Efficient (3S)-acetoin and (2S, 3S)-2, 3-butanediol production from meso-2, 3-butanediol using whole-cell biocatalysis

Article abstract of DOI:10.3390/molecules23030691

(3S)-Acetoin and (2S, 3S)-2, 3-butanediol are important platform chemicals widely applied in the asymmetric synthesis of valuable chiral chemicals. However, their production by fermentative methods is difficult to perform. This study aimed to develop a whole-cell biocatalysis strategy for the production of (3S)-acetoin and (2S, 3S)-2, 3-butanediol from meso-2, 3-butanediol. First, E. coli co-expressing (2R, 3R)-2, 3-butanediol dehydrogenase, NADH oxidase and Vitreoscilla hemoglobin was developed for (3S)-acetoin production from meso-2, 3-butanediol. Maximum (3S)-acetoin concentration of 72.38 g/L with the stereoisomeric purity of 94.65% was achieved at 24 h under optimal conditions. Subsequently, we developed another biocatalyst co-expressing (2S, 3S)-2, 3-butanediol dehydrogenase and formate dehydrogenase for (2S, 3S)-2, 3-butanediol production from (3S)-acetoin. Synchronous catalysis together with two biocatalysts afforded 38.41 g/L of (2S, 3S)-butanediol with stereoisomeric purity of 98.03% from 40 g/L meso-2, 3-butanediol. These results exhibited the potential for (3S)-acetoin and (2S, 3S)-butanediol production from meso-2, 3-butanediol as a substrate via whole-cell biocatalysis.

Full text of DOI:10.3390/molecules23030691

molecules
Article
Efficient (3S)-Acetoin and (2S,3S)-2,3-Butanediol
Production from meso-2,3-Butanediol Using
Whole-Cell Biocatalysis
Yuanzhi He 1,†, Feixue Chen 1,†, Meijing Sun 1, Huifang Gao 1, Zewang Guo 1, Hui Lin 1,
Jiebo Chen 2, Wensong Jin 1, Yunlong Yang 1, Liaoyuan Zhang 1,
*
and Jun Yuan 1,
*
ID
1
Key Laboratory of Biopesticide and Chemical Biology, Ministry of Education, College of Life Sciences,
Gutian Edible Fungi Research Institute, Fujian Agriculture and Forestry University, Fuzhou 350002, China;
Hyz19933@163.com (Y.H.); feixuechen@163.com (F.C.); 18950975897@163.com (M.S.);
lovehuifang2012@163.com (H.G.); keepmovinggzw@163.com (Z.G.); lh4832@126.com (H.L.);
jinws@fafu.edu.cn (W.J.); longyunyang@126.com (Y.Y.)
2
National Engineering Research Center for Sugarcane, Fujian Agriculture and Forestry University,
Fuzhou 350002, China; jiebo-chen@fafu.edu.cn
*
Correspondence: zliaoyuan@126.com (L.Z.); yjmail2008@126.com (J.Y.); Tel.: +86-591-8378-9492 (L.Z.);
Fax: +86-591-8378-9121 (L.Z.)
†
These authors contribute equally to this work.
Received: 16 February 2018; Accepted: 12 March 2018; Published: 19 March 2018
Abstract: (3S)-Acetoin and (2S,3S)-2,3-butanediol are important platform chemicals widely applied
in the asymmetric synthesis of valuable chiral chemicals. However, their production by fermentative
methods is difficult to perform. This study aimed to develop a whole-cell biocatalysis strategy
for the production of (3S)-acetoin and (2S,3S)-2,3-butanediol from meso-2,3-butanediol. First, E. coli
co-expressing (2R,3R)-2,3-butanediol dehydrogenase, NADH oxidase and Vitreoscilla hemoglobin was
developed for (3S)-acetoin production from meso-2,3-butanediol. Maximum (3S)-acetoin concentration
of 72.38 g/L with the stereoisomeric purity of 94.65% was achieved at 24 h under optimal conditions.
Subsequently, we developed another biocatalyst co-expressing (2S,3S)-2,3-butanediol dehydrogenase
and formate dehydrogenase for (2S,3S)-2,3-butanediol production from (3S)-acetoin. Synchronous
catalysis together with two biocatalysts afforded 38.41 g/L of (2S,3S)-butanediol with stereoisomeric
purity of 98.03% from 40 g/L meso-2,3-butanediol. These results exhibited the potential for (3S)-acetoin
and (2S,3S)-butanediol production from meso-2,3-butanediol as a substrate via whole-cell biocatalysis.
Keywords: meso-2,3-butanediol; (3S)-acetoin; (2S,3S)-butanediol; Escherichia coli; coenzyme regeneration;
whole-cell biocatalysis
1. Introduction
2,3-Butanediol (2,3-BD) is an important biobased bulk chemical with extensive applications
in industry [
given priority regarding their development and utilization by the United States Department of
Energy [ ]. 2,3-Butanediol has three stereoisomers ((2S,3S)-2,3-butanediol, (2R,3R)-2,3-butanediol,
and meso-2,3-butanediol), while acetoin has two stereoisomers, including (3R)-acetoin and
(3S)-acetoin [ ]. These isomers of 2,3-butanediol and acetoin showed important potential for
synthesis of pharmaceutical intermediates [ ]. However, a mixture of 2,3-butanediol and acetoin
1,2]. Its precursor, acetoin (AC), is one of the 30 platform chemicals which are
3,4
5–8
6,7
isomers is generally produced by native producing strains, which results in difficulties for the
production of acetoin and 2,3-butanediol with high chiral purity [6,9].
α
-Acetolactate synthase (α-ALS), α-acetolactate decarboxylase (α-ALDC), and 2,3-butanediol
dehydrogenase (BDH) in natural producing strains have been revealed in previous studies as three
Molecules 2018, 23, 691; doi:10.3390/molecules23030691
www.mdpi.com/journal/molecules

Molecules 2018, 23, 691
2 of 15
key enzymes involved in the biosynthesis of acetoin and 2,3-butanediol [10
,11]. (3R)-Acetoin is
mainly produced from pyruvate via
α-acetolactate as one intermediate by α-ALS and α-ALDC.
Meanwhile, the intermediate -acetolactate is readily converted into diacetyl (DA) via non-enzymatic
α
oxidative decarboxylation under oxygen supply conditions. Dependending on various BDHs with
different stereospecificities, diacetyl can be catalytically converted into (3S)-acetoin and (3R)-acetoin.
Ultimately, (3S)-acetoin and (3R)-acetoin can further be converted into three 2,3-butanediol
isomer forms by BDHs, which show three types, including (2S,3S)-2,3-BDH, (2R,3R)-2,3-BDH and
meso-2,3-BDH. During 2,3-butanediol fermentation process, meso-2,3-butanediol was synthesized from
(3R)-acetoin by meso-2,3-BDH or (3S)-acetoin by (2R,3R)-2,3-BDH, whereas (2S,3S)-2,3-butanediol and
(2R,3R)-2,3-butanediol were produced from (3S)-acetoin and (3R)-acetoin by (2S,3S)-2,3-BDH and
(2R,3R)-2,3-BDH respectively [12,13]. These findings indicated that the existence of various 2,3-BDHs
with different stereospecificities in native 2,3-butanediol producers leads to the formation of acetoin
and 2,3-butanediol isomers during the fermentation process.
Based on the mechanism of acetoin and 2,3-butanediol isomers formation, metabolic engineering
and synthetic biology have been applied in recent years to improve the productivity and purity.
Zhang et al. developed a recombinant E. coli co-expressing α-ALS, α-ALDC from Serratia marcescens
and NADH oxidase (NOX) from Lactobacillus brevis for (3R)-acetoin from glucose [14]. Maximum
(3R)-acetoin concentration of 60.3 g/L with the purity of 97.3% could be achieved by fed-batch
fermentative strategy. The highest (2R,3R)-2,3-butanediol concentration of 152.0 g/L with the
purity of more than 97.5% was produced from a mixture of glucose and xylose using engineered
Enterobacter cloacae strain through deleting meso-2,3-BDH and over-expressing (2R,3R)-2,3-BDH [15].
98.0 g/L of meso-2,3-butanediol with the purity of 99.0% could also be obtained from glucose
by Bacillus licheniformis deficient of glycerol dehydrogenase and acetoin degradable genes [16].
For (2S,3S)-2,3-butanediol production, Chu et al. introduced two genes encoding
α-ALS and
meso-2,3-BDH from E. cloacae into E. coli, which could produce low (2S,3S)-2,3-butanediol concentration
(2.2 g/L) with a stereoisomeric purity of 95.0% from glucose using the fermentation method [17].
A major reason is that low concentration of diacetyl from
α-acetolactate via non-enzymatic
decarboxylation was produced during the fermentation process, resulting in low flux into
(2S,3S)-2,3-butanediol via (3S)-acetoin by meso-2,3-BDH [18]. To obtain higher concentration and
yield, biocatalytic technologies have been used to produce (3S)-acetoin and (2S,3S)-2,3-butanediol
from diacetyl as a substrate. Li et al. employed whole-cell biocatalyst over-expressing meso-2,3-BDH
from E. cloacae to convert diacetyl into (2S,3S)-2,3-butanediol via (3S)-acetoin as an intermediate,
and glucose as a cheap source of reducing equivalents was used during the biocatalytic reaction process.
High optical purity of (2S,3S)-2,3-butanediol (purity > 99%) with maximum concentration of 26.8 g/L
was achieved using a fed-batch strategy [19]. The highest (2S,3S)-2,3-butanediol concentration of
31.7 g/L was obtained from diacetyl using 2,3-BDH with NADH-regeneration formate dehydrogenase
(FDH) by in vitro biocatalysis [20]. Considering that (3S)-acetoin from diacetyl is readily converted
into (2S,3S)-2,3-butanediol by BDHs, Gao et al. employed NADPH-dependent carbonyl reductase
from Gluconobacter oxydans and glucose dehydrogenase from Bacillus subtilis with NADH regeneration
to carry out the bioconversion from diacetyl to (3S)-acetoin [21]. Maximum (3S)-acetoin concentrations
of 12.2 g/L were achieved from diacetyl by whole-cell biocatalysis. However, the toxicity of diacetyl to
cells and enzymes was found to limit the biotransformation process and recyclability.
Previous studies indicated that meso-2,3-butanediol without diacetyl was also converted into
(3S)-acetoin via one reversible reaction by (2R,3R)-2,3-BDH in the presence of NAD+ [22]. Xiao et al.
showed that (3S)-acetoin could be efficiently produced from meso-2,3-butanediol using (2R,3R)-2,3-BDH
from Bacillus subtilis coupled with NOX from L. brevis [23]. 36.7 g/L of (3S)-acetoin produced
from meso-2,3-butanediol by whole-cell biocatalysis is still low. A possible reason is that the
coenzyme regeneration system required oxygen as a substrate for NOX enzyme as described in our
previous study [7]. In the current study, whole-cell engineered E. coli co-expressing (2R,3R)-2,3-BDH,
NOX and Vitreoscilla hemoglobin (VHB) from Paenibacillus polymyxa, L. brevis and Vitreoscilla was

Molecules 2018, 23, 691
3 of 15
developed for the production of (3S)-acetoin from meso-2,3-butanediol (Figure 1). Biotransformation
conditions including pH, temperature, wet cell weight (WCW), substrate concentration, and metal
ions were optimized in conical flasks. A high yield of (3S)-acetoin was obtained by batch
bioconversion in 5-L bioreactor under the optimal conditions. Additionally, another biocatalyst
co-expressing (2S,3S)-2,3-BDH and formate dehydrogenase (FDH) was developed and used to produce
(2S,3S)-2,3-butanediol from (3S)-acetoin. Synchronous catalysis together with two biocatalysts showed
that (2S,3S)-2,3-butanediol with high yield and purity could be achieved from meso-2,3-butanediol via
(3S)-acetoin as intermediate.
(A)
(B)
Figure 1. Schematic illustration of biocatalytic (3S)-AC (A) and (2S,3S)-2,3-BD (B) production from
meso-2,3-BD using whole-cell biocatalysts of induced E. coli (pET-rrbdh-nox-vgb) cells and induced E. coli
(pET-ssbdh-fdh) cells.
2. Results and Discussion
2.1. Construction of the Whole-Cell Biocatalysts
First, three recombinant strains, including E. coli (pET-rrbdh), E. coli (pET-rrbdh-nox), and E. coli
(pET-rrbdh-nox-vgb) were constructed for (3S)-acetoin production from meso-2,3-butanediol. SDS-PAGE
analysis demonstrated that three clear bands of NADH oxidase, (2R,3R)-2,3-BDH, and VHB could be
observed in three recombinant E. coli strains (Figure 2), implying that the nox, rrbdh, and vgb genes
were successfully expressed or co-expressed in recombinant strains. Furthermore, the activities of
(2R,3R)-2,3-BDH and NADH oxidase in the recombinant E. coli strains were determined, and E. coli
(pET28a) was used as the control. The results were given in Table 1. As for (2R,3R)-2,3-BDH activity,
the crude extracts from induced E. coli (pET-rrbdh), E. coli (pET-rrbdh-nox), and E. coli (pET-rrbdh-nox-vgb)
cells exhibited the activities of 1.11, 0.97, and 0.95 U/mg for (2R,3R)-2,3-butanediol as substrate,
and that of 0.57, 0.53, and 0.51 U/mg for meso-2,3-butanediol as substrate in the presence of NAD+ as
coenzyme. No activity could be detected for (2S,3S)-2,3-butanediol as substrate by (2R,3R)-2,3-BDH.
As described previously by Yu et al. [22], (2R,3R)-2,3-BDH from P. polymyxa could efficiently convert
meso-2,3-butanediol and (2R,3R)-2,3-butanediol into (3S)-acetoin and (3R)-acetoin, respectively, whereas
(2S,3S)-2,3-butanediol is not a substrate for (2R,3R)-2,3-BDH at all. In addition, the control strain
E. coli pET28a also catalyzed the conversion of (2R,3R)-2,3-butanediol and meso-2,3-butanediol into
acetoin though showing obviously low activity. Meanwhile, the NADH oxidase activities of 6.83 and
5.93 U/mg in E. coli (pET-rrbdh-nox) and E. coli (pET-rrbdh-nox-vgb) could be obtained when NADH
was used as the substrate. Subsequently, the recombinant strain E. coli (pET-ssbdh-fdh) was developed
for the conversion of (3S)-acetoin to (2S,3S)-2,3-butanediol. As shown in Figure 2, the ssbdh and fdh
genes could be expressed or co-expressed in the recombinant E. coli strains. Moreover, enzyme activity
assays were performed using the substrates of (3R/3S)-acetoin for (2S,3S)-2,3-BDH and formate for
FDH. The crude enzyme from induced E. coli (pET-ssbdh-fdh) cells showed the activities of 38.90 U/mg

Molecules 2018, 23, 691
4 of 15
for (3R/3S)-acetoin and 0.06 U/mg for formate (Table 2). These results indicated that whole-cell
biocatalysts for the production of (3S)-acetoin and (2S,3S)-2,3-butanediol from meso-2,3-butanediol
were successfully obtained.
Figure 2. Expression analysis of recombinant E. coli strains by SDS-PAGE. Lane M1, marker proteins
(180, 140, 100, 80, 60, 45, 35, 25, 15, 10 kDa); Lane 1, E. coli (pET-rrbdh-nox-vgb); Lane 2, E. coli
(pET-rrbdh-nox); Lane 3, E. coli (pET-rrbdh); Lane 4–5, E. coli (pET28a); Lane M2, marker proteins (120,
100, 70, 50, 40, 30, 25, 14 kDa); Lane 6, E. coli (pET-fdh); Lane 7, E. coli (pET-ssbdh); and Lane 8, E. coli
(pET-ssbdh-fdh).
Table 1. Activity assays of (2R,3R)-2,3-BDH and NADH oxidase in the recombinant E. coli strains.
Crude Enzyme Activities of (2R,3R)-2,3-BDH and NADH Oxidase (U/mg)
E. coli BL21(DE3)
(2S,3S)-2,3-BD
(2R,3R)-2,3-BD
meso-2,3-BD
NADH
pET28a
pET-rrbdh
pET-rrbdh-nox
pET-rrbdh-nox-vgb
0
0
0
0
0.01 ± 0.01
1.11 ± 0.04
0.97 ± 0.05
0.95 ± 0.02
0.04 ± 0.01
0.57 ± 0.03
0.53 ± 0.03
0.51 ± 0.04
ND
ND
6.83 ± 0.48
5.93 ± 0.35
ND: not detected.
Table 2. Activity assays of (2S,3S)-2,3-BDH and FDH in the recombinant E. coli strains.
Crude Enzyme Activities of (2S,3S)-2,3-BDH and FDH (U/mg)
E. coli BL21(DE3)
(3R/3S)-AC
Formate
pET28a
pET-ssbdh
pET-fdh
0.05 ± 0.01
53.20 ± 0.49
0.03 ± 0.01
38.90 ± 0.21
ND
ND
0.18 ± 0.01
pET-ssbdh-fdh
0.06 ± 0.02
ND: not detected.
2.2. (3S)-Acetoin Production from meso-2,3-Butanediol by Whole-Cell Catalysis
2.2.1. Feasibility of (3S)-Acetoin Production from meso-2,3-Butanediol by Whole-Cell Catalysis
The whole-cell biocatalysis for (3S)-acetoin production from meso-2,3-butanediol was firstly
conducted by using E. coli (pET-rrbdh), E. coli (pET-rrbdh-nox), and E. coli (pET-rrbdh-nox-vgb) in
a 10 mL reaction mixture (pH 7.0) containing 20 g/L 2,3-butanediol and 40 g WCW/L at 30 ◦C for
12 h, and E. coli (pET28a) was used as the control. The configuration and yield of acetoin produced
by whole-cell biocatalysis were analyzed and quantified using a GC system equipped with a chiral
column. The results were shown in Figure 3 and Table 3. As shown in Table 3, 7.86 g/L of (3S)-acetoin
from 20 g/L 2,3-butanediol as substrate was achieved by E. coli (pET-rrbdh). Meanwhile, a small
amount of (3R)-acetoin (0.71 g/L) could be detected in the reaction system partially due to the

Molecules 2018, 23, 691
5 of 15
existence of (2R,3R)-2,3-butanediol (4.04%) in the 2,3-butanediol substrate (Figure 3). As reported in
previous studies, the (2R,3R)-2,3-BDH enzyme could convert (2R,3R)-2,3-butanediol into (3R)-acetoin,
which resulted in a small amount of (3R)-acetoin production [13,22]. The (2R,3R)-2,3-BDH coupled
with NOX enzyme in E. coli (pET-rrbdh-nox) resulted in the rapid increase of (3S)-acetoin yield
(13.88 g/L), indicating that NAD+ regeneration could remarkably improve the whole-cell biocatalytic
efficiency. Considering NOX enzyme required oxygen as substrate, the vgb gene encoding VHB
enzyme introduced into E. coli (pET-rrbdh-nox) was employed to improve oxygen transfer during the
whole-cell biocatalytic process [7,24]. As shown in Table 3, the expression of VHB led to an increase
of (3S)-acetoin yield (16.79 g/L) by 20.97% compared with that by E. coli (pET-rrbdh-nox). The result
was consistent with those of previous studies showing that VHB protein could be used to improve
biocatalytic efficiency in biotransformation system with NOX-dependent NAD(P)+ regeneration [
7,25].
Table 3. The feasibility of (3S)-AC production from meso-2,3-BD by the recombinant strains.
(3R)-AC
(g/L)
(3S)-AC
(g/L)
(2S,3S)-2,3-BD
(2R,3R)-2,3-BD
meso-2,3-BD
E. coli BL21(DE3)
(g/L)
(g/L)
(g/L)
pET28a
pET-rrbdh
pET-rrbdh-nox
pET-rrbdh-nox-vgb
0.06 ± 0.01
0.71 ± 0.03
0.81 ± 0.05
0.83 ± 0.02
0.04 ± 0.01
7.86 ± 0.05
13.88 ± 0.12
16.79 ± 0.15
0.52 ± 0.03
0.53 ± 0.02
0.55 ± 0.03
0.55 ± 0.01
0.86 ± 0.02
0.27 ± 0.01
0.12 ± 0.01
0.09 ± 0.03
18.75 ± 0.19
10.46 ± 0.14
4.52 ± 0.10
1.96 ± 0.05
Figure 3. GC analysis of substrates and products in the bioconversion reaction by E. coli (pET-rrbdh-nox-vgb)
and E. coli (pET-ssbdh-fdh) (n-butanol was used as the internal standard). (
chemicals of (3R/3S)-AC, (2S,3S)-2,3-BD, (2R,3R)-2,3-BD, and meso-2,3-BD; (
(93.73% meso-2,3-BD, 2.23% (2S,3S)-2,3-BD, and 4.04% (2R,3R)-2,3-BD); (
substrate of 2,3-BD by induced E. coli (pET-rrbdh-nox-vgb) cells; (
(3S)-AC produced from meso-2,3-BD by induced E. coli (pET-rrbdh-nox-vgb) cells.
A
B
C
) a mixture of standard
) the substrate of 2,3-BD
) the product from the
D) the product from the substrate of

Molecules 2018, 23, 691
6 of 15
Interestingly, a small amount of acetoin was also produced from 2,3-butanediol by the control
strain E. coli (pET28a), which suggested that some non-specific dehydrogenases in E. coli might catalyze
conversion of 2,3-butanediol into acetoin as observed in our previous study [13]. Based on the above
results, the recombinant strain of E. coli (pET-rrbdh-nox-vgb) was chosen to perform the optimization of
bioconversion conditions.
2.2.2. Effects of pH, Temperature, and WCW on (3S)-Acetoin Production by E. coli (pET-rrbdh-nox-vgb)
To obtain high (3S)-acetoin concentrations, the effects of pH, temperature, and WCW on whole-cell
biocatalytic efficiency were systematically investigated by using induced E. coli (pET-rrbdh-nox-vgb)
cells. As shown in Figure 4A, the whole-cell biocatalytic reactions containing 20 g/L 2,3-butanediol
and 40 g/L wet cells were conducted under different pH-values for 12 h at 30 ◦C. The results showed
that the yield of (3S)-acetoin was gradually increased with the pH increase from 6.0 to 8.5. A maximum
(3S)-acetoin concentration of 18.31 g/L could be obtained at pH 8.5. Thus, pH 8.5 as the optimum
pH-value was used for the following experiments. The effect of temperature on (3S)-acetoin production
from meso-2,3-butanediol by induced E. coli (pET-rrbdh-nox-vgb) cells was studied in the range of
25–42 ◦C. Figure 4B indicates that 18.45 g/L of (3S)-acetoin was achieved at 12 h when the whole-cell
◦
biocatalytic reaction was performed at 30 C, which was used as the optimum temperature for further
experiments. Among the parameters affecting whole-cell biocatalytic reaction, the concentration of the
biocatalyst also plays an important role on the bioconversion efficiency [7,26], so WCWs from 10 to
60 g/L were used to evaluate the effect on the whole-cell biocatalysis process. As shown in Figure 4C,
the (3S)-acetoin concentration was improved rapidly with the increase of WCW in the whole-cell
biocatalytic reaction. The (3S)-acetoin concentration of 18.20 and 18.64 g/L could be produced from
20 g/L 2,3-butanediol by induced E. coli (pET-rrbdh-nox-vgb) cells at 12 h when the cell concentrations
were 40 g and 60 g WCW/L. The WCW of 40 g/L was chosen as an optimum cell concentration after
considering the cost.
(A)
(B)
(C)
(D)
(E)
Figure 4. Effects of pH, temperature, WCW, substrate concentration and metal ions on (3S)-AC
production from meso-2,3-BD by whole-cell biocatalysis of E. coli (pET-rrbdh-nox-vgb). ) pH;
) temperature; ( ) WCW; ( ) substrate concentration; ( ) metal ions. The biocalytic reactions
(
A
(
B
C
D
E
were performed in 100 mL flask containing 10 mL reaction solution for 12 h for optimization of pH,
temperature and WCW in triplicate, while the optimizations of initial substrate concentration and
metal ions were conducted in 100 mL flask containing 10 mL reaction solution for 24 h in triplicate.

Molecules 2018, 23, 691
7 of 15
2.2.3. Effects of Substrate Concentration and Metal Ions on (3S)-Acetoin Production by E. coli
(pET-rrbdh-nox-vgb)
Substrate concentration is another limiting factor in the whole-cell biocatalytic reaction.
Low substrate concentration resulted in low product yield, whereas the bioconversion reaction might
be inhibited by high substrate concentration. The effect of the initial 2,3-butanediol concentration
on (3S)-acetoin production from meso-2,3-butanediol by E. coli (pET-rrbdh-nox-vgb) was tested in the
range of 20–140 g/L for 24 h. The results indicated that the product (3S)-acetoin concentration
was significantly increased by increasing the initial substrate concentration from 20 to 100 g/L
(Figure 4D). When the initial 2,3-butanediol concentration continued to increase to 140 g/L,
the (3S)-acetoin concentration appeared the decrease trend, implying that 100 g/L 2,3-butanediol
as initial substrate concentration was suitable for (3S)-acetoin production. Ultimately, maximum
(3S)-acetoin concentration of 60.29 g/L from 100 g/L 2,3-butanediol was obtained at 24 h (Figure 4D).
Previous studies showed that the use of some metal ions such as Mn2+, Ca2+, Fe2+, Fe3+, and Mg2+
as chemical stimulators could accelerate the conversion from 2,3-butanediol to acetoin by improving
the activity of (2R,3R)-2,3-BDH [22
for NADH oxidase, another enzyme in the biocatalyst [
,
27]. However, these metal ions showed stimulation or inhibition
]. To evaluate their effect on (3S)-acetoin
7
production, five metal ions including Mn2+, Ca2+, Fe2+, Fe3+, and Mg2+ at 0, 2.5, and 5.0 mM were
chosen to conduct the whole-cell biocatalysis by using induced E. coli (pET-rrbdh-nox-vgb) cells for
24 h. The results showed that all the listed metal ions except Fe2+ could promote (3S)-acetoin
production at different concentrations (Figure 4E). Especially Mn2+ exhibited obvious stimulation
effect on (3S)-acetoin production in the bioconversion reaction. Maximum (3S)-acetoin concentration
of 65.77 g/L was achieved by Mn2+ at 5 mM at 24 h.
2.2.4. Batch Bioconversion of (3S)-Acetoin Production from meso-2,3-Butanediol in a 5-L Bioreactor
The batch bioconversion for (3S)-acetoin production from meso-2,3-butanediol by induced
E. coli (pET-rrbdh-nox-vgb) cells was conducted in a 5-L bioreactor with the reaction volume of 2 L
under the optimized conditions. The bioconversion experiment in the bioreactor was performed at
◦
30 C with an aeration rate of 4 vvm and agitation speed of 200 rpm to provide adequate oxygen.
The result was shown in Figure 5. Maximum (3S)-acetoin concentration of 72.38 g/L with the
productivity of 3.02 g/L/h and stereoisomeric purity of 94.65% was obtained by induced E. coli
(pET-rrbdh-nox-vgb) cells at 24 h (Figure 5). However, the whole-cell biocatalyst could not completely
convert meso-2,3-butanediol into (3S)-acetoin in the bioconversion reaction. A probable reason was
that (2R,3R)-2,3-BDH was a reversible enzyme catalyzing the interconversion of meso-2,3-butanediol
and (3S)-acetoin [13,22]. The residual meso-2,3-butanediol of about 20 g/L was retained in the
whole-cell biocatalysis reaction partially due to the limitation of high (3S)-acetoin concentration.
During the batch bioconversion process, (2R,3R)-2,3-butanediol from the substrate of 2,3-butanediol as
another substrate could be converted into (3R)-acetoin by (2R,3R)-2,3-BDH, leading to the reduction
of the (3S)-acetoin purity. Previous studies showed that high meso-2,3-butanediol concentration with
a small amount of (2S,3S)-2,3-butanediol could be produced by Serratia marcescens H30, whereas
no (2R,3R)-2,3-butanediol could be detected during the fermentation process [28,29]. Therefore,
the substrate 2,3-butanediol without (2R,3R)-2,3-butanediol produced by S. marcescens H30 might
contribute on high (3S)-acetoin purity in current reaction system. In addition, the (2S,3S)-2,3-butanediol
concentration in the bioconversion system was kept at about 2.2 g/L since it was not the substrate for
(2R,3R)-2,3-BDH in the biocatalyst.

Molecules 2018, 23, 691
8 of 15
Figure 5. Time course of batch bioconversion of (3S)-AC production from meso-2,3-BD by E. coli
(pET-rrbdh-nox-vgb) in 5-L bioreactor.
2.3. (2S,3S)-2,3-Butanediol Production from meso-2,3-Butanediol by Synchronous Catalysis
2.3.1. Feasibility of (2S,3S)-2,3-Butanediol Production from meso-2,3-Butanediol by Synchronous Catalysis
The (2S,3S)-2,3-BDH enzyme showed the ability of efficiently catalyzing (3S)-acetoin into
(2S,3S)-2,3-butanediol in the presence of NADH in previous studies [13,30–32]. Herein, (2S,3S)-2,3-BDH
from Serratia sp. T241 coupled with FDH from C. boidinii NCYC 1513 was employed to produce
(2S,3S)-2,3-butanediol from (3S)-acetoin. As shown in Figures 1 and 2, the biocatalyst of E. coli
(pET-ssbdh-fdh) co-expressing (2S,3S)-2,3-BDH from Serratia sp. T241 and FDH from C. boidinii
NCYC 1513 was developed for (2S,3S)-2,3-butanediol production from (3S)-acetoin produced from
meso-2,3-butanediol by E. coli (pET-rrbdh-nox-vgb). Synchronous catalysis together with two biocatalysts
was used to evaluate the feasibility of the conversion from meso-2,3-butanediol to (2S,3S)-2,3-butanediol
via (3S)-acetoin as an intermediate (Figure 1). The initial reaction mixture contained phosphate buffer
(pH 7.0), 20 g/L 2,3-butanediol, 20 g WCW/L of induced E. coli (pET-rrbdh-nox-vgb) cells, 20 g WCW/L
of induced E. coli (pET-ssbdh-fdh) cells and 20 g/L ammonium formate as the driving force for NADH
regeneration. The result showed that 13.96 g/L of (2S,3S)-2,3-butanediol could be achieved from 20 g/L
meso-2,3-butanediol for 6 h at 30 ◦C by synchronous catalysis, implying that (2S,3S)-2,3-butanediol
production from meso-2,3-butanediol was feasible by synchronous catalysis using two biocatalysts of
induced E. coli (pET-rrbdh-nox-vgb) cells and induced E. coli (pET-ssbdh-fdh) cells.
2.3.2. Optimization of Synchronous Catalysis Conditions
Furthermore, four factors including pH, temperature, the WCW ratio of E. coli (pET-rrbdh-nox-vgb)
cells to E. coli (pET-ssbdh-fdh) cells and metal ions were optimized using single factor experiments.
The results were given in Figure 6. Figure 6A indicated that the pH value in the synchronous
catalysis system had an important effect on (2S,3S)-2,3-butanediol production from meso-2,3-butanediol.
The optimum pH was observed at 7.0, which was not consistent with that of (3S)-acetoin from
meso-2,3-butanediol by E. coli (pET-rrbdh-nox-vgb). A probable explanation was that all the reported
BDHs were reversible enzymes catalyzing the interconversion between acetoin and 2,3-butanediol.
Alkaline environment favors the oxidation of 2,3-butanediol to acetoin by BDH enzymes, which readily
reduced acetoin as a substrate to 2,3-butanediol in acid solution [5,13,22,27]. The effect of temperature
on synchronous catalysis was investigated by using the optimum pH of 7.0. Two biocatalysts of
induced E. coli (pET-rrbdh-nox-vgb) and E. coli (pET-ssbdh-fdh) cells exhibited high biocatalytic stability
at 30 ◦C (Figure 6B). The ratio of E. coli (pET-rrbdh-nox-vgb) cells to E. coli (pET-ssbdh-fdh) cells was
optimized at pH 7.0 and 30 ◦C as shown in Figure 6C. The results indicated that 15.17 and 15.43 g/L
of (2S,3S)-2,3-butanediol production from 20 g/L meso-2,3-butanediol could be achieved at 6 h when

Molecules 2018, 23, 691
9 of 15
the ratios of E. coli (pET-rrbdh-nox-vgb) to E. coli (pET-ssbdh-fdh) were 40:30 and 40:40 respectively.
To consider the cost, the ratio (40:30) of two biocatalysts was chosen for following experiments.
The effect of metal ions with different concentrations on synchronous catalysis was shown in Figure 6D.
The results showed that Mn2+ among all the listed meal ions played an obvious stimulation effect
on (2S,3S)-2,3-butanediol production from meso-2,3-butanediol in the synchronous catalysis reaction.
Maximum (2S,3S)-2,3-butanediol concentration of 16.71 g/L was obtained in the presence of 5.0 mM
Mn2+ for 6 h.
(A)
(B)
(C)
(D)
Figure 6. Effects of pH, temperature, ratio of induced E. coli (pET-rrbdh-nox-vgb) cells to induced
E. coli (pET-ssbdh-fdh) cells, and metal ions on (2S,3S)-BD production from meso-2,3-BD by synchronous
catalysis. (
A
) pH; (
B
) temperature; (C) ratio of E. coli (pET-rrbdh-nox-vgb) cells to induced E. coli
(pET-ssbdh-fdh) cells; (
D
) different metal ions at the concentrations of 0, 2.5, and 5 mM. All the
experiments were performed in triplicate in 100 mL flasks containing 10 mL reaction solution for 6 h.
2.3.3. Batch Bioconversion of (2S,3S)-2,3-Butanediol Production from meso-2,3-Butanediol by
Synchronous Catalysis in 5-L Bioreactor
Under optimal conditions, batch bioconversion by synchronous catalysis together with
two biocatalysts was conducted in 5-L bioreactor with 2 L reaction mixture containing 20, 40,
and 60 g/L 2,3-butanediol as substrate respectively. The results were shown in Figure 7. 44.03 g/L
of (2S,3S)-2,3-butanediol was obtained from 60 g/L substrate at 24 h in the synchronous catalysis
reaction. However, the residual meso-2,3-butanediol of 12.51 g/L was retained in the reaction, resulting
in low (2S,3S)-2,3-butanediol stereoisomeric purity of 77.87%. On contrary, 18.04 and 38.41 g/L
of (2S,3S)-2,3-butanediol with high stereoisomeric purity of 96.26% and 98.03% could be achieved
from 20 and 40 g/L substrate at 8 h and 21 h respectively by synchronous catalysis. Considering
the product yield and stereoisomeric purity, the initial substrate concentration of 40 g/L favored
(2S,3S)-2,3-butanediol production in current reaction system. During the whole synchronous catalysis

Molecules 2018, 23, 691
10 of 15
process, a small amount of (2R,3R)-2,3-butanediol in the 2,3-butanediol substrate could rapidly be
consumed and no (2R,3R)-2,3-butanediol was detected at the end of synchronous catalysis. As reported
in previous studies, (2R,3R)-2,3-butanediol was readily converted into (3R)-acetoin by the biocatalyst
of E. coli (pET-rrbdh-nox-vgb) [22]. However, the (3R)-acetoin concentration was retained at low level in
the whole synchronous catalysis reaction, implying that (3R)-acetoin from (2R,3R)-2,3-butanediol in the
2,3-butanediol substrate might be further converted into meso-2,3-butanediol by the biocatalyst of E. coli
(pET-ssbdh-fdh). Our previous study showed that (2S,3S)-2,3-BDH from Serratia sp. T241 also catalyzed
(3R)-acetoin into meso-2,3-butanediol [13], which could be used as substrate and converted into the
product (2S,3S)-2,3-butanediol via (3S)-acetoin as an intermediate by induced E. coli (pET-ssbdh-fdh)
cells during the synchronous catalysis process.
(A)
(B)
(C)
Figure 7. Time course of batch bioconversion of (2S,3S)-2,3-BD production from meso-2,3-BD with the
initial substrate concentration of 20 (A); 40 (B); and 60 (C) g/L by synchronous catalysis in 5-L bioreactor.
3. Materials and Methods
3.1. Enzymes and Chemicals
The standard samples of (3S/3R)-acetoin, (2S,3S)-2,3-butanediol (97.0%), (2R,3R)-2,3-butanediol
(97.0%), and meso-2,3-butanediol (99.0%) were obtained from Sigma-Aldrich (Shanghai, China).
The substrate 2,3-butanediol (93.73% meso-2,3-butanediol, 2.23% (2S,3S)-2,3-butanediol, and 4.04%
(2R,3R)-2,3-butanediol) was purchased from Sinopharm (Beijing, China). Kanamycin was obtained
from Amresco (Solon, OH, USA). Isopropyl-β-D-1-thiogalactopyranoside (IPTG) was purchased from
Merck (Shainghai, China). PCR primers were synthesized by Sangon (Shanghai, China). Pfu DNA
polymerase and restriction endonucleases were purchased from TaKaRa Biotech (Dalian, China). DNA,
protein marker, and competent cells were obtained from Tiangen Biotech (Shanghai, China). All other
chemicals were commercially available reagents of analytical grade.
3.2. Construction of the Recombinant Strains as Biocatalysts
The bacterial strains, plasmids, and primers used in this study are listed in Table 4. The genomic
DNA of P. polymyxa ATCC12321, L. brevis 20054, Serratia sp. T241 and C. boidinii NCYC 1513 were
extracted the OMEGA Bacterial Genomic DNA Kit (OMEGA, Shanghai, China). The vgb gene (GenBank
Accession number AAA75506) source was from the pBR322-vgb plasmid previously constructed in
our lab. For construction of the recombinant pET-rrbdh plasmid, the rrbdh gene (GenBank Accession
number ADV15558) encoding (2R,3R)-2,3-BDH from P. polymyxa ATCC12321 were amplified by PCR
using the primers P1/P2 with BamHI and HindIII sites respectively. The obtained PCR products were
inserted into the expression plasmid pET28a at the BamHI and HindIII sites. ClonExpress MultiS
One Step Cloning Kit (Vazyme, Nanjing, China) was used to develop the recombinant pET-rrbdh-nox,
pET-rrbdh-nox-vgb and pET-ssbdh-fdh plasmids according to the protocol. In brief, a series of primers
(P3–P6) were designed with adjacent oligos overlapped by 15–20 bp at each end of the assembly.

Molecules 2018, 23, 691
11 of 15
The PCR-amplification products of the rrbdh and nox (GenBank Accession number AAN04047) genes
using the primers P3/P4 and P5/P6 were assembled into the linearized pET28a vector at BamHI and
HindIII sites, generating the recombinant pET-rrbdh-nox plasmid. Similarly, the rrbdh, nox, vgb, ssbdh
(GenBank Accession number AEF51363) and fdh (GenBank Accession number O13437) genes were
amplified using the primers (P7–P16), respectively. The PCR-amplification products of the rrbdh, nox
and vgb genes or the ssbdh and fdh genes were assembled into the linearized pET28a vector, resulting
in the recombinant pET-rrbdh-nox-vgb and pET-ssbdh-fdh plasmids. Then, four recombinant plasmids
of pET-rrbdh, pET-rrbdh-nox, pET-rrbdh-nox-vgb, and pET-ssbdh-fdh were transformed into competent
cells of E. coli BL21 (DE3). The obtained recombinant strains were designated as E. coli (pET-rrbdh),
E. coli (pET-rrbdh-nox), E. coli (pET-rrbdh-nox-vgb), and E. coli (pET-ssbdh-fdh) and kept at
further experiments.
−
80 ◦C for
Table 4. Bacterial strains, plasmids, and primers used in this study.
Strains, Plasmids, or Primers
Genotype, Properties, or Sequences
Source
Strains
P. polymyxa ATCC12321
L. brevis DSM 20054
Serratia sp. T241
Wild type
Wild type
Wild type
Wild type
Laboratory stock
Laboratory stock
Laboratory stock
Laboratory stock
C. boidinii NCYC 1513
−
F
, φ80d/lacZ∆M15, ∆(lacZYA-argF)U169, deoR, recA1, endA1,
E. coli DH5α
Tiangen Biotech
Tiangen Biotech
hsdR17(rk mk+), phoA, supE44, λ , thi-1, gyrA96, relA1
F-, ompT, hsdSB(rB-mB-), gal(λ c I 857, ind1, Sam7, nin5,
lacUV-T7 gene1), dcm(DE3)
−
−
E. coli BL21(DE3)
Plasmids
pET28a
pBR322-vgb
pET-fdh
Kmr; expression vector
AMPr; pBR322 vector containing the vgb gene
Kmr; fdh in pET28a
Laboratory stock
Laboratory stock
Laboratory stock
Laboratory stock
This study
pET-ssbdh
pET-rrbdh
pET-rrbdh-nox
pET-rrbdh-nox-vgb
Kmr; ssbdh in pET28a
Kmr; rrbdh in pET28a
Kmr; rrbdh and nox in pET28a
Kmr; rrbdh, nox, and vgb in pET28a
Kmr; rrbdh and fdh in pET28a
This study
This study
This study
pET-ssbdh-fdh
Primers
P1
P2
CGCGGATCCATGCAAGCATTGAGATGGC
CGCAAGCTTTTAGGCTTTCGGAGATACCA
BamHI
HindIII
P3
P4
P5
P6
P7
P8
P9
P10
P11
P12
P13
P14
P15
P16
CAGCAAATGGGTCGCGGATCCATGCAAGCATTGAGATGGC
TTTCCTTTCCTTATTGTGATGACTTAGGCTTTCGGAGATAC
GTCATCACAATAAGGAAAGGAAAATGAAAGTCACAGTTG
CTCGAGTGCGGCCGCAAGCTTTTAAGCGTTAACTGAT
CAGCAAATGGGTCGCGGATCCATGCAAGCATTGAGATGGC
TTTCCTTTCCTTATTGTGATGACTTAGGCTTTCGGAGATAC
GTCATCACAATAAGGAAAGGAAAATGAAAGTCACAGTTG
TTTCCTTTCCTTATTGTGATGACTTAAGCGTTAACTGAT
GTCATCACAATAAGGAAAGGAAAATGTTAGACCAGCAAAC
CTCGAGTGCGGCCGCAAGCTTTTATTCAACCGCTTGAGCGT
CAGCAAATGGGTCGCGGATCCATGTCGACAGGTTTGAAC
TTTCCTTTCCTTATTGTGATGACTTAGCGATAAACCAGCCC
GTCATCACAATAAGGAAAGGAAAATGAAAATTGTCCTGGT
CTCGAGTGCGGCCGCAAGCTTTTACTTTTTATCGTGTTTG
BamHI
RBS sequence
RBS sequence
HindIII
BamHI
RBS sequence
RBS sequence
RBS sequence
RBS sequence
HindIII
BamHI
RBS sequence
RBS sequence
HindIII
3.3. Biocatalyst Preparation
The recombinant strains harboring the plasmids pET-rrbdh, pET-rrbdh-nox, pET-rrbdh-nox-vgb,
and pET-ssbdh-fdh were cultured in LB medium containing 50
g/mL kanamycin at 37 ◦C until the
OD600 reach up to 0.6, and then 0.5 mM IPTG was added into the culture for induction expression.
After 8 h induction at 30 ◦C, the cells were harvested by centrifugation at 8000 g for 10 min at 4 ◦C
µ
×
and then washed twice with 0.85% NaCl. The cell pellets were resuspended in 50 mM potassium
phosphate buffer for bioconversion experiments.

Molecules 2018, 23, 691
12 of 15
3.4. (3S)-Acetoin Production from meso-2,3-Butanediol by Whole-Cell Biocatalysis
The initial bioconversion experiments for (3S)-acetoin production from meso-2,3-butanediol by
E. coli (pET-rrbdh), E. coli (pET-rrbdh-nox), and E. coli (pET-rrbdh-nox-vgb) were performed in 100 mL
flasks containing 10 mL reaction mixtures (20 g/L 2,3-butanediol, 40 g WCW/L of induced cells,
◦
and pH 7.0) at 30 C for 12 h, and E. coli (pET28a) was used as the control. For the optimization
◦
of bioconversion conditions, five factors including pH (6.0–10.0), temperature (25–42 C), WCW
(10–60 g/L), substrate concentration (20–160 g/L), and metal ions (Mn2+, Ca2+, Fe2+, Fe3+, and Mg2+
at 2.5 and 5.0 mM) were investigated using single factor experiments by E. coli (pET-rrbdh-nox-vgb).
The substrate and product in the biocatalytic reactions were determined using gas chromatography.
All the bioconversion experiments were performed in triplicate, and standard deviations of the
biological replicates were represented by error bars.
3.5. (2S,3S)-2,3-Butanediol Production from meso-2,3-Butanediol by Synchronous Catalysis
Synchronous catalysis together with two biocatalysts of induced E. coli (pET-rrbdh-nox-vgb) cells
and induced E. coli (pET-ssbdh-fdh) cells was used to evaluate the feasibility of (2S,3S)-2,3-butanediol
production from meso-2,3-butanediol via (3S)-acetoin as an intermediate at 30 ◦C for 6 h. The initial
reaction mixture contained phosphate buffer (pH 7.0), 20 g/L 2,3-butanediol, 20 g WCW/L of induced
E. coli (pET-rrbdh-nox-vgb) cells, 20 g WCW/L of induced E. coli (pET-ssbdh-fdh) cells and 20 g/L
ammonium formate as the driving force for NADH regeneration. The reaction was performed at
30 ◦C for 6 h. For the optimization of bioconversion conditions, four factors including pH (6.5–8.0),
◦
temperature (25–42 C), the WCW ratio of E. coli (pET-rrbdh-nox-vgb) cells to E. coli (pET-ssbdh-fdh) cells
(40 g/L:10 g/L to 40 g/L:40 g/L) and metal ions (Mn2+, Ca2+, Fe2+, Fe3+, and Mg2+ at 2.5 and 5.0 mM)
were investigated using single factor experiments. All the bioconversion experiments were performed
in triplicate, and standard deviations of the biological replicates were represented by error bars.
3.6. Enzyme Assays
The induced cells after harvest by centrifugation were resuspended in 50 mM potassium
phosphate buffer (pH 7.4) and disrupted by sonication in an ice bath for 10 min. The disrupted
◦
cells were centrifuged at 10,000
×
g for 10 min at 4 C to remove the cell debris, and the obtained
supernatant was used as the crude enzyme extract for enzyme activity assays. The enzyme activities
of (2R,3R)-2,3-BDH and FDH were assayed by measuring the changes in absorbance at 340 nm
corresponding to the reduction of NAD+ using a UV/visible spectrophotometer (UV-1800, Mapada,
Shanghai, China) [22,33]. The reaction mixtures containing 50 mM potassium phosphate buffer
(pH 8.5), 0.2 mM NAD+ and 50 mM 2,3-butanediol ((2S,3S)-2,3-butanediol or (2R,3R)-2,3-butanediol
or meso-2,3-butanediol) were used to determine (2R,3R)-2,3-BDH activity. The assay of FDH
activity was carried out in 50 mM potassium phosphate buffer (pH 7.0) with 0.2 mM NAD+ and
100 mM formate as substrate. The enzyme activities of (2S,3S)-2,3-BDH and NOX were assayed by
measuring the changes in absorbance at 340 nm corresponding to the oxidation of NADH using
a UV/visible spectrophotometer (UV-1800, Mapada, Shanghai, China) [13,34]. The reaction mixtures
for (2S,3S)-2,3-BDH activity assay contained 50 mM potassium phosphate buffer (pH 7.0), 0.2 mM
NADH and 50 mM (3R/3S)-acetoin as substrate. The NOX activity assay was carried out in 50 mM
potassium phosphate buffer with 0.2 mM NADH as the substrate. One unit of (2R,3R)-2,3-BDH
and FDH activity was defined as the amount of enzyme required to reduce 1
minute. One unit of (2S, 3S)-2,3-BDH and NOX activity was defined as the amount of enzyme required
to oxidize 1 mol of NADH in one minute. All enzyme activities were determined in triplicate,
µ
mol of NAD+ in one
µ
and standard deviations of the biological replicates were represented by error bars. The protein
concentration was determined by the Bradford method using bovine serum albumin as the standard.

Molecules 2018, 23, 691
13 of 15
3.7. Product Analysis
The samples in the bioconversion reactions were centrifuged at 10,000
×
g for 5 min.
The concentration of acetoin and 2,3-butanediol in the supernatant was analyzed by a GC system
(Agilent 7820A, Santa Clara, CA, USA), but before GC analysis, the supernatant was extracted by
ethyl acetate with the addition of n-butanol as the internal standard. The GC system consisted of
a FID detector and a chiral column (Supelco β-DE 120, 30-m length, and 0.25-mm inner diameter;
Sigma-Aldrich). The operation conditions were as follows: N2 was used as the carrier gas at a flow
rate of 1.2 mL/min; the injector temperature and the detector temperature were 215 ◦C and 245 ◦C,
respectively; an◦d the column temperature was maintained at 50 ◦C for 1.5 min, then raised to 180 ◦C
at a rate of 15 C/min. The concentration of acetoin and 2,3-butanediol in the supernatant was
determined using standard curves [5,35].
4. Conclusions
In summary, a novel E. coli (pET-rrbdh-nox-vgb) biocatalyst was developed for efficiently
catalyzing the stereospecific oxidation of meso-2,3-butanediol to (3S)-acetoin. Maximum (3S)-acetoin
concentration of 72.38 g/L with the productivity of 3.02 g/L/h and stereoisomeric purity of 94.65%
was obtained by induced E. coli (pET-rrbdh-nox-vgb) cells under optimal conditions. Subsequently,
the strategy of synchronous catalysis was established for efficient (2S,3S)-2,3-butanediol production
from meso-2,3-butanediol via (3S)-acetoin as an intermediate through using two biocatalysts
of E. coli (pET-rrbdh-nox-vgb) and E. coli (pET-ssbdh-fdh). Under optimal conditions, 38.41 g/L
(2S,3S)-2,3-butanediol with stereoisomeric purity of 98.03% was achieved from 40 g/L 2,3-butanediol
by synchronous catalysis. These results suggested that biocatalysis was a powerful and effective
strategy for the production of enantiomerically pure building blocks that cannot be achieved through
chemical and fermentation processes.
Acknowledgments: This work was supported by the National Natural Science Foundation of China
(No. 81673542), New Century Excellent Talents Supporting Plan of the Provincial Education Department of
Fujian Province of China (No. K8015056A), and the Outstanding Youth Fund of Fujian Agriculture and Forestry
University (No. xjq201412).
Author Contributions: Jun Yuan, Liaoyuan Zhang, and Yunlong Yang conceived and designed the experiments.
Yuanzhi He and Huifang Gao developed the two biocatalysts. Feixue Chen, Meijing Sun, and Zewang Guo
performed enzyme assays and biocatalytic experiments. Hui Lin and Jiebo Chen performed GC analysis.
All authors analyzed the data. Liaoyuan Zhang, Jun Yuan and Wensong Jin wrote and edited the manuscript.
All authors have read and approved the manuscript for publication.
Conflicts of Interest: The authors declare no competing financial interest.
References
1.
2.
3.
Celinska, E.; Grajek, W. Biotechnological production of 2,3-butanediol current state and prospects.
Biotechnol. Adv. 2009, 27, 715–725. [CrossRef] [PubMed]
Ji, X.; Huang, H.; Ouyang, P. Microbial 2,3-butanediol production: A state-of-the-art review. Biotechnol. Adv.
2011, 29, 351–364. [CrossRef] [PubMed]
Gao, C.; Zhang, L.; Xie, Y.; Hu, C.; Zhang, Y.; Li, L.; Wang, Y.; Ma, C.; Xu, P. Production of (3S)-acetoin
from diacetyl by using stereoselective NADPH-dependent carbonyl reductase and glucose dehydrogenase.
Bioresoure Technol. 2013, 137, 111–115. [CrossRef] [PubMed]
4.
5.
6.
Zhang, L.; Liu, Q.; Ge, Y.; Li, L.; Gao, C.; Xu, P.; Ma, C. Biotechnological production of acetoin, a biobased
platform chemical, from a lignocellulosic resource by metabolically engineering Enterobacter cloacae.
Green Chem. 2015, 18, 1560–1570. [CrossRef]
Zhang, L.; Xu, Q.; Zhan, S.; Li, Y.; Lin, H.; Sun, S.; Sha, L.; Hu, K.; Guan, X.; Shen, Y. A new
NAD(H)-dependent meso-2,3-butanediol dehydrogenase from an industrially potential strain Serratia
marcescens H30. Appl. Microbiol. Biotechnol. 2014, 98, 1175–1184. [CrossRef] [PubMed]
Ge, Y.; Li, K.; Li, L.; Gao, C.; Zhang, L.; Ma, C.; Xu, P. Contracted but effective: Production of enantiopure
2,3-butanediol by thermophilic and GRAS Bacillus licheniformis. Green Chem. 2016, 18, 4693–4703. [CrossRef]

Molecules 2018, 23, 691
14 of 15
7.
Guo, Z.; Zhao, X.; He, Y.; Yang, T.; Gao, H.; Li, G.; Chen, F.; Sun, M.; Lee, J.; Zhang, L. Efficient
(3R)-acetoin production from meso-2,3-butanediol using a new whole-cell biocatalyst with co-expression of
meso-2,3-butanediol dehydrogenase, NADH oxidase, and Vitreoscilla hemoglobin. J. Microbiol. Biotechnol.
2017, 27, 92–100. [CrossRef] [PubMed]
8.
9.
Zhang, L.; Raushan, S.; Sivakumar, D.; Guo, Z.; Li, J.; Chen, F.; He, Y.; Guan, X.; Kang, Y.; Lee, J. An artificial
synthetic pathway for acetoin, 2,3-butanediol, and 2-butanol production from ethanol using cell free
multi-enzyme catalysis. Green Chem. 2018, 20, 230–242. [CrossRef]
Mao, Y.; Fu, J.; Tao, R.; Huang, C.; Wang, Z.; Tang, Y.; Chen, T.; Zhao, M. Systematic metabolic engineering of
Corynebacterium glutamicum for the industrial-level production of optically pure D-(
2017, 19, 5691–5702. [CrossRef]
−
)-acetoin. Green Chem.
10. Yang, T.; Rathnasingh, C.; Lee, H.; Seung, D. Identification of acetoin reductases involved in 2,3-butanediol
pathway in Klebsiella oxytoca. J. Biotechnol. 2014, 172, 59–66. [CrossRef] [PubMed]
11. Rao, B.; Zhang, L.; Sun, J.; Su, G.; Wei, D.; Chu, J.; Zhu, J.; Shen, Y. Characterization and regulation of the
2,3-butanediol pathway in Serratia marcescens. Appl. Microbiol. Biotechnol. 2012, 93, 2147–2159. [CrossRef]
[PubMed]
12. Chen, C.; Wei, D.; Shi, J.; Wang, M.; Hao, J. Mechanism of 2,3-butanediol stereoisomer formation in
Klebsiella pneumoniae. Appl. Microbiol. Biotechnol. 2014, 98, 4603–4613. [CrossRef] [PubMed]
13. Zhang, L.; Guo, Z.; Chen, J.; Xu, Q.; Lin, H.; Hu, K.; Guan, X.; Shen, Y. Mechanism of 2,3-butanediol
stereoisomers formation in a newly isolated Serratia sp. T241. Sci. Rep. 2016, 6, 19257. [CrossRef] [PubMed]
14. Xu, Q.; Xie, L.; Li, Y.; Lin, H.; Sun, S.; Guan, X.; Hu, K.; Shen, Y.; Zhang, L. Metabolic engineering of
Escherichia coli for efficient production of (3R)-acetoin. J. Chem. Technol. Biotechnol. 2015, 90, 93–100.
[CrossRef]
15. Li, L.; Li, K.; Wang, Y.; Chen, C.; Xu, Y.; Zhang, L.; Han, B.; Gao, C.; Tao, F.; Ma, C.; et al. Metabolic
engineering of Enterobacter cloacae for high-yield production of enantiopure (2R,3R)-2,3-butanediol from
lignocellulose-derived sugars. Metab. Eng. 2015, 28, 19–27. [CrossRef] [PubMed]
16. Qiu, Y.; Zhang, J.; Li, L.; Wen, Z.; Nomura, C.; Wu, S.; Chen, S. Engineering Bacillus licheniformis for the
production of meso-2,3-butanediol. Biotechnol. Biofuels 2016, 9, 117. [CrossRef] [PubMed]
17. Chu, H.; Xin, B.; Liu, P.; Wang, Y.; Li, L.; Liu, X.; Zhang, X.; Ma, C.; Xu, P. Metabolic engineering of
Escherichia coli for production of (2S,3S)-butane-2,3-diol from glucose. Biotechnol. Biofuels 2015, 8, 143.
[CrossRef] [PubMed]
18. Zhang, L.; Zhang, Y.; Liu, Q.; Meng, L.; Hu, M.; Lv, M.; Li, K.; Gao, C.; Xu, P.; Ma, C. Production of diacetyl
by metabolically engineered Enterobacter cloacae. Sci. Rep. 2015, 5, 9033. [CrossRef] [PubMed]
19. Li, L.; Wang, Y.; Zhang, L.; Ma, C.; Wang, A.; Tao, F.; Xu, P. Biocatalytic production of (2S,3S)-2,3-butanediol
from diacetyl using whole cells of engineered Escherichia coli. Bioresource Technol. 2011, 115, 111–116.
[CrossRef] [PubMed]
20. Wang, Y.; Li, L.; Ma, C.; Gao, C.; Tao, F.; Xu, P. Engineering of cofactor regeneration enhances
(2S,3S)-2,3-butanediol production from diacetyl. Sci. Rep. 2013, 3, 2643. [CrossRef] [PubMed]
21. Gao, C.; Zhang, L.; Xie, Y.; Hu, C.; Zhang, Y.; Li, L.; Wang, Y.; Ma, C.; Xu, P. Production of (3S)-acetoin
from diacetyl by using stereoselective NADPH-dependent carbonyl reductase and glucose dehydrogenase.
Bioresour. Technol. 2013, 137, 111–115. [CrossRef] [PubMed]
22. Yu, B.; Sun, J.; Bommareddy, R.; Song, L.; Zeng, A. Novel (2R,3R)-2,3-butanediol dehydrogenase from
potential industrial strain Paenibacillus polymyxa ATCC 12321. Appl. Environ. Microbiol. 2011, 77, 4230–4233.
[CrossRef] [PubMed]
23. Xiao, Z.; Lv, C.; Gao, C.; Qin, J.; Ma, C.; Liu, Z.; Liu, P.; Li, L.; Xu, P. A novel whole-cell biocatalyst with
NAD+ regeneration for production of chiral chemicals. PLoS ONE 2010, 5, e8860. [CrossRef] [PubMed]
24. Geckil, H.; Barak, Z.; Chipman, D.; Erenler, S.; Webster, D.; Stark, B. Enhanced production of acetoin and
butanediol in recombinant Enterobacter aerogenes carrying Vitreoscilla hemoglobin gene. Bioprocess Biosyst. Eng.
2004, 26, 325–330. [CrossRef] [PubMed]
25. Horng, Y.; Chang, K.; Chien, C.; Wei, Y.; Sun, Y.; Soo, P. Enhanced polyhydroxybutyrate (PHB) production
via the coexpressed phaCAB and vgb genes controlled by arabinose P promoter in Escherichia coli.
Lett. Appl. Microbiol. 2010, 50, 158–167. [CrossRef] [PubMed]

Molecules 2018, 23, 691
15 of 15
26. Gao, J.; Xu, Y.; Li, F.; Ding, G. Production of S-acetoin from diacetyl by Escherichia coli transformant cells that
express the diacetyl reductase gene of Paenibacillus polymyxa ZJ-9. Lett. Appl. Microbiol. 2013, 57, 274–281.
[PubMed]
27. Yu, M.; Huang, M.; Song, Q.; Shao, J.; Ying, X. Characterization of a (2R,3R)-2,3-Butanediol Dehydrogenase
from Rhodococcus erythropolis WZ010. Molecules 2015, 20, 7156–7173. [CrossRef] [PubMed]
28. Zhang, L.; Yang, Y.; Sun, J.; Shen, Y.; Wei, D.; Zhu, J.; Chu, J. Microbial production of 2,3-butanediol by
a mutagenized strain of Serratia marcescens H30. Bioresource Technol. 2010, 101, 1961–1967. [CrossRef]
[PubMed]
29. Zhang, L.; Sun, J.; Hao, Y.; Zhu, J.; Chu, J.; Wei, D.; Shen, Y. Microbial production of 2,3-butanediol by
a surfactant (serrawettin)-deficient mutant of Serratia marcescens H30. J. Ind. Microbiol. Biotechnol. 2010, 37,
857–862. [CrossRef] [PubMed]
30. Otagiri, M.; Ui, S.; Takusagawa, Y.; Ohtsuki, T.; Kurisu, G.; Kusunoki, M. Structural basis for chiral substrate
recognition by two 2,3-butanediol dehydrogenases. FEBS Lett. 2010, 584, 219–223. [CrossRef] [PubMed]
31. Park, J.; Hong, W.; Lee, S.; Heo, S.; Jung, Y.; Kang, I.; Oh, B.; Seo, J.; Kim, C. Identification and characterization
of a short-chain acyl dehydrogenase from Klebsiella pneumoniae and its application for high-level production
of L-2,3-butanediol. J. Ind. Microbiol. Biotechnol. 2014, 41, 1425–1433. [CrossRef] [PubMed]
32. Wang, Z.; Song, Q.; Yu, M.; Wang, Y.; Xiong, B.; Zhang, Y.; Zheng, J.; Ying, X. Characterization of
a stereospecific acetoin (diacetyl) reductase from Rhodococcus erythropolis WZ010 and its application for the
synthesis of (2S,3S)-2,3-butanediol. Appl. Microbiol. Biotechnol. 2014, 98, 641–650. [CrossRef] [PubMed]
33. Spieler, V.; Valldorf, B.; Maaß, F.; Kleinschek, A.; Hüttenhain, S.; Kolmar, H. Coupled reactions on bioparticles:
Stereoselective reduction with cofactor regeneration on PhaC inclusion bodies. Biotechnol. J. 2016, 11, 890–898.
[CrossRef] [PubMed]
34. Zhang, Y.; Tiwari, M.; Gao, H.; Dhiman, S.; Jeya, M.; Lee, J. Cloning and characterization of a thermostable
H2O-forming NADH oxidase from Lactobacillus rhamnosus. Enzym. Microb. Technol. 2012, 50, 255–262.
[CrossRef] [PubMed]
35. Zhang, L.; Xu, Q.; Peng, X.; Xu, B.; Wu, Y.; Yang, Y.; Sun, S.; Hu, K.; Shen, Y. Cloning, expression and
characterization of glycerol dehydrogenase involved in 2,3-butanediol formation in Serratia marcescens H30.
J. Ind. Microbiol. Biotechnol. 2014, 41, 1319–1327. [CrossRef] [PubMed]
Sample Availability: Samples of the compounds are not available from the authors.
©
2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).