Engineering anthracycline biosynthesis toward angucyclines

Article abstract of DOI:10.1128/AAC.47.4.1291-1296.2003

The biosynthesis pathways of two anthracyclines, nogalamycin and aclacinomycin, were directed toward angucyclines by using an angucycline-specific cyclase, pgaF, isolated from a silent antibiotic biosynthesis gene cluster. Addition of pgaF to a gene cassette that harbored the early biosynthesis genes of nogalamycin resulted in the production of two known angucyclinone metabolites, rabelomycin and its precursor, UWM6. Substrate flexibility of pgaF was demonstrated by replacement of the nogalamycin minimal polyketide synthase genes in the gene cassette with the equivalent aclacinomycin genes together with aknE2 and aknF, which specify the unusual propionate starter unit in aclacinomycin biosynthesis. This modification led to the production of a novel angucyclinone, MM2002, in which the expected ethyl side chain was incorporated into the fourth ring.

Full text of DOI:10.1128/AAC.47.4.1291-1296.2003

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 2003, p. 1291–1296
0066-4804/03/$08.00ϩ0 DOI: 10.1128/AAC.47.4.1291–1296.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Vol. 47, No. 4
Engineering Anthracycline Biosynthesis toward Angucyclines
Mikko Mets¨a-Ketel¨a,1* Kaisa Palmu,1 Tero Kunnari,2 Kristiina Ylihonko,2
and Pekka M¨ants¨al¨a1
Department of Biochemistry, University of Turku, FIN-20014 Turku,1 and Galilaeus Oy,
FIN-20781 Kaarina,2 Finland
Received 2 October 2002/Returned for modification 1 November 2002/Accepted 6 January 2003
The biosynthesis pathways of two anthracyclines, nogalamycin and aclacinomycin, were directed toward
angucyclines by using an angucycline-specific cyclase, pgaF, isolated from a silent antibiotic biosynthesis gene
cluster. Addition of pgaF to a gene cassette that harbored the early biosynthesis genes of nogalamycin resulted
in the production of two known angucyclinone metabolites, rabelomycin and its precursor, UWM6. Substrate
flexibility of pgaF was demonstrated by replacement of the nogalamycin minimal polyketide synthase genes in
the gene cassette with the equivalent aclacinomycin genes together with aknE2 and aknF, which specify the
unusual propionate starter unit in aclacinomycin biosynthesis. This modification led to the production of a
novel angucyclinone, MM2002, in which the expected ethyl side chain was incorporated into the fourth ring.
Aromatic polyketides consist of a large group of structurally
diverse natural products that exhibit a broad range of biolog-
ical activities. Despite the structural diversity found within
different aromatic polyketides, they all arise from a fundamen-
tally similar biosynthesis pathway which has been elucidated
for many representatives of this class of natural products (for
a review, see reference 4). Biosynthesis begins with the con-
densation of a specific number of small carboxylic acids by the
iterative action of the minimal polyketide synthase (minPKS)
complex, which consists of two ketosynthases (KS␣ and KS␤)
and an acyl carrier protein (ACP) onto which the growing
polyketide chain is attached via a flexible phosphopantetheinyl
arm. The polyketide chain is subsequently folded into a range
of different aromatic compounds by various ketoreductases
(KR), cyclases (CYC), and aromatases (ARO). Finally, tailor-
ing reactions catalyzed by diverse oxygenases (OXY), methyl-
ases, and reductases, as well as possible noncatalyzed reac-
tions, often further modify the aglycone formed. In this work
the latter turned out to be important because of the reactive
nature of the isolated intermediates (see below).
The convergent biosynthesis pathways have prompted re-
search into combinatorial biosynthesis, a method that uses
genetic engineering of metabolic pathways to provide modified
natural products for drug discovery (6, 8). Early research led to
the identification of a set of design rules (12) which could be
used to engineer novel aromatic polyketides in a predictable
manner. However, later research has shown that in many in-
stances different combinations of antibiotic biosynthesis genes
have not resulted in the production of the expected com-
pounds. In particular, the jadI cyclase gene from the biosyn-
thesis pathway of the angucycline antibiotic jadomycin has
been reported to be incompatible with tetracenomycin (11)
and daunorubicin (20) biosynthesis genes. Similarly, the tetra-
cenomycin (tcmI) and daunorubicin (dpsY) cyclase genes were
nonfunctional with jadomycin biosynthesis genes (11, 20).
We have recently isolated a silent antibiotic biosynthesis
gene cluster that exhibits strong sequence homology to the
known angucycline gene clusters (M. Mets¨a-Ketel¨a, unpub-
lished results) from soil isolate Streptomyces sp. strain PGA64.
The cluster contains a cyclase gene designated pgaF, according
to the other homologous angucycline cyclases lanF and urdF
from the landomycin (19) and urdamycin (3) biosynthesis path-
ways, respectively. All of these cyclases also display sequence
homology to the jadI cyclase, which has been proven to be
responsible for the cyclization of the fourth, angular ring in
jadomycin biosynthesis (11).
Our previous investigations on the biosynthesis pathways of
the anthracycline antibiotics nogalamycin (17, 24) and aclaci-
nomycins (14) (Fig. 1) combined with the genes from the silent
angucycline gene cluster presented us an opportunity to study
the interface of these two classes of aromatic polyketides and
to assess the extent to which these pathways are compatible. In
particular, the nogalamycin biosynthesis genes offered a good
starting point for this study, since nogalamycin biosynthesis
proceeds identically, up to a point, to the proposed biosynthe-
sis pathways of angucyclines (Fig. 2); in both pathways the
polyketide chain synthesized is composed of 10 acetates and
the C-9 ketone is reduced to hydroxyl, followed by cyclization
between C-7 and C-12 and aromatization of the first ring. The
second ring is also closed in a similar manner, and differences
start to appear only in the third cyclization event, in which
opposite carbons (C-16 in nogalamycin and C-4 in angucy-
clines) carry out the nucleophilic attack.
The biosynthesis of aklavinone, the aglycone moiety of
aclacinomycin, progresses highly similarly to that of nogalamy-
cin, with the exception of the use of a propionate starter unit,
which results in an ethyl side chain in the fourth ring (14), and
the stereochemistry in the cyclization of the fourth ring, which
is opposite in the nogalamycin and aclacinomycin biosynthesis
pathways (16). In this study, the differences in anthracycline
starter unit utilization could be used to investigate the sub-
strate flexibility of PgaF, as priming of the minPKS complex
with propionate results in an unnatural substrate for PgaF that
is composed of a longer carbon chain (Fig. 2). Here we report
* Corresponding author. Mailing address: Department of Biochem-
istry and Food Chemistry, University of Turku, Vatselankatu 2, FIN-
20014 Turku, Finland. Phone: 358-2-333 6847. Fax: 358-2-333 6860.
E-mail: mianme@utu.fi.
1291

¨
¨
1292
METSA-KETELA ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
products were cloned with the TOPO-TA cloning system (Invitrogen, Carlsbad,
Calif.) and sequenced with an automatic ABI310 DNA sequencer (Applied
Biosystems, Foster City, Calif.). DNA isolations and manipulations were carried
out by standard procedures (9, 15). DNA propagated in E. coli was introduced by
standard protoplast transformation into S. lividans TK24 (9).
Expression constructs. The nogalamycin biosynthesis genes were previously
amplified (J. Kantola, unpublished results) by PCR with oligonucleotide primers
that contain unique restriction sites at their ends (Table 1) to facilitate the
construction of the desired expression vectors. The genes snoa1-a3, snoaD, and
snoaE were combined in pUC19 (22) one at the time by using standard molecular
biology methods (15) to give plasmid pMC5. The angucycline cyclase pgaF was
inserted as a Klenow fragment-treated EcoRI fragment to a similarly blunt-
ended NheI site of the pMC5 cassette, resulting in plasmid pMC6B (Fig. 3). To
investigate the effect of the aclacinomycin minPKS genes, the sno minPKS genes
were first removed from plasmid pMC6BD by XbaI-NheI digestion, and the akn
genes were inserted as an XbaI-NheI fragment to give plasmid pSJ10 (Fig. 3).
Plasmid pMC6BD was used in this case, because the NheI restriction site in
pMC6B was no longer intact, as it was used for insertion of the pgaF cyclase gene.
Plasmid pMC6BD, which causes the production of the same compounds as
pMC6B in S. lividans TK24, differs from pMC6B in that it contains an aromatase
(the pgaL gene from the silent angucycline gene cluster) different from the
homologous nogalamycin snoaE aromatase. Both constructs were ligated as
XbaI-HindIII fragments to similarly digested vector Streptomyces(pIJE486) and
introduced into S. lividans TK24. In this system, all of the genes are expressed
from the constitutive ermE promoter from Saccharopolyspora erythraea (9), which
has been cloned into the polylinker of Streptomyces cloning vector pIJ486 (18).
Isolation and purification of products. For structure elucidation the strains
were grown in 250-ml flasks (a total of 2 liters of E1 medium supplemented with
thiostrepton [50 ␮g/ml] and XAD-7 absorbent [20 g/liter] at 30°C and 330 rpm)
for 7 days. Compounds were extracted with acidic methanol-chloroform (1:3)
and evaporated to dryness. The crude extract was subjected to silica gel liquid
chromatography and was further separated by reversed-phase high-pressure liq-
uid chromatography on a Merck Hitachi instrument (L-6200A/L-4250).
Instrumental analysis. Structural elucidation of the compounds by nuclear
magnetic resonance (NMR) was performed with a JEOL JNM-GX 400 spec-
trometer in dimethyl sulfoxide (DMSOd6). The spectra were run at ambient
temperatures in the solvent, and both the 1H and 13C NMR spectra were
referenced internally to tetramethylsilane, which was assigned a value of 0 ppm.
Nucleotide sequence accession number. The 16.5-kb DNA fragment se-
quenced from Streptomyces sp. strain PGA64 has been submitted to GenBank
and given accession number AY034378.
FIG. 1. Structures of anthracycline antibiotics nogalamycin (a),
produced by S. nogalater, and aclacinomycin A, produced by S. gali-
laeus (b), and an example of angucycline antibiotic rabelomycin (c).
Black and gray lines indicate atoms derived from PKS and deoxysugar
biosynthesis pathways, respectively.
RESULTS AND DISCUSSION
on the use of the pgaF cyclase to divert the biosynthetic path-
ways of two anthracyclines, nogalamycin and aclacinomycin,
toward angucyclines.
Deduced function of pgaF gene product. The gene cluster
designated pga was cloned from a rubromycin-producing soil
isolate, Streptomyces sp. strain PGA64. Analysis of the 16.5-kb
DNA fragment sequenced revealed that the region was most
similar to gene clusters involved in the biosynthesis of angucy-
cline metabolites (Mets¨a-Ketel¨a, unpublished). In particular,
the cluster harbors a gene designated pgaF, which is homolo-
gous to various cyclases found in angucycline biosynthesis gene
clusters. These cyclases are distinct from other cyclases found
in databases, and although they do show a lower degree of
similarity to other cyclases involved in secondary metabolite
production, they are indicative of angucycline biosynthesis.
pgaF encodes a short 109-amino-acid peptide which is most
related to the lanF gene product from the landomycin biosyn-
thesis (19) pathway (82% identity, 92% similarity), followed by
the jadI gene product (79% identity, 86% similarity), which has
been shown to cyclize the last angular ring in jadomycin bio-
synthesis (11).
MATERIALS AND METHODS
Bacterial strains and cultivation of bacteria. The bacterial strain designated
PGA64 was obtained from a soil sample collected in Barcelona, Spain. One gram
of the dried soil sample was suspended in 5 ml of H2O and centrifuged to remove
solid substances. The supernatant containing bacterial strains was spread as
100-␮l aliquots on International Streptomyces Project (ISP) medium 4-related
(ISP4) agar plates in which fructose replaced starch as a carbon source and that
were supplemented with heximide (25 ␮g/ml). Soil isolate PGA64 was purified
on agar plates by repeated plating. Cultures were maintained on ISP4 agar
(Difco, Detroit, Mich.), which is a medium commonly used to isolate Streptomy-
ces and closely related genera from soil. Manipulations of Streptomyces DNA
were carried out with Escherichia coli XL2-Blue (Stratagene, La Jolla, Calif.).
The Streptomyces strains used were Streptomyces nogalater ATCC 27451 (2),
Streptomyces galilaeus ATCC 31615 (13), and Streptomyces lividans TK24 (9). E.
coli XL2-Blue and Streptomyces strains were grown at 37 and 30°C in Luria-
Bertani medium (15) and E1 medium (23), respectively.
PCR amplifications and cloning procedures. Amplification of DNA fragments
by PCR was performed with 100 pmol of each oligonucleotide primer, 0.1 to 100
ng of plasmid or chromosomal DNA template, 5 mmol of each deoxynucleoside
triphosphate, and 2 U of DynaZyme II DNA polymerase (Finnzymes Oy, Espoo,
Finland). The template was initially denaturated by heating at 99°C for 5 min,
followed by 30 cycles of amplification, i.e., denaturation at 96°C for 1 min,
annealing at 55 to 62°C (depending on the primers) for 2 min, and extension at
73°C for 1 min 30 s. The primers that were used are shown in Table 1. The PCR
Conversion of nogalamycin biosynthetic pathway toward an-
gucyclines. We have recently elucidated the biosynthesis path-
way of auramycinone by stepwise cloning of genes and isola-
tion of the compounds produced (7; Kantola, unpublished).
From these studies we acquired plasmid pMC5, which contains

VOL. 47, 2003
ANTHRACYCLINE AND ANGUCYCLINE BIOSYNTHESIS
1293
FIG. 2. Structures and hypothetical biosynthesis pathways of the compounds produced in this study. The pathway resulting in the production
of nogalonic acid is described elsewhere in detail (14). Structures within brackets indicate hypothetical intermediates.

¨
¨
1294
METSA-KETELA ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
TABLE 1. Sequences of oligonucleotide primers used in amplification of the genes used in this studya
Gene
Forward and reverse primer sequences
Restriction site
Reference
snoa1 and snoa2
GATTCTAGAACTTCAAGACGATCAAAGC
GATAAGCTTTTAATTAACTTACCGCGGCTCCGG
XbaI
HindIII and PacI
Kantola, unpublished
Kantola, unpublished
snoa3
GATTTAATTAACGGTAAGAGGCCACGGAA
GATAAGCTTGCTAGCAGTTCCGTGCCGTACACA
PacI
HindIII and NheI
Kantola, unpublished
Kantola, unpublished
snoaD
GATGCTAGCTTGTATTCCGCCGTGTC
GATAAGCTTGTTAACTGTCATGGTCCTCCGTCC
NheI
HindIII and HpaI
Kantola, unpublished
Kantola, unpublished
snoaE
GATGTTAACGGCCTGGGAAACTACTGA
GATAAGCTTATGCATGAACCGTCCTCCGCTGT
HpaI
HindIII and NsiI
Kantola, unpublished
Kantola, unpublished
pgaF
CTTAAGCCCGCTCACCCGAAGAAGAG
TACGTACTTCACTGTGTGGCCGTCCA
AflII
SnaBI
This work
This work
pgaL
GTTAACGACCTGAAACCGACCCCTGA
ATGCATGTGTGGTCCTCGCTCATGTC
HpaI
NsiI
This work
This work
aknBCDE2F
GATTCTAGAGCCCGAACTGTATCTGGTA
GATAAGCTTGCTAGCAGGACAAACGTCAGCAGCT
XbaI
NheI
12
12
a The HindIII sites at the ends of the sno reverse primers were used as insertion sites for the indicated gene.
the genes that are responsible for the putatively mutual part
of auramycinone and angucyclinone biosynthesis, namely,
snoa1-a3 (minPKS), snoaD (KR), and snoaE (ARO). The pu-
tative angucycline cyclase pgaF was amplified from Streptomy-
ces sp. strain PGA64 by PCR; inserted into the pMC5 cassette,
resulting in plasmid pMC6B (Fig. 3); and introduced into S.
lividans TK24 by standard protoplast transformation methods
(9).
Fermentation of S. lividans TK24/pMC6B resulted in the
production of two previously undetected compounds that ap-
peared in different ratios in separate flask culture fermenta-
tions after 7 days of cultivation. The two compounds were
isolated from the culture broth, and structural elucidation of
the compounds by NMR (Table 2) revealed that the com-
pounds were UWM6 and rabelomycin, which have previously
been described as intermediates in the jadomycin biosynthesis
pathway (11). Additionally, during the NMR work the insta-
bility of UWM6 under the conditions used was observed, as the
sample slowly turned red; the maximum of the visible spectrum
changed from 440 to 510 nm. This indicates additional conju-
gation within the molecule, which could result from the elim-
ination of two water molecules and the formation of a fully
aromatized derivative of UWM6 that is aromatized similarly to
6-hydroxytetrangulol (21). Furthermore, this transformation
FIG. 3. Diagrams of expression constructs used in this work. The genes have been obtained from S. nogalater (sno; black), S. galilaeus (akn;
gray), and Streptomyces PGA64 (pga; white); and they encode the following proteins: KS␣ (snoa1, aknB), KS␤ (snoa2, aknC), ACP (snoa3, aknD),
starter unit selection (aknE2, aknF), KR (snoaD), ARO (snoaE, pgaL), and CYC (pgaF). The antibiotic biosynthesis genes were cloned in the
pIJ486 vector under the constitutive ermE promoter (8).

VOL. 47, 2003
ANTHRACYCLINE AND ANGUCYCLINE BIOSYNTHESIS
TABLE 2. 1H and 13C NMR spectral data for compounds MM2002 and UWM6
1295
MM2002
13C NMR spectrum (100 MHz)
UWM6
Site
1H NMR spectrum (400 MHz)
1H NMR spectrum (400 MHz)
13C NMR spectrum (100 MHz)
1
166.1 (s)
123.5 (d)
72.4 (s)
42.6 (t)
71.1 (s)
48.2 (t)
203.9 (s)
1-OH
2A
2B
3
brda, exchangeable
5.95, 1H, s
3.00, 1H, d, 18.0
2.58, 1H, d, 18.0
57.5 (t)
72.3 (s)
46.9 (t)
70.0 (s)
53.1 (t)
3-OH
4A
4B
4a
brd, exchangeable
2.72, 1H, d, 17.6
2.50, 1H, d, 17.6
brd, exchangeable
2.90, 1H, d, 17.8
2.56, 1H, d, 17.8
4a-OH
5A
5B
6
brd, exchangeable
2.92, 1H, d, 17.8
2.78, 1H, d, 17.8
brd, exchangeable
3.18, 1H, d, 17.9
2.87, 1H, d, 17.9
202.0 (s)
113.0 (s)
163.4 (s)
108.9 (s)
202.7 (s)
110.0 (s)
164.6 (s)
108.7 (s)
6a
7
7a
7-OH
8
16.0, 1H, s
15.9, 1H, brs
157.5 (s)
157.2 (s)
8-OH
9
10
11
11a
12
9.66, 1H, s
9,67, 1H, s
6.84, 1H, d, 7.8
7.47, 1H, dd, 8.2, 7.8
7.17, 1H, d, 8.2
110.7 (d)
132.2 (d)
118.2 (d)
139.1 (s)
121.1 (d)
133.2 (s)
58.2 (s)
6.78, 1H, dd, 7.8, 0.9
7.45, 1H, dd, 8.1, 7.8
7.18 1H, dd, 8.0, 0.9
110.8 (d)
132.2 (d)
118.0 (d)
138.6 (s)
124.8 (d)
132.9 (s)
62.0 (d)
7.01, 1H, s
7.14, 1H, s
12a
12b
13
3.87, 1H, s
2.26, 2H, m
1.11, 3H, t, 7.2
3.80, 1H, s
1.31, 3H, s
29.9 (t)
10.5 (q)
23.6 (q)
14
a brd, broadened.
was accelerated in acidic conditions, which are favorable to the
elimination reaction.
gen abstraction can then be followed by reaction with oxygen
and subsequent ketone formation.
Of the two compounds identified, UWM6 has been sug-
gested to be the compound that results from the direct action
of the corresponding jadomycin biosynthesis genes and rabe-
lomycin has been suggested to emerge from oxidation of
UWM6 in flask cultures or from the concomitant action of
endogenous genes of the host strain, S. lividans (11). These
suggestions were based on the fact that the principal product
was UWM6 on R2YENG agar plates. Our results coincide
with the nonenzymatic model for UWM6 oxidation, since ad-
dition of an absorbent, XAD-7, to liquid cultures shifted the
production greatly toward UWM6 and only minor amounts of
rabelomycin were produced. This can be interpreted to mean
that the UWM6 produced by the strain binds to XAD-7 after
export to the culture medium and is subsequently protected
from oxidation.
Interestingly, studies on the total synthesis of angucyclinones
present an attractive analogy and a possible explanation for the
nonenzymatic oxidation of the C-12 carbon; Krohn et al. (10)
have reported a method for the total synthesis of a rabelomycin
derivative in which the C-1 ketone is synthesized by photoin-
duced oxygenation upon exposure to daylight. They suggested
that the reaction could proceed through a diradical interme-
diate derived from photoinduced hydrogen abstraction at C-1
by the neighboring C-12 carbonyl group. In the biosynthetic
route presented here, a similar diradical could conceivably be
formed after dehydration of UWM6 and photoinduced hydro-
gen abstraction at C-12 by the C-1 carbonyl group. The hydro-
Conversion of aclacinomycin biosynthetic pathway toward
angucyclines. To further test the ability of pgaF to act in con-
junction with unnatural biosynthesis genes, we replaced the sno
minPKS genes with the corresponding genes aknB, aknC, and
aknD as well as genes aknE2 and aknF from the aclacinomycin
pathway. The aknE2 and aknF genes, which are homologous to
the dpsC and dpsD genes from the daunorubicin biosynthesis
pathway (1), respectively, are responsible for the initiation of
biosynthesis from a longer propionate starter unit (14). This
expression construct, which was designated pSJ10 (Fig. 3) and
which was transformed into S. lividans TK24, was cultivated in
E1 medium with XAD-7. The compounds produced were pu-
rified as described above for S. lividans TK24/pMC6B. Accord-
ing to the NMR results (Table 2), the strain produced the
expected UWM6 derivative, MM2002, which, however, ap-
peared in the NMR solvent used as an enol tautomer (Fig. 2).
The accumulation of MM2002 in the culture medium demon-
strated that the pgaF cyclase is capable of processing a C21
polyketide chain and cyclizing the last ring correctly.
The jadI jadomycin cyclase, unlike the pgaF cyclase de-
scribed here, has been reported to exhibit strict context-depen-
dent behavior and nonfunctionality with the tcm and dps
biosynthesis genes. Tetracenomycin biosynthesis proceeds
through an unreduced intermediate of the first ring, which
subsequently leads to cyclization between C-9 and C-14 that is
different from the folding pattern of reduced polyketides like
anthracyclines and angucyclines. The differences in the early

¨
¨
1296
METSA-KETELA ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
Practical Streptomyces genetics. The John Innes Foundation, John Innes
Centre, Norwich, United Kingdom.
10. Krohn, K., F. Ballwanz, and W. Baltus. 1993. Total synthesis of angucyclines.
1. Synthesis of a daunomycin-rabelomycin hybrid. Liebigs. Ann. Chem. 1993:
911–913.
11. Kulowski, K., E. Wendt-Pienkowski, L. Han, K. Yang, L. C. Vining, and C. R.
Hutchinson. 1999. Functional characterization of the jadI gene as a cyclase
forming angucyclinones. J. Am. Chem. Soc. 121:1786–1794.
12. McDaniel, R., S. Ebert-Khosla, D. A. Hopwood, and C. Khosla. 1995. Ra-
tional design of aromatic polyketide natural products by recombinant assem-
bly of enzymatic subunits. Nature 375:549–554.
13. Oki, T., Y. Matsuzawa, A. Yoshimoto, K. Numata, I. Kitamura, S. Hori, A.
Takamatsu, H. Umezawa, M. Ishizuka, H. Naganawa, H. Suda, M. Hamada,
and T. Takeuchi. 1975. New antitumor antibiotics, aclacinomycins A and B.
J. Antibiot. 28:830–834.
14. Ra¨ty, K., J. Kantola, A. Hautala, J. Hakala, K. Ylihonko, and P. Ma¨ntsa¨la¨.
2002. Cloning and characterization of Streptomyces galilaeus aclacinomycins
PKS cluster. Gene 293:115–122.
15. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.
16. Torkkell, S., T. Kunnari, K. Palmu, J. Hakala, P. Ma¨ntsa¨la¨, and K. Yli-
honko. 2000. Identification of a cyclase gene dictating the C-9 stereochem-
istry of anthracyclines from Streptomyces nogalater. Antimicrob. Agents Che-
mother. 44:396–399.
part of the biosynthesis of unreduced and reduced polyketides
are the most likely reasons why these two pathways were in-
compatible, as investigators acknowledged previously (11).
On the contrary, the biosynthesis of daunorubicin proceeds
in a manner highly similar to the biosynthesis of aclacinomy-
cins, as described above, and no clear explanation for the
incompatibility of the jad and dps biosynthesis cyclases could
be presented (20). However, it is interesting that the expres-
sion constructs used in the jad and dps biosynthesis experi-
ments also included the tcmJ gene from the biosynthesis path-
way of tetracenomycin. The exact function of tcmJ has not been
elucidated, but it has been reported to improve production of
tetracenomycin in its native cluster (5). Nonetheless, in light of
the fact that the pgaF cyclase is functional with two different
sets of anthracycline biosynthesis genes, it would be interesting
to see if the inclusion of tcmJ in the expression constructs has
an effect on the nonfunctionality of the jad and dnr genes.
17. Torkkell, S., T. Kunnari, K. Palmu, P. Ma¨ntsa¨la¨, J. Hakala, and K. Yli-
honko. 2001. The entire nogalamycin biosynthetic gene cluster of Streptomy-
ces nogalater: characterization of a 20-kb DNA region and generation of
hybrid structures. Mol. Genet. Genomics 266:276–288.
ACKNOWLEDGMENT
This research was supported by a grant from the Jenni and Antti
Wihuri Foundation to M.M-K.
18. Ward, J. N., G. R. Janssen, T. Kieser, M. J. Bibb, M. J. Buttner, and M. J.
Bibb. 1986. Construction and characterization of a series of multicopy pro-
moter-probe plasmid vectors for Streptomyces using the aminoglycoside
phosphotransferase from Tn5 as indicator. Mol. Gen. Genet. 203:468–478.
19. Westrich, L., S. Domann, B. Faust, D. Bedford, D. A. Hopwood, and A.
Bechthold. 1999. Cloning and characterization of a gene cluster from Strep-
tomyces cyanogenus S136 probably involved in landomycin biosynthesis.
FEMS Microbiol. Lett. 170:381–387.
20. Wohlert, S. E., E. Wendt-Pienkowski, W. Bao, and C. R. Hutchinson. 2001.
Production of aromatic minimal polyketides by the daunorubicin polyketide
synthase genes reveals the incompatibility of the heterologous DpsY and
JadI cyclases. J. Nat. Prod. 64:1077–1080.
REFERENCES
1. Bao, W., P. J. Sheldon, E. Wendt-Pienkowski, and C. R. Hutchinson. 1999.
The Streptomyces peucetius dpsC gene determines the choice of starter unit in
biosynthesis of the daunorubicin polyketide. J. Bacteriol. 181:4690–4695.
2. Bhuyan, B. K., and A. Dietz. 1965. Fermentation, taxonomic, and biological
studies of nogalamycin. J. Antimicrob. Chemother. 5:836–844.
3. Decker, H., and S. Haag. 1995. Cloning and characterization of a polyketide
synthase gene from Streptomyces fradiae Tu2717, which carries the genes for
biosynthesis of the angucycline antibiotic urdamycin A and a gene probably
involved in its oxygenation. J. Bacteriol. 177:6126–6136.
4. Hopwood, D. A. 1997. Genetic contributions to understanding polyketide
synthases. Chem. Rev. 97:2465–2497.
5. Hutchinson, C. R. 1997. Biosynthetic studies of daunorubicin and tetraceno-
mycin C. Chem. Rev. 97:2525–2535.
6. Hutchinson, C. R. 1998. Combinatorial biosynthesis for new drug discovery.
Curr. Opin. Microbiol. 1:319–329.
21. Yamashita, N., T. Harada, K. Shin-ya, and H. Seto. 1998. 6-Hydroxytetran-
gulol, a new CPP32 protease inducer produced by Streptomyces sp. J. Anti-
biot. 51:79–81.
22. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage
cloning vectors and host strains: nucleotide sequences of the M13mp18 and
pUC19 vectors. Gene 33:103–119.
7. Kantola, J., T. Kunnari, A. Hautala, J. Hakala, K. Ylihonko, and P. Ma¨nt-
sa¨la¨. 2000. Elucidation of anthracyclinone biosynthesis by stepwise cloning of
genes for anthracyclines from three different Streptomyces spp. Microbiology
146:155–163
8. Khosla, C., and R. J. X. Zawada. 1996. Generation of polyketide libraries via
combinatorial biosynthesis. Trends Biotechnol. 14:335–341.
9. Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000.
23. Ylihonko, K., J. Hakala, J. Niemi, J. Lundell, and P. Ma¨ntsa¨la¨. 1994. Iso-
lation and characterization of aclacinomycin A-non-producing Streptomyces
galilaeus (ATCC 31615) mutants. Microbiology 140:1359–1365.
24. Ylihonko, K., J. Tuikkanen, S. Jussila, L. Cong, and P. Ma¨ntsa¨la¨. 1996. A
gene cluster involved in nogalamycin biosynthesis from Streptomyces noga-
later: sequence analysis and complementation of early-block mutations in the
anthracycline pathway. Mol. Gen. Genet. 251:113–120.