Novel nucleoside analogues targeting HCV replication through an NS5A-dependent inhibition mechanism

Article abstract of DOI:10.1111/cbdd.12966

A series of new tricyclic nucleosides were synthesized and evaluated as hepatitis C virus (HCV) replication inhibitors. Initial screening in a HCV replicon system, derived from a genotype 1b isolate, identified 9-benzylamino-3-(β-D-ribofuranosyl)-3H-imidazo[4′,5′:5,6]pyrido[2,3-b]pyrazine (15d) as the most potent analogue. Comparative assessment of 15d activity against HCV full-length viruses or subgenomic replicons derived from genotypes 1 to 4 revealed a specificity of the compound for genotypes 1 and 3. Surprisingly, resistance mutations selected against 15d were mapped to domains II and III of the non-structural protein 5A (NS5A), but not to the RNA-dependent RNA polymerase residing in NS5B. These results argue that compound 15d might represent a lead for the development of a novel class of NS5A inhibitors.

Full text of DOI:10.1111/cbdd.12966

PROF. NICOLE POULI (Orcid ID : 0000-0003-3272-759X)
Received Date : 28-Nov-2016
Revised Date : 20-Jan-2017
Accepted Date : 10-Feb-2017
Article type : Research Article
Novel nucleoside analogues targeting HCV replication through an NS5A-dependent
inhibition mechanism
Nikolaos Lougiakis,a Efseveia Frakolaki,b Panagiota Karmou,a Nicole Pouli,*a Panagiotis
Marakos,a Vanesa Madan,c Ralf Bartenschlagerc,d,e and Niki Vassilaki*b
a Division of Pharmaceutical Chemistry, Department of Pharmacy, National and Kapodistrian
University of Athens, Panepistimiopolis-Zografou, Athens 15771, Greece
b
Molecular Virology Laboratory, Hellenic Pasteur Institute, Vas. Sofias Avenue, 11521,
Athens, Greece
c
Department of Infectious Diseases, Molecular Virology, University of Heidelberg,
Heidelberg, Germany
d German Center for Infection Research, Heidelberg University
e Division of Virus-Associated Carcinogenesis, German Cancer Research Center (DKFZ), Im
Neuenheimer Feld 242, 69120 Heidelberg, Germany
Running title: Tricyclic nucleosides targeting HCV replication
*Address correspondence to:
N. Pouli, pouli@pharm.uoa.gr, Tel: 0030 2107274185, Fax: 0030 2107274747
N. Vassilaki, nikiv@pasteur.gr Tel: 0030 2106478875, Fax: 0030 2106425038
Abstract
A series of new tricyclic nucleosides were synthesized and evaluated as Hepatitis C
virus (HCV) replication inhibitors. Initial screening in a HCV replicon system, derived from a
This article has been accepted for publication and undergone full peer review but has not
been through the copyediting, typesetting, pagination and proofreading process, which may
lead to differences between this version and the Version of Record. Please cite this article as
doi: 10.1111/cbdd.12966
This article is protected by copyright. All rights reserved.

genotype
1b
isolate,
identified
9-benzylamino-3-(β-D-ribofuranosyyl)-3H-
imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazinee (15d) as the most potent analogue. Comparative
assessment of 15d activity against HHCV full-length viruses or subgenomic replicons derived
from genotype 1 - 4 revealed a sspecificity of the compound for genotypes 1 and 3.
Surprisingly, resistance mutations sellected against 15d were mapped to domains II annd III of
the nonstructural protein 5A (NS5AA), but not to the RNA-dependent RNA polymmerase
residing in NS5B. These results argue that compound 15d might represent a lead for the
development of a novel class of NS5AA inhibitors.
Keywords: imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazine; N-ribonucleosides; nucleoside scaffold;
antiviral activity; resistance mutationss; NS5A domains II, III.
Graphical Abstract
Novel nucleoside analogues targ
inhibition mechanism
eeting HCV replication through an NS5A-dependent
Nikolaos Lougiakis, Efseveia Frakolaki, Panagiota Karmou, Nicole Pouli,* Panagiotis
Marakos, Vanesa Madan, Ralf Bartennschlager, Niki Vassilaki*
A
number of new
tricyclic nucleosides
were synthessized and
their inhibitoryy potential
against
evaluated.
HCCV
was
The
CH2C6H5
benzylaminodderivative
HN
N
15d, reduce
replication
d
HCV
and
N
N
N
N
possessed selectivity
index 4.97 in 1b
genotype.
O
15d
HO
OH
HO
Resistance mutation studies were peerformed, suggesting that this compound could possess a
NS5A-dependent mechanism of actioon, which is unexpected for nucleoside derivatives
.

Introduction
Hepatitis C virus (HCV) infection is a major cause of chronic liver disease that often
leads to liver cirrhosis and hepatocellular carcinoma [1-3]. No vaccine is currently available [4]
and treatment aims towards the eradication of the virus. The primary management of HCV
infection until recently, consisting of pegylated IFN-α plus ribavirin [5], was only partially
effective and associated with numerous side-effects. However, progressive advances in the
molecular understanding of the various steps of the viral life cycle [6], along with the
[7, 8]
introduction of an efficient HCV cell culture system that is based on the JFH1 isolate
,
enabled the development of promising direct acting antivirals (DAAs). Combinations of
different approved DAAs, each targeting individual viral proteins, have proven very effective
and resulted in multiple IFN-free and largely ribavirin-free regimens, which can safely
eliminate HCV in the majority of patients [9-11]. Current drug combinations are orally active
and generally well tolerated, but access to diagnosis and therapy remains low on a global
scale [12]. Thus, there is a remaining need for novel effective drugs that will avoid the
development of resistance, reducing also the high costs of treatment.
[13]
HCV belongs to the Flaviviridae family
and is classified into seven major HCV
genotypes and more than one hundred subtypes [14]. The single strand positive-sense RNA
genome of HCV is composed of a 5’-untranslated region (UTR), a long open reading frame
encoding a polyprotein precursor of about 3,000 amino acids, and a 3′-UTR. The polyprotein
precursor is processed into structural proteins (core, E1 and E2), p7 required for assembly
and release of virus particles and six nonstructural proteins (NS2, NS3, NS4A, NS4B, NS5A
and NS5B) which form a membrane-associated replicase complex in association with
[15,
cellular factors
16]. Among the non-structural proteins, the NS3/4A serine-protease
complex, the NS5A replicase protein and the NS5B RNA-dependent RNA polymerase
(RdRp) are the primary targets for currently available DAAs [15]. In case of NS3/4A, first
generation linear peptidomimetic inhibitors were replaced by more potent macrocyclic or
This article is protected by copyright. All rights reserved.

linear second-wave inhibitors, but these still have a limited genotype specificity and a rather
low barrier to resistance [17, 18]
.
RdRp inhibitors fall into two different subclasses, namely nucleos(t)ide (NPIs) and
nonnucleoside inhibitors (NNPIs). NNPIs are potent allosteric inhibitors, but with a limited
spectrum of activity and a low barrier to resistance. They target five distinct binding pockets
located at the thumb (sites 1 and 2) and palm (sites 3, 4 and 5) subdomains of NS5B, which
resembles a characteristic human “right hand motif” [19]. On the contrary, NPIs which mimic
natural polymerase substrates and bind to the highly conserved active site of the enzyme
are characterized by pangenotypic activity and a high barrier to resistance. The uridine
nucleotide sofosbuvir (Figure 1) is the most prominent representative of this drug class, and
in combination with broadly active NS5A inhibitors results in high cure rates for virtually all
genotypes 1-6 [9, 20]
.
HCV NS5A is a multifunctional RNA-binding phosphoprotein which exists in a basal (56
[21,
kDa) and a hyperphosphorylated (58 kDa) form
22]. Available data suggests that the
phosphorylation status plays a major role in regulating viral RNA replication versus assembly
[23]. NS5A consists of three domains, separated by short low-complexity sequences (LCSs).
Domains I (D1) and II (D2) are required for virus genome replication, whereas domain III
(D3) is essential for assembly. D1 contributes to binding to lipid droplets, which are crucial
for HCV assembly, whereas D3 is involved in interaction with the core protein [24]. D1 can
form different homodimers, one of them forming a RNA-binding groove [25]. D2 and D3 of
NS5A are intrinsically unfolded and highly flexible, explaining the broad spectrum of protein
interactions into which NS5A can engage. For instance, phosphatidylinositol 4-kinase IIIα
(PI4KIIIa) interacts with the C-terminal part of D1 [26], cyclophilin A with the C terminus of D2
and with D3 [27, 28] and Src Homology 3 domain-containing proteins (Src family members Lyn
and Fyn, mixed lineage kinase 3) with a conserved polyproline (PxxPxR) motif present in
low-complexity sequence II (LCSII) [29, 30]. NS5A appears to be phosphorylated at serine and
threonine residues by several kinases including casein kinase Iα and II, Mitogen-activated
Protein Kinase Kinase 1, AKT (or Protein Kinase B), Polo-like kinase I and cyclic AMP-
This article is protected by copyright. All rights reserved.

dependent protein kinase. Phosphorylation at some of these sites has been reported to
affect RNA replication and virus assembly [22]
.
Clinically approved DAAs against NS5A, as exemplified by daclatasvir (Fig. 1) [31], have
been identified by using high content screening approaches. These drugs share as common
characteristic two identical peptidomimetic substituents, which suggests binding to a
symmetric protein structure.
As part of our involvement in the synthesis and biological evaluation of nucleoside
derivatives [32-34], we screened a number of differently substituted compounds with the aim to
discover agents with potent anti-HCV activity. In this context, we have identified derivatives
of a novel tricyclic nucleoside scaffold, endowed with antiviral activity. It should be noted that
the concept of bioactive nucleosides possessing ring-expanded nucleobases has previously
[35]
been developed
and analogously modified derivatives have been found to possess
[36,
interesting activity against HIV and HCV
37]. We now report the synthesis of new
imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazine ribosides, their evaluation against HCV of genotypes
1-4 and our attempts to clarify their mode of action.
Methods and Materials
Chemistry
Melting points were determined on a Büchi apparatus and are uncorrected. 1H NMR spectra
and 2D spectra were recorded on a Bruker Avance III 600 or a Bruker Avance DRX 400
instrument, whereas 13C NMR spectra were recorded on a Bruker Avance III 600 or a Bruker
AC 200 spectrometer in deuterated solvents and were referenced to TMS (δ scale). The
1
signals of H and 13C spectra were unambiguously assigned by using 2D NMR techniques:
1H1H COSY, NOESY, HMQC, and HMBC. Mass spectra were recorded with a LTQ Orbitrap
Discovery instrument, possessing an Ionmax ionization source. Flash chromatography was
performed on Merck silica gel 60 (0.040–0.063 mm). Analytical thin layer chromatography
(TLC) was carried out on precoated (0.25 mm) Merck silica gel F-254 plates. The purity of all
the synthesized compounds was >95% as ascertained by elemental analysis. Elemental
This article is protected by copyright. All rights reserved.

analyses were undertaken using a PerkinElmer PE 240C elemental analyzer (Norwalk, CT,
U.S.) and the measured values for C, H, and N were within 0.4% of the theoretical values.
N,N’-(3-Nitropyridine-2,6-diyl)diacetamide (3)
To a solution of the diacetamidopyridine 2 (5 g, 25.90 mmol) in concentrated sulfuric acid
(37.6 mL) was added dropwise at 0 oC a mixture of sulfuric acid (2.5 mL) and nitric acid (2.5
o
mL). The mixture was stirred at 0 C for 20 min and then at room temperature for 25 min.
Upon completion of the reaction, the solution was poured into crashed ice and neutralized
using ammonium hydroxide (25%) until pH 7. The yellow precipitate was filtered, washed
with water and air-dried, to provide the pure nitroderivative 3 (5.5 g, 89%) as a yellow solid,
o
1
mp 195 C (EtOAc). H NMR (600 MHz, DMSO-d6) δ 2.11 (s, 3H, CH3), 2.15 (s, 3H, CH3),
7.99 (d, 1H, J=9 Hz, H-4), 8.38 (d, 1H, J=9 Hz, H-5), 10.68 (s, 1H, NH, D2O exch.), 10.86 (s,
1H, NH, D2O exch.). 13C NMR (151 MHz, DMSO-d6) δ 24.60 (CH3), 24.69 (CH3), 109.82 (C-
4), 134.72 (C-3), 137.28 (C-5), 143.17 (C-2), 153.94 (C-6), 169.52 (CO), 170.61 (CO). HR-
MS (ESI) m/z: Calcd for C9H11N4O4: [M1+H]+ =239.0775, found 239.0772. Anal. Calcd for
C9H10N4O4: C, 45.38; H, 4.23; N, 23.52. Found: C, 45.52; H, 4.26; N, 23.34.
N-(6-Amino-5-nitropyridin-2-yl)acetamide (4) and 3-nitropyridine-2,6-diamine (4a)
o
Hydrochloric acid (36%, 5.4 mL) was added dropwise at 0 C into a solution of the
nitroderivative 3 (2.7 g, 11.34 mmol) in methanol (40 mL) and the mixture was stirred at 0 oC
for 40 min and then at room temperature for 1 h. Upon completion of the reaction, the
solution was poured into crashed ice and neutralized with ammonium hydroxide (25%) until
pH 7. The solvents were vacuum-evaporated, water was added to the residue and it was
extracted with EtOAc. The organic extracts were dried over sodium sulfate and evaporated
to dryness. The crude mixture was purified by column chromatography (silica gel) using a
mixture of dichloromethane / ethyl acetate (from 100/1 up to 100/5, v/v) as the eluent, to
provide the nitroderivatives 4 and 4a.
o
1
Data for 4: Yield 50%. Yellow solid, mp 209 C (EtOAc). H NMR (600 MHz, DMSO-d6) δ
2.13 (s, 1H, CH3), 7.44 (d, 1H, J=9 Hz, H-4), 7.75 (brs, 2H, NH2, D2O exch.), 8.36 (d, 1H,
This article is protected by copyright. All rights reserved.

J=9 Hz, Η-5), 10.64 (s, 1H, NH, D2O exch.). 13C NMR (151 MHz, DMSO-d6) δ 24.73 (CH3),
103.48 (C-4), 123.23 (C-3), 137.96 (C-5), 153.93 (C-2), 156.56 (C-6), 170.77 (CO). HR-MS
(ESI) m/z: Calcd for C7H9N4O3: [M1+H]+ =197.0669, found 197.0661. Anal. Calcd for
C7H8N4O3: C, 42.86; H, 4.11; N, 28.56. Found: C, 42.99; H, 4.14; N, 28.35.
o
1
Data for 4a: Yield 3%. Yellow solid, mp 240 C (EtOAc). H NMR (600 MHz, DMSO-d6) δ
5.92 (d, 1H, J=9 Hz, H-4), 7.27 (brs, 1H, NH, D2O exch.), 7.59 (brs, 1H, NH, D2O exch.),
7.97 (d, 1H, J=9 Hz, H-5), 8.04 (brs, 2H, NH2, D2O exch.). 13C NMR (151 MHz, DMSO-d6) δ
101.86 (C-4), 117.77 (C-3), 135.79 (C-5), 156.21 (C-2), 162.80 (C-6). HR-MS (ESI) m/z:
Calcd for C5H7N4O2: [M1+H]+ =155.0564, found 155.0559. Anal. Calcd for C5H6N4O2: C,
38.96; H, 3.92; N, 36.35. Found: C, 38.78; H, 3.87; N, 36.51.
N-(Pyrido[2,3-b]pyrazin-6-yl)acetamide (5)
A solution of the nitroderivative 4 (500 mg, 2.55 mmol) in absolute ethanol (30 mL) was
hydrogenated in the presence of 10% Pd/C (60 mg) under a pressure of 50 psi at room
temperature for 4h. The solution was then filtered through a celite pad and the filtrate was
evaporated to dryness. The resulting diamine was dissolved in ethanol (30 mL), glyoxal
(40% w/w aq. solution, 0.41 g, 2.8 mmol) was added to the solution and the mixture was
refluxed for 90 min. The solvents were then evaporated and the residue was purified by
column chromatography (silica gel) using ethyl acetate as the eluent, to provide the
compound 5 as a beige solid (0.54 g, 96%). mp 240 oC (EtOAc). 1H NMR (600 MHz, DMSO-
d6) δ 2.19 (s, 3H, CH3), 8.49 (d, 1H, J=9 Hz, H-8), 8.62 (d, 1H, J=9 Hz, H-7), 8.90 (d, 1H,
J=2 Hz, H-2), 9.03 (d, 1H, J=2 Hz, H-3), 11.28 (s, 1H, NH, D2Oexch.). 13C NMR (151 MHz,
DMSO-d6) δ 24.37 (CH3), 119.09 (C-7), 135.97 (C-8a), 140.04 (C-8), 144.41 (C-2), 148.16
(C-3), 150.98 (C-4a), 154.73 (C-6), 170.67 (CO). HR-MS (ESI) m/z: Calcd for C9H9N4O:
[M1+H]+ =189.0771, found 189.0767. Anal. Calcd for C9H8N4O: C, 57.44; H, 4.29; N, 29.77.
Found: C, 57.66; H, 4.36; N, 29.59.
7-Nitropyrido[2,3-b]pyrazin-6-amine (6)
A mixture of fuming nitric acid (0.4 mL) and acetic anhydride (1.6 mL) was added dropwise
into a solution of the acetamide 5 (250 mg, 1.33 mmol) in acetic anhydride (6 mL) at -20 oC,
This article is protected by copyright. All rights reserved.

and the mixture was stirred at this temperature for 90 min. The solution was then poured into
crashed ice, extracted with ethyl acetate, the organic extracts were dried over sodium sulfate
and evaporated to dryness. The crude mixture was purified by column chromatography
(silica gel) using a mixture of cyclohexane / ethyl acetate (4/6, v/v) as the eluent, to provide
the nitrocompound 6 (20 mg, 6%) as an orange colored solid. mp > 300 oC (EtOAc). 1H NMR
(600 MHz, DMSO-d6) δ 7.84 (brs, 1H, NH2, D2O exch.), 8.14 (brs, 1H, NH2, D2O exch.), 8.73
(d, 1H, J=1.9 Hz, H-2), 8.95 (d, 1H, J=1.9 Hz, H-3), 8.99 (s, 1H, H-8). 13C NMR (151 MHz,
DMSO-d6) δ 131.28 (C-8a), 134.10 (C-7), 137.23 (C-8), 142.47 (C-2), 150.04 (C-6), 151.92
(C-3), 153.79 (C-4a). HR-MS (ESI) m/z: Calcd for C7H6N5O2: [M1+H]+ =192.0516, found
192.0507. Anal. Calcd for C7H5N5O2: C, 43.98; H, 2.64; N, 36.64. Found: C, 44.11; H, 2.69;
N, 36.53.
N-(3H-imidazo[4,5-b]pyridin-5-yl)acetamide (7)
The nitroderivative 4 (1.2 g, 6.12 mmol) was hydrogenated according to the method reported
for the preparation of compound 5. The resulting diamine was then dissolved in
triethylorthoformate (6 mL) followed by dropwise addition of hydrochloric acid (36%, 0.1 mL)
and the mixture was stirred at room temperature for 30 h. Upon completion of the reaction,
n-pentane (50 mL) was added and the precipitate was filtered, washed with n-pentane and
air-dried. The solid was dissolved in methanol, sodium bicarbonate (0.5 g) was added and
the mixture was stirred at room temperature for 1h. The solvent was evaporated and the
crude product was purified by column chromatography (silica gel) using a mixture of
dichloromethane / methanol (100/1, v/v) as the eluent, to provide the acetamide 7 (1 g,
93%). mp 212-3 oC (EtOAc). 1H NMR (600 MHz, DMSO-d6) δ 2.10 (s, 3H, CH3), 7.99 (d, 1H,
J=8.5Hz, H-7), 8.02 (d, 1H, J=8.5Hz, H-6), 8.33 (s, 1H, H-2), 10.46 (s, 1H, NHCO, D2O
exch.), 12.80 (s, 1H, NH-3, D2O exch.). 13C NMR (151 MHz, DMSO-d6) δ 24.43 (CH3),
109.94 (C-6), 125.78 (C-7), 127.74 (C-7a), 143.65 (C-2), 148.17 (C-5), 149.49 (C-3a),
169.28 (CO). HR-MS (ESI) m/z: Calcd for C8H9N4O: [M1+H]+ =177.0771, found 177.0765.
Anal. Calcd for C8H8N4O: C, 54.54; H, 4.58; N, 31.80. Found: C, 54.73; H, 4.64; N, 31.61.
6-Nitro-3H-imidazo[4,5-b]pyridin-5-amine (8)
This article is protected by copyright. All rights reserved.

This compound was prepared following a methodology analogous to that reported for 3. The
product was purified by column chromatography (silica gel) using a mixture of
dichloromethane / methanol (92/8, v/v) as the eluent, to provide the nitroderivative 8 (0.69 g,
68%) as an orange colored solid. mp >300 oC (EtOH). 1H NMR (600 MHz, DMSO-d6) δ 7.75
(s, 2H, NH2, D2O exch.), 8.36 (s, 1H, H-2), 8.60 (s, 1H, H-7). 13C NMR (151 MHz, DMSO-d6)
δ 125.15 (C-7), 126.92 (C-6), 127.31 (C-7a), 147.11 (C-2), 152.71 (C-5), 154.09 (C-3a). HR-
MS (ESI) m/z: Calcd for C6H6N5O2: [M1+H]+ =180.0516, found 180.0509. Anal. Calcd for
C6H5N5O2: C, 40.23; H, 2.81; N, 39.10. Found: C, 40.46; H, 2.88; N, 38.94.
3H-Imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazine (9)
This compound was prepared from the nitroderivative 8, following a methodology analogous
to that reported for 3. The hydrogenation lasted 2 days and the product was obtained upon
repeated recrystallizations with methanol in 56% yield. mp >300 oC (MeOH). A small quantity
of the compound was purified by column chromatography (silica gel) for analytical reasons,
1
using a mixture of ethyl acetate / methanol (9/1, v/v) as the eluent. H NMR (600 MHz,
DMSO-d6) δ 8.74 (s, 1H, H-2), 8.94 (s, 1H, H-9), 9.00 (s, 1H, H-7), 9.08 (s, 1H, H-6). 13C
NMR (151 MHz, DMSO-d6) δ 127.31 (C-9a), 132.93 (C-8a), 135.16 (C-9), 144.46 (C-7),
146.57 (C-6), 147.47 (C-2), 151.68 (C-4a), 153.11 (C-3a). HR-MS (ESI) m/z: Calcd for
C8H6N5: [M1+H]+ =172.0618, found 172.0611. Anal. Calcd for C8H5N5: C, 56.14; H, 2.94; N,
40.92. Found: C, 56.27; H, 2.99; N, 40.69.
3-(2,3,5-Tri-O-acetyl-β-D-ribofuranosyl)-3H-imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazine (10) and
1-(2,3,5-tri-O-acetyl-β-D-ribofuranosyl)-1H-imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazine (11)
N,O-Bis(trimethylsilyl)acetamide (1.67 mL, 6.81 mmol) was added under argon to a
suspension of compound 9 (1 g, 5.84 mmol) in anhydrous acetonitrile (35 mL) and the
mixture was heated at 80 oC for 45 min. Upon cooling at room temperature, tetra-O-acetyl-β-
D-ribofuranose (2 g, 6.28 mmol) was added, followed by dropwise addition of trimethylsilyl
o
trifluoromethanesulfonate (1.06 mL, 5.84 mmol) at 0 C and the mixture was refluxed for 3
hours. The solvents were then evaporated, the crude material was diluted with ethyl acetate
and extracted with a saturated NaHCO3 solution. The aqueous layer was extracted twice
This article is protected by copyright. All rights reserved.

more with ethyl acetate, the combined organic extracts were dried over sodium sulfate and
evaporated to dryness. The crude mixture was purified by column chromatography, using
initially a mixture of cyclohexane / ethyl acetate (from 2/8 up to 0/10, v/v) and then a mixture
of ethyl acetate / methanol (from 100/0 up to 95/5, v/v) as the eluent, providing 1.03 g of 10
(as a mixture with its corresponding α-anomer, ratio 7 : 1, as indicated by NMR), and 0.35 g
of 11 (as a mixture with its corresponding α-anomer, ratio 7 : 1, as indicated by NMR). The
mixture of 10 with its α-anomer was repurified by column chromatography using a mixture of
dichloromethane / ethyl acetate (6/4, v/v) as the eluent and the target β-anomer could be
isolated pure, as a pale yellow gum (0.77 g, 31%). On the other hand, the mixture of 11 with
its α-anomer was repurified by column chromatography using a mixture of dichloromethane /
methanol (100/1, v/v) as the eluent and the target β-anomer was isolated pure, as a pale
yellow solid (0.17 g, 7%).
Data for 10: 1H NMR (600 MHz, CDCl3) δ 2.03 (s, 3H, CH3), 2.15 (s, 3H, CH3), 2.16 (s, 3H,
CH3), 4.45 (m, 2H, H-5’), 4.50 (m, 1H, H-4’), 5.65 (m, 1H, H-3’), 5.90 (m, 1H, H-2’), 6.65 (d,
1H, J=5.8 Hz, H-1’), 7.72 (s, 1H, H-2), 8.85 (s, 1H, H-9), 8.96 (d, 1H, J=1.6 Hz, H-7), 9.05 (d,
1H, J=1.6 Hz, H-6). 13C NMR (151 MHz, CDCl3) δ 20.40 (CH3), 20.57 (CH3), 20.85 (CH3),
63.19 (C-5’), 70.77 (C-3’), 73.30 (C-2’), 80.35 (C-4’), 85.50 (C-1’), 128.96 (C-9), 136.53 (C-
8a), 138.19 (C-9a), 144.21 (C-7), 146.77 (C-6), 148.17 (C-2), 148.36 (C-4a), 149.98 (C-3a),
169.50 (CO), 169.67 (CO), 170.29 (CO). HR-MS (ESI) m/z: Calcd for C19H20N5O7: [M1+H]+
=430.1357, found 430.1350. Anal. Calcd for C19H19N5O7: C, 53.15; H, 4.46; N, 16.31. Found:
C, 53.02; H, 4.43; N, 16.46.
Data for 11: mp 92-3 oC (CHCl3/Et2O). 1H NMR (400 MHz, CDCl3) δ 2.09 (s, 3H, CH3), 2.18
(s, 3H, CH3), 2.32 (s, 3H, CH3), 4.44 (dd, 1H, J=13.2 Hz, J= 2.9 Hz, H-5’), 4.52-4.59 (m, 2H,
H-4’, H-5’), 5.48 (m, 1H, H-3’), 5.66 (m, 1H, H-2’), 6.24 (d, 1H, J= 5.7 Hz, H-1’), 8.79 (s, 1H,
H-9), 8.81 (s, 1H, H-2), 8.94 (s, 1H, J=1.4 Hz, H-7), 9.11 (s, 1H, J=1.4 Hz, H-6). 13C NMR
(50 MHz, CDCl3) δ 20.46 (CH3), 20.65 (CH3), 21.11 (CH3), 62.93 (C-5’), 70.17 (C-3’), 72.79
(C-2’), 80.97 (C-4’), 88.24 (C-1’), 119.48 (C-9), 127.36 (C-9a), 135.76 (C-8a), 144.99 (C-7),
146.95 (C-6), 148.64 (C-4a), 150.98 (C-2), 159.88 (C-3a), 169.44 (CO), 169.69 (CO), 170.46
This article is protected by copyright. All rights reserved.

(CO). HR-MS (ESI) m/z: Calcd for C19H20N5O7: [M1+H]+ =430.1357, found 430.1352. Anal.
Calcd for C19H19N5O7: C, 53.15; H, 4.46; N, 16.31. Found: C, 53.32; H, 4.53; N, 16.16.
General procedure for the synthesis of nucleosides 12 and 13
Compound 10 or 11 (130 mg, 0.3 mmol) was dissolved in a saturated solution of ammonia in
methanol (15 mL) and the resulting mixture was stirred at room temperature for 6 h. The
solvent was vacuum-evaporated and the residue was purified by column chromatography.
3-(β-D-ribofuranosyl)-3H-imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazine (12)
Purification was effected using a mixture of dichloromethane / methanol (96/4, v/v) as the
eluent to provide the nucleoside 12 as a white solid. Yield 87%. mp 227-8 oC (MeOH). [α]D -
1
31.76o (c=0.296, DMSO). H NMR (400 MHz, DMSO-d6) δ 3.63 (m, 1H, H-5’), 3.76 (m, 1H,
H-5’), 4.03 (m, 1H, H-4’), 4.26 (m, 1H, H-3’), 4.76 (m, 1H, H-2’), 5.22 (t, 1H, J=5.7 Hz, OH-5’,
D2O exch.), 5.29 (d, 1H, J=4.9 Hz, OH-3’, D2O exch.), 5.58 (d, 1H, J=5.9 Hz, OH-2’, D2O
exch.), 6.23 (d, 1H, J=5.7 Hz, H-1’), 8.88 (s, 1H, H-9), 9.04 (d, 1H, J=1.7 Hz, H-7), 9.12 (d,
1H, J=1.7 Hz, H-6), 9.18 (s, 1H, H-2). 13C NMR (50 MHz, DMSO-d6) δ 61.81 (C-5’), 70.85
(C-3’), 73.90 (C-2’), 86.16 (C-4’), 88.14 (C-1’), 127.95 (C-9), 135.93 (C-8a), 138.78 (C-9a),
144.81 (C-7), 147.47 (C-6), 147.83 (C-4a), 150.59 (C-3a), 151.36 (C-2). HR-MS (ESI) m/z:
Calcd for C13H14N5O4: [M1+H]+ =304.1040, found 304.1032. Anal. Calcd for C13H13N5O4: C,
51.49; H, 4.32; N, 23.09. Found: C, 51.68; H, 4.39; N, 22.91.
1-(β-D-ribofuranosyl)-1H-imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazine (13)
Purification was effected using a mixture of ethyl acetate / methanol (98/2, v/v) as the eluent
o
to provide the nucleoside 13 as a white solid. Yield 82%. mp 218-9 C(dec.) (MeOH). [α]D -
59.41o (c=0.239, DMSO). 1H NMR (600 MHz, DMSO-d6) δ 3.69-3.77 (m, 2H, H-5’), 4.08 (m,
1H, H-4’), 4.19 (m, 1H, H-3’), 4.49 (m, 1H, H-2’), 5.31 (d, 1H, J=4.6 Hz, OH-3’, D2O exch.),
5.34 (t, 1H, J=4.9 Hz, OH-5’, D2O exch.), 5.61 (d, 1H, J=6.3 Hz, OH-2’, D2O exch.), 6.09 (d,
1H, J=6.3 Hz, H-1’), 9.03 (d, 1H, J=1.6 Hz, H-7), 9.06 (s, 1H, H-9), 9.12 (d, 1H, J=1.6 Hz, H-
6), 9.23 (s, 1H, H-2). 13C NMR (50 MHz, DMSO-d6) δ 61.10 (C-5’), 70.12 (C-3’), 73.62 (C-2’),
86.08 (C-4’), 89.83 (C-1’), 119.60 (C-9), 127.58 (C-9a), 134.79 (C-8a), 144.78 (C-7), 146.67
(C-6), 147.43 (C-4a), 152.93 (C-2), 159.69 (C-3a). HR-MS (ESI) m/z: Calcd for C13H14N5O4:
This article is protected by copyright. All rights reserved.

[M1+H]+ =304.1040, found 304.1034. Anal. Calcd for C13H13N5O4: C, 51.49; H, 4.32; N,
23.09. Found: C, 51.30; H, 4.28; N, 23.28.
9-Chloro-3-(2,3,5-tri-O-acetyl-β-D-ribofuranosyl)-3H-imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazine
(14)
N-Chlorosuccinimide (100 mg, 0.75 mmol) was added under argon in a solution of the
derivative 10 (230 mg, 0.54 mmol) in anhydrous THF (10 mL) and the mixture was stirred at
room temperature for 24 h. The solvent was then removed in vacuo, the residue was
extracted with ethyl acetate and water, the organic extracts were dried over sodium sulfate
and evaporated to dryness. The crude product was purified by column chromatography
(silica gel) using a mixture of cyclohexane / ethyl acetate (6/4, v/v) as the eluent, to provide
1
the chloroderivative 14 (150 mg, 60%) as a pale yellow gum. H NMR (600 MHz, CDCl3) δ
2.03 (s, 3H, CH3), 2.16 (s, 6H, 2 x CH3), 4.45 (m, 2H, H-5’), 4.51 (m, 1H, H-4’), 5.63 (m, 1H,
H-3’), 5.89 (m, 1H, H-2’), 6.60 (d, 1H, J=5.8 Hz, H-1’), 8.67 (s, 1H, H-2), 9.04 (d, 1H, J=1.6
Hz, H-7), 9.10 (d, 1H, J=1.6 Hz, H-6). 13C NMR (151 MHz, CDCl3) δ 20.31 (CH3), 20.49
(CH3), 20.75 (CH3), 63.31 (C-5’), 70.75 (C-3’), 73.28 (C-2’), 80.43 (C-4’), 85.61 (C-1’),
133.60 (C-9), 134.30 (C-8a), 136.16 (C-9a), 143.99 (C-7), 147.22 (C-6), 148.26 (C-2),
148.64 (C-4a), 149.45 (C-3a), 169.40 (CO), 169.58 (CO), 170.20 (CO). HR-MS (ESI) m/z:
Calcd for C19H19ClN5O7: [M1+H]+ =464.0968, found 464.0963. Anal. Calcd for C19H18ClN5O7:
C, 49.20; H, 3.91; N, 15.10. Found: C, 49.09; H, 3.88; N, 15.26.
General procedure for the synthesis of the target compounds 15a-e
2-Dicyclohexylphosphino-2’,4’,6’-triisopropylbiphenyl (X-phos, 6.2 mg, 0.013 mmol),
tris(dibenzylideneacetone)dipalladium(0) (12 mg, 0.013 mmol) and the appropriate amine
(1.3 mmol) were added under argon in a solution of the chloroderivative 14 (120 mg, 0.26
mmol) in anhydrous dioxane (3 mL) and the resulting mixture was heated at 90 oC for 20 h.
The solvents were then vacuum-evaporated and the crude mixture was treated with a
saturated solution of ammonia in methanol (10 mL) for 18 h at room temperature. The
solvent was evaporated and the residue was purified by column chromatography to provide
the aminosubstituted tricyclic nucleosides 15a-f.
This article is protected by copyright. All rights reserved.

N-(Butyl)-3-(β-D-ribofuranosyl)-3H-imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazin-9-amine (15a)
This compound was prepared according to the general procedure described above, upon
reaction of 14 with n-butylamine. Purification was effected using a mixture of chloroform /
o
methanol (95/5, v/v) as the eluent. Yield 39%. mp 227-8 C (MeOH). [α]D -10.77o (c=0.130,
MeOH). 1H NMR (600 MHz, DMSO-d6) δ 0.92 (t, 3H, J=7.4 Hz, CH3), 1.40 (m, 2H, CH2CH3),
1.73 (m, 2H, CH2CH2CH3), 3.59 (m, 1H, H-5’), 3.72 (m, 1H, H-5’), 4.00 (m, 1H, H-4’), 4.13
(m, 2H, NHCH2CH2), 4.20 (m, 1H, H-3’), 4.74 (m, 1H, H-2’), 5.18 (d, 1H, J=4.6 Hz, OH-3’,
D2O exch.), 5.44 (d, 1H, J=6.2 Hz, OH-2’, D2O exch.), 5.57 (m, 1H, OH-5’, D2O exch.), 6.05
(d, 1H, J=6.3 Hz, H-1’), 8.20 (t, 1H, J=6.6 Hz, NH, D2O exch.), 8.54 (s, 1H, H-2), 8.66 (d, 1H,
J=1.7 Hz, H-7), 8.94 (d, 1H, J=1.7 Hz, H-6). 13C NMR (50 MHz, DMSO-d6) δ 13.81 (CH3),
19.43 (CH2CH3), 32.28 (CH2CH2CH3), 43.47 (NHCH2), 61.75 (C-5’), 70.72 (C-3’), 73.00 (C-
2’), 85.86 (C-4’), 87.67 (C-1’), 119.61 (C-9a), 125.98 (C-8a), 138.38 (C-7), 142.64 (C-2),
143.38 (C-9), 146.96 (C-6), 148.54 (C-4a), 150.89 (C-3a). HR-MS (ESI) m/z: Calcd for
C17H23N6O4: [M1+H]+ =375.1775, found 375.1771. Anal. Calcd for C17H22N6O4: C, 54.54; H,
5.92; N, 22.45. Found: C, 54.38; H, 5.95; N, 22.56.
N-(3-Methylbutyl)-3-(β-D-ribofuranosyl)-3H-imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazin-9-amine
(15b)
This compound was prepared according to the general procedure described above, upon
reaction of 14 with 3-methylbutylamine. Purification was effected using a mixture of
dichloromethane / methanol (100/4, v/v) as the eluent. Yield 60%. mp 218 oC (MeOH/THF).
1
[α]D -37.04o (c=0.189, DMSO). H NMR (600 MHz, DMSO-d6) δ 0.93 (d, 6H, J=6.5 Hz, 2 x
CH3), 1.62 (q, 2H, J=7.1 Hz, CH2CH(CH3)2), 1.70 (m, 1H, CH2CH(CH3)2), 3.59 (m, 1H, H-5’),
3.72 (m, 1H, H-5’), 4.00 (m, 1H, H-4’), 4.12-4.22 (m, 3H, H-3’, HNCH2CH2), 4.73 (m, 1H, H-
2’), 5.21 (d, 1H, J=4.5 Hz, OH-3’, D2O exch.), 5.47 (d, 1H, J=6.3 Hz, OH-2’, D2O exch.), 5.62
(m, 1H, OH-5’, D2O exch.), 6.04 (d, 1H, J=6.3 Hz, H-1’), 8.15 (t, 1H, J=6.4 Hz, NH, D2O
exch.), 8.53 (s, 1H, H-2), 8.66 (d, 1H, J=1.6 Hz, H-7), 8.93 (d, 1H, J=1.6 Hz, H-6). 13C NMR
(151 MHz, DMSO-d6) δ 22.70 (CH(CH3)2), 25.49 (CH2CH(CH3)2), 40.06 (CH2CH(CH3)2),
42.28 (HNCH2CH2), 61.87 (C-5’), 70.83 (C-3’), 73.12 (C-2’), 85.98 (C-4’), 87.79 (C-1’),
This article is protected by copyright. All rights reserved.

119.70 (C-9a), 126.06 (C-8a), 138.56 (C-7), 142.74 (C-2), 143.46 (C-9), 147.11 (C-6),
148.63 (C-4a), 150.97 (C-3a). HR-MS (ESI) m/z: Calcd for C18H25N6O4: [M1+H]+ =389.1932,
found 389.1929. Anal. Calcd for C18H24N6O4: C, 55.66; H, 6.23; N, 21.64. Found: C, 55.75;
H, 6.26; N, 21.51.
N-(3-Methylbut-2-en-1-yl)-3-(β-D-ribofuranosyl)-3H-imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazin-9-
amine (15c)
This compound was prepared according to the general procedure described above, upon
reaction of 14 with 3-methylbut-2-en-1-amine. Purification was effected using a mixture of
dichloromethane / methanol (100/4, v/v) as the eluent. Yield 45%. mp 209 oC (MeOH). [α]D -
1
39.45o (c=0.256, DMSO). H NMR (600 MHz, DMSO-d6) δ 1.67 (s, 3H,CH3), 1.76 (s,
3H,CH3), 3.59 (m, 1H, H-5’), 3.72 (m, 1H, H-5’), 4.01 (m, 1H, H-4’), 4.20 (m, 1H, H-3’), 4.70-
4.79 (m, 3H, H-2’, HNCH2CH), 5.18 (d, 1H, J=4.6 Hz, OH-3’, D2O exch.), 5.43-5.49 (m, 2H,
OH-2’, D2O exch., CH2CH=C(CH3)2), 5.56 (m, 1H, OH-5’, D2O exch.), 6.05 (d, 1H, J=6.2 Hz,
H-1’), 8.12 (t, 1H, J=6.4 Hz, NH, D2O exch.), 8.56 (s, 1H, H-2), 8.66 (d, 1H, J=1.7 Hz, H-7),
8.94 (d, 1H, J=1.7 Hz, H-6). 13C NMR (151 MHz, DMSO-d6) δ 18.00 (CH3), 25.47 (CH3),
41.73 (HNCH2CH), 61.74 (C-5’), 70.71 (C-3’), 73.01 (C-2’), 85.85 (C-4’), 87.65 (C-1’), 119.75
(C-9a), 122.31 (CH=C(CH3)2), 125.91 (C-8a), 133.92 (CH=C(CH3)2), 138.45 (C-7), 142.72
(C-2), 143.00 (C-9), 146.99 (C-6), 148.51 (C-4a), 150.86 (C-3a). HR-MS (ESI) m/z: Calcd for
C18H23N6O4: [M1+H]+ =387.1775, found 387.1770. Anal. Calcd for C18H22N6O4: C, 55.95; H,
5.74; N, 21.75. Found: C, 56.04; H, 5.78; N, 21.63.
N-(Benzyl)-3-(β-D-ribofuranosyl)-3H-imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazin-9-amine (15d)
This compound was prepared according to the general procedure described above, upon
reaction of 14 with benzylamine. Purification was effected using a mixture of
o
dichloromethane / methanol (100/4, v/v) as the eluent. Yield 52%. mp 227-8 C (MeOH).
1
[α]D-48.33o (c=0.269, DMSO). H NMR (600 MHz, DMSO-d6) δ 3.58 (m, 1H, H-5’), 3.71 (m,
1H, H-5’), 3.99 (m, 1H, H-4’), 4.19 (m, 1H, H-3’), 4.73 (m, 1H, H-2’), 5.18 (d, 1H, J=4.6 Hz,
OH-3’, D2O exch.), 5.42 (m, 2H, CH2C6H5), 5.45 (d, 1H, J=6.2 Hz, OH-2’, D2O exch.), 5.52
(m, 1H, OH-5’, D2O exch.), 6.05 (d, 1H, J=6.3 Hz, H-1’), 7.20 (t, 1H, J=7.4 Hz, H-4’’), 7.28 (t,
This article is protected by copyright. All rights reserved.

2H, J=7.5 Hz, H-3’’, H-5’’), 7.43 (d, 2H, J=7.5 Hz, H-2’’, H-6’’), 8.56 (s, 1H, H-2), 8.68-8.72
(m, 2H, H-7, NH), 8.97 (d, 1H, J=1.7 Hz, H-6). 13C NMR (50 MHz, DMSO-d6) δ 47.17
(CH2C6H5), 62.19 (C-5’), 71.15 (C-3’), 73.46 (C-2’), 86.30 (C-4’), 88.05 (C-1’), 120.30 (C-9a),
126.35 (C-8a), 127.20 (C-4’’), 127.66 (C-3’’, C-5’’), 128.74 (C-2’’, C-6’’), 139.12 (C-7), 140.79
(C-1’), 143.24 (C-2), 143.62 (C-9), 147.54 (C-6), 149.94 (C-4a), 151.33 (C-3a). HR-MS (ESI)
m/z: Calcd for C20H21N6O4: [M1+H]+ =409.1619, found 409.1613. Anal. Calcd for C20H20N6O4:
C, 58.82; H, 4.94; N, 20.58. Found: C, 58.97; H, 4.97; N, 20.41.
N-(Furan-2-ylmethylen)-3-(β-D-ribofuranosyl)-3H-imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazin-9-
amine (15e)
This compound was prepared according to the general procedure described above, upon
reaction of 14 with 2-aminomethylfuran. Purification was effected using a mixture of
dichloromethane / methanol (100/4, v/v) as the eluent. Yield 45%. mp 212-3 oC
1
(MeOH/THF). [α]D -55.74o (c=0.296, DMSO). H NMR (600 MHz, DMSO-d6) δ 3.59 (m, 1H,
H-5’), 3.72 (m, 1H, H-5’), 4.00 (m, 1H, H-4’), 4.21 (m, 1H, H-3’), 4.74 (m, 1H, H-2’), 5.19 (d,
1H, J=4.6 Hz, OH-3’, D2O exch.), 5.41 (m, 2H, HNCH2), 5.46 (d, 1H, J=6.2 Hz, OH-2’, D2O
exch.), 5.51 (m, 1H, OH-5’, D2O exch.), 6.07 (d, 1H, J=6.2 Hz, H-1’), 6.29 (m, 1H, H-3’’),
6.34 (m, 1H, H-4’’), 7.55 (m, 1H, H-5’’), 8.47 (t, 1H, J=6.7 Hz, NH, D2O exch.), 8.61 (s, 1H,
H-2), 8.70 (d, 1H, J=1.7 Hz, H-7), 8.97 (d, 1H, J=1.7 Hz, H-6). 13C NMR (50 MHz, DMSO-d6)
δ 40.63 (HNCH2-furan), 61.70 (C-5’), 70.69 (C-3’), 73.03 (C-2’), 85.83 (C-4’), 87.57 (C-1’),
106.93 (C-3’’), 110.40 (C-4’’), 120.07 (C-9a), 125.82 (C-8a), 138.85 (C-7), 142.14 (C-5’’),
142.77 (C-2), 143.01 (C-9), 147.11 (C-6), 148.36 (C-4a), 150.85 (C-3a), 153.01 (C-2’’). HR-
MS (ESI) m/z: Calcd for C18H19N6O5: [M1+H]+ =399.1411, found 399.1404. Anal. Calcd for
C18H18N6O5: C, 54.27; H, 4.55; N, 21.10. Found: C, 54.13; H, 4.48; N, 21.33.
Biological evaluation
Cell lines, viruses and plasmid constructs
[38]
The replication permissive Huh7-Lunet
cells and the replication and infection permissive
[39]
Huh7.5
cells were cultured in high glucose (25 mM) Dulbecco’s modified minimal
This article is protected by copyright. All rights reserved.

essential medium (Invitrogen), supplemented with 2 mM L-glutamine, 0.1 mM non-essential
amino acids, 100 U/mL penicillin, 100 µg/mL streptomycin and 10% (v/v) fetal calf serum
(referred to as complete DMEM).
[40]
[41]
Huh5-2
and Huh7-JFH1
stable cell lines harbor the subgenomic HCV reporter
replicons I389luc-ubi-neo/NS3-3’/Con1/5.1 (genotype 1b, Con1 strain) and I389luc-ubi-
neo/NS3-3’_dg_JFH1 (genotype 2a, JFH1 strain), respectively. Specifically, they carry the
HCV 5’ UTR with the internal ribosome entry site (IRES) directing the expression of a firefly
luciferase-ubiquitin-neomycin phosphotransferase fusion cassette (luc-ubi-neo), followed by
an IRES from encephalomyocarditis virus (EMCV) that directs translation of the HCV NS3 to
NS5B region, and the HCV 3’ UTR. The expression of luc-ubi-neo gene enables the
concurrent selection of neomycin/G418-resistant cells expressing the HCV RNA and the
assessment of RNA replication levels by measuring the activity of the reporter protein firefly
luciferase (F-Luc). Huh 5-2 and Huh7-JFH1 cells were grown in complete DMEM
supplemented with 500 μg/mL G418 or 1mg/mL respectively.
Bicistronic replicon plasmids S52-SG (Feo) (AII) and ED43-SG (Feo)(VYG) (kindly provided
[42]
by C.M. Rice, The Rockefeller University, NY) have been described previously
and
encode a chimeric gene of F-Luc protein fused in frame with neomycin phosphotransferase
(Feo), under the HCV IRES control, and the subgenomic sequences of HCV genotype 3a
(strain S52) and 4a (strain ED43), respectively, under the EMCV IRES control. Stable cell
lines were generated by transfecting Huh7.5 cells with the above replicon RNAs and pooling
colonies after selection with 750 μg/ml G418 for Huh7.5-3a and 350 μg/mL G418 for Huh7.5-
4a. After selection, cells were mentained in complete DMEM supplemented with the same
G418 concentrations.
[43]
[44]
Plasmids pH77S.3/GLuc2A
and pHCV-N.2/GLuc2A
(kindly provided by S.M. Lemon,
University of North Carolina, USA) encode full-length reporter HCV genome sequences of
genotype 1a (strain H77) and 1b (strain HCV-N), respectively, with adaptive mutations. The
Gaussia luciferase (G-Luc) gene followed by the FMDV2A sequence is included between
HCV p7 and NS2.
This article is protected by copyright. All rights reserved.

All amino acid and nucleotide numbers refer to the Con1 genome (GenBank accession no.
AJ238799).
In vitro transcription
Full-length and bicistronic HCV constructs were linearized with XbaI and used for in vitro
transcription as described previously [45]
.
Transfection with in vitro transcribed RNA
Electroporation with full-length viral RNAs into Huh7-Lunet cells and bicistronic HCV RNAs
into Huh7.5 cells was performed as described elsewhere [46]
.
Anti-HCV assay
Anti-HCV assay in replicon cells was performed by seeding 1x104 cells per well in a 96-well
flat bottom plate cultured in 200 μL complete DMEM supplemented with G418. Following 24
h incubation at 37°C (5% CO2), medium was removed and 2-fold serial dilutions (without
G418) of the test compounds in complete DMEM were added, in a total volume of 100 μL.
After 3 days of incubation at 37°C, cells were lysed and F-Luc activity was measured.
Anti-HCV assay for full-length viral constructs was performed after electroporation of Huh7-
Lunet cells with HCV RNA. Cells were resuspended in complete DMEM and seeded in
tetraplicates on 48-well plates. 24 h after electroporation, medium was removed and 2-fold
serial dilutions of the test compounds in complete DMEM were added, in a total volume of
200 μL. 24 and 48 h after compound addition, medium was exchanged and at 72 h cell
supernatants were collected and G-Luc activity was measured. In addition, cells were lysed
for total protein quantification.
Relative luminescence units (RLU) were expressed as percentage of the respective values
from DMSO-treated control cells. The half maximal effective concentration (EC50) was
defined as the concentration of compound that reduced the luciferase signal by 50%.
EC50 values were determined by nonlinear regression analysis after converting the drug
concentrations into log-X using Prism 5.0 software (GraphPad Software Inc.).
This article is protected by copyright. All rights reserved.

Luciferase and Bradford assays
F-Luc activity in cell lysates was measured using the respective chemiluminescent assay kit
(Promega), as manufacturer recommended. G-Luc activity in cell supernatants was
measured using 12 μΜ Coelenterazine (Promega) in assay buffer (50 mM potassium
phosphate, pH 7.4, 500 mM NaCl, 1 mM EDTA). Measurements were performed with a
GloMax 20/20 single tube luminometer (Promega) for 10 s. F-Luc and G-Luc activities were
normalized to the intracellular total protein amount, determined using the Bradford assay
reagent (Pierce).
Cytotoxicity assay
The CC50 of the compounds in treated cells was determined by measuring intracellular ATP
levels. The sensitivity of this assay was confirmed by using saponin (Sigma-Aldrich) as a
positive control, as its cytotoxicity was previously reported [47]. Specifically, 104 cells per well
were seeded in 96-well flat bottom plates in total volume of 100 μL complete DMEM. 24 h
post-seeding, cells were incubated with the compounds for 72 h at 37°C (5% CO2) and lysed
for ATP measurement. Calculation of the compound concentration causing 50% cell death
(CC50) was performed using cells treated with DMSO as control sample. CC50 values were
determined by nonlinear regression analysis after converting the drug concentrations into
log-X using Prism 5.0 software (GraphPad Software Inc.).
Measurement of intracellular ATP levels
ATP was measured using the ViaLight HS BioAssay kit (Lonza) according to the
manufacturer’s protocol in a GloMax 20/20 single-tube luminometer (Promega) for 1 s. ATP
levels were normalized to total protein amounts.
Indirect immunofluorescence
Indirect immunofluorescence analysis of Con1 NS5A was performed as described elsewhere
[46]. DNA was stained with propidium iodide (Sigma-Aldrich). Images were acquired with the
Leica TCS-SP5II Two-photon Confocal Microscope with Spectra Physics Mai Tai infrared
laser source.
This article is protected by copyright. All rights reserved.

Gel electrophoresis and Western blot analysis
Denaturing SDS-polyacrylamide gelelectrophoresis and Western blotting was performed as
described elsewhere Dilutions of 1:1,000 for HCV NS5A monoclonal antibody 9E10 (kindly
provided by C.M. Rice, The Rockefeller University, NY) [48], and 1:6000 for pan-actin mouse
monoclonal antibody (Chemicon International) were used.
Total RNA extraction and quantification of viral replicons
Total RNA was extracted from Huh5-2 cells using TRIzol reagent (Ambion), according to the
manufacturer’s instructions. Replicon RNA was quantified with reverse-transcription (RT)
and quantitative real-time polymerase chain reaction (qPCR). For RT, the Con1 IRES
specific primer 5'-GGATTCGTGCTCATGGTGCA-3' (reverse) and Moloney Murine
Leukemia Virus (MMLV) reverse transcriptase (Promega) were used. For qPCR, the Con1
IRES specific primers 5'-GGCCTTGTGGTACTGCCTGATA-3' (forward) and 5'-
GGATTCGTGCTCATGGTGCA-3' (reverse) and KAPA SYBR FAST qPCR Master Mix
(Kapa Biosystems) were used. The housekeeping gene YWHAZ was employed as an
internal
GGATGTGTTGGTTGCATTTCCT -3').
Development of Drug-Resistance Mutations
control
(primers
5'-GCTGGTGATGACAAGAAAGG-3'
and
5'-
Huh5-2 replicon cells were treated with 15d at 40-160 μΜ (concentrations 1-4 times of the
EC50 value) in the presence of 500 μg/mL G418 for 16 passages. 15d concentration was
gradually increased (1-2-4x EC50). Cells treated with DMSO were used as control. The
resulting cell populations were used for anti-HCV assay to quantify 15d activity, or lysed for
RNA isolation.
HCV RNA amplification by long template RT-PCR
RNA isolation from cells treated with 15d at 1-2-4xEC50 or DMSO, was performed using
TRIzol reagent (Ambion), according to manufacture’s instructions. Reverse transcription of
HCV RNA from treated replicon cells was performed using MMLV reverse transcriptase
(Promega). Specifically, 0.5 µg total RNA was mixed with 80 pmol reverse primer A9413 (5’-
CAGGATGGCCTATTGGCCTGGAG-3’) and transcription reaction solution (5x MMLV buffer,
This article is protected by copyright. All rights reserved.

2mM nucleotide mix (Invitrogen) and H2O) in 22 µL total volume and incubated at 90°C for
3min. Next, 176 U MMLV and 21.6 U rRNasin (Promega) were added and reverse
transcription was performed for 1h at 42°C.
Long template PCR was carried out using TaKaRa LA taq polymerase with CG buffers
(TaKaRa). The Con1 HCV protein coding sequence (NS3-NS5B) was amplified in four
segments of 1.5-2 kb with overlapping regions, using specific primers (Supplementary Table
1). 2 µL cDNA were added to 50µL reaction mixture (0.5 µM forward primer, 0.5 µM reverse
primer, 1.6 mM nucleotide mix, 1x buffer 1, 2U polymerase, H2O up to 50 µL) and
polymerase chain reaction was performed following the instructions of the manufacturer.
Purification and Next Generation Sequencing (NGS) of PCR products encoding the
NS3-NS5B region of Con1 replicon
The PCR products were separated via agarose gel-electrophoresis and products of
appropriate size were purified with the NucleoSpin Gel and PCR Clean-up kit (Macherey-
Nagel) according the instructions of the manufacturer. Samples were further purified with
Agencourt AMPure XP beads (Beckman Coulter). Following purification, PCR products from
each sample were quantified with a Qubit2.0 Fluorometer (Life Technologies) and Qubit
dsDNA HS Assay kit (Life Technologies), and pooled together at equimolar ratios. The Ion
Xpress™ Plus Fragment Library Kit (Life Technologies) was used to shear 100 ng of the
pooled cDNA into ~200-bp fragments. The sheared cDNA fragments were purified with the
Agencourt AMPure XP beads, ligated with Ion Xpress™ Barcode Adapters Kits (Life
Technologies) to prepare the multiple cDNA libraries, size selected with E-Gel™
SizeSelect™ Agarose Gels (Life Technologies) and further purified with Agencourt AMPure
XP beads. The quality and quantity of the libraries were assessed by using Qubit2.0
Fluorometer (Life Technologies) and the Ion Library TaqMan™ Quantitation Kit (Life
Technologies).
The libraries were then enriched using the Ion OneTouch™ 2 System (Life Technologies)
and loaded on an Ion 318™ Chip on the Ion PGM™ System (Life Technologies). The data
This article is protected by copyright. All rights reserved.

obtained were analyzed using the Ion PGM™ System software (Life Technologies) to
identify resistant mutations.
Statistical analysis
In all diagrams, bars represent mean values of at least two independent experiments in
triplicate or tetraplicate. Error bars represent standard deviation. Only results subjected to
statistical analysis using Student’s t-test with p≤0.05 were considered as statistically
significant and presented. Statistical calculations were carried out using Excel Microsoft
Office®.
Results and discussion
Chemistry
The target nucleosides were prepared from 1,6-diaminopyridine (1, Scheme 1) which
was acetylated and then nitrated to give compound 3. The nitropyridine 3 was selectively
deacetylated and provided the 2-amino-acetamide 4, in a 50% yield, together with traces of
the fully deprotected 2,6-diamino-3-nitropyridine. The nitroderivative 4 was catalytically
reduced with the use of palladium on carbon as catalyst. The resulting unstable diamine was
not isolated, but upon treatment with glyoxal was converted to the pyrido[2,3-b]pyrazine 5.
Attempts to nitrate the pyridopyrazine 5 were not successful, since the nitroderivative 6 was
obtained only with the use of a mixture of acetic anhydride and fuming nitric acid, albeit in
very low yield (6%).
Consequently, we followed a modified synthetic procedure, using the pyridineacetamide
4, which upon catalytic reduction and treatment of the resulting diaminopyridine with
triethylorthoformate, was converted to the imidazopyridine 7. Compound 7 was nitrated to
result in the nitroderivative 8, which was first catalytically reduced and the resulting diamine
was ring-closed as mentioned above and converted to the tricyclic base 9.
Compound 9 was introduced to a Vorbrüggen type glycosylation and reacted with
1,2,3,5-tetra-O-acetyl-β-D-ribofuranose in the presence of N,O-bis(trimethylsilyl)acetamide
and trimethylsilyl trifluoromethanesulfonate (TMSOTf, Scheme 2) [49, 50]. Both regio-isomers
This article is protected by copyright. All rights reserved.

10 and 11 were isolated from the glycosylation reaction, each as a mixture of the
corresponding α/β anomeric forms. Upon repeated chromatographic purifications, we
managed to isolate pure the predominant β-anomers of each regio-isomer, since the
percentage of α-anomers in each mixture was very low. The unambiguous characterization
of the nucleosides 10 and 11 was effected through 1D and 2D-NMR experiments. More
precisely, concerning compound 11, we observed clear correlation peaks between the
aromatic H-9 with protons of the ribosyl moiety, in the corresponding nOe spectral data,
indicating the position of ribosylation. On the other hand, the configuration at C-1’ was
assigned on the basis of nOe experiments and concerning both 10 and 11 we recorded
strong couplings between the anomeric protons of each compound with the corresponding
H-4’.
The acetyl protecting groups were easily removed upon treatment of 10 and 11 with
methanolic ammonia, to afford quantitatively the deprotected derivatives 12 and 13
respectively. The tricyclic nucleoside 10 was then subjected to electrophilic substitution,
using N-chlorosuccinimide and was converted to the 9-chloroderivative 14 in good yield
(49%). The site of halogenation was confirmed using nOe spectral data, where clear
correlation peaks were observed between the ribosyl H-1’, H-2’, H-3’ and the aromatic H-2.
Compound 14 was used for the synthesis of the target aminoderivatives, using suitable
primary amines bearing linear or branched aliphatic or aromatic groups with the aim to
extract structure-activity relationships. The chloride 14 was thus coupled with the selected
amines, in the presence of 2-dicyclohexylphosphino-2’,4’,6’-triisopropylbiphenyl (X-phos)
and tris(dibenzylideneacetone)dipalladium(0) (Pd2(dba)3), followed by the concomitant
deprotection of the acetyl groups in alkaline media, to provide the target nucleosides 15a-e
in reasonable yields.
This article is protected by copyright. All rights reserved.

Biological evaluation
Screening of nucleoside analogues in HCV replicon cells
The effects of the synthesized nucleoside analogues on HCV RNA replication and cell
viability were determined in the Huh5-2 stable cell line containing the firefly luciferase-
encoding subgenomic replicon of the HCV genotype 1b Con1 strain (Figure 2A). The initial
evaluation of all compounds was performed at a concentration of 100 μM by measuring
luciferase activity. As shown in Figure 2B, compounds 12 and 13 that do not possess a 9-
alkyl/arylamino substitution, were inactive. However, the 9-aminoderivatives 15a-e inhibited
HCV replication with different potency. The furylmethyl- derivative 15e was the least active
compound. Among the alkylamino- substituted analogues, the branched isopentylamino-
derivative 15b appeared to be the most active, followed by the corresponding isopentenyl
derivative 15c, while the n-butyl derivative 15a possessed the lowest potency. The most
promising analogue identified was the benzylamino- derivative 15d, which was thus selected
for further evaluation. This compound reduced replication of genotype 1b HCV with an EC50
of 40.22 μM (Figure 2C, Table 1), and showed promising safety since the half maximal
cytotoxic concentration (CC50) was higher than 200 μM (the highest concentration tested)
(Figure 2D). Thus, even if its activity can be considered moderate, it exhibited a selectivity
index (SI: CC50/EC50) higher than 4.97. Compound 15d was also evaluated against
subgenomic replicons of genotypes 2a (strain JFH1), 3a (strain S52), and 4a (strain ED43),
showing antiviral activity only against genotype 3a with an EC50 value of 73.56 μΜ (Table 1).
This activity against 3a is of importance as patients with genotype 3 infection still are most
difficult to treat especially in patients with liver cirrhosis [51]
.
The inhibition profiles measured by the luciferase assay in genotype 1b were confirmed
using western blot (Figure 3A) and indirect immunofluorescence against NS5A (Figure 3B).
Consistently, replicon RNA levels were significantly reduced in the presence of 15d, with an
EC50 value of 25 μM (Figure 3C).
This article is protected by copyright. All rights reserved.

Validation of 15d against full-length HCV viruses
The effect of 15d on HCV replication was confirmed in the context of full length HCV. In
vitro transcripts of reporter viruses of the HCV isolates H77S.3 (genotype 1a) or HCV-N.2
(genotype 1b) (Figure 4A) were electroporated into Huh7-Lunet cells. Of note, for the
genotype 1b virus an EC50 value of 52.72 μM was calculated (Figure 4B), similar to the one
measured for the subgenomic replicon of the Con1 isolate (Table 1), confirming the antiviral
activity of this compound. A higher EC50 value (83.62 μM) was observed for the genotype 1a
virus. No cytotoxicity was detected even at the highest compound concentrations tested
(Figure 4C).
Determining the viral target of 15d by resistance mutation analysis
To investigate the possible mechanism of action for 15d on HCV replication, we
selected for drug resistance by using Huh5-2 replicon cells that were cultured for 16
passages in the presence of G418 to maintain the replicon and 15d at increasing
concentrations up to 4-fold of EC50 (1-2-4xEC50, Figure 5A). While direct treatment of cells
with 4 times the EC50 of 15d resulted in cell death after 3 passages, gradual increase of 15d
concentration, allowed the selection of drug-resistant colonies after 8 cell passages up to
4xEC50. In comparison to cells treated for the same number of passages with G418 and
DMSO only, we observed an about 1.7-fold increase of the EC50 value for 15d in compound-
treated cells, as determined by measuring luciferase activity (Figure 5B). This suggests the
development of a slight viral resistance to the inhibitor, which prompted us to determine the
coding sequence of NS3 to NS5B from the replicon system by using next generation
sequencing (NGS). 7 non-synonymous amino acid substitutions (E295G, V298D, I352T,
P353S, S414P, D443G and C446R) were detected after the 16th passage with 15d, all in
positions located in the C-terminal part of NS5A (Figure 5D). Direct comparison of the
replication fitness of the HCV replicon in the 15d and DMSO-adapted cell populations
showed similar replication levels (Figure 5C). This suggests that the selected mutations do
not increase the fitness of the virus.
This article is protected by copyright. All rights reserved.

These results indicate a possible resistance via NS5A and imply that these nucleoside
analogues act through an NS5B-independent mechanism. Of the mutations detected in
NS5A, V298D, I352T, P353S and S414P were present only in 15d-treated cells, whereas
E295G, D443G and C446R were present also in DMSO-treated cells, but at a much lower
frequency, as compared to the inhibitor-treated cells. These mutations are not among those
reported in the literature as cell-culture adaptive ones [52-56]. Mutations E295G and V298D
are positioned in domain II (D2), I352T and P353S in low-complexity sequence II (LCSII) and
S414P, D443G and C446R in D3. Thus, 15d-resistance mutations appear in different
domains than D1 which is previously reported to be targeted by the NS5A-specific DAAs. As
D2 and D3 have been implicated in a broad spectrum of interactions with cellular and other
viral proteins [22], our results imply that a cellular target of 15d is also possible. This
possibility is also favored by the low increase (1.7-fold) in the EC50 value of 15d observed
after the drug-resistance selection, as the high barrier of resistance is characteristic of host-
targeting inhibitors [57]. However, we cannot exclude the possibility that 15d targets NS5A-
NS5B interactions, even by targeting NS5B, as mutations E295G and V298D are within a
region essential for the binding of NS5B [58, 59]. In addition, E295G and V298D are at the
carboxy-terminal part of a region implicated in the interaction of NS5A with protein kinase R
(PKR), an IFN-stimulated gene, and thus might inhibit PKR activation [60]. Interestingly, I352T
and P353S create two possible phosphorylation positions in LCSII, with threonine at position
352 being a native phosphorylation site in the JFH1 strain (genotype 2a) with a as yet
undefined role [61]. The presence of T352 in JFH1 might be a reason for the difference in the
activity of 15d in this strain as compared to Con1. On the other hand, S414P removes a
putative phosphorylation site that is involved in basal phosphorylation and has been
implicated in virus assembly [62]. All these imply a possible shift in NS5A phosphorylation,
under the pressure of compound 15d. Furthermore, I352T and P353S are contained in a
conserved polyproline motif (PxxPxR) which is necessary for NS5A interaction with Src
Homology 3 domain-containing proteins (Grb2 GTPase, Lyn and Fyn kinases). This
interaction modulates host-cell signalling pathways, playing subtle roles in HCV replication
This article is protected by copyright. All rights reserved.

[29,
63]. However, these adaptive mutations are not on residues important for the motif
function. Interestingly, mutation S414P in D3 has been previously associated with viral
resistance to interferon through impairing STAT1 phosphorylation, although it is not
positioned within the interferon sensitivity determining region [64]. In the same study, the 15d-
adaptive mutation E295G has also been developed in one of the IFN-resistant clones,
although no further correlation with IFN resistance was made. In general, it is known that D3
region directly binds and inhibits STAT1, suppressing type I IFN signaling [65]. The same
aminoacid position S414 has also been shown with biochemical assays to participate in the
interaction of NS5A with the vesicle-associated membrane protein-associated protein B,
which is important for the anchoring of the HCV RNA replication machinery onto the ER [66]
.
Moreover, positions S414 and D443 have been implicated in the binding of Cyclophilin A, a
peptidylprolyl isomerase essential for HCV replication, to NS5A D3, based on chemical shift
perturbation assays [28]. Finally, the aminoacid sequence directly upstream of D443 varies
between the genotypes tested, with JFH1 and ED43 lacking one and two aminoacids
respectively, as compared to Con1 and S52 (data not shown), which might be a possible
reason for the lack of 15d activity in genotypes 2a and 4a.
Conclusion
In conclusion, we have synthesized a series of new tricyclic nucleoside derivatives and
have examined their inhibitory potential against HCV. The compounds were prepared from
1,6-diaminopyridine, which was converted first to 5-acetamidoimidazo[4,5-b]pyridine and
then to 3H-imidazo[4’,5’:5,6]pyrido[2,3-b]pyrazine. The former analogue provided two regio-
ribosides and through halogenation of the suitable isomer we obtained a number of 9-
aminosubstituted nucleosides as well. We have identified the 9-benzylamino-substituted
derivative 15d, reducing HCV replication with a selectivity index higher than 4.97 (in 1b
genotype). Based on resistance mutation studies we suggest that this interesting lead
compound most probably possesses a NS5A-dependent mechanism of action, through a
This article is protected by copyright. All rights reserved.

different region than the one targeted by DAAs, which is unprecedented for nucleoside
derivatives.
Acknowledgements
We would like to thank Prof. C. Rice for providing S52 (3a) and ED43 (4a) replicon plasmids,
as well as the anti-NS5A antibody (9E10) and Prof. S. Lemon for providing H77S.3-GLuc
and HCV-N.2-GLuc constructs.
Conflict of interest
The authors declare no conflict of interest.
References
1.
2.
Hoofnagle J.H. (2002) Course and outcome of hepatitis C. Hepatology;36:S21-29.
Wilder J., Patel K. (2014) A Review of the Natural History of Chronic Hepatitis C Infection.
N Am J Med Sci;7: 1-7.
3. World
http://www.who.int/mediacentre/factsheets/fs164/en/.
4. Chauhan V., Goyal K., Singh M.P. (2016) HCV Vaccine: How Far are We? J Hum Virol &
Retrovirol;3:00084.
Health
Organization,
2016,
Hepatitis
C
5.
Soriano V., Peters M.G., Zeuzem S. (2009) New therapies for hepatitis C virus infection.
Clin Infect Dis;48:313-320.
6.
Scheel T.K., Rice C.M. (2013) Understanding the hepatitis C virus life cycle paves the way
for highly effective therapies. Nat Med;19:837-849.
7.
Wakita T., Pietschmann T., Kato T., Date T., Miyamoto M., Zhao Z., Mutrhy K., Habermann
A., Krausslich H.G., Mizokami M., Bartenschlager R., Liang T.J. (2005) Production of infectious
hepatitis C virus in tissue culture from a cloned viral genome. Nat Med;11:791-796.
8.
Lohmann V., Korner F., Koch J., Herian U., Theilmann L., Bartenschlager R. (1999)
Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science;285:110-113.
9.
10.
http://hepatitiscnewdrugresearch.com/approved-treatments-for-hepatitis-c.html.
European Association for Study of the Liver: http://www.easl.eu/research/our-
contributions/clinical-practice-guidelines/detail/recommendations-on-treatment-of-hepatitis-c-2015
11.
12.
The American Association for the Study of Liver Disease: http://www.hcvguidelines.org.
Barth H. (2015) Hepatitis C virus: Is it time to say goodbye yet? Perspectives and challenges
for the next decade. World J Hepatol;7:725-737.
13. King A.M.Q. (2012) Family - Flaviviridae. In: King AMQ, Adams MJ, Carstens EB, Lefkowitz
EJ, editors Family - Flaviviridae. San Diego: Elsevier: p. 1003-20.
14. Simmonds P., Bukh J., Combet C., Deléage G., Enomoto N., Feinstone S., et al. (2015)
Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes.
Hepatology;42:962-973.
15.
Bartenschlager R., Lohmann V., Penin F. (2013) The molecular and structural basis of
advanced antiviral therapy for hepatitis C virus infection. Nat Rev Microbiol;11:482-496.
This article is protected by copyright. All rights reserved.

16.
Moradpour D., Penin F., Rice C.M. (2007) Replication of hepatitis C virus. Nat Rev
Microbiol;5:453-463.
17.
Scola P.M., Sun L.Q., Wang A.X., Chen J., Sin N., Venables B.L., et al. (2014) The discovery
of asunaprevir (BMS-650032), an orally efficacious NS3 protease inhibitor for the treatment of
hepatitis C virus infection. J Med Chem;57:1730-1752.
18.
Summa V., Ludmerer S.W., McCauley J.A., Fandozzi C., Burlein C., Claudio G., et al. (2012)
MK-5172, a selective inhibitor of hepatitis C virus NS3/4a protease with broad activity across
genotypes and resistant variants. Antimicrob Agents Chemother;56:4161-4167.
19.
Lesburg C.A., Cable M.B., Ferrari E., Hong Z., Mannarino A.F., Weber P.C. (1999) Crystal
structure of the RNA-dependent RNA polymerase from hepatitis C virus reveals a fully encircled
active site. Nat Struct Biol;6:937-943.
20.
Current Direct-Acting Antiviral Treatment Strategies. N Am J Med Sci;9:47-54.
21. Issur M., Gotte M. (2014) Resistance patterns associated with HCV NS5A inhibitors provide
limited insight into drug binding. Viruses;6:4227-4241.
22. Ross-Thriepland D., Harris M. (2015) Hepatitis C virus NS5A: enigmatic but still
promiscuous 10 years on! J Gen Virol;96:727-738.
23. Evans M.J., Rice C.M., Goff S.P. (2004) Phosphorylation of hepatitis C virus nonstructural
Zhang J., Nguyen D., Hu K.Q. (2016) Chronic Hepatitis C Virus Infection: A Review of
protein 5A modulates its protein interactions and viral RNA replication. Proc Natl Acad Sci U S
A.;101.13038-13043.
24.
Top Microbiol Immunol;369:113-142.
25. Tellinghuisen T.L., Marcotrigiano J., Rice C.M. (2005) Structure of the zinc-binding domain
of an essential component of the hepatitis C virus replicase. Nature;435:374-379.
26. Reiss S., Harak C., Romero-Brey I., Radujkovic D., Klein R., Ruggieri A., Rebhan I.,
Moradpour D., Penin F. (2013) Hepatitis C virus proteins: from structure to function. Curr
Bartenschlager R., Lohmann V. (2013) The lipid kinase phosphatidylinositol-4 kinase III alpha
regulates the phosphorylation status of hepatitis C virus NS5A. PLoS Pathog;9:e1003359.
27.
Hanoulle X., Badillo A., Wieruszeski J.M., Verdegem D., Landrieu I., Bartenschlager R.,
Penin F., Lippens G. (2009) Hepatitis C virus NS5A protein is a substrate for the peptidyl-prolyl
cis/trans isomerase activity of cyclophilins A and B. J Biol Chem;284:13589-13601.
28.
Verdegem D., Badillo A., Wieruszeski J.M., Landrieu I., Leroy A., Bartenschlager R., Penin
F., Lippens G., Hanoulle X. (2011) Domain 3 of NS5A protein from the hepatitis C virus has intrinsic
alpha-helical propensity and is a substrate of cyclophilin A. J Biol Chem;286:20441-20454.
29.
Macdonald A., Crowder K., Street A., McCormick C., Harris M. (2004) The hepatitis C virus
NS5A protein binds to members of the Src family of tyrosine kinases and regulates kinase activity.
J Gen Virol;85:721-729.
30.
Amako Y., Igloi Z., Mankouri J., Kazlauskas A., Saksela K., Dallas M., Peers C., Harris M.
(2013) Hepatitis C virus NS5A inhibits mixed lineage kinase 3 to block apoptosis. J Biol
Chem;288:24753-24763.
31.
virus NS5A replication complex inhibitor with potent clinical effect. J Med Chem;57:5057-5071.
32. Tite T., Lougiakis N., Skaltsounis A.L., Marakos P., Pouli N., Tenta R., Balzarini J. (2009) The
Belema M., Meanwell N.A. (2014) Discovery of daclatasvir, a pan-genotypic hepatitis C
Application of Mitsunobu Cyclization for the Synthesis of 2 ',3 '-Dideoxy-C-Nucleosides Designed as
Didanosine Analogues. Synlett;1741-1744.
33.
Tite T., Lougiakis N., Myrianthopoulos V., Marakos P., Mikros E., Pouli N., Tenta R.,
Fragopoulou E., Nomikos T. (2010) Design and synthesis of new C-nucleosides as potential
adenosine deaminase inhibitors. Tetrahedron;66:9620-9628.
34.
Lougiakis N., Marakos P., Pouli N., Fragopoulou E., Tenta R. (2015) Synthesis of new
nebularine analogues and their inhibitory activity against adenosine deaminase. Chem Pharm
Bull;63:134-142.
This article is protected by copyright. All rights reserved.

35.
Leonard N.J., Sprecker M.A., Morrice A.G. (1976) Defined dimensional changes in enzyme
substrates and cofactors. Synthesis of lin-benzoadenosine and enzymatic evaluation of derivatives
of the benzopurines. J Amer Chem Soc;98:3987-3994.
36.
Amblard F., Fromentin E., Detorio M., Obikhod A., Rapp K.L., McBrayer T.R., Whitaker T.,
Coats S.J., Schinazi R.F. (2009) Synthesis, antiviral activity, and stability of nucleoside analogs
containing tricyclic bases. Eur J Med Chem;44:3845–3851.
37.
C-Modified Nucleosides as Potential Anti- HCV Therapeutics. Org Lett;12:4466–4469.
38. Friebe P., Boudet J., Simorre J.P., Bartenschlager R. (2005) Kissing-loop interaction in the 3'
end of the hepatitis C virus genome essential for RNA replication. J virol;79:380-392.
39. Blight K.J., McKeating J.A., Rice C.M. (2002) Highly permissive cell lines for subgenomic and
genomic hepatitis C virus RNA replication. J virol;76:13001-13014.
40. Vrolijk J.M., Kaul A., Hansen B.E., Lohmann V., Haagmans B.L., Schalm S.W.,
Wauchope O.R., Tomney M.J., Pepper J.L., Korba B.E., Seley-Radtke K.L. (2010) Tricyclic 2′-
Bartenschlager R. (2003) A replicon-based bioassay for the measurement of interferons in patients
with chronic hepatitis C. J Virol Methods;110:201-209.
41.
Jo J., Aichele U., Kersting N., Klein R., Aichele P., Bisse E., Sewell A.K., Blum H.E.,
Bartenschlager R., Lohmann V., Thimme R. (2009) Analysis of CD8+ T-cell-mediated inhibition of
hepatitis C virus replication using a novel immunological model. Gastroenterology;136:1391-1401.
42.
Saeed M., Scheel T.K., Gottwein J.M., Marukian S., Dustin L.B., Bukh J., Rice C.M. (2012)
Efficient replication of genotype 3a and 4a hepatitis C virus replicons in human hepatoma cells.
Antimicrob Agents Chemother;56:5365-5373.
43.
Shimakami T., Welsch C., Yamane D., McGivern D.R., Yi M., Zeuzem S., Lemon S.M. (2011)
Protease inhibitor-resistant hepatitis C virus mutants with reduced fitness from impaired
production of infectious virus. Gastroenterology;140:667-675.
44.
Shimakami T., Honda M., Shirasaki T., Takabatake R., Liu F., Murai K., Shiomoto T., Funaki
M., Yamane D., Murakami S., Lemon S.M., Kaneko S. (2014) The acyclic retinoid Peretinoin inhibits
hepatitis C virus replication and infectious virus release in vitro. Sci Rep;4:4688.
45.
adaptation of hepatitis C virus and in vivo viability of an adapted variant. J virol;81:13168-13179.
46. Vassilaki N., Friebe P., Meuleman P., Kallis S., Kaul A., Paranhos-Baccala G., Leroux-Roels
Kaul A., Woerz I., Meuleman P., Leroux-Roels G., Bartenschlager R. (2007) Cell culture
G., Mavromara P., Bartenschlager R. (2008) Role of the hepatitis C virus core+1 open reading
frame and core cis-acting RNA elements in viral RNA translation and replication. J virol;82:11503-
11515.
47.
Lee J., Lim S., Kang S.M., Min S., Son K., Lee H.S., Park E.M., Ngo H.T.T., Tran H.T.L., Lim Y-
S., Hwang S.B. (2012) Saponin inhibits hepatitis C virus propagation by up-regulating suppressor of
cytokine signaling 2. PloS ONE;7: e39366.
48.
Lindenbach B.D., Evans M.J., Syder A.J., Wolk B., Tellinghuisen T.L., Liu C.C., Maruyama T.,
Hynes R.O., Burton D.R., McKeating J.A., Rice C.M. (2005) Complete replication of hepatitis C virus
in cell culture. Science;309:623-626.
49.
Triflate and Perchlorate as Catalysts. Chem Ber;114:1234-1255.
50. Vorbrüggen H., Bennua B. (1978) New simplified nucleoside synthesis. Tetrahedron
Lett;19:1339-1342.
Vorbrüggen H., Krolikiewicz K., Bennua, B. (1981) Nucleoside Synthesis with Trimethylsilyl
51.
Gondeau C., Pageaux G.P., Larrey D. (2015) Hepatitis C virus infection: Are there still
specific problems with genotype 3? World J Gastroenterol;21:12101-12113.
52.
cell culture. Science;290:1972-1974.
53. Krieger N., Lohmann V., Bartenschlager R. (2001) Enhancement of hepatitis C virus RNA
replication by cell culture-adaptive mutations. J virol;75:4614-4624.
54. Blight K.J., McKeating J.A., Marcotrigiano J., Rice C.M. (2003) Efficient replication of
Blight K.J., Kolykhalov A.A., Rice C.M. (2000) Efficient initiation of HCV RNA replication in
hepatitis C virus genotype 1a RNAs in cell culture. J virol;77:3181-3190.
This article is protected by copyright. All rights reserved.

55.
virus RNAs conferring cell culture adaptation. J virol;75:1437-1449.
56. Lohmann V., Hoffmann S., Herian U., Penin F., Bartenschlager R. (2003) Viral and cellular
determinants of hepatitis C virus RNA replication in cell culture. J virol;77:3007-3019.
57. Pawlotsky J.M. (2014) What are the pros and cons of the use of host-targeted agents
against hepatitis C? Antiviral Res;105:22-25.
58. Ngure M., Issur M., Shkriabai N., Liu H.W., Cosa G., Kvaratskhelia M., Götte M. (2016)
Lohmann V., Korner F., Dobierzewska A., Bartenschlager R. (2001) Mutations in hepatitis C
Interactions of the Disordered Domain II of Hepatitis C Virus NS5A with Cyclophilin A, NS5B, and
Viral RNA Show Extensive Overlap. ACS infectious diseases;2:839-851.
59.
Shirota Y., Luo H., Qin W., Kaneko S., Yamashita T., Kobayashi K., Murakami S. (2002)
Hepatitis C virus (HCV) NS5A binds RNA-dependent RNA polymerase (RdRP) NS5B and modulates
RNA-dependent RNA polymerase activity. J Biol Chem;277:11149-11155.
60.
Gale M., Blakely C.M., Kwieciszewski B., Tan S.L., Dossett M., Tang N.M., Korth M.J.,
Polyak S.J., Gretch D.R., Katze M.G. (1998) Control of PKR protein kinase by hepatitis C virus
nonstructural 5A protein: Molecular mechanisms of kinase regulation. Mol Cell Biol;18:5208-5218.
61.
hepatitis C virus NS5A phosphorylation. J virol;88:1421-1432.
62. Masaki T., Suzuki R., Murakami K., Aizaki H., Ishii K., Murayama A., Date T., Matsuura Y.,
Ross-Thriepland D., Harris M. (2014) Insights into the complexity and functionality of
Miyamura T., Wakita T., Suzuki T. (2008) Interaction of hepatitis C virus nonstructural protein 5A
with core protein is critical for the production of infectious virus particles. J virol;82:7964-7976.
63.
Macdonald A., Mazaleyrat S., McCormick C., Street A., Burgoyne N.J., Jackson R.M.,
Cazeaux V., Shelton H., Saksela K., Harris M. (2005) Further studies on hepatitis C virus NS5A-SH3
domain interactions: identification of residues critical for binding and implications for viral RNA
replication and modulation of cell signalling. J Gen Virol;86:1035-1044.
64.
Noguchi T., Otsubaki T., Ando I., Ogura N., Ikeda S., Shimotohno K. (2008) Isolation and
gene analysis of interferon alpha-resistant cell clones of the hepatitis C virus subgenome.
Virology;375:424-432.
65.
Kumthip K., Chusri P., Jilg N., Zhao L., Fusco D.N., Zhao H., et al. (2012) Hepatitis C virus
NS5A disrupts STAT1 phosphorylation and suppresses type I interferon signaling. J virol;86:8581-
8591.
66.
Gupta G., Qin H., Song J. (2012) Intrinsically unstructured domain 3 of hepatitis C Virus
NS5A forms a "fuzzy complex" with VAPB-MSP domain which carries ALS-causing mutations. PLoS
One;7:e39261.
Figure Legends and Tables
Figure 1. Structures of Sofosbuvir and daclatasvir.
Scheme 1. Reagents and conditions: a) Ac2O, CH2Cl2, r.t., 97%; b) HNO3, H2SO4, 0 ˚C then
r.t., 89%; c) HCl, MeOH, 0 ˚C then r.t., 50%; d) 1) Pd/C, H2, EtOH, 50 psi, r.t., 2) glyoxal,
EtOH, reflux, 96% for 5, 56% for 9 (two steps); e) HNO3(f.), Ac2O, -20 ˚C, 6%; f) 1) Pd/C, H2,
EtOH, 50 psi, r.t., 2) triethylorthoformate, HCl, r.t., 93% (two steps); g) HNO3, H2SO4, 0 ˚C
then 50 ˚C, 68%.
Scheme 2. Reagents and conditions: a) 1) N,O-bis(trimethylsilyl)acetamide, ACN, reflux, 2)
tetra-O-acetyl-β-D-ribofuranose, TMSOTf, reflux, 31% for 10, 7% for 11 (two steps); b) NH3,
CH3OH, r.t., 82-87%; c) NCS, THF, r.t., 60%; d) 1) X-Phos, Pd2(dba)3, amine, dioxane, 90
˚C, 2) NH3, CH3OH, r.t., 39-60% (two steps).
This article is protected by copyright. All rights reserved.