glycine max – GI
18252508; Nicotiana plumbaginifolia, (SAT1) – GI 38350581; Nicotiana tabacum, SAT1 – GI 23343581; Nicotiana tabacum, SAT4 – GI 23343583;
Nicotiana tabacum, SAT7 – GI 23343585; Oryza sativa I – GI 22758278; Oryza sativa II – GI 34910686; Spinacea oleracea – GI 7433702; Zea mays,
SATaseI – GI 25991547; Zea mays, SATaseII – GI 25991549; Zea mays, SATaseIII – GI 25991545. [C] = cytoplasm location; [M] = mitochondrial
location; [P] = chloroplast location.
G272 and H277 the corresponding residues in the A. cepa
SAT1 sequence.
matrix, with the SAT protein moiety released using a
recombinant protease. This procedure yielded a protein
of ca. 33 kDa, as determined by SDS–PAGE (lane c,
Fig. 5A), and further purification of the protein
was undertaken using ion-exchange column chromatog-
raphy. The major protein of ca. 33,000 Da, the putative
recombinant SAT protein, eluted at 210–240 mM
NaCl. Activity assays confirmed that this fraction con-
tained SAT activity (data not shown), and SDS–PAGE
revealed this protein to be the major component in this
fraction, as determined by coomassie blue staining (lane
d, Fig. 5A).
2.5. Expression of SAT in E. coli and kinetic analysis of
the recombinant enzyme
The SAT1 gene of A. cepa was cloned into the pGEX
expression vector and expressed in E. coli as a GST:SAT
protein fusion. In response to IPTG induction, the fu-
sion accumulated with a mass of ca. 58 kDa (cf. lane b
with lane a, Fig. 5A). Affinity purification of the fusion
protein was achieved using a glutathione–Sepharose

M.T. McManus et al. / Phytochemistry 66 (2005) 1407–1416
1411
Fig. 4. CLUSTAL-X alignment of the SAT sequences form Arabidopsis thaliana SAT5 – AT5g56760, Citrullus vulgaris – GI 1361979, Glycine max –
GI 18252508, Spinacia oleracea – GI 7433702, Allium cepa – GI 6601494; Allium tuberosum – GI 7384806. (*) represents identical residues, (:)
represents similar residues, and (.) represents partial identity (4 out of 6 residues).
2.6. Western analysis of SAT expression
2.7. Kinetic characterisation of the recombinant SAT
enzyme
Whole leaf and chloroplast extracts were separated
using gradient SDS–PAGE, and challenged with anti-
bodies raised against the affinity purified SAT1 protein.
The antibody strongly recognised a protein of ca.
33 kDa in the whole leaf extract (lane a, Fig. 5B), and
weak recognition of two peptides of ca. 45 kDa and
ca. 70 kDa was observed in the separated chloroplast ex-
tracts (lanes b, c, Fig. 5B).
SAT activity was measured, using the recombinant
enzyme obtained by affinity purification, by acetyl-
CoA hydrolysis detected at 232 nm. Using L-serine as
substrate, a Km of 0.72 mM was determined while a
Km of 92 lM was calculated with acetyl-CoA as sub-
strate. An inhibition curve for L-cysteine was generated
using substrate concentrations of 5 mM L-serine and

1412
M.T. McManus et al. / Phytochemistry 66 (2005) 1407–1416
Fig. 5. (A) Expression of the SAT1 gene of A. cepa in E. coli strain BL-21 and purification using affinity chromatography and ion-exchange
chromatography. The proteins at each stage of the purification process were separated through a 12% SDS–PAGE gel and visualised using coomassie
blue staining. Lane a = whole cell lysate of non-induced E. coli Bl-21 cells; lane b = whole cell lysate of E. coli Bl-21 cells induced with 0.6 mM IPTG;
lane c = affinity purification of SAT1 using glutathione–Sepharose after cleavage of the GST–SAT1 fusion protein with protease; lane
d = purification of SAT1 using ion-exchange chromatography from the preparation shown as lane c. (B) Western analysis of a whole leaf extract of
A. cepa line W202A (lane a) and choloroplast preparations from A. cepa lines W202A (lane b) and Texas Grano W438 (lane c). Extracts were
separated though a 10–20% gradient gel, blotted onto a PVDF membrane, and challenged with antibodies to SAT1 from A. cepa. Antibody
recognition was determined using alkaline-phosphatase-linked secondary antibodies.
Fig. 6. Titration of recombinant SAT1 enzyme from A. cepa against increasing concentrations of L-cysteine using substrate concentrations of 5 mM
L-serine and 1 mM acetyl-CoA. The IC50 value is indicated.
1 mM acetyl-CoA, from which an IC50 value of 3.1 lM
was calculated (Fig. 6).
and an APS reductase gene have been shown to be
upregulated in response to S-deprivation in a pungent
(high accumulator of ACSOs) and mild (lower accumu-
lator or ACSOs) cultivar, while the transcription of an
ATP sulfurylase gene decreased in response to S-depri-
vation (McCallum et al., 2001). Further, the activity of
the APS reductase enzyme in leaf tissue of field-grown
onions in response to nitrogen (N) and S inputs did
not show the expected induction in response to low S in-
puts (McCallum et al., 2005). Collectively, these studies
suggest that there are differences in the control of the
reductive S-assimilation pathway in onion when
compared to the model species, A. thaliana. Thus the
characterisation of enzymes in the pathway in onion is
3. Discussion
Knowledge of the regulation of accumulation and
allocation of S by the Allium group of vegetables repre-
sents an important avenue for the improvement of their
flavour and medicinal benefits. However, there has been
comparatively little characterisation of the mechanism
of control of S uptake and assimilation in this important
group of crop plants. In roots of onion, the expression
of one member of the high-affinity-uptake gene family,

M.T. McManus et al. / Phytochemistry 66 (2005) 1407–1416
1413
important to understand the accumulation of S in this
important crop species, and this study focusses on the
serine acetyltransferase enzyme, SAT1.
family in onion also displays differential expression in
response to developmental or environmental cues.
Phylogenetic analysis supports this biochemical simi-
larity in that the SAT1 gene of A. cepa is placed in a
group of genes whose protein products have been char-
acterised biochemically, and shown to be feedback
inhibited by L-cysteine. Of those in which sub-cellular
localisation data have been sought, the SAT5 protein
of A. thaliana has been shown to be localised in the cyto-
sol (Noji et al., 1998), while the isoform encoded for by
the SAT gene of C. vulgaris has been shown not to occur
in the chloroplast. The activity of the SAT-m (SAT3)
and SAT-p (SAT1) enzymes of A. thaliana are not feed-
back inhibited by L-cysteine suggesting that this prop-
erty of SAT may be restricted to the cytosolic enzyme.
However, the SAT1 gene of A. cepa characterised in this
study, and the SAT5 gene of A. thaliana also groups
with the SAT gene from S. oleracea, which displays inhi-
bition of activity by L-cysteine and has been localised to
the chloroplast (Noji et al., 1998). In another study,
using a plastid isolated SAT enzyme from P. sativum,
Droux (2003) also demonstrated feedback inhibition
by L-cysteine. Further, Droux and colleagues reported
that the mitochondrial isoform was comparatively
weakly inhibited (IC50 of 205.3 lM) and no evidence
of L-cysteine inhibition could be detected in SAT activity
from a cytosol preparation (with less than 5% of mito-
chondria or chloroplast contamination) (Droux, 2003).
Phylogenetic analysis has also determined that the A.
cepa SAT1 gene and the A. tuberosum sequence form a
sub-group, suggesting a closer relationship between the
two species of Allium.
In this study, western analysis has shown that anti-
bodies raised against the recombinant gene product rec-
ognise a protein of the expected size in a leaf extract of
onion, but not one of the expected size in the chloroplast
preparation. We have raised antibodies to APS reduc-
tase, a plastid-localised enzyme and these antibodies
do recognise a protein of the expected mass in the chlo-
roplast (data not shown) suggesting that our plastid
preparations are sufficiently pure. We cannot, however,
exclude the possibility that the SAT enzyme under inves-
tigation in this study is localised in the mitochondria,
but the phylogenetic analysis places the gene as distant
from SAT-m and SAT-p from A. thaliana (Noji et al.,
1998). Two proteins were recognised, albeit weakly, in
the chloroplast preparation but the identity of these pro-
teins is yet to be determined. However, we cannot ex-
clude the possibility that the recognition is non-specific
in nature, and these proteins are not related to SAT1.
A survey of the literature suggests that inhibition of
SAT enzyme activity by L-cysteine is not restricted to
cytosolic forms, but in S. oleracea and P. sativum, at
least, the plastid-localised enzyme is inhibited (and for
P. sativum, the cytosolic enzyme is not). For A. cepa,
we have not characterised any plastid isoforms from
In terms of the biochemical data, a molecular mass of
30,573 Da for the onion enzyme compares well with
determinations for other SAT enzymes that are deduced
from SAT genes including 31,536 Da from C. vulgaris
(Saito et al., 1995), 32,700 Da from SAT5 (SAT-p; Noji
et al., 1998) and 30,300 Da from G. max (Chronis and
Krishnan, 2004). The Km value for L-serine as substrate
of 0.72 mM for the onion enzyme compares well with a
value of 0.59 mM for C. vulgaris when expressed as a re-
combinant enzyme (Saito et al., 1995), but is lower than
other recombinant enzyme values including 2.71 mM for
SAT5 of A. thaliana (SAT-c; Noji et al., 1998) and
2.27 mM for G. max (Chronis and Krishnan, 2004),
and with the isoform purified from plastids (2.29 mM;
Ruffet et al., 1994). For acetyl-CoA, a Km value
of 92 lM again compares well with C. vulgaris
(0.13 mM), but is lower than values determined for
SAT5 (SAT-c; 0.28 mM) and G. max (0.31 mM), and
a determination of 0.35 mM for the purified plastid en-
zyme of S. oleracea (Ruffet et al., 1994). These data sug-
gest that SAT1 of A. cepa is not significantly distinct,
kinetically, from the SAT1 enzyme that has been charac-
terised in both S-accumulating and non S-accumulating
plants.
Titrations with L-cysteine determined that the SAT
activity is inhibited by the presence of the amino acid,
L-cysteine. An IC50 value of 3.1 lM L-cysteine compares
well with values of 2.9 lM for C. vulgaris, 1.8 lM for
SAT5 of Arabidopsis, and 7.6 lM for S. oleracea (Noji
et al., 2001). In addition, a plastid isoform of SAT iso-
lated from S. oleracea has also been shown to be inhib-
ited by L-cysteine with an IC50 value of 12.2 lM (Droux,
2003). However, the IC50 value calculated for SAT1 is
lower than a value of 48.7 lM calculated for the recom-
binant enzyme from A. tuberosum (Urano et al., 2000).
In their study, Urano et al. (2000) argued that the cyto-
solic form of SAT they had characterised was feedback-
insensitive to cysteine and that this, in part, accounted
for the significant accumulation of S-containing in A.
tuberosum. As onion also accumulates significant levels
of S-containing compounds, one would expect that at
least one of the SAT family may also be feedback-insen-
sitive to cysteine. However, SAT1 is feedback regulated
by cysteine suggesting that the function of this isoform is
not as part of the regulatory mechanism that allows sig-
nificant pools of S-containing compounds to accumu-
late. Indeed, northern analysis has shown that SAT1 is
induced in leaves of bulbing onions by low S-supply,
indicating that this isoenzyme may be involved in the re-
sponse to low S-stress. Further, it has been well estab-
lished in A. thaliana that the SAT multi-gene family
displays tissue-specific patterns of expression (Howarth
et al., 2003), and so it is probable that the multi-gene

1414
M.T. McManus et al. / Phytochemistry 66 (2005) 1407–1416
the protein family, and so cannot speculate further on
this aspect of control of the SAT enzyme in different
compartments of leaf cells of onion. However, the inhi-
bition of activity by L-cysteine is common to other plant
species that are not significant S-accumulators, e.g.,
water melon, suggesting that if there are different points
of control of the pathway in S-accumulators such as
onion, then these may not be focussed around this
SAT gene.
presence of 2.2 M formaldehyde. After transfer to a ny-
lon membrane, the separated RNA was probed with the
3-UTR (284 bp) region of the SAT1 gene. The probe
was amplified using a forward primer, 50- AAGGTCG-
GAGCAGGGTCT-30, positioned at +740 to +758 bp in
the SAT1 sequence, and a reverse primer, 50-AAC-
AACAAGACGATCACGTACAA-30, positioned at
+1001 to +1024 bp in the SAT1 gene sequence. The
284 bp probe was labelled with [a-32P]dATP using the
Megaprimee DNA labelling kit (Amersham Biosci-
ences, Piscataway, NJ, USA), and northern analysis per-
formed essentially as described in Hunter et al. (1999).
Hybridisation was recorded using a FUJI PLA-5000
Phospho-Imager.
4. Experimental
4.1. Plant material
An F2 family of 82 plants was developed from the
ÔW202AÕ · ÔTexas Grano 438Õ (W · T) population by
self-pollinating a single F1 plant derived from a bulk
cross between ÔW202AÕ (Goldman et al., 2000) and
ÔTexas Grano 438Õ (Asgrow Seed Co.).
4.5. Expression and purification of SAT as a recombinant
protein in E. coli
The SAT cDNA, previously cloned (AF212156;
McCallum et al., 2002) into the pBluescript vector,
was used as template for the PCR amplification with a
forward primer (SAT-F1) comprising 50-CAGCAG-
CCGAATTCCATGCCATGCTCAACTCTT-30, and a
reverse primer (SAT-R1) comprising 50-CAGCAGC-
TCGAGTCAGATGATATAATCCGACC-30. The ampli-
fied product had a 50-EcoR1 site and a 30-Xho1 site to
afford the directional cloning of the reading frame into
the polylinker of the pGEX-GP-3 plasmid (Amersham
Biosciences), to provide a fusion protein with glutathi-
one-S-transferase (GST), and a N-terminal 8-amino acid
residue extension in the translated protein product after
protease digestion (Gly-Pro-Leu-Gly-Ser-Pro-Asn-Ser).
The pGEX-GP-3 vector with the SAT insert was trans-
formed into E. coli strain BL21, and translation of the
SAT gene insert induced with the addition of 0.6 mM
IPTG and incubation at 20 ꢁC for 18 h. After this incu-
bation period, cells were collected by centrifugation at
3000g for 10 min at 4 ꢁC, the cells lysed by French Press
at 15 kpsi, and the slurry centrifuged at 12,000g for
20 min at 4 ꢁC. The fusion protein was isolated by incu-
bation with glutathione–Sepharose (Amersham BioSci-
ences), pre-equilibrated in phosphate-buffered saline,
for 30 min at 25 ꢁC. The Sepharose containing the
bound GST–SAT fusion protein was then collected by
centrifugation at 500g for 5 min at 25 ꢁC, the resin then
washed once with PBS, and then once with protease
cleavage buffer (50 mM Tris–HCl, pH 7.0 containing
150 mM NaCl, 1 mM EDTA and 1 mM DTT) before
release of the SAT protein by incubation with Precission
Protease (Amersham BioSciences) for 18 h at 25 ꢁC. The
Sepharose was collected by centrifugation at 500g for
5 min at 25 ꢁC, and an aliquot of the supernatant con-
taining the recombinant SAT protein was examined by
4.2. Plant growth and regulation by S-supply
Germinated seeds of the W202A cultivar were trans-
ferred to ÔOasisÕ Horticultural foam blocks, and at the
second leaf stage blocks were transferred to 18 L tubs
containing Hoagland media (Hoagland and Arnon,
1950). Plants were maintained in the glasshouse as de-
scribed in McCallum et al. (2002), and high S [4 Meq
S] and low S [0.1 Meq] media, supplied by varying the
concentration of MgSO4, Mg(NO3)2 and Ca(NO3)2 in
Hoagland media. Leaf material was excised from plants
at a pre-bulbing stage (ca. 10-week-old seedlings), and at
bulbing (ca. 16-week-old stage).
4.3. Genetic mapping
DNA isolation, PCR conditions and single-stranded
conformation polymorphism analysis (SSCP) were per-
formed as described previously (McCallum et al.,
2001). The SAT1 locus was amplified using the primers
SAT 50 AAGGTCGGAGCAGGGTCT and SAT30
AACAACAAGACGATCACGTACAA and scanned
for SSCPs. SSR markers were analysed according to
Martin et al.(2005) and the SSR locus ACM157 was
amplified using the primers ACM157L GCTAGTTG-
TACCTGCGCCTC and ACM157R TTGTTGTTGG-
TGTTTCCAGG. Linkage analysis was performed with
Joinmap 3.0 software (Van Ooijen and Voorrips, 2001).
4.4. Isolation of RNA and northern analysis
Total RNA was isolated from leaf tissue as described
in McCallum et al. (2002). For northern analysis, 30 lg
of total RNA was reduced in 2.2 M formaldehyde, and
then separated through a 1% (w/v) agarose gel in the
SDS–PAGE. Staining revealed
a protein of ca.
33,000 Da as the major protein in the fraction, the ex-
pected mass of the recombinant SAT protein with the

M.T. McManus et al. / Phytochemistry 66 (2005) 1407–1416
1415
8-amino acid N-terminal extension, but other minor
contaminants were clearly discernable.
4.8. SDS–PAGE and western analysis
To purify the recombinant SAT protein, the superna-
tant after protease digestion was exchanged into 50 mM
Tris–HCl, pH 7.5 (buffer A), and loaded onto a Mono Q
HR 5/5 ion-exchange column (Amersham BioSciences).
Bound proteins were eluted within a gradient of 100%
A:0% buffer B (buffer A containing 1.0 M NaCl) to
0% buffer A:100% buffer B. To localise the eluted SAT
enzyme, activity was then measured in each of the FPLC
fractions.
To make chloroplast extracts, whole chloroplasts
were thawed, an equal volume of ice-cold water added
and the slurry homogenised using a mortar and pestle.
The slurry was then centrifuged at 13,000 g for 10 min
at 4 ꢁC, and the supernatant used directly for SDS–
PAGE. For leaf extracts, whole leaf tissue from onion
line W202A was extracted in a morter and pestle with
50 mM potassium phosphate buffer, pH 7.5 containing
1.0 mM DTT and 1.0 mM EDTA, using a buffer:fresh
weight ratio of 3:1. The slurry was then centrifuged at
13,000 g for 10 min at 4 ꢁC, and the supernatant used di-
rectly for SDS–PAGE. SDS–PAGE was performed
either using a 12% continuous, or 10 % to 20% gradient
gel and western transfer used the method essentially as
described in Lancaster et al. (2000). Determination of
molecular masses of proteins was as described by Hames
and Rickwood (1981).
4.6. Measurement of SATase activity
SAT enzyme activity was determined from the rate of
decrease in absorbance at A232 nm due to cleavage of the
thioester bond in acetyl-CoA (Baecker and Wedding,
1980). For Km determinations with L-serine as substrate,
a concentration range of 0.1–20 mM was used, while for
the determination of the Km for acetyl-CoA, substrate
concentrations of 0.5–10 mM were used. For the L-cys-
teine titrations, substrate concentrations of 5 mM L-ser-
ine and 1 mM acetyl-CoA were used. All assays were
buffered with 50 mM Tris–HCl, pH 8.0, the enzyme
reaction initiated with the addition of L-serine, and con-
ducted at 25 ꢁC. The molar extinction co-efficient of ace-
tyl-CoA of e = 4500 was used to calculate rates.
4.9. Phylogenetic analysis
A majority rule consensus tree (neighbour joining/ob-
served distances/100 bootstraps) was built using the
computer programme ÔPhylogenetic Analysis Using Par-
simony *Õ (PAUP* version 4.0 od64, Sinaur Associates,
Inc. Publishers, Sunderland, MA, USA). Sequences used
to construct the tree are identified by accession number
in the figure legend.
4.7. Isolation of chloroplasts from leaf tissue of A. cepa
Ice-cold leaf tissue of A. cepa lines W202A and Texas
Grano 438 (5 g) were homogenised in 25 ml of ice-cold
isolation medium (50 mM Tricine–KOH, pH 7.9, con-
taining 2.0 mM EDTA, 1 mM MgCl2 and 330 mM sor-
bitol) using an Ultra-Turrax blender for 10 s. The slurry
was filtered through three layers of ice-cold miracloth
into a 50-mL capacity plastic centrifuge tube, and the fil-
trate centrifuged at 1465g for 3 min at 4 ꢁC. The super-
natant was carefully decanted and the pellet resuspended
with 5 mL of isolation medium. The slurry was then
carefully layered onto a 40% (v/v):80% (v/v) (12 mL of
each made up in isolation medium) discontinuous Per-
coll gradient (Sigma–Aldrich) made in a 30-mL capacity
Corex glass centrifuge tube, and centrifuged at 3300g for
10 min at 4 ꢁC. The upper 40% layer was removed down
to the chloroplast fraction at the 40%–80% interface,
fresh isolation medium added, the content mixed and
then centrifuged as before. On the conclusion of centri-
fugation, the chloroplast fraction had migrated towards
the bottom of the Corex tube, and so the upper layer
was again removed, fresh ice-cold isolation medium
added, the contents mixed and centrifuged as described.
After centrifugation, the isolation medium supernatant
was removed and the chloroplast pellet was resuspended
in a small volume (ca. 500 lL) of residual isolation med-
ium, before storage at ꢀ20 ꢁC until use.
Acknowledgements
The authors thank Dr. Peter Lockhart, Institute of
Molecular BioSciences, Massey University for assistance
with the phylogenetic analysis.
References
Baecker, P., Wedding, R.T., 1980. Purification of serine acetyltrans-
ferase, a component of a multienzyme complex, by immunoad-
sorption and selective dissociation of the complex. Anal. Biochem.
102, 16–21.
Bogdanova, N., Hell, R., 1997. Cysteine synthesis in plants: protein–
protein interactions of serine acetyltransferase from Arabidopsis
thaliana. Plant J. 11, 251–262.
Chronis, D., Krishnan, H.B., 2004. Sulfur assimilation in soybean
(Glycine max [L.] Merr.): molecular cloning and characterization of
a cytosolic isoform of serine acetyltransferase. Planta 218, 417–426.
Droux, M., 2003. Plant serine acetyltransferase: new insights for
regulation of sulphur metabolism in plant cells. Plant Physiol.
Biochem. 41, 619–627.
Droux, M., Ruffet, M.-L., Douce, R., Job, D., 1998. Interactios
between serine acetyltransferase and O-acetyltransferase (thiol)
lyase in higher plants. Eur. J. Biochem. 255, 235–245.
Goldman, I.L., Schroek, G., Havey, M.J., 2000. History of public
onion breeding programs in the United States. Plant Breeding
Reviews 20, 68–103.

1416
M.T. McManus et al. / Phytochemistry 66 (2005) 1407–1416
Hames, B.D., Rickwood, D., 1981. Gel Electrophoresis of Proteins: a
Practical Approach. IRL Press, Oxford, Washington, DC.
Hawkesford, M.J., Wray, J.L., 2000. Molecular genetics of sulphate
assimilation. Adv. Bot. Res. 33, 159–223.
McCallum, J., Pither-Joyce, M., Shaw, M., 2002. Sulfur deprivation
and genotype affect gene expression and metabolism in onion roots.
J. Am. Soc. Hort. Sci. 127, 583–589.
McCallum, J., Porter, N., Searle, B., Shaw, M., Bettjeman, B.,
McManus, M.T., 2005. Sulfur and nitrogen fertility affects flavour
of field-grown onions. Plant and Soil (in press).
Hell, R., Jost, R., Berkowitz, O., Wirtz, M., 2002. Molecular and
biochemical analysis of the enzymes of cysteine biosynthesis in the
plant Arabidopsis thaliana. Amino Acids 22, 245–257.
Nakamura, K., Tamura, G., 1990. Isolation of serine acetyltransferase
complexed with cysteine synthase from Allium tuberosum. Agric.
Biol. Chem. 54, 649–656.
Hesse, H., Nikiforova, V., Gakie`re, B., Hoefgen, R., 2004. Molecular
analysis and control of cysteine biosynthesis: integration of
nitrogen and sulphur metabolism. J. Exp. Botany 55, 1283–1292.
Hoagland, D.R., Arnon, D.I., 1950. The water culture method for
growing plants without soil. Calif. Agric. Exp. Stn. Circ., No.347.
Howarth, J.R., Dominguez-Solis, J.R., Gutierrez-Alcala, G., Wray,
J.L., Romero, L.C., Gotor, C., 2003. The serine acetyltransferase
gene family in Arabidopsis thaliana and the regulation of its
expression by cadmium. Plant Mol. Biol. 51, 589–598.
Noji, M., Inoue, K., Kimura, N., Gouda, A., Saito, K., 1998. Isoform-
dependent differences in feedback regulation and subcellular
localization of serine acetyltransferase involved in cysteine biosyn-
thesis from Arabidopsis thaliana. J. Biol. Chem. 273, 32739–
32745.
Noji, M., Takagi, Y., Kimura, N., Inoue, K., Saito, M., Horikoshi,
M., Saito, F., Takahashi, H., Saito, K., 2001. Serine acetyltrans-
ferase involved in cysteine biosynthesis from spinach: molecular
cloning, characterization and expression analysis of cDNA encod-
ing a plastidic isoform. Plant Cell Physiol. 42, 627–634.
Van Ooijen, J.W., Voorrips, R.E., 2001. JoinMap (r) 3.0, Software for
the Calculation of Genetic Linkage Maps. Plant Research Inter-
national BV, Wageningen, The Netherlands.
Hunter, D.A., Yoo, S.D., Butcher, S.M., McManus, M.T., 1999.
Expression of 1-aminocyclopropane-1-carboxylate oxidase during
leaf ontogeny in white clover. Plant Physiol. 120, 131–141.
Inoue, K., Noji, M., Saito, K., 1999. Determination of the sites
required for the allosteric inhibition of serine acetyltransferase by
L-cysteine in plants. Eur. J. Biochem. 266, 220–227.
King, J.J., Bradeen, J.M., Bark, O., McCallum, J.A., Havey, M.J.,
1998. A low-density genetic map of onion reveals a role for tandem
duplication in the evolution of an extremely large diploid genome.
Theor. Appl. Genet. 96, 52–62.
Randle, W.M., Lancaster, J.E., 2002. Sulfur compounds in Alliums in
relation to flavour quality. In: Rabinowitch, H., Currah, L. (Eds.),
Allium Crop Science – Recent Advances. CABI Publishing, Oxford,
pp. 1–62.
Lancaster, J.E., Shaw, M.L., Pither-Joyce, M.D., McCallum, J.,
McManus, M.T., 2000. A novel alliinase from onion (Allium cepa
L.) roots: biochemical characterization and cDNA cloning. Plant
Physiol. 122, 1269–1279.
Ruffet, M.-L., Droux, M., Douce, R., 1994. Purification and kinetic
properties of serine acetyltransferase free of O-acetylser-
ine(thiol)lyase from spinach chloroplasts. Plant Physiol. 104, 597–
604.
Leustek, T., Martin, M.N., Bick, J.A., Davies, J.P., 2000. Pathways
and regulation of sulfur metabolism revealed through molecular
and genetic studies. Annu. Rev. Plant Physiol. Plant Mol. Biol. 51,
141–165.
Saito, K., Yokoyama, H., Noji, M., Murakoshi, I., 1995. Molecular
cloning and characterization of a plant serine acetyltransferase
playing a regulatory role in cysteine biosynthesis from watermelon.
J. Biol. Chem. 270, 16321–16326.
Martin, W., McCallum, J., Shigyo, M., Jakse, J., Kuhl, J.C., Yamane,
N., Sink, K.C., Town, C.D., Havey, M.J., 2005. Genetic mapping
of expressed sequences in onion and in silico comparisons with rice
show scant colinearity. Mol. Gen. Genet. (in press).
Urano, Y., Manabe, T., Noji, M., Saito, K., 2000. Molecular cloning
and functional characterization of cDNAs encoding cysteine
synthase and serine acetyltransferase tht may be responsible for
high cellular cysteine content in Allium tuberosum. Gene 257, 269–
277.
McCallum, J.A., Leite, D., Pither-Joyce, M., Havey, M.J., 2001.
Expressed sequence markers for genetic analysis of bulb onion
(Allium cepa. L.). Theor. Appl. Genet. 103, 979–991.
Wirtz, M., Berkowitz, O., Droux, M., Hell, R., 2001. The cysteine
synthase complex from plants. Eur. J. Biochem. 268, 686–693.