Cytotoxic effect of a family of peroxisome proliferator-activated receptor antagonists in colorectal and pancreatic cancer cell lines

Article abstract of DOI:10.1111/cbdd.13026

Recent studies report an interesting role of peroxisome proliferator-activated receptor (PPAR) antagonists in different tumor models, being these compounds able to perturb metabolism and viability in cancer cells. In this work, the identification of a nov

Full text of DOI:10.1111/cbdd.13026

DR. ALESSANDRA AMMAZZALORSO (Orcid ID : 0000-0003-4369-1772)
Article type : Research Letter
Cytotoxic effect of a family of Peroxisome Proliferator-Activated Receptor
antagonists in colorectal and pancreatic cancer cell lines
Alessandra Ammazzalorso,a,#,* Laura De Lellis,b,c,# Rosalba Florio,b,c Isabella Bruno,a Barbara De
Filippis,a Marialuigia Fantacuzzi,a Letizia Giampietro,a Cristina Maccallini,a Silvia Perconti,c Fabio
Verginelli,b,c Alessandro Cama,b,c,* Rosa Amorosoa,*
a Unità di Chimica Farmaceutica, Dipartimento di Farmacia, Università “G. d’Annunzio”, Chieti, Italy
b Unità di Patologia Generale, Dipartimento di Farmacia, Università “G. d’Annunzio”, Chieti, Italy
c Aging Research Center (Ce.S.I.), Università “G. d'Annunzio”, Chieti, Italy
# These authors contributed equally to the work
* Corresponding authors:
Prof. Rosa Amoroso, Dipartimento di Farmacia, Università di Chieti, via dei Vestini 31, 66100 Chieti, Italy. Ph:
+39-0871-3554686; fax: +39-0871-3554911; rosa.amoroso@unich.it
Prof. Alessandro Cama, Dipartimento di Farmacia, Università di Chieti, via dei Vestini 31, 66100 Chieti, Italy. Ph:
+39-0871-3554559; alessandro.cama@unich.it
Dr. Alessandra Ammazzalorso, Dipartimento di Farmacia, Università di Chieti, via dei Vestini 31, 66100 Chieti,
Italy. Ph: +39-0871-3554682; fax: +39-0871-3554911; alessandra.ammazzalorso@unich.it
This article has been accepted for publication and undergone full peer review but has not
been through the copyediting, typesetting, pagination and proofreading process, which may
lead to differences between this version and the Version of Record. Please cite this article as
doi: 10.1111/cbdd.13026
This article is protected by copyright. All rights reserved.

Abstract
Recent studies report an interesting role of Peroxisome Proliferator-Activated Receptors (PPAR)
antagonists in different tumor models, being these compounds able to perturb metabolism and
viability in cancer cells. In this work the identification of a novel PPAR antagonist, showing inhibitory
activity on PPARα and a weaker antagonism on PPARγ, is described. The activity of this compound
and of a series of chemical analogues was investigated in selected tumor cell lines, expressing both
PPARα and PPARγ. Data obtained show a dose-dependent cytotoxic effect of the novel PPAR
antagonist in colorectal and pancreatic cancer models.
Keywords
antitumor agents, CPT1A expression, cytotoxicity, PPAR antagonist, sulfonimides
Since their discovery in 1990, Peroxisome Proliferator-Activated Receptors (PPARs) represent
important pharmacological target to modulate metabolic pathways in the organism. They are
transcription factors directly binding to DNA, able to control many physiological pathways in the
cells. The distribution of the three PPAR isotypes (PPARα, PPARγ, and PPARβ/δ) is related to
different effects in liver, kidney, heart, skeletal muscle and adipose tissue.[1-3]
After heterodimerization with 9-cis retinoic acid receptor (RXR), PPARs undergo conformational
changes stimulating the expression of target genes, involved in glucose, lipid and energetic
homeostasis.[4-6] PPARα is mainly involved in lipid metabolism, leading to an increase of fatty acid
oxidation.[7-8] Potent and selective PPARα agonists have been developed in the last decades, as
useful drugs to treat hypercholesterolemia and related metabolic disorders.[9-10] PPARγ agonists play
an important role in insulin sensitivity and adipocyte differentiation: synthetic agonists, the
thiazolidinediones, are currently used to improve insulin sensitivity in type-2 diabetes.[11-12] To date
no PPARδ agonists are marketed, also if it is well known their beneficial effect on fatty acid
catabolism and energetic homeostasis.[13-14] In addition to selective PPAR agonists, dual agonists and
PPAR-pan agonists have been developed.[15-17]
This article is protected by copyright. All rights reserved.

A recent field of research is focused on compounds able to repress PPAR activation, including full
antagonists and partial agonists.[18-20] In different pathologies, in fact, a repression of PPARs could be
advantageous to obtain therapeutic effects. To this aim, selective PPAR antagonists have been
identified, showing beneficial effects in metabolic and tumor diseases.[21-23]
There is a rising interest in the possibility to interfere with metabolic pathways in cancer cells, that
exhibit different energetic needs to survive and proliferate, with an aberrant glycolysis and fatty acid
oxidation (FAO).[24-26] In this scenario, PPARα is emerging as a new target to interfere with metabolic
needs of cancer cells, that utilize FAO for ATP generation.
The exact role of PPARα in cancer is still controversial, and to date it is uncertain whether this
receptor functions as a tumor suppressor or an oncoprotein.[27] Antitumor effects of PPARα
antagonists have been recently described in leukemia and kidney carcinoma. A specific PPARα
antagonist, GW6471, induces cell cycle arrest and apoptosis in renal cell carcinoma, showing a
synergistic cytotoxic behavior when used in combination with a glycolysis inhibitor.[28] Spaner et al.
tested MK886 in a chronic lymphocytic leukemia (CLL) model; in those experiments the PPARα
antagonist killed circulating CLL cells and caused proliferating cells to undergo immunogenic death,
suggesting a possible therapeutic role of PPARα antagonists in leukemia.[29]
In addition, also PPARγ repression produces antitumor effects: T0070907 and CDDO-Me, PPARγ
antagonists, displayed antitumor effects in different cancer cell lines.[30-31]
In the search for novel PPARα ligands, we identified sulfonimide derivatives 1a-d (Figure 1) showing
a PPARα antagonistic profile in the micromolar range.[32-34] These molecules also showed a PPARγ
antagonism, whereas no PPARδ activity was observed.[34] In agreement with these observations, the
sulfonimide derivatives were able to repress carnitine palmitoyl transferase 1 (CPT1A), a key gene
controlled by PPARα and PPARγ, involved in fatty acid transport in mitochondria.
In the present work the synthesis of a novel sulfonimide derivative with PPARα and
PPARγ antagonistic effects is described, and the cytotoxic evaluation of this family of sulfonimide
compounds in different tumor cell lines, including colorectal and pancreatic cancer cell lines,
expressing both PPARα and PPARγ, was reported.
This article is protected by copyright. All rights reserved.

O
S
O
S
N
S
N
H
Cl
O
R1
R2
1a R1= Ph; R2 = H
1b R1= nPr; R2 = OMe
1c R1= nPr; R2 = NO2
1d R1= Ph; R2 = NO2
Figure 1. General structure of benzenesulfonimide derivatives 1a-d. [34]
The novel sulfonimide derivative, compound 4, was obtained by inserting an amide group in p-
position to benzenesulfonimide scaffold; the synthetic route is illustrated in Scheme 1.
O
S
N
S
N
a,b
S
SH
OH
Cl
Cl
O
S
O
S
N
2
d
S
N
H
O
Cl
O
O
O
O
O
S
N
H
c
S
H2N
H2N
O
NH2
N
H
4
3
Scheme 1. Synthesis of compound 4. Reagents and conditions: a) ethyl 2-bromopentanoate, Na,
EtOH, reflux, 4 h, 89%; b) NaOH 2N, THF, r.t., 24 h, 92%; c) phenyl acetyl chloride, pyridine, DCM,
0°C-r.t., 15 h, 99%; d) EDC, DMAP, dry DCM, 0°C-r.t., N2, 20 h, 77%.
This article is protected by copyright. All rights reserved.

The 2-mercapto-5-chlorobenzothiazole was reacted with ethyl 2-bromopentanoate, in SN2
conditions, and the intermediate ester was hydrolyzed by NaOH to afford acid 2.[35] Sulfanilamide
was acylated in standard conditions by phenyl acetyl chloride, in the presence of pyridine, to obtain
the derivative 3, that was directly coupled to acid 2, using EDC as condensing agent, to synthesize
the target compound 4.
In Figure 2 is depicted a summary of SAR studies performed on our benzothiazole PPAR
ligands;[32,33,35] while carboxylic acids are PPARα agonists, benzenesulfonimide bioisosteres showed
antagonistic properties. The introduction of substituents in para position of aromatic ring was
tolerated, and the presence of amide groups resulted in compounds with better potency.
PPARα agonists
O
S
N
R1 monosubstitution in 5 or 6
R2 alkyl or phenyl
S
R1
OH
R2
PPARα antagonists
O
O
S
N
R1 monosubstitution in 5 or 6
R2 alkyl or phenyl
R3 amide groups well tolerated
S
S
N
H
R1
O
R2
R3
Figure 2. Summary of SARs of benzothiazole PPARα agonists and antagonists.
Transactivation assays have been chosen to assess PPAR activity of synthesized compound. These
assays were performed on three PPAR isoforms by Gal4 fusion reporter assays (using Gal4-PPAR-
LBD) in human embryonic kidney 293 cells (HEK293).
When tested at 150 μM, compound 4 showed an antagonistic behavior on PPARα (calculated as fold
activation), being able to decrease the basal receptor activity, while it was inactive on PPARδ and
showed a slight antagonism on PPARγ (data not shown). Because the weak PPARγ antagonism at
This article is protected by copyright. All rights reserved.

high concentration (150 μM), we decided to not further analyze the action of compound 4 on this
isoform.
Dose-response experiments with compound 4 on PPARα were performed, at concentrations up to
150 μM, in the presence of GW7647 (2 μM), a potent PPARα agonist. In these conditions, compound
4 showed a dose-dependent inhibition profile. Notably, the IC50 of this compound, corresponding to
its capability to decrease by 50% the maximum receptor activity obtained in the presence of the
agonist GW7647 alone, was in the submicromolar range (IC50 0.98 μM) (Figure 3, panel A).
In line with these results, compound 4, alone or in combination with GW7647, was able to repress
the PPARα/γ target gene CPT1A (Figure 3, panel B). Based on these findings, compound 4, similarly
to other molecules in this family,[34] shows a PPARα antagonism and a weaker PPARγ antagonism.
A)
B)
This article is protected by copyright. All rights reserved.

Figure 3. Dose-response inhibition of compound 4 on PPARα in the presence of GW7647 (panel A)
and evaluation of CPT1A mRNA expression by RT-qPCR, using 150 μM of compound 4. (panel B).
To assess the cytotoxicity of compounds 1a-d and 4, MTT assays were performed in different tumor
cell lines. Colorectal (HT-29 and SW480) and pancreatic (Capan-2 and AspC-1) cancer cell lines were
selected, because all of them express PPARα and PPARγ according to the Expression Atlas database
(https://www.ebi.ac.uk/gxa/home). Preliminary experiments were conducted incubating the four
cell lines for 72 hours with PPARα/γ antagonists 1a-d and 4. Cells were also incubated with
PPARα agonist WY-14643 or PPARγ agonist rosiglitazone. Compounds were used at a single, high
concentration (75 μM) to identify the molecule most active on cell viability (Figure 4). Interestingly,
tested compounds significantly reduced viability in pancreatic cancer cell lines, and the novel
sulfonimide derivative 4 was the most potent in this series. Notably, when used at the same
concentration (75 μM), compound 4 showed a threefold lower toxicity on normal human gingival
fibroblasts as compared to the commercial PPARα antagonist GW6471 (fibroblast viability: 74% with
compound 4 vs. 25% with GW6471). In addition, this novel compound had the most pronounced
effect on the viability of colorectal cancer cell lines. Conversely, treatments with WY-14643 or
rosiglitazone had no relevant effect on colorectal cancer cell viability.
Based on these results, the most active compound 4 was selected for further characterization of its
dose-dependent cytotoxic effects. This molecule was incubated with the four cancer cell lines at
concentrations ranging from 25 to 150 μM to obtain dose-response curves (Figure 5). Incubation for
72 hours significantly reduced cell viability in a dose-dependent fashion in pancreatic and colorectal
cancer cell lines. Colorectal cell lines were more sensitive to the novel molecule with an IC50 of 73.3
μM in SW480, 72.3 μM in HT-29, whereas pancreatic cancer cell lines appeared to be less sensitive,
with an IC50 of 153.6 μM in Capan-2 and 122 μM in AspC-1, as calculated using the CompuSyn
software.[36]
These IC50s are similar to those observed with other antitumor molecules.[37-38] It should be also
noted that the distinctive IC50 values observed among the analyzed cancer cell lines could be related
to the inherent differences in their genetic profile, suggesting cell-line specific effects.
Further studies will be necessary to exclude the possibility that the reduction in tumor cell viability
observed in this study could be due to effects of the molecule on different targets, as previously
shown for other compounds used in human therapy.[39]
This article is protected by copyright. All rights reserved.

Figure 4. Effect of compounds tested in this study on viability in pancreatic (panel A) and colorectal
(panel B) tumor cell lines. Cell viability was assessed by MTT assay using compounds at 75 μM. Data
shown are the means +SD of three exxperiments with quintuplicate determinations. *Significant
differences between control and each coompound (*p<0.05; **p<0.01).

Figure 5. Dose-response curves of the effect of compound 4 on viability of pancreatic (Capan-2 and
AspC-1) and colorectal (HT-29 and SW480) tumor cell lines assessed by MTT assay. Compound 4 was
incubated with the four cancer cell lines at concentrations ranging from 25 to 150 μM for 72 hours.
Data shown are the means +SD of three experiments with quintuplicate determinations. *Significant
differences between control and each molecule concentration (*p<0.05; **p<0.01; ***p<0.001).
In conclusion, the synthesis of a novel sulfonimide derivative with PPARα antagonistic activity and a
weaker PPARγ antagonism was described. The cytotoxic potential of this novel compound and of a
group of related PPAR antagonists was evaluated in pancreatic and colorectal cancer cell lines. The
novel sulfonimide 4 emerged as the most promising compound in this series with antitumor activity,
showing an interesting cytotoxic effect in selected tumor cell lines, more pronounced in colorectal
cancer cell lines.
[25-29]
In line with other studies
our experiments support the hypothesis that a repression of PPARα
and PPARγ could be an advantageous strategy in cancer therapy.
Experimental Section
General
Commercial reagents were used as received from Aldrich or Fluka. Flash chromatography was
performed on silica gel 60 (Merck) and thin layer chromatography (TLC) on F254 silica gel 60 TLC
plates. Melting points were determined on a Büchi B-540 apparatus and are uncorrected. Infrared
spectra were recorded on a FT-IR 1600 Perkin-Elmer spectrometer. NMR spectra were run at 300
MHz on a Varian instrument using TMS as an internal standard; chemical shifts (δ) are reported in
ppm. Microanalyses were carried out with an Eurovector Euro EA 3000 model analyzer. Analyses
indicated by the symbols of the elements were within ± 0.4 % of the theoretical values.
General procedure for the preparation of compounds 3 and 4
The synthesis of compound 2 was previously described.[35]
Compound 3 was synthesized by reaction of sulfanilamide (1 eq) with phenylacetyl chloride (1.3 eq),
in the presence of pyridine (2 eq) in dichlorometane (5 mL) at 0°C, allowing the reaction to reach r.t.
This article is protected by copyright. All rights reserved.

and stirring for 15h. The solvent was then evaporated under reduced pressure, water was added and
the solid precipitate was collected under reduced pressure and recrystallized.
N-[4-(aminosulfonyl)phenyl]-2-phenylacetamide (3)
Colourless needles (from water), 99% yield; m.p. 204-206 °C; IR (KBr) 3350, 3230, 1691, 1594, 1535,
1324, 1153 cm-1; 1H NMR (CD3OD) δ 3.69 (s, 2H, CH2), 7.26-7.35 (m, 5H, CH Ar), 7.73 (d, 2H, J = 9.0 Hz,
CH ), 7.82 (d, 2H, J = 9.0 Hz, CH ); 13C NMR (CD3OD) δ 43.5, 119.3, 126.8, 126.9, 128.4, 128.9,
Ar
Ar
135.2, 138.6, 142.3, 171.4. Anal. Calcd. for C14H14N2O3S: C, 57.92; H, 4.86; N, 9.65. Found: C, 57.70; H,
4.87; N, 9.63.
To a cooled mixture (0-5°C) of 2 (1 eq) in dry dichloromethane (15 mL), 1-ethyl-3-[3-
dimethylaminopropyl]carbodiimide hydrochloride (EDC, 1 eq) and 4-dimethylaminopyridine (DMAP,
1 eq) were added, under stirring in a nitrogen atmosphere. After 15 minutes, 3 (1.1 eq) was added
and the mixture was allowed to warm to r.t. After stirring overnight, the reaction was diluted with
dichloromethane, washed with 2N HCl, dried over Na2SO4. After evaporation of solvent under
reduced pressure, crude product was purified on silica gel (eluent dichloromethane/methanol 95:5).
2-[(5-chloro-1,3-benzothiazol-2-yl)thio]-N-({4-[(phenylacetyl)amino]phenyl}sulfonyl) pentanamide
(4)
Colourless solid, 77% yield; m.p. 202-204 °C (dec); IR (KBr) 3310, 3267, 1706, 1671, 1540, 1403, 1363,
1173 cm-1; 1H NMR (DMSO) δ 0.82 (t, 3H, J = 7.2 Hz, CH3CH2), 1.19-1.35 (m, 2H, CH2CH3), 1.72-1.85
(m, 2H, CH2CH), 3.65 (s, 2H, CH2), 4.49 (t, 1H, J = 7.2 Hz, CHS), 7.22-7.36 (m, 6H, CH Ar), 7.65 (d, 1H, J =
2.1 Hz, CH Ar), 7.71 (d, 2H, J = 9.0 Hz, CH Ar), 7.82 (d, 2H, J = 9.0 Hz, CH Ar), 7.96 (d, 1H, J = 8.4 Hz, CH
13
Ar), 10.55 (bs, 1H, NH), 12.56 (bs, 1H, NH ); C NMR (DMSO) δ 14.0, 20.2, 33.9, 43.9, 51.6, 119.0,
Ar
121.2, 123.9, 125.4, 127.3, 129.0, 129.6, 129.8, 131.8, 133.0, 134.2, 136.1, 144.5, 153.7, 166.7,
169.4, 170.5. Anal. Calcd. for C26H24ClN3O4S3: C, 54.39; H, 4.21; N, 7.32. Found: C, 54.57; H, 4.22; N,
7.30.
This article is protected by copyright. All rights reserved.

In vitro PPAR transactivation assay
Human embryonic kidney 293 cell line (HEK293) was maintained in growth medium composed of
DMEM (Sigma) supplemented with 10% FBS (Gibco), 1% penicillin/streptomycin (Sigma), 1% MEM
non-essential amino acid (Sigma) and 1% sodium pyruvate MEM (Sigma) at 37 °C, 5% CO2. The
PPARα or PPARγ ligand-binding activity of the test compound was determined using transient
transfection assay. The HEK293A cells were placed in white 96-well plates and cultured until 70-80%
confluency for 16 h.
Before transfection, the culture medium was replaced by fresh serum-free medium. The cells were
transiently transfected with 50 ng of reporter plasmid, 20 ng of renilla, 40 ng of pGEM, and 30 ng
of each receptor expression plasmid per well by the calcium phosphate coprecipitation method.
Test compound, dissolved in DMSO, was added after 6 h; the final concentration of DMSO did not
exceed 0.1% (v/v) in the sample. After 16-18 h treatment, the cellular luciferase activity was
determined using commercial fire-fly luciferase assay according to the supplier's instructions
(Promega). Luciferase and renilla activities were measured by a dual luciferase assay kit using a
luminometer (Labsystems Ascent Luminoskan reader). The results were normalized to the renilla
activity to correct the transfection efficiencies.
Cell culture, RNA extraction and gene expression analysis
Human HepG2 cells were maintained in growth medium composed of DMEM (Sigma) supplemented
with 10% FBS (Gibco), at 37°C, 5% CO2. Cells were seeded in 6-well plates at a density of 5x105
cells/well in 2 mL of medium per well and incubated for 24 h. After this, medium was replaced to
serum free medium containing test compound (150 μM) vehicled by DMSO, GW7647 (2 μM) or
GW7647 in combination with test compound, respectively. Cells were then incubated for 48 h. After
the treatment period, cells were washed with PBS and total RNA was isolated using the TRIzol
reagent (Invitrogen, Carlsbad, CA) following the manufacturer's instruction. RNA was quantified
using the Nanodrop 2000 (Thermo Scientific) and RNA integrity was checked by visualization on
agarose gel electrophoresis. Total RNA (300 ng) was retro-transcribed using the High Capacity cDNA
Reverse Transcription kit (Life Technologies) following the manufacturer's instruction. RT-qPCR
assays were performed in 96-well optical reaction plates using the ABI 7900HT instrument (Applied
Biosystem). Samples were analyzed in duplicate plates, with each sample analyzed in triplicate on
each of the duplicate using the following reaction mixture per well: 5 μL of Power SYBR Green buffer
This article is protected by copyright. All rights reserved.

(Life Technologies), 1.2 μL of primers at a final concentration of 150 nM, 0.8 μL of RNAase free
water, 3 μL of cDNA. For all experiments the following conditions were used: denaturation at 95°C
for 10 min, followed by 40 cycles at 95°C for 15 s, then at 60°C for 60 s. Baseline values of
amplification plots were set automatically, and threshold values were kept constant to obtain
normalized cycle times and linear regression data. Quantitative normalization was performed using
GAPDH as internal control. Relative quantification was performed using the DDCT method using as a
calibrator the cDNA obtained from cells cultured adding only the compound's vehicle (DMSO) in the
medium. Validated primers for RTqPCR were 50TGCCATGGATCTGCTGTATATCC30 (FW) e
50GCGTTGCCGGCTCTTG30
(RW)
for
the
human
CPT1A
mRNA
and
50CAACTTTGGTATCGTGGAAGGAC30 (FW) e 50ACAGTCTTCTGGGTGGCAGTG30 (RW) for the human
GAPDH.
After treatments significant expression differences of CPT1A were evaluated using the two tailed t-
test performed with Graph-Pad Prism software (version 4; San Diego, CA, USA).
MTT assay
Stock solutions were prepared dissolving compounds 1a-d and 4 (80 mM) in DMSO that were then
diluted to the final concentration in tissue culture medium. In this way the working solutions were
completely clear and devoid of any undissolved material by microscopic inspection. The final
concentration of DMSO in all points of our MTT experiments was 0.19% and showed no cell toxicity.
Human Capan-2, AspC-1 and SW480 cells were cultured in RPMI (Euroclone), whereas human HT-29
cells were cultured in DMEM (Sigma), all supplemented with 10% FBS (Gibco), at 37°C, 5% CO2. Cell
viability was tested by MTT assay (Sigma-Aldrich, St. Louis, MO, USA) following manufacturer’s
instructions. Briefly, cells were seeded in 96-well plates (4x103 cells/well) and incubated with the
indicated treatments (5 replica wells per each condition) for 72 hours. At the end, cells were
incubated with the MTT solution for at least 3 hours, until purple precipitate was visible. Then, the
MTT solution was removed and crystalline precipitate in each well was dissolved in DMSO.
Absorbance of each well at 570 nm was quantified using a microplate reader (SoftMaxPro, Molecular
Devices).
Statistical analysis
Comparisons of mean values were performed using the independent samples t-test using the
Dunnett’s test for multiple comparisons where appropriate. A p-value of 0.05 was considered
This article is protected by copyright. All rights reserved.

statistically significant. IC50 values were calculated using the CompuSyn software based on
the Chou-Talalay algorithm.[36]
Aknowledgements
The study was supported by FAR funds from the Italian Ministry of Education, University and
Research (MIUR). We thank Dr. Viviana di Giacomo, Università “G. d’Annunzio”, Chieti, Italy, for the
kind gift of normal human gingival fibroblasts.
Conflict of interest
Authors declare no conflict of interest.
Figure legends
Figure 1. General structure of benzenesulfonimide derivatives 1a-d. [34]
Scheme 1. Synthesis of compound 4. Reagents and conditions: a) ethyl 2-bromopentanoate, Na,
EtOH, reflux, 4 h, 89%; b) NaOH 2N, THF, r.t., 24 h, 92%; c) phenyl acetyl chloride, pyridine, DCM,
0°C-r.t., 15 h, 99%; d) EDC, DMAP, dry DCM, 0°C-r.t., N2, 20 h, 77%.
Figure 2. Summary of SARs of benzothiazole PPARα agonists and antagonists.
Figure 3. Dose-response inhibition of compound 4 on PPARα in the presence of GW7647 (panel A)
and evaluation of CPT1A mRNA expression by RT-qPCR, using 150 μM of compound 4. (panel B).
Figure 4. Effect of compounds tested in this study on viability in pancreatic (panel A) and colorectal
(panel B) tumor cell lines. Cell viability was assessed by MTT assay using compounds at 75 μM. Data
shown are the means +SD of three experiments with quintuplicate determinations. *Significant
differences between control and each compound (*p<0.05; **p<0.01).
Figure 5. Dose-response curves of the effect of compound 4 on viability of pancreatic (Capan-2 and
AspC-1) and colorectal (HT-29 and SW480) tumor cell lines assessed by MTT assay. Compound 4 was
This article is protected by copyright. All rights reserved.

incubated with the four cancer cell lines at concentrations ranging from 25 to 150 μM for 72 hours.
Data shown are the means +SD of three experiments with quintuplicate determinations. *Significant
differences between control and each molecule concentration (*p<0.05; **p<0.01; ***p<0.001).
References
[1] I. Issemann, S. Green, Nature 1990, 347, 645.
[2] T.M. Willson, P.J. Brown, D.D. Sternbach, B.R. Henke, J. Med. Chem. 2000, 43, 527.
[3] J.P. Berger, T.E. Akiyama, P.T. Meinke, Trends Pharmacol. Sci. 2005, 26, 244.
[4] J. Berger, D.E. Moller, Annu. Rev. Med. 2002, 53, 409.
[5] K. Motojima, Cell Struct. Func. 1993, 18, 267.
[6] G.J. Etgen, N. Mantlo, Curr. Top. Med. Chem. 2003, 3,1649.
[7] J.-C. Fruchart, Atherosclerosis 2009, 205, 1.
[8] S.R. Pyper, N. Viswakarma, S. Yu, J.K. Reddy, Nucl. Recept. Signal. 2010, 8, e002.
[9] S. Fazio, M.F. Linton, Curr. Atheroscler. Rep. 2004, 6, 148.
[10] N. Katsiki, D. Nikolic, G. Montalto, M. Banach, D.P. Mikhailidis, M. Rizzo, Curr. Pharm. Des.
2013, 19, 3124.
[11] G.J. Murphy, J.C. Holder, Trends Pharmacol. Sci. 2000, 21, 469.
[12] B. Cariou, B. Charbonnel, B. Staels, Trends Endocrin. Met. 2012, 23, 205.
[13] G.D. Barish, V.A. Narkar, R.M. Evans, J. Clin. Invest. 2006, 116, 590.
[14] C.-H. Lee, P. Olson, A. Hevener, I. Mehl, L.-W. Chong, J.M. Olefsky, F.J. Gonzalez, J. Ham, H. Kang,
J.M. Peters, R.M. Evans, Proc. Natl. Acad. Sci. U S A 2006, 103, 3444.
[15] C. Pirat, A. Farce, N. Lebègue, N. Renault, C. Furman, R. Millet, S. Yous, S. Speca, P. Berthelot, P.
Desreumaux, P. Chavatte, J. Med. Chem. 2012, 55, 4027.
[16] P.L. Feldman, M.H. Lambert, B.R. Henke, Curr. Top. Med. Chem. 2008, 8, 728.
This article is protected by copyright. All rights reserved.

[17] B. De Filippis, P. Linciano, A. Ammazzalorso, C. Di Giovanni, M. Fantacuzzi, L. Giampietro, A.
Laghezza, C. Maccallini, P. Tortorella, A. Lavecchia, F. Loiodice, R. Amoroso, Eur. J. Med. Chem.
2015, 89, 817.
[18] Å. Kaupang, E.T. Kase, C.X.T. Vo, M. Amundsen, A. Vik, T.V. Hansen, Bioorg. Med. Chem.
2016, 24, 247.
[19] B.G. Shearer, R.W. Wiethe, A. Ashe, A.N. Billin, J.M. Way, T.B. Stanley, C.D. Wagner, R.X. Xu,
L.M. Leesnitzer, R.V. Merrihew, T.W. Shearer, M.R. Jeune, J.C. Ulrich, T.M. Willson, J. Med. Chem.
2010, 53, 1857.
[20] A. Rubenstrunk, R. Hanf, D.W. Hum, J.-C. Fruchart, B. Staels, BBA-Mol. Cell Biol L. 2007, 1771,
1065.
[21] A. Ammazzalorso, B. De Filippis, L. Giampietro, R. Amoroso, ChemMedChem 2013, 8, 1609.
[22] N.T. Zaveri, B.G. Sato, F. Jiang, J. Calaoagan, K.R. Laderoute, B.J. Murphy, Cancer Biology &
Therapy 2009, 8, 1252.
[23] W. Lu, P. Che, Y. Zhang, H. Li, S. Zou, J. Zhu, J. Deng, X. Shen, H. Jiang, J. Li, J. Huang, J. Steroid.
Biochem. Mol. Biol. 2011, 124, 112.
[24] U.E. Martinez-Outschoorn, M. Peiris-Pagés, R.G. Pestell, F. Sotgia, M.P. Lisanti, Nat. Rev. Clin.
Oncol., published online May 4, 2016; DOI:10.1038/nrclinonc.2016.60.
[25] G. Laurenti, E. Benedetti, B. D'Angelo, L. Cristiano, B. Cinque, S. Raysi, M. Alecci, M. P. Cerù, M.
G. Cifone, R. Galzio, A. Giordano, A. Cimini, J. Cell. Biochem. 2011, 112, 3891.
[26] E. Benedetti, M. d'Angelo, A. Ammazzalorso, G. Gravina, C. Laezza, A. Antonosante, G. Panella,
B. Cinque, L. Cristiano, A. C. Dhez, C. Astarita, R. Galzio, M.G. Cifone, R. Ippoliti, R. Amoroso, E. Di
Cesare, A. Giordano, A. Cimini, J. Cell. Physiol. 2017, 232 (6), 1458.
[27] J.M. Peters, Y.M. Shah, F.J. Gonzalez, Nature Reviews Cancer 2012, 12, 181.
[28] O.A. Aboud, H.I. Wettersen, R.H. Weiss, Plos One 2013, 8, e71115.
[29] D.E. Spaner, E. Lee, Y. Shi, F. Wen, Y. Li, S. Tung, L. McCaw, K. Wong , H. Gary Gouy, A. Dalloul, R.
Ceddia, R. Gorzcynski, Leukemia 2013, 27, 1090.
This article is protected by copyright. All rights reserved.

[30] A. Nakajima, A. Tomimoto, K. Fujita, M. Sugiyama, H. Takahashi, I. Ikeda, K. Hosono, H.
Endo, K. Yoneda, H. Iida, M. Inamori, K. Kubota, S. Saito, N. Nakajima, K. Wada, Y. Nagashima, H.
Nakagama, Cancer Sci. 2008, 99, 1892.
[31] K. Ryu, M. Susa, E. Choy, C. Yang, F.J. Hornicek, H.J. Mankin, Z. Duan, BMC Cancer 2010,
10, 187.
[32] A. Ammazzalorso, A. Giancristofaro, A. D’Angelo, B. De Filippis, M. Fantacuzzi, L.
Giampietro, C. Maccallini, R. Amoroso, Bioorg. Med. Chem. Lett. 2011, 21, 4869.
[33] A. Ammazzalorso, A. D’Angelo, A. Giancristofaro, B. De Filippis, M. Di Matteo, M. Fantacuzzi, L.
Giampietro, P. Linciano, C. Maccallini, R. Amoroso, Eur. J. Med. Chem. 2012, 58, 317.
[34] A. Ammazzalorso, A. Carrieri, F. Verginelli, I. Bruno, G. Carbonara, A. D’Angelo, B. De Filippis, M.
Fantacuzzi, R. Florio, G. Fracchiolla, L. Giampietro, A. Giancristofaro, C. Maccallini, A. Cama, R.
Amoroso, Eur. J. Med. Chem. 2016, 114, 191.
[35] L. Giampietro, A. Ammazzalorso, A. Giancristofaro, F. Lannutti, G. Bettoni, B. De Filippis, M.
Fantacuzzi, C. Maccallini, M. Petruzzelli, A. Morgano, A. Moschetta, R. Amoroso, J. Med. Chem. 2009,
52, 6224.
[36] T.C. Chou, Cancer Res. 2010, 70, 440.
[37] A. Udelnow, A. Kreyes, S. Ellinger, K. Landfester, P. Walther, T. Klapperstueck, J. Wohlrab, D.
Henne-Bruns, U. Knippschild, P. Würl, Plos One 2011, 6, e20143.
[38] B. Bao, Z. Wang, S. Ali, A. Ahmad, A.S. Azmi, S.H. Sarkar, S. Banerjee, D. Kong, Y. Li, S. Thakur,
F.H. Sarkar, Cancer Prev. Res. 2012, 5, 355.
[39] J.S. Shim, J.O. Liu, Int. J. Biol. Sci. 2014, 10, 654.
Supporting information
Additional Supporting Information may be found online in
the supporting information tab for this article
Additional Supporting Information may be found online in
the supporting information tab for this article
This article is protected by copyright. All rights reserved.

Additional Supporting Information may be found online in
the supporting information tab for this article
Additional Supporting Information may be found online in
the supporting information tab for this article
Additional Supporting Information may be found online in
the supporting information tab for this article
Additional Supporting Information may be found online in the supporting information tab for
this article.
This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.