4-Octyl itaconate protects against renal fibrosis via inhibiting TGF-β/Smad pathway, autophagy and reducing generation of reactive oxygen species

Article abstract of DOI:10.1016/j.ejphar.2020.172989

Renal fibrosis is an inevitable course of all kinds of progressive chronic kidney disease (CKD). Itaconic acid is an endogenous metabolite that has shown anti-inflammatory and antioxidant effects. 4-octyl itaconate (OI), a derivative of itaconic acid with higher fat solubility, can penetrate the cell membranes and be metabolized into itaconic acid in vitro. However, whether OI has an anti-renal fibrotic effect is still unclear. The current study purposed to investigate the anti-fibrotic effect in renal and the underlying mechanisms of OI. The unilateral ureteral occlusion (UUO) model and adenine-induced fibrosis model in Sprague-Dawley (SD) rats and Transforming growth factor-β1 (TGF-β1) induced HK-2 cells were applied to investigate the renoprotective effects of OI. This study reports for the first time that OI ameliorated renal fibrosis by suppressing the activation of TGF-β/Smad and nuclear factor kappa B (NF-κB) pathways, reducing generation of reactive oxygen species and inhibiting autophagy. These results clearly suggest that OI has great clinical potential for managing renal fibrosis.

Full text of DOI:10.1016/j.ejphar.2020.172989

EuropeanJournalofPharmacology873(2020)172989
Contents lists available at ScienceDirect
European Journal of Pharmacology
journal homepage: www.elsevier.com/locate/ejphar
Full length article
4-Octyl itaconate protects against renal fibrosis via inhibiting TGF-β/Smad
pathway, autophagy and reducing generation of reactive oxygen species
Feng Tian1, Zhe Wang1, Junqiu He, Zhihao Zhang∗, Ninghua Tan∗∗
State Key Laboratory of Natural Medicines, Department of TCMs Pharmaceuticals, School of Traditional Chinese Pharmacy, China Pharmaceutical University, Nanjing,
211198, China
A R T I C L E I N F O
A B S T R A C T
Keywords:
Renal fibrosis is an inevitable course of all kinds of progressive chronic kidney disease (CKD). Itaconic acid is an
endogenous metabolite that has shown anti-inflammatory and antioxidant effects. 4-octyl itaconate (OI), a de-
rivative of itaconic acid with higher fat solubility, can penetrate the cell membranes and be metabolized into
itaconic acid in vitro. However, whether OI has an anti-renal fibrotic effect is still unclear. The current study
purposed to investigate the anti-fibrotic effect in renal and the underlying mechanisms of OI. The unilateral
ureteral occlusion (UUO) model and adenine-induced fibrosis model in Sprague-Dawley (SD) rats and
Transforming growth factor-β1 (TGF-β1) induced HK-2 cells were applied to investigate the renoprotective ef-
fects of OI. This study reports for the first time that OI ameliorated renal fibrosis by suppressing the activation of
TGF-β/Smad and nuclear factor kappa B (NF-κB) pathways, reducing generation of reactive oxygen species and
inhibiting autophagy. These results clearly suggest that OI has great clinical potential for managing renal fi-
brosis.
Renal fibrosis
4-Octyl itaconate
CKD
TGF-β/Smad
Reactive oxygen species
Autophagy
1. Introduction
interstitial myofibroblasts, and excessive accumulation of extracellular
matrix components, eventually replacing normal kidney structures,
Chronic kidney disease (CKD), which has a high prevalence and low
prevention rate, has become a threat to human health after cardiovas-
cular and cerebrovascular tumors (Couser et al., 2011; Shanzhi et al.,
2018) in the past two decades. It has been reported that 10% of the
world's population suffer from CKD (Jha et al., 2013). Regardless of the
cause, the ultimate progression of CKD is renal fibrosis, scar tissue
formation, and renal failure (Remuzzi and Bertani, 1998). When renal
fibrosis develops, most CKD patients will progress to end-stage renal
disease (ESRD), in which dialysis and kidney transplantation are the
only therapeutic options. Therefore, in-depth study of renal fibrosis in
CKD is of great clinical significance.
Renal fibrosis has been a research hotspot in the field of kidney
disease for a long time, and inhibition of the development of fibrosis
can effectively curb the development of the disease (Kalluri and
Weinberg, 2009). A large number of clinical practice and experimental
data show that renal fibrosis is the main cause of the gradual loss of
renal function, and the degree of disease is closely related to the
prognosis of the disease. Lesions of renal fibrosis are characterized by
massive inflammatory cell infiltration, tubular atrophy, activation of
forming scars, and causing kidney function loss and exhaustion (Boor
and Ostendorf, 2010; Wynn, 2008). Transforming growth factor-β1
(TGF-β1) is the most important pro-fibrotic cytokine involved in fi-
brosis and upon binding to its cell-surface receptor, it activates both
Smad and non-Smad signaling pathways to promote myofibroblast ac-
tivation (Meng et al., 2016; Liu, 2004). Pro-fibrotic cytokine-activated
myofibroblasts express α-smooth muscle actin (α-SMA), generate re-
active oxygen species, and synthesize extra cellular matrix (ECM) in-
cluding fibronectin (FN), plasminogen activator inhibitor-1 (PAI-1) and
so on (Diao et al., 2019; Zaman et al., 2009).
Itaconic acid is an endogenous metabolite that has been shown to
have anti-inflammatory and antioxidant effects (Mills et al., 2018).
Unfortunately, the application of itaconic acid is limited because it does
not penetrate the cell membranes well due to its hydrophilic structure.
4-Octyl itaconate (OI), a derivative of itaconic acid, has a higher fat
solubility than itaconic acid and can penetrate cell membranes more
easily. However, there are no reports about its efficacy of anti-renal
fibrosis in vivo or in vitro. This work reports for the first time that OI
ameliorates renal fibrosis in two classic animal models of renal fibrosis,
∗ Corresponding author. School of Traditional Chinese Pharmacy, China Pharmaceutical University, Nanjing, 211198, China.
∗∗ Corresponding author. Professor School of Traditional Chinese Pharmacy, China Pharmaceutical University, Nanjing 211198, China.
E-mail addresses: zzh-198518@163.com (Z. Zhang), nhtan@cpu.edu.cn (N. Tan).
1 Feng Tian and Zhe Wang are the co-first authors.
https://doi.org/10.1016/j.ejphar.2020.172989
Received 14 October 2019; Received in revised form 1 February 2020; Accepted 3 February 2020
Availableonline04February2020
0014-2999/©2020PublishedbyElsevierB.V.

F. Tian, et al.
EuropeanJournalofPharmacology873(2020)172989
the unilateral ureteral occlusion (UUO) and adenine-induced models,
suggesting that OI has the effect on inhibition of renal fibrosis and
preservation of kidney function in animals. The effect of anti-renal fi-
brosis is further proved by using HK-2 cells in vitro. We further reveal
that OI attenuates the renal injury and fibrosis by inhibiting the TGF-β/
Smad, nuclear factor kappa B (NF-κB) pathway and autophagy.
authorized by the Animal Welfare and Ethics Committee of China
Pharmaceutical University. The application approval number is
202002001.
2.4. Western blot analysis
Western blot protocol was used as described previously (Zhao et al.,
2015). The following primary antibodies were used: anti-p62 (5114s;
CST), anti LC3A/B (12741s; CST),anti-Nrf-2 (ab137550; Abcam), anti-
fibronectin (ab45688; Abcam), anti-α-SMA (ab124964; Abcam), anti-
GAPDH (HRP-60004; Proteintech), anti-TGF-β1 (21898-1-AP; Pro-
teintech), anti-Smad2 (5339; CST), anti-phospho-Smad2 (1087; CST),
anti-Smad3 (9523; CST), anti-phospho-Smad3 (95207; CST), anti-
Smad7 (MAB2029; R&D), anti-12-LO (C-5) (sc-365194; Santa Cruz),
anti-Rac1 (66122-1-Ig; Proteintech), anti-IκBα (4812; CST), phospho-
NF-κB-p65 (3033; CST), anti-phospho-IκBα (2859; CST), anti-NF-κB-
p65 (6956S; CST).
2. Materials and methods
2.1. Synthesis of 4-octyl itaconate
OI was synthesized according to previously documented methods
(Mills et al., 2018). Itaconate anhydride (5.00 g, 44.64 mmol, 1.0 eq)
and 1-octanol (6.00 g, 46.07 mmol, 1.03 eq) were heated to 110 °C for
4 h. Nitrogen was used as a protective gas. After cooling to RT, the
solution was poured slowly into hexane (60 ml). The resulting solid was
filtered off and washed with cold hexane (40 ml). The solid was re-
crystallized twice from hexane to produce OI as fine white needles
(4.53 g, 41%). 1H NMR and 13C NMR data were identical with the data
in the literature (Mills et al., 2018).
2.5. Cell line and culture
HK-2 cell line was obtained from the cell bank of the Chinese
Academy of Sciences and was cultured in Dulbecco's modified Eagle's
medium (DMEM/F12, Gibco) containing 10% (v/v) heat-inactivated
fetal bovine serum (Biological Industries) (Ryan et al., 1994; Pujalté
et al., 2011). The cells were maintained at 37 °C in a humidified in-
cubator with an atmosphere of 5% CO2/95% air (v/v). To investigate
the effect of OI on inflammatory and fibroblast activation, HK-2 cells
were stimulated with TGF-β1 (2.5 ng/ml; R&D Systems, Minneapolis,
MN) for 24 h and then treated with OI (1, 10, 30 and 100 μmol/L) for
24 h.
2.2. Chemicals
Various drugs and chemicals were purchased: recombinant TGF-β1
(R&D Systems, Minneapolis, MN), itaconic anhydride (J&K Scientific
Co., Ltd, AR ≥ 97%, C5H4O3, MW = 112.08, CAS:2170-03-8, 25 g, 1-
Octanol (Nanjing Chemical Reagent Co., Ltd, AR
CH3(CH2)7OH, MW 130.23, CAS:111-87-5, 500 ml), hexane
(Shanghai Titan Scientific Co. Ltd, AR 97%, CH3(CH2)4CH3,
≥
99%,
=
≥
MW = 86.18, CAS: 110-54-3, 500 ml), and adenine (J&K Scientific Co.,
purity ≥ 95%, CAS: 73-24-5, 100 g).
2.6. Quantitative RT-PCR with reverse transcription
2.3. Animal models
The total RNA was extracted from the indicated cells using Trizol
reagent (Invitrogen) according to the manufacturer's instructions and
then was reverse transcribed. The RNA concentrations were measured
Animals were acclimatizatized for 1 week prior to being used in the
experiments. Male Sprague-Dawley (SD) rats (180–200 g) were given
free access to water and regular food. The animal model of UUO was
performed as described previously (Kawada et al., 1999). In brief, under
chloral hydrate anesthesia, the left ureter was double-ligated with 4–0
silk suture following a midline abdominal incision. Control group ani-
mals underwent the same surgical intervention except for ureteric li-
gation. For the adenine-induced rat model, control group animals re-
ceived saline daily (0.2 ml/100 g) by oral gavage for 6 weeks (Xu et al.,
2018). Control + OI group were given a tail vein injection of OI so-
lution (1 mg/kg) daily for 6 weeks. The first experimental group re-
ceived daily adenine injectable suspension 200 mg/kg by oral gavage
for 6 weeks. Starting in week 4, this group received a tail vein injection
OI solution (1 mg/kg) daily for 3 weeks. The second experimental
group also received daily adenine injectable suspension (200 mg/kg) by
oral gavage for 6 weeks. This group received a tail vein injection of OI
solution 10 mg/kg daily during weeks 4–6. All animal experiments
were performed in accordance with protocols that were approved and
spectrophotometrically
with
a
BioPhotometer
(Eppendorf).
Quantitative real time PCR (qPCR) for RAC-1, HO-1, GSH-Px, P47PHOX
,
P67PHOX, Nrf-2, KEAP-1, NQO-1 and GADPH was performed with the
SYBR Green PCR Master Mix (ABI). The qPCR primers used to detect the
target genes are listed in Table 1.
2.7. Oxidative stress status of HK-2 cells
Reactive oxygen species was detected with the reactive oxygen
species assay kit (Beyotime Biotechnology) according to the manufac-
turer's instruction (No. S0033). DCFH-DA was used to detect the in-
tracellular reactive oxygen species (Ji et al., 2017). The formation of the
fluorescent-oxidized DCF derivative was monitored using FACS Cali bur
flow cytometer, with excitation at 485 nm and emission at 525 nm.
Reactive oxygen species generation was quantified using median
fluorescence. Additionally, this result was confirmed in 96-well plates
Table 1
Primer sequences of qPCR.
mRNA name
Sequence (5′-3′) forward
Sequence (5′-3′) backward
RAC-1
HO-1
GSH-Px
P47PHOX
P67PHOX
Nrf-2
KEAP-1
NQO-1
GADPH
AGGACACGATTGAGAAGCTGAAGG
TATCGTGCTCGCAATGAACACTCTG
GTGCGAGGTGAATGGTGAGAAGG
AACGCTCACCGAGTACTTCAACAG
AGCAGAAGAGCAGTTAGCATTGGC
GCCTTCCTCTGCCATTAGTC
TGCTCAACCGCTTGCTGTATGC
AGAAGCGTCTGGAGACTGTCTGG
CAGGAGGCATTGCTGATGAT
CACTGTCTTGAGTCCTCGCTGTG
GTTGAGCAGGAAGGCGGTCTTAG
ACTGGAACACCGTCTGGACCTAC
CTGGCTTCTTCACCTGGCTGTC
GGTGAACCACAGAGGCTACAACG
TCATTGAACTCCACCGTGCCTTC
TCATCCGCCACTCATTCCTCTCC
GATCTGGTTGTCGGCTGGAATGG
GAAGGCTGGGGCTCATTT
2

F. Tian, et al.
EuropeanJournalofPharmacology873(2020)172989
by using automatic fluorescence microplate reader (n = 3).
application (Fig. 1B). Moreover, results of pathological sections con-
firmed that OI treatment decreased the deposition of collagen in the
ligated kidneys of UUO model (Fig. 1C and D). As observed in patho-
logical sections, the control group has expanded main lesions in renal
tubular lumen, enlarged renal pelvis, and epithelial cell degeneration.
Two rats developed secondary infections 7 days after the unilateral
ureteral ligation. After OI treatment, creatinine (CRE) and blood urea
nitrogen (BUN) were significantly reduced in OI treatment rats com-
pared to control group rats. Biochemical parameters also indicated that
OI can prevent the hydronephrosis and ameliorate injury of kidney
tissue in a renal interstitial fibrosis model induced by UUO (Fig. 1E).
2.8. Statistics
For in vivo experiments, 6 to 8 animals were included in each group.
Data related to experiments glomeruli consisted of 3 or more in-
dependent experiments in which indicates the number of experiments
or is otherwise stated. The statistical analysis was performed using
GraphPad Prism 6 software (San Diego, CA). Data were expressed as
mean S.D. and analyzed by one-way analysis of variance (ANOVA) with
Tukey post hoc tests and Student's t-test, for which P values < 0.05
were considered significant.
3.2. Protective effects of OI in adenine-induced rats
3. Results
An adenine-induced rat model has been widely used as a CKD vivo
model (Jia et al., 2013; Yokozawa et al., 2004). To overcome the effects
of surgery, the goal this research was to establish a nonsurgical model
of chronic renal fibrosis in rats using an adenine-based regimen (Zhao
et al., 2013). Then, the effects of OI on normal and model kidneys in
adenine-induced rats were evaluated. The Control + OI group was used
to see if there were potentially toxic effects (Fig. 2A). By comparing the
ratio of kidney weight to body weight, OI was shown to effectively
reduce kidney enlargement induced by adenine (Fig. 2C). In addition, H
&E staining of kidney tissue revealed that OI improved the integrity of
the renal parenchymal cells in the kidneys from adenine-induced rats
(Fig. 2D). Moreover, Masson staining confirmed that OI treatment de-
creased the deposition of collagen in the ligated kidneys of adenine-
induced model. Under the experimental conditions, the pathological
changes at 42 days after modeling included renal tubular enlargement
3.1. Protective effects of OI in UUO rats
UUO model is the most widely used animal model of renal fibrosis to
simulate clinical common renal interstitial injury (Kong et al., 2018;
Pang et al., 2010). Therefore, the effects of OI on ligated kidneys in
UUO rats were evaluated. One week after the operation, the swelling of
kidneys was ameliorated after OI treatment (Fig. 1A). In addition, H&E
staining combined with semi-quantitative scoring of kidney tissue re-
vealed that OI improved the integrity of the renal parenchymal cells in
the ligated kidneys from UUO rats. The results of Masson staining
suggest that rats exhibited lower occurrence of renal perivascular fi-
brous tissue hyperplasia after treatment with OI. The expanded rose-red
staining of single glomerular parietal layer with PAS staining indicated
glomerular injury in model rats. These lesions were alleviated after OI
Fig. 1. OI alleviates renal fibrosis in UUO rats. (a) Photograph of renal tissue, one week after the operation, the enlargement of kidneys was improved after OI
treatment (n = 4). (b) Renal histology showing glomeruli of indicated groups stained with eosin (H&E), Masson x200 and periodic acid–Schiff (PAS) (n = 3 rats per
group). Bar = 50 μm. (c. d) Graphs from electron microscopic images indicated Masson score and tissue lesion score. (e) Biochemical indexes including CRE, BUN, TG
and TP in each group. Represent mean S.D., and P values of one-way analysis of variance are indicated at the top of the bar diagrams. *P < 0.05, **P < 0.01 and
***P < 0.001 respectively.
3

F. Tian, et al.
EuropeanJournalofPharmacology873(2020)172989
Fig. 2. OI relieves fibrotic symptoms in adenine-
induced rat model. (a) Photograph of renal tissue,
three weeks after the molding and three weeks after
the treatment, the significantly relieve symptoms of
kidneys after OI treatment were observed (n = 3).
(b) Biochemical indexes of serum renal function. (c)
The comparison of the ratio of unilateral kidney
weight to body weight indicated that the treatment
group had the effect of reducing kidney weight and
alleviating fibrosis. (d) Renal histology showing
glomeruli of indicated groups stained with eosin (H
&E) x200. (e) Masson staining was performed to
identify tubulointerstitial fibrosis in kidney sections
x200. Represent mean S.D., and P values of one-way
analysis of variance are indicated at the top of the
bar diagrams. *P
< 0.05, **P < 0.01, and
***P < 0.001 respectively.
and epithelial degeneration. The results of Masson staining showed
interstitial fibrous hyperplasia in control group. The OI treatment group
showed less nephropathy than the other groups (Fig. 2E). Biochemical
indexes of BUN and CRE were conspicuously reduced after OI treat-
ment. These biochemical indicators indicated that OI can ameliorate
injury of kidney tissue in a renal interstitial fibrosis model induced by
adenine (Fig. 2B).
and inflammatory cytokines associated with renal interstitial fibrosis.
3.4. Benefits of OI in reactive oxygen species -defense network
It is reported that oxidative stress is widely present in the UUO and
adenine-induced rats (Kawada et al., 1999; Xu et al., 2018). To explore
the effects of OI in reactive oxygen species -defense network, re-
searchers first analyzed antioxidant enzymes, namely 12-Lox and Rac-1,
which can increase the concentration of superoxide in cells and induce
inflammation (Fig. 4A). This was followed by an analysis of the tran-
script levels of a number of activated genes associated to oxidative
stress, including Nrf-2, Keap-1, GSH-px, RAC-1, HO-1, P47PHOX, P67PHOX
and NQO-1. The results showed that OI significantly alleviated the gene
expression of Nrf-2, Keap-1, GSH-px, RAC-1, HO-1, P47PHOX in UUO and
adenine-induced rats (Fig. 4C and D). Similarly, OI was able to relieve
oxidative stress and reduce intracellular reactive oxygen species in TGF-
β1-induced HK-2 cells by using reactive oxygen species probes (Fig. 5F).
3.3. OI attenuates the renal fibrosis and inhibits the TGF-β/smad pathway
in the ligated kidneys of UUO rats and adenine-induced rats
Next, the effects of OI on the level of renal fibrosis induced by UUO
and adenine were assessed. Expressions of the fibrotic portions in-
cluding α-SMA, PAI-1 and fibronectin were analyzed by western blot-
ting in kidney tissues (Fig. 3A and B). In two different animal models,
the protein expressions of α-SMA, PAI-1 and FN in the model groups
were all significantly increased compared with controls. However, in
the treatment groups, the upregulated fibrosis-related proteins levels
significantly decreased. TGF-β is a key factor in promoting renal fi-
brosis. Smad protein is an important signal transduction protein
downstream of the TGF-β family. Multiple studies have shown that
TGF-β1/Smad pathway is involved in renal fibrosis and plays a key role
in the process (Wang et al., 2017). In this study, it was confirmed that
OI can inhibit the TGF-β/Smad pathway by reducing the expression of
TGF-β1, phospho-Smad2/Smad2, phospho-Smad3/Smad3, and up-reg-
ulating Smad7 portions in both UUO and adenine-induced models
(Fig. 3C and D). The results showed that the expression of fibrotic re-
lated proteins in TGF-β1 induced cells were significantly reduced after
OI treatment in a dose-dependent manner (Fig. 5A). The results indicate
that OI treatment prevents the accumulation of fibrosis-related proteins
3.5. OI inhibits the NF-κB signaling pathway and autophagy
To evaluate the effects of OI on the autophagy and NF-κB signaling
pathways, the expression of these pathways was analyzed by western
blotting in control, Control + OI, Experimental Group 1 (OI 1 mg/kg)
and Experimental Group 2 (OI 10 mg/kg). Representative western blots
for p65, IκBα and phospho-IκBα are shown (Fig. 4B). The expression of
NF-κB related proteins was significantly decreased in OI treated rats.
The expression of phospho-p65 and phospho-IκBα were also sig-
nificantly decreased in OI group compared with TGF-β1 group in HK-
2 cells (Fig. 5C). To determine the effect of OI on autophagy, expression
of LC3-I, LC3-II, and p62 proteins in HK-2 cells was measured via
4

F. Tian, et al.
EuropeanJournalofPharmacology873(2020)172989
Fig. 3. Effect of OI on the expression
of renal fibrosis-associated proteins
and TGF-β related proteins were de-
termined by western blotting in UUO
and adenine-induced rats. GAPDH
was used as an internal control. (b. d)
In UUO model, Western blot analysis
showing expression of α-SMA, PAI-1,
FN and TGF-β. (a. c) In adenine-in-
duced rat model, Western blot analysis
showing expression of α-SMA, PAI-1,
FN and TGF-β.
Western blot. The expression of autophagy-associated protein increased
in HK-2 cells after 48 h of TGF-β1 treatment compared to the control
group, which was reversed by OI treatment (Fig. 5B). Meanwhile, its
inhibitory effect was time-dependent (Fig. 5D). The effect of chlor-
oquine (CQ) on OI was not obvious, suggesting that OI might act on the
later stage of autophagy (Fig. 5F). Taken together, these results in-
dicated that the autophagy and NF-κB signaling pathways were acti-
vated in response to renal injury, while OI treatment suppressed the
activation of both pathways.
stimulation by cytokines and growth factors results in sustained acti-
vation and proliferation of fibroblasts and synthesis of ECM compo-
nents. In other words, inhibiting inflammation reduces the possibility of
early fibrosis occurrence. The NF-κB pathway is mainly involved in the
transmission of information about inflammation, tissue damage and
stress. NF-κB (p65) and IκBα are the key proteins of inflammatory re-
sponse (Reuter et al., 2010). These proteins regulate gene expression
and affect a variety of biological processes, including inflammation,
stress response and B-cell development. In this study, the expression of
p65, IκBα and phospho-IκBα was significantly decreased in OI treat-
ment group (Fig. 4B). OI could also alleviate the oxidative stress state
evidently by increasing expression of antioxidant related protein genes,
reducing the content of reactive oxygen species in cells (Figs. 4 and 5F).
Taken together, these results indicated that the NF-κB signaling path-
ways were activated in response to renal injury induced by UUO and
adenine, and OI treatment suppressed its activation by relieving oxi-
dative stress.
During the scar formation period, renal innate cells such as me-
sangial cells, glomerular epithelial cells and renal tubular epithelial
cells can be transformed into myofibroblasts. Although the structure
and function of the kidney have changed, the damaged cells can still
perform some of the original functions. At this stage, due to the strong
compensatory capacity of kidney, there may be no significant altera-
tions in clinical indicators such as creatinine and urea nitrogen. The
damaged cells can be reversed to normal cells by treatment to restore
the original function. In fact, suppressing the transformation of da-
maged cells into myofibroblasts is a key link in blocking renal fibrosis.
Undoubtedly, the TGF-β/Smad signaling pathway plays a central and
predominant role in the initiation and development of renal fibrosis
(Meng et al., 2016). As this experiment proved, OI can inhibit the TGF-
β/Smad pathway by reducing the expression of TGF-β1, p-Smad2/
Smad2, p-Smad3/Smad3, and up-regulating Smad7 proteins in both
UUO and adenine-induced nephropathy rats (Fig. 3B and D). The
therapeutic effect by changing the expression of these proteins is di-
rectly reflected by pathological sections (Figs. 1B and 2D and E). Ad-
ditionally, in two different animal models, the expression of fibrosis-
associated proteins in treatment-groups were all significantly decreased
compared to models (Fig. 3A and C). These results have also been
confirmed in TGF-β1 induced HK-2 cells (Fig. 5A). It is possible that OI
may correct the oxidative stress state in tissues in advance and reduce
the occurrence of fibrosis at the source. However, these results show
that OI processed the anti-fibrotic effect by inhibiting activated TGF-β/
Smad pathway.
4. Discussion
The endogenous metabolite itaconate was first identified as a pro-
duct of citric acid distillation and has been used extensively in the
polymer industry for many years. Recently, scientists uncovered its
function as a modulator of mammalian immunity through anti-in-
flammatory activity in activated macrophages (Perico et al., 2018;
Lampropoulou et al., 2016). Although there have been some reports on
the anti-inflammatory activities of OI and itaconate, it has not been
applied in the treatment of renal fibrosis. Renal fibrosis is a patho-
physiological change with a gradual process of loss of kidney function.
According to the current research and the course features, it is generally
considered that renal fibrosis is a process resulting from an in-
flammatory reaction to scar formation, and eventually develops into
chronic renal failure (CRF) (Kasiske and Wheeler, 2013; Levey et al.,
2005). In this study, the results reveal that OI can reduce inflammation
and relieve renal fibrosis, which was verified using two different animal
models. This provides a potential possibility for clinical treatment of
renal fibrosis. Moreover, the research confirmed that OI can improve
the cellular environmental homeostasis of renal cells under pathological
conditions by inhibiting NF-κB and autophagy pathway as well as re-
ducing reactive oxygen species, implying OI can also provide an ef-
fective protection on renal cells.
When kidney cells are initially damaged by multiple factors such as
hypertension, diabetes, or infections, some cytokines are released, these
cytokines attract a range of inflammatory cells including white blood
cells, lymphocytes and macrophages. The inflammatory cells penetrate
the mesangial region, vascular region and renal interstitial region into
the blood, and release a series of inflammatory mediators leading to
inflammatory reactions and increasing the content of reactive oxygen
species in cells. Further promoting the phenotypic transformation of
renal innate cells, cell fibrosis begins to appear and the regular function
gradually begins to diminish (Cachofeiro et al., 2008). Continuous
5

F. Tian, et al.
EuropeanJournalofPharmacology873(2020)172989
Fig. 4. OI can alleviates the oxidative stress in UUO rats and adenine-induced rats. Effects of OI on the expression of oxidative stress proteins and mRNA were
determined by western blotting and RT-qPCR in two rat models. GAPDH was used as an internal control. (a) Western blot analysis showing expression of 12-lox and
RAC-1 demonstrated that OI can alleviates the oxidative stress in renal tissue of UUO rats. (c) RT-qPCR showing the expression of oxidative stress related mRNA in
UUO model (n = 4). (d) RT-qPCR showing the expression of oxidative stress related mRNA in adenine-induced rats (n = 4). OI can inhibits NF-κB pathway. Effects of
OI on the expression NF-κB pathway related proteins were determined by western blotting in renal tissues. GAPDH was used as an internal control. (b) Expression of
NF-κB, p65, IκBα and p-IκBα in adenine-induced rats (n = 3). Represent mean S.D., and P values of one-way analysis of variance are indicated at the top of the bar
diagrams. *P < 0.05, **P < 0.01, and ***P < 0.001 respectively.
Autophagy is a highly dynamic multi-step biological process that
involves breakdown and recycling of intracellular components and
serves as a pro-survival mechanism. Mounting evidence suggests that
autophagy is closely related to oxidative stress and inflammation in
renal disease (Sureshbabu et al., 2015). Generally, inflammation and
oxidative stress promote autophagy, but excessive autophagy will lead
to cell death. An ubiquitin-binding protein, p62, is related to cell signal
transduction, oxidative stress, and autophagy (Bjørkøy et al., 2014).
During autophagy, lysosomal degradation leads to a decrease in the
level of p62; conversely, autophagy inhibition stabilizes p62 level. In
this study, the expression of p62 upregulated after OI treatment, in-
dicating that autophagy was inhibited sectionally (Fig. 5B). The pre-
sence of LC3 in autophagosomes and its transformation into downward
migration of LC3-II are markers of autophagy (Kabeya, 2004). These
6

F. Tian, et al.
EuropeanJournalofPharmacology873(2020)172989
Fig. 5. Effects of OI on fibrosis, oxidative stress, inflammation and autophagy in the human HK-2 cell vitro assay. (a) Effects of OI on the expression of fibrosis
proteins by western blotting in HK-2 cells. GAPDH was used as an internal control. (b. c) Expression of NF-κB related proteins and autophagy related LC-3I, LC-3II,
p62 analyzed by western blotting in HK-2 cells. GAPDH was used as an internal control. (d. e) The use of OI alone had the effect of inhibiting autophagy in HK-2 cells.
(f) By using flow cytometry and fluorescent microplate reader detected reactive oxygen species in HK-2 cells.
results of the current study showed the expression of LC3-II was de-
creased in OI treatment group (Fig. 5D). In the current research, the
expression of p62 proteins increased and LC3-II decreased in OI group,
which means OI is an autophagy inhibitor. Meanwhile, the effect of
chloroquine (CQ) on OI was not obvious, suggesting that OI might act
on the later stage of autophagy (Fig. 5E). As a result, it is hypothesized
that OI reduces cell damage by relieving oxidative stress and in-
flammatory response, thereby reducing the occurrence of autophagy. In
other words, OI reversed the fibrosis of cells and had a protective effect
in renal cells.
A review of the literature suggests that this is the first study to re-
port the use of OI for ameliorating renal fibrosis in vivo using the UUO
7

F. Tian, et al.
EuropeanJournalofPharmacology873(2020)172989
Fig. 6. OI ameliorates renal fibrosis by attenuating activation of TGF-β/Smad and NF-κB pathways, reducing generation of reactive oxygen species and inhibiting
autophagy.
and adenine-induced models. OI inhibited renal fibrosis via attenuating
activation of TGF-β/Smad pathway, reducing generation of reactive
oxygen species and inhibiting autophagy (Fig. 6). Importantly, there
were no side effects observed in OI treated rats. These results strongly
suggest the clinical potential of OI for managing renal fibrosis.
Hori, M., 1999. Increased oxidative stress in mouse kidneys with unilateral ureteral
obstruction Kidney. Bar Int. 56, 1004–1013. https://doi.org/10.1046/j.1523-1755.
1999.00612.x.
Kabeya, Y., 2004. LC3, GABARAP and GATE16 localize to autophagosomal membrane
depending on form-II formation. J. Cell Sci. 117, 2805–2812. https://doi.org/10.
1242/jcs.01131.
Kalluri, R., Weinberg, R.A., 2009. The basics of epithelial-mesenchymal transition. J. Clin.
Invest. 119, 1420–1428. https://doi.org/10.1172/JCI39104.
Declaration of competing interest
The authors have declared that no competing interest exists.
Acknowledgments
Kasiske, B.L., Wheeler, D.C., 2013. KDIGO 2012 clinical practice guideline for the eva-
luation and management of chronic kidney disease kidney. Int. Suppl. 3, 2. https://
doi.org/10.1038/kisup.2012.74.
Kong, W., Fu, J., Liu, N., Jiao, C., Guo, G., Luan, J., Wang, H., Yao, L., Wang, L.,
Yamamoto, M., Pi, J., Zhou, H., 2018. Nrf2 deficiency promotes the progression from
acute tubular damage to chronic renal fibrosis following unilateral ureteral ob-
struction. Nephrol. Dial. Transplant. 33, 771–783. https://doi.org/10.1093/ndt/
gfx299.
This work was financially supported by the National Natural Science
Foundation of China (Grants 81703691, 21702231), the Program for
Jiangsu Province Innovative Research Team, “Double First-Class”
Project of China Pharmaceutical University (CPU2018GF05), and to my
love Zifeng Zhao for the spirit support. Many thanks to my friend
Janelle Stewart from the University of Michigan for helping me correct
my grammar and modify the language.
Liu, Y., 2004. Epithelial to mesenchymal transition in renal fibrogenesis: pathologic
significance, molecular mechanism, and therapeutic intervention. J. Am. Soc.
Nephrol. 15, 1–12. https://doi.org/10.1097/01.ASN.0000106015.29070.E7.
Levey, A.S., Eckardt, K., Tsukamoto, Y., Levin, A., Coresh, J., Rossert, J., Zeeuw, D.D.E.,
Hostetter, T.H., Lameire, N., Eknoyan, G., 2005. Definition and classification of
chronic kidney disease: a position statement from Kidney Disease. Improv. Glob.
Outcomes (KDIGO) Kidney Int. 67, 2089–2100. https://doi.org/10.1111/j.1523-
1755.2005.00365.x.
Lampropoulou, V., Sergushichev, A., Bambouskova, M., Nair, S., Vincent, E.E.,
Loginicheva, E., Cervantes-Barragan, L., Ma, X., Huang, S.C., Griss, T., Weinheimer,
C.J., Khader, S., Randolph, G.J., Pearce, E.J., Jones, R.G., Diwan, A., Diamond, M.S.,
Artyomov, M.N., 2016. itaconate links inhibition of succinate dehydrogenase with
macrophage metabolic remodeling and regulation of inflammation cell. Metab 24,
158–166. https://doi.org/10.1016/j.cmet.2016.06.004.
Meng, X., Nikolic-Paterson, D.J., Lan, H.Y., 2016. TGF-β: the master regulator of fibrosis.
Nat. Rev. Nephrol. 12, 325–338. https://doi.org/10.1038/nrneph.2016.48.
Mills, E.L., Ryan, D.G., Prag, H.A., Dikovskaya, D., Menon, D., Zaslona, Z., Jedrychowski,
M.P., Costa, A.S.H., Higgins, M., Hams, E., Szpyt, J., Runtsch, M.C., King, M.S.,
McGouran, J.F., Fischer, R., Kessler, B.M., McGettrick, A.F., Hughes, M.M., Carroll,
R.G., Booty, L.M., Knatko, E.V., Meakin, P.J., Ashford, M.L.J., Modis, L.K., Brunori,
G., Sévin, D.C., Fallon, P.G., Caldwell, S.T., Kunji, E.R.S., Chouchani, E.T., Frezza, C.,
Dinkova-Kostova, A.T., Hartley, R.C., Murphy, M.P., O Neill, L.A., 2018. Itaconate is
an anti-inflammatory metabolite that activates Nrf2 via alkylation of KEAP1. Nature
556, 113–117. https://doi.org/10.1038/nature25986.
Pujalté, I., Passagne, I., Brouillaud, B., Tréguer, M., Durand, E., Ohayon-Courtès, C., Azou,
B.L., 2011. Cytotoxicity and oxidative stress induced by different metallic nano-
particles on human kidney cells Part Fibre. Toxicology 8, 10. https://doi.org/10.
1186/1743-8977-8-10.
Perico, L., Wyatt, C.M., Benigni, A., 2018. A new BEACON of hope for the treatment of
inflammation? The endogenous metabolite itaconate as an alternative activator of the
KEAP1-Nrf2 system Kidney. Bar Int. 94, 646–649. https://doi.org/10.1016/j.kint.
2018.07.018.
Pang, M., Ma, L., Gong, R., Tolbert, E., Mao, H., Ponnusamy, M., Chin, Y.E., Yan, H.,
Dworkin, L.D., huang, S.Z., 2010. A novel STAT3 inhibitor, S3I-201, attenuates renal
interstitial fibroblast activation and interstitial fibrosis in obstructive nephropathy
Kidney. Bar Int. 78, 257–268. https://doi.org/10.1038/ki.2010.154.
Ryan, M.J., Johnson, G., Kirk, J., Fuerstenberg, S.M., Zager, R.A., Torok-Storb, B., 1994.
HK-2: an immortalized proximal tubule epithelial cell line from normal adult human
kidney Kidney. Bar Int. 45, 48–57. https://doi.org/10.1038/ki.1994.6.
Reuter, S., Gupta, S.C., Chaturvedi, M.M., Aggarwal, B.B., 2010. Oxidative stress,
References
Boor, P., Ostendorf, T., 2010. J. Floege Renal fibrosis: novel insights into mechanisms and
therapeutic targets. Nat. Rev. Nephrol. 6, 643–656. https://doi.org/10.1038/nrneph.
2010.120.
Bjørkøy, G., Lamark, T., Johansen, T., 2014. p62/SQSTM1: a missing link between pro-
tein aggregates and the autophagy machinery. Autophagy 2, 138–139. https://doi.
org/10.4161/auto.2.2.2405.
Cachofeiro, V., Goicochea, M., de Vinuesa, S.G., Oubiña, P., Lahera, V., Luño, J., 2008.
Oxidative stress and inflammation, a link between chronic kidney disease and car-
diovascular disease Kidney. Bar Int. 74, S4–S9. https://doi.org/10.1038/ki.2008.516.
Couser, W.G., Remuzzi, G., Mendis, S., Tonelli, M., 2011. The contribution of chronic
kidney disease to the global burden of major noncommunicable diseases Kidney. Bar
Int. 80, 1258–1270. https://doi.org/10.1038/ki.2011.368.
Diao, W., Chen, W., Cao, W., Yuan, H., Ji, H., Wang, T., Chen, W., Zhu, X., Zhou, H., Guo,
H., Zhao, X., 2019. Astaxanthin protects against renal fibrosis through inhibiting
myofibroblast activation and promoting CD8+ T cell recruitment Biochimica et.
Biophys. Acta (BBA) -Gen. Subj. 1863, 1360–1370. https://doi.org/10.1016/j.
bbagen.2019.05.020.
Jia, T., Olauson, H., Lindberg, K., Amin, R., Edvardsson, K., Lindholm, B., Andersson, G.,
Wernerson, A., Sabbagh, Y., Schiavi, S., Larsson, T.E., 2013. A novel model of ade-
nine-induced tubulointerstitial nephropathy in mice. BMC Nephrol. 14. https://doi.
org/10.1186/1471-2369-14-116.
Jha, V., Garcia-Garcia, G., Iseki, K., Li, Z., Naicker, S., Plattner, B., Saran, R., Wang, A.Y.,
Yang, C., 2013. Chronic kidney disease: global dimension and perspectives. Lancet
382, 260–272. https://doi.org/10.1016/S0140-6736(13)60687-X.
Ji, J., Zhu, P., Sun, C., Sun, J., An, L., Zhang, Y., Sun, X., 2017. Pathway of 3-MCPD-
induced apoptosis in human embryonic kidney cells. J. Toxicol. Sci. 42, 43–52.
https://doi.org/10.2131/jts.42.43.
Kawada, N., Moriyama, T., Ando, A., Fukunaga, M., Miyata, T., Kurokawa, K., Imai, E.,
8

F. Tian, et al.
EuropeanJournalofPharmacology873(2020)172989
adenine-induced chronic renal failure via regulating ROS production and TGF-beta/
SMAD pathway. Eur. Rev. Med. Pharmacol. Sci. 22, 5024–5032. https://doi.org/10.
26355/eurrev_201808_15645.
inflammation, and cancer: how are they linked? Free Radical Biol. Med. 49,
1603–1616. https://doi.org/10.1016/j.freeradbiomed.2010.09.006.
Remuzzi, G., Bertani, T., 1998. Pathophysiology of progressive nephropathies. N. Engl. J.
Med. 339, 1448–1456. https://doi.org/10.1056/NEJM199811123392007.
Shanzhi, W., Yongjun, Z., Guoquan, L., Liangbao, Z., Couser, W.G., 2018. Prevalence of
chronic kidney disease in Chinese adults: results from Meta-analysis Chinese. J.
Nephrol. 34, 579–586. https://doi.org/10.3760/cma.j.issn.1001-7097.2018.08.004.
Sureshbabu, A., Ryter, S.W., Choi, M.E., 2015. Oxidative stress and autophagy: crucial
modulators of kidney injury Redox. Biol. 4, 208–214. https://doi.org/10.1016/j.
redox.2015.01.001.
Yokozawa, T., Zheng, P.D., Oura, H., Koizumi, F., 2004. Animal model of adenine-in-
duced chronic renal failure in rats. Nephron 44, 230–234. https://doi.org/10.1159/
000183992.
Zaman, A.K.M.T., French, C.J., Schneider, D.J., Sobel, B.E., 2009. A profibrotic effect of
plasminogen activator inhibitor type-1 (PAI-1) in the heart. Exp. Biol. Med. 234,
246–254. https://doi.org/10.3181/0811-RM-321.
Zhao, Y., Cheng, X., Wei, F., Bai, X., Tan, X., Lin, R., Mei, Q., 2013. Intrarenal metabo-
lomic investigation of chronic kidney disease and its TGF-β1 mechanism in induced-
adenine rats using UPLC. Q-TOF/HSMS/MSE J. Proteome Res. 12, 692–703. https://
doi.org/10.1021/pr3007792.
Zhao, Y., Wang, H., Cheng, X., Wei, F., Bai, X., Lin, R., Vaziri, N.D., 2015. Metabolomics
analysis reveals the association between lipid abnormalities and oxidative stress,
inflammation, fibrosis and Nrf2 dysfunction in aristolochic acid-induced nephro-
pathy. Sci. Rep. UK 5. https://doi.org/10.1038/srep12936.
Wynn, T.A., 2008. Cellular and molecular mechanisms of fibrosis. J. Pathol. 214,
199–210. https://doi.org/10.1002/path.2277.
Wang, L., Diao, Z., Zheng, J., Wu, Y., Zhang, Q., Liu, W., 2017. Apelin Attenuates TGF-Β1-
Induced Epithelial to Mesenchymal Transition via Activation of PKC-ε in Human
Renal Tubular Epithelial Cells Peptides, vol. 96. pp. 44–52. https://doi.org/10.1016/
j.peptides.2017.08.006.
Xu, J., Feng, Z.P., Peng, H.Y., Fu, P., 2018. Omega-3 polyunsaturated fatty acids alleviate
9