Triazole-linked inhibitors of inosine monophosphate dehydrogenase from human and mycobacterium tuberculosis

Article abstract of DOI:10.1021/jm100424m

The modular nature of nicotinamide adenine dinucleotide (NAD)-mimicking inosine monophsophate dehydrogenase (IMPDH) inhibitors has prompted us to investigate novel mycophenolic adenine dinucleotides (MAD) in which 1,2,3-triazole linkers were incorporated

Full text of DOI:10.1021/jm100424m

4768 J. Med. Chem. 2010, 53, 4768–4778
DOI: 10.1021/jm100424m
Triazole-Linked Inhibitors of Inosine Monophosphate Dehydrogenase from Human and
Mycobacterium tuberculosis
Liqiang Chen,* Daniel J. Wilson, Yanli Xu, Courtney C. Aldrich, Krzysztof Felczak, Yuk Y. Sham, and
Krzysztof W. Pankiewicz
Center for Drug Design, Academic Health Center, University of Minnesota, 516 Delaware Street SE, Minneapolis, Minnesota 55455
Received April 6, 2010
The modular nature of nicotinamide adenine dinucleotide (NAD)-mimicking inosine monophsophate
dehydrogenase (IMPDH) inhibitors has prompted us to investigate novel mycophenolic adenine
dinucleotides (MAD) in which 1,2,3-triazole linkers were incorporated as isosteric replacements of
the pyrophosphate linker. Synthesis and evaluation of these inhibitors led to identification of low
nanomolar inhibitors of human IMPDH and more importantly the first potent inhibitor of IMPDH
from Mycobacterium tuberculosis (mtIMPDH). Computational studies of these IMPDH enzymes
helped rationalize the observed structure-activity relationships. Additionally, the first cloning,
expression, purification and characterization of mtIMPDH is reported.
Introduction
people, is infected with TB. The emergence of multidrug and
extensively drug resistant TB strains represents a serious and
unsolved public health problem that requires the identifica-
tion of drugs, ideally with new mechanisms of action.
Nicotinamide adenine dinucleotide (NADa)-dependent in-
osine monophosphate dehydrogense (IMPDH), which con-
verts inosine monophosphate (IMP) into xanthosine mono-
phosphate (XMP), is a key enzyme in the de novo synthesis of
guanine nucleotides. Inhibition of IMPDH depletes the sup-
ply of guanine nucleotides that are required for the growth
and proliferation of cells and constitutes a powerful strategy
for the treatment of cancers and autoimmune diseases, as well
as viral, protozoal, and bacterial infections.1 There are two
human IMPDH isoforms, hIMPDH1 and hIMPDH2, with
high (84%) sequence similarity. The hIMPDH1, long consid-
ered as a house-keeping enzyme, is involved in diverse biolo-
gical processes such as angiogenesis,2 translation regulation,3
and DNA-binding.4 By contrast, the hIMPDH2 is up-regu-
lated in cancer cells, representing an attractive anticancer
target.5,6 IMPDH from nonhuman species, such as parasites
and microbes, has received growing attention as potential
targets for antimicrobial drug discovery. For instance, potent
inhibitors of Cryptosporidium parvum IMPDH have been
recently discovered through high-throughput screening and
selected hits have been subjected to structure-activity analy-
sis.7,8 IMPDH from Mycobacterium tuberculosis (Mtb) has
been proposed as a potential target to combat tuberculosis
(TB).9-11 The World Health Organization (WHO) has estimated
that one-third of the world’s population, nearly 2 billion
The enzymatic mechanism of hIMPDH has been exten-
sively studied and is illustrated in Scheme 1.1,12 After binding
of the substrates IMP and NAD, a covalent thioimidate
enzyme-substrate adduct with IMP (E-IMP) is formed with
concomitant production of NADH. After dissociation of
NADH, the thioimidate complex (E-IMP) is hydrolyzed to
afford the product XMP. Both the substrate (IMP) binding
site and the cofactor (NAD) binding domain have been
targeted for the rational development of IMPDH inhibitors.
Inhibitors that target the NAD binding site can interact with
the three subsites of the cofactor binding domain; the nicoti-
namide binding subsite (N-subsite), the adenosine binding
subsite(A-subsite), andthe pyrophosphate bindingsubsite(P-
subsite). Mycophenolic acid (1, MPA, Figure 1) is a clinically
used IMPDH inhibitor that binds to the N-subsite as well as a
portion of the P-subsite. Tiazofurin (2, TR) is another well-
known IMPDH inhibitor that is bioactivated into the corre-
spondingtiazofurinadenine dinucleotide (TAD) and interacts
with all three subsites of the NAD cofactor binding domain.
We have previously described a series of mycophenolic
adenine dinucleotide (MAD) as potent IMPDH inhibitors
such as C2-MAD and its analogues (3a-c, Figure 2) and C4-
MAD (4, Figure 2) that contain methylenebis(phosphonates)
as isosteres of the metabolically labile pyrophosphate moiety
of NAD.13-15 These modular inhibitors interact with all three
of the N-, A-, and P-subsites. In efforts to replace the negatively
charged methylenebis(phosphonate) linkers in these com-
pounds, we recently reported the synthesis of analogues con-
taining a nonionic methylenebis(sulfonamide) linker (5a-d,
Figure 3).16,17 Significantly, the methylenebis(sulfonamide)
MAD analogues 5a-d showed potency against hIMPDH
comparable to that of compound 3a, demonstrating the re-
markable promiscuity of the P-subsite. This finding prompted
*To whom correspondence should be addressed. Phone: 612-624-
2575. Fax: 612-624-8154. E-mail: chenx462@umn.edu.
aAbbreviations: NAD, nicotinamide adenine dinucleotide; IMPDH,
inosine monophsophate dehydrogenase; IMP, inosine monophosphate;
XMP; xanthosine monophosphate; hIMPDH, human inosine mono-
phsophate dehydrogenase; mtIMPDH, Mycobacterium tuberculosis
inosine monophsophate dehydrogenase; TB, tuberculosis; MPA, myco-
phenolic acid; TAD, tiazofurin adenine dinucleotide; MAD, mycophe-
nolic adenine dinucleotide; SAR, structure-activity relationship; CuAAC,
copper-(I)-catalyzed azide-alkyne cycloaddition; SEM, 2-(trimethylsilyl)-
ethoxymethyl; TFA, trifluoroacetic acid; NMR, nuclear magnetic reso-
nance; NOE, nuclear overhauser effect.
r
pubs.acs.org/jmc
Published on Web 05/19/2010
2010 American Chemical Society

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 12 4769
Scheme 1a
a RP, ribofuranosyl-50-monophosphate; IMP, inosine monophosphate; Enz, enzyme; E-IMP, IMP/IMPDH adduct; E-XMP*, IMPDH/XMP
thioimidate intermediate; XMP, xanthosine monophosphate.
between an azide and an alkyne, allowing preparation of the
requisite triazoles in a highly convergent fashion.8,18-20 This
approach would enable us to expeditiously probe the factors
that influence the potency and isoform selectivity of IMPDH
inhibitors that target human enzymes as well as those from
other species.
Preparation of compound 6 began with aldehyde 1017
wherein the phenol was protected as a 2-(trimethylsilyl)-
ethoxymethyl (SEM) ether. Reductive amination of propar-
Figure 1. IMPDH inhibitors.
gylamine and aldehyde 10 afforded alkyne 11 (Scheme 2).
CuAAC coupling reaction between alkyne 11 and 50-azido-
us to explore 1,2,3-triazole as a nonionic bioisosteric replace-
ment of the methylenebis(phosphonate) linker in compound
3a, and we predicted that these triazole linkers would maintain
50-deoxy-20,30-O-isopropylidene adenosine 1221 yielded pro-
tected triazole 13. Removal of the SEM and isopropylidene
the overall geometric positioning of the mycophenolic and
protecting groups was accomplished with 80% aqueous
adenosine moieties in their respective N- and A-subsites within
IMPDH.
TFA to provide target compound 6. Compound 7 was
prepared from aldehyde 1414 that was first protected under
phase-transfer catalysis conditions22 to give protected alde-
Herein we report the design and synthesis of a novel series
of triazole-linked mycophenolic adenine inhibitors as NAD
mimics. These inhibitors were biochemically evaluated
hyde 15 with a side chain longer that of aldehyde 10. In
analogy to the preparation of compound 6, homologated
against both human IMPDH isoforms as well as the Myco-
aldehyde 15 was further elaborated to give compound 7
bacterium tuberculosis IMPDH. Additionally, we describe the
(Scheme 3).
first cloning, expression, purification, and characterization of
For the synthesis of compound 8, aldehyde 10 was con-
M. tuberculosis IMPDH (mtIMPDH). Molecular docking
verted to azide 19 through a three-step process involving
of these compounds into the reported crystal structures of
reduction to alcohol 18 followed by mesylation and subse-
hIMPDHs, and a homology model of mtIMPDH was used to
quent nucleophilic displacement with sodium azide. The
rationalize the observed structure-activity relationships
alkyne coupling partner was prepared by debenzoylation
(SAR).
of N-benzoyl-20,30-O-isopropylidene-50-O-propargyl adeno-
sine (20), which was prepared as previously described
Results and Discussion
(Scheme 4).23 CuAAC reaction between azide 19 and 20,30-
Design and synthesis. We designed a series of novel tria-
zole-linked IMPDH inhibitors containing aminomethyl-
1,2,3-triazole or oxymethyl-1,2,3-triazole moieties, which
serve as a conformationally constrained bioisosteric replace-
ment of the pyrophosphate linker (Figure 4). As shown
in Figure 4, compound 6 could be considered a truncated
MPA derivative wherein a two-carbon side chain was
attached to adenosine via an aminomethyl-1,2,3-triazole
linker. In compound 7 a four-carbon side chain was incor-
porated, a design based on our previous observation that
compound 4 showed inhibitory activity similar to that of
compound 3a. In compounds 8 and 9, an oxymethyl-1,2,3-
triazole linker was used, with an ether linkage at the 50 posi-
tion of adenosine.
Our modeling studies (vide infra) based on the crystal
structure of compound 3a/hIMPDH2 complex indicated
that compound 3a analogues containing a rigid 1,2,3-triazole
ring were accommodated in the P-subsite of IMPDH. In
addition, the 1,4-substitution pattern of the triazole ring pro-
jects the truncated MPA subunit and adenosine motifs into
their respective N- and A-subsites. Furthermore, a 1,2,3-
triazole linker can be prepared through a copper-(I)-cataly-
zed azide-alkyne cycloaddition (CuAAC) coupling reaction,
which involves a highly efficient and chemoselective coupling
O-isopropylidene-50-O-propargyl adenosine (21) catalyzed
by Cu (I) in a mixture of tert-butyl alcohol and water
afforded protected triazole 22. Removal of the SEM and
isopropylidene protecting groups with aqueous TFA furni-
shed compound 8.
As depicted in Scheme 5, compound 9 was prepared in an
analogous fashion from azide 24 and alkyne 21. The azide
coupling partner was prepared from aldehyde 15 by sequen-
tial reduction to alcohol 23, mesylation, and azidation to
afford 24. The resulting azide 24 comprised an approxi-
mately 6:3:1 mixture of allylic azides in chloroform as judged
by 1H NMR. Careful examination of the spectrum revealed
the existence of two terminal azides which accounted for
60% and 10% of the mixture, respectively, presumably
favoring azide 24 with the Z geometry of the double bond.
This observation indicated that facile [3,3]-sigmatropic
rearrangement24-26 of allylic azide 24 not only shifted the
position of azido group but also compromised the geometry
of the double bond, resulting in a mixture of allylic azides in
rapid equilibrium. Azide 24 and its allylic isomers were
subjected to a CuAAC reaction with alkyne 21 to provide a
mixture of isomeric triazoles 25, which could not be sepa-
rated. After deprotection with aqueous TFA, the desired
compound 9 was successfully purified as a single isomer by

4770 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 12
Chen et al.
Figure 2. Compounds 3a, 4, and methylenebis(phosphonate) analogues.
To simplify purification of hIMPDH1 and hIMPDH2, the
corresponding plasmids pH1 and pHIA5 (generously pro-
vided by Prof. Liz Hedstrom) were subcloned into pDEST-
HisMBP to generate expression constructs containing TEV-
cleavable N-terminal (His)6-tagged MBP fusion proteins,
which were overexpressed as described in the Experimental
Section. Both hIMPDH1 and hIMPDH2 were purified by
standard immobilized metal affinitychromatography, and the
N-terminal (His)6-tagged maltose binding protein (MBP)
fusions were cleaved with TEV protease to afford wild-type
hIMPDH1 and hIMPDH2 that possessed catalytic activity
commensurate with the reported values.27,28
Figure 3. Mycophenolic adenine methylenebis(sulfonamide)s.
Biochemical Evaluation. Triazole-linked MAD analogues
6-9 were evaluated as inhibitors of hIMPDH1 and hIMPDH2
(Table 2). Compound 6 was a modest inhibitor of both iso-
forms with low micromolar Kiapp values. However compound
7, which has a longer side chain, was found to be a potent nano-
molar inhibitor with Kiapp values against the type 1 and the
type 2 isoform approximately 180- and 60-fold lower, respec-
tively, than those for compound 6. This finding differs from our
previous observation that a shorter compound 3a (Figure 2)
was nearly as equipotent as the corresponding longer com-
pound 4. Compound 8, which contains an oxymethyltriazole
linker, was 10-fold more potent than compound 6in spite of the
fact that both compounds are almost identical in the overall
length. Furthermore, compound 9 showed increased potency
over the corresponding shorter analogue 8, albeit to an extent
much lower than the enhancement observed for compound 7
versus 6. Interestingly, compounds 7 and 9 shared almost iden-
tical activity against either hIMPDH1 or hIMPDH2.
These findings indicate that the linker length is a key factor
that influences the activity against hIMPDHs. This trend was
not unexpected, as previous studies have demonstrated that
NAD binds to hIMPDHs in an extended conformation. This
preferred binding mode could account for the activity ob-
served for compounds 6-9, which were designed to mimic
NAD, the natural substrate. It was expected that a rigid
1,2,3-triazole ring substituted at the 1 and 4 positions would
allow for a desired fitting of the mycophenolic derivative and
adenosine moieties in their respective N- and A-subsites of
the human enzymes. Conceivably, the adenine ring of our
triazole-linked inhibitors is sandwiched between aromatic
residues H253 and F282 of hIMPDH2 in the A-subsite as it
was found in the crystal structures of the complexes of com-
pound 3a/hIMPDH2 and NAD/hIMPDH2. Not surpris-
ingly, compounds 7 and 9 showed increased activity in
comparison with compounds 6 and 8, respectively, because
7 and 9 resemble very well the length of NAD.
trituration with hot methanol. Because the geometry of the
trisubstituted Z-olefin in the precursor azide 24 had been
compromised by the allylic rearrangement, we performed
nuclear overhauser effect (NOE) experiments on the final
compound 9. Selective NOE interactions are shown in
Figure 6. The allylic methyl protons showed a correlation
with protons attached to methylene carbon a while a correla-
tion was observed between the vinylic proton and protons on
methylene carbon b, confirming the Z geometry of the
double bond as shown in compound 9.
Cloning, Expression, and Purification of mtIMPDH,
hIMPDH1, and hIMPDH2. The three IMPDH paralogs
guaB1, guaB2, and guaB3 were annotated in the genome of
Mycobacterium tuberculosis by Cole and co-workers.9 The
guaB2 gene was identified as essential by Himar1-based
transposon mutagenesis in M. tuberculosis H37Rv, whereas
guaB1 was identified as nonessential and guaB3 was not
studied.10 The guaB2 gene was amplified by PCR from
M. tuberculosis H37Rv genomic DNA then cloned into
pET28b to generate a N-terminal (His)6-tagged fusion protein
and overexpressed and purified as described in the Experi-
mental Section.
Apparent steady-state kinetic parameters of mtIMPDH
were determined for both NAD and IMP (Table 1). Because
of the reduced rates observed at high NAD concentrations,
the kinetic data were fit to a substrate-inhibited model to
provide a KM and kcat of 1005 μM and 0.53 s-1 for NAD at
saturating concentrations of IMP, respectively. The sub-
strate inhibition constant, Ki, was 5.0 mM for NAD, which
is 5-fold higher than the KM value. By comparison, the Ki of
NAD with respect to hIMPDH2 was reported as 590 μM,
which is approximately 100-fold higher than the respective
KM value for NAD.27 The KM of 78 μM for IMP was
determined at subsaturating concentrations of NAD due to
substrate inhibition by NAD, and the kinetic data were fit to
the Michaelis-Menten model (Figure 5). The kcat for
mtIMPDH is similar to the values for hIMPDH1 and
hIMPDH2. However, the KM (IMP) for mtIMPDH is 4-20-
fold higher than the human enzymes, while the KM(NAD) for
mtIMPDH is 14- and 168-fold higher than hIMPDH1 and
hIMPDH2, respectively.
In addition to the importance of linker length, the charge
state in the linker region can also affect the activity. The
aminomethyl 1,2,3-triazole linker present in compounds 6
and 7 was expected to bind to the P-groove that is occupied
by the negatively charged pyrophosphate moiety of NAD.

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 12 4771
Figure 4. Triazole-linked MAD analogues.
Scheme 2a
Scheme 4a
a Reagents and conditions: (a) propargylamine, NaBH(OAc)3, HOAc,
a Reagents and conditions: (a) (i) MsCl, Et3N, THF, 0 °C, (ii) NaN3,
dichloroethane, 86%; (b) CuSO4 5H2O, sodium ascorbate, tBuOH/H2O
(1:1), 77%; (c) 80% (v/v) TFA, H2O, 86%.
3
DMF, 80 °C, 37% for 2 steps; (b) NH3, MeOH, 92%; (c) CuSO4 5H2O,
3
sodium ascorbate, tBuOH/H2O (1:1), 86%; (d) 80% (v/v) TFA, H2O, 48%.
Scheme 3a
Scheme 5a
a Reagents and conditions: (a) NaBH4, CeCl3 7H2O, MeOH, H2O,
3
a Reagents and conditions: (a) SEMCl, Adogen 464, NaOH, CH2Cl2/
H2O (1:1), 88%; (b) propargylamine, NaBH(OAc)3, HOAc, dichloro-
57%; (b) (i) MsCl, Et3N, THF, 0 °C, (ii) NaN3, DMF, 60 °C, 85% for 2
steps; (c) CuSO4 5H2O, sodium ascorbate, tBuOH/H2O (1:1); (d) 80%
(v/v) TFA, H2O, 5% for 2 steps.
3
t
ethane, 65%; (c) CuSO4 5H2O, sodium ascorbate, BuOH/H2O (1:1),
3
64%; (d) 80% (v/v) TFA, H2O, 80%.
Therefore, it is reasonable to speculate that a positive charge
that is generated through a protonation of the secondary
amine present in compound 6 might cause unfavorable
interactions with surrounding amino acid residues. How-
ever, in compound 7, an elongation of the linker might
position the proposed positive charge in such a way that it
now could not disturb the ligand-enzyme interactions,
leading to a highly potent inhibitor. By contrast, in com-
pounds 8 and 9, the linker region is neutral under physiolo-
gical conditions. Under these circumstances, the linker length
determines the inhibitory activity, with compound 9 better
mimicking NAD and consequently a more active inhibitor.
Next, we evaluated compounds 6-9 and a panel of
IMPDH inhibitors previously developed in our laboratory

4772 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 12
Chen et al.
including MPA (1), methylenebis(phosphonate) MAD ana-
logues 3a-c, and methylenebis(sulfonamide) MAD analo-
gues 5a-c against mtIMPDH (Table 2). MPA was a weak
inhibitor with a Kiapp value of 62 μM. Nevertheless, com-
pound 3a and its analogues 3b-3c were completely inactive
against mtIMPDH even though they were all low nanomolar
inhibitors of hIMPDHs. Compound 3a analogues in which
the truncated MPA and adenosine are connected through a
methylenebis(sulfonamide) bridge (5a-d) also displayed no
activity against mtIMPDH. Among the triazole derivatives
6-9, only 9 displayed significant inhibition. Further char-
acterization of compound 9 was performed to determine its
mode of inhibition by varying each substrate with the other
substrate maintained at a fixed concentration (Figure 7).
Compound 9 displayed uncompetitive inhibition with both
NAD and IMP providing Kiu values of 1.5 ( 0.1 and 2.2 (
0.1 μM, respectively. The observed inhibition modality
suggests that 9 has a strong preference for the E-XMP*
intermediate consistent with previous studies with mycophe-
nolic acid.1
modeled compound 3a/hMPDH1 complex. In contrast, in
the A-subsite of mtIMPDH, the adenine recognition site
consists of L291 and V261, both of which are incapable of
aromatic ring stacking with the adenine moiety. In addition,
the hydrophobic A-subsite appears to be shallower than
those of hIMPDHs (Figure 10), reducing its capacity to
accommodate the adenine ring. Taken together, these varia-
tions suggest that the adenine moiety fails to contribute
significantly to the binding affinity as has been observed in
hIMPDHs.
Furthermore, in the N-subsite of mtIMPDH, E458 exhi-
bits an unfavorable 1.5 kcal/mol toward compound 3a,
binding primarily through long-range electrostatic repul-
sions with the negatively charged methylenebis(phosphonate)
group in the P-subsite. In hIMPDH1 and hIMPDH2, the
neutral Q334 and Q441 lack such long-range repulsions but
Computational Modeling. To understand the binding se-
lectivity of hIMPDH1 and hIMPDH2 versus mtIMPDH,
compound 3a was modeled into the NAD binding sites of all
three IMPDHs with bound IMP (Figure 8). The per residue
interaction energy between compound 3a to individual
IMPDH residues within the NAD binding sites are shown
in Figure 9. Examination of the interactions revealed varia-
tions in the NAD binding domain that might account for
compound 3a’s lack of activity against mtIMPDH. First,
in the solved X-ray crystal structure of compound 3a/
hIMPDH2 complex, the adenine ring was involved in an
aromatic ring stacking between F282 and H253, which were
replaced by energetically similar Y282 and R253 in the
Figure 6. NOE correlations observed for compound 9.
Table 2. Biological Evaluations of IMPDH Inhibitors
Kiapp hIMPDH1
(μM)
Kiapp hIMPDH2
(μM)
Kiapp mtIMPDH
(μM)
compd
1
0.033a
0.33a
0.066a
0.016a
0.52b
0.35c
0.66c
0.52c
0.82c
14
0.007a
0.25a
0.11a
0.038a
0.38b
0.17c
0.31c
0.18c
0.44c
2.2
62
>100
>100
>100
>100
>100
>100
>100
>100
>100
>100
>100
1.5d (2.2)e
3a
3b
3c
4
5a
5b
5c
5d
6
Table 1. Michaelis-Menten Parameters for M. tuberculosis and Human
Type I and II IMPDH
kcat
(s-1
KM (IMP) KM (NAD) Ki (NAD)
(mM)
IMPDH
)
(μM)
(μM)
7
0.077
1.5
0.070
0.034
0.20
0.044
M. tuberculosis 0.53 ( 0.03
human-type 1
78 ( 6
17 ( 2a
4 ( 1b
1005 ( 95
70 ( 10a
6 ( 1b
5.0 ( 0.6
2.0 ( 0.6a
0.59 ( 0.02b
8
1.2 ( 0.4a
9
human-type 2
0.39 ( 0.01b
a Ref 15. b Ref 14. c Ref 17. d Uncompetitive Kiu vs NAD; e Uncompetitive
Kiu vs IMP.
a Ref 28. b Ref 27.
Figure 5. Steady-state kinetics of mtIMPDH. (A) Initial velocity vs [IMP]. Data were fit to the Michaelis-Menten equation. (B) Initial
velocity vs [NAD]. Data were fit to the Michaelis-Menten substrate inhibition equation. Each reaction contained mtIMPDH at 75 nM, 50 mM
Tris, pH 8.0, 100 mM KCl, 1 mM DTT, and either 3 mM NAD (for curve A) or 1 mM IMP (for curve B).

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 12 4773
Figure 7. Inhibition studies with 9. Initial rate data of variable amounts of inhibitor and either IMP (A) or NAD (B). The fixed substrate was
held at 100 μM for IMP and 500 μM for NAD. 9 was used at concentrations of 0 μM (b), 3.33 μM (O), and 10 μM (1). The inhibitor is
uncompetitive with respect to both substrates, with Ki(IMP) 2.2 ( 0.1 μM and Ki(NAD) 1.5 ( 0.1 μM.
Figure 9. Per residue interaction energy in kcal/mol between com-
pound 3a and IMPDH.
Figure 8. Comparison between the NAD binding sites of hIMPDHs
and mtIMPDH.
instead engage in favorable hydrogen bonding interactions
withthephenolichydroxylgroupofthe mycophenolic moiety.
In short, lack of aromatic stacking of the adenine moiety
together with unfavorable electrostatic interactions might
explain the inability of compound 3a and its analogues to
inhibit mtIMPDH.
Next, we examined compound 9 in an attempt to rationa-
lize its activity against mtIMPDH. While the variations in the
Figure 10. (A) Modeled mode of binding of compound 9 in
mtIMPDH. (B) Per residue interaction energy in kcal/mol between
compound 9 and mtIMPDH.
A- and N-subsites might render compound 3a inactive
against mtIMPDH, the residues in the P-subsite provide

4774 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 12
Chen et al.
key clues to the activity of compound 9. Because the 1,2,3-
triazole linker is neutral, the unfavorable electrostatic inter-
actions with compound 3a, which are elicited by E458 and
D283, are abrogated in the compound 9/mtIMPDH com-
plex. More importantly, the interactions in the P-subsites
contribute positively to the binding energy. Analysis of the
P-subsite of IMPDHs revealed that hIMPDHs have a
large and shallow region with a floor formed by S275 and
S276, which are important in the selective binding to the
methylenebis(phosphonate) linker in compound 3a. But in
mtIMPDH, these two serines are replaced by T284 and
A285, respectively. The methyl groups of T284 and A285
create an extension of the hydrophobic binding pocket of the
N-subsite and allow favorable binding of the four-carbon
side of the mycophenolic moiety present in compound 9.
In short, a neutral linker such as 1,2,3-triazole induces
favorable interactions and concomitantly avoids undesired
charge-charge interactions with mtIMPDH. The gain of
energy could potentially offset the loss of energy due to
the absence of π-π stacking in the A-subsite and the hydro-
gen bonding in the P-subsite, leading to compound 9 as
a potent inhibitor of mtIMPDH. Therefore, it is reason-
able to speculate that the electronic nature and proper
positioning of the linker, especially the mycophenolic side
chain portion, represent promising elements for further
chemical modifications in order to enhance the selectivity
against mtIMPDH.
Experimental Section
General Methods. All commercial reagents (Sigma-Aldrich,
Acros) were used as provided unless otherwise indicated. An
anhydrous solvent dispensing system (J. C. Meyer) using two
packed columns of neutral alumina was used for drying THF,
Et2O, and CH2Cl2, while two packed columns of molecular sieves
were used to dry DMF. Solvents were dispensed under argon.
Flash chromatography was performed with Ultra Pure silica gel
(Silicycle) withtheindicatedsolventsystem. AnalyticalHPLCwas
performed on a Varian Microsorb column (C18, 5 μ, 4.6 mm ꢀ
250 mm) with a flow rate of 0.5 mL/min. All target compounds
possessed a purity of greater than 95% as determined by HPLC.
Nuclear magnetic resonance spectra were recorded on a Varian
600 MHz with Me4Si or signals from residual solvent as the
1
internal standard for H. Chemical shifts are reported in ppm,
and signals are described as s (singlet), d (doublet), t (triplet),
q (quartet), m (multiplet), bs (broad singlet), and dd (double
doublet). Values given for coupling constants are first order. High
resolution mass spectra wererecorded on an Agilent TOF IITOF/
MS instrument equipped with either an ESI or APCI interface.
5-Methoxy-4-methyl-6-(2-(prop-2-yn-1-ylamino)ethyl)-7-((2-
(trimethylsilyl)ethoxy)methoxy)isobenzofuran-1(3H)-one (11). A
solution of aldehyde 1017 (450 mg, 1.23 mmol), propargylamine
(0.12 mL. 1.9 mmol), NaB(OAc)3H (785 mg, 3.70 mmol), and
HOAc (70 μL, 1.2 mmol) in dry dichloroethane (10 mL) was
allowed to stir at rt for 4 h. After addition of NaHCO3 (840 mg),
the mixture was stirred for 30 min and then diluted with CH2Cl2
(30 mL) and H2O (10 mL). The organic layer was separated and
concentrated. The residue was purified by silica gel column
chromatography (2%/6% MeOH/CH2Cl2) to give alkyne 11 as
a yellow syrup (432 mg, 86%). 1H NMR (CDCl3, 600 MHz) δ
5.41 (s, 2H), 5.12 (s, 2H), 3.85 (t, J = 8.4 Hz, 2H), 3.81 (s, 3H),
3.44 (d, J = 1.8 Hz, 2H), 2.96-2.92 (m, 4H), 2.21-2.16 (m, 4H),
0.98 (t, J = 8.4 Hz, 2H), 0.02 (s, 9H). HRMS calcd for C21H32-
NO5Si 406.2044 (M þ H)þ, found 406.2074.
Conclusions
Our earlier studies on IMPDH inhibitors that bind at the
cofactor binding domain have indicated that these NAD
mimics can be divided into three modules, targeting the N-,
A-, and P-subsites, respectively. We have also demonstrated
these three modules can be modified and optimized individu-
ally. In this study, we have shown that a 1,4-disubstituted
1,2,3-triazole can mimic the natural pyrophosphate moiety
in NAD, resulting in compounds 6-9 that possessed potent
activity against human IMPDHs. This finding further vali-
dates the premise that the P-subsite is relatively promiscuous
and can accommodate various modified linkers. Our preli-
minary SAR suggests that the linker length plays a key
role on activity, but other factors such as the charge state
and the position of the charge state within the linker region
should also be taken into account. The cloning, expres-
sion, purification, and characterization of M. tuberculosis
IMPDH (mtIMPDH) have allowed us to evaluate these tria-
zole-linked inhibitors and other known NAD mimics against
mtIMPDH, leading to the identification of compound 9 as the
first potent inhibitor of this enzyme. Our modeling study has
revealed the structural variations between hIMPDH and
mtIMPDH in the A- and N-subsites, which could account for
the lack of activity against mtIMPDH for compound 3a and its
analogues. Significantly, we have identified the charge state and
the position of hydrophobic portion in the linker region as
potential key factors that contribute to the activity of com-
pound 9.
6-(2-(((1-(50-Deoxy-20,30-O,O-isopropylidene-adenosin-50-yl)-
1H-1,2,3-triazol-4-yl)methyl)amino)ethyl)-5-methoxy-4-methyl-
7-((2-(trimethylsilyl)ethoxy)methoxy)isobenzofuran-1(3H)-one (13).
To a solution of alkyne 11 (210 mg, 0.52 mmol) in tert-BuOH
(4 mL) and H2O (4 mL) were added CuSO4 5H2O (6.0 mg, 0.024
3
mmol), sodium ascorbate (21 mg, 0.10 mmol), and then azide 1221
(345 mg, 1.04 mmol). The mixture was allowed to stir at rt for 3 h
and concentrated. The residue was purified by preparative thin-
layer chromatography (1000 μm, 5%/10% MeOH/CH2Cl2) to give
1
protected triazole 13 as a pale solid (293 mg, 77%). H NMR
(CD3OD, 600 MHz) δ8.22 (s, 1H), 8.15 (s, 1H), 7.64 (s, 1H), 6.21 (s,
1H), 5.45 (d, J = 6.0 Hz, 1H), 5.34 (s, 2H), 5.24-5.18 (m 3H),
4.82-4.78 (m, 2H), 4.60-4.54 (m, 1H), 3.88-3.75 (m, 7H), 2.95 (t,
J = 7.5 Hz, 2H), 2.76 (t, J = 7.5 Hz, 2H), 2.18 (s, 3H), 1.58 (s, 3H),
1.36 (s, 3H), 0.89 (t, J = 8.4 Hz, 2H), 0.32 (s, 9H). HRMS calcd for
C34H48N9O8Si 738.3389 (M þ H)þ, found 738.3393.
6-(2-(((1-(50-Deoxy-adenosin-50-yl)-1H-1,2,3-triazol-4-yl)methyl)-
amino)ethyl)-7-hydroxy-5-methoxy-4-methylisobenzofuran-1(3H)-
one (6). A solution of protected triazole 13 (230 mg, 0.31 mmol) in
TFA (4 mL) and H2O (1 mL) was allowed to stir at rt overnight.
The mixture was concentrated and coevaporated with MeOH.
The solid obtained was triturated with hot hexanes and then
dissolved in MeOH (ca. 2 mL). Diethyl ether (30 mL) was added,
and the precipitate was filtered and washed with diethyl ether to
give triazole 6 as a pale solid (184 mg, 86%). 1H NMR (CD3OD,
600 MHz) δ 8.37 (s, 1H), 8.33 (s, 1H), 8.02 (s, 1H), 6.04 (d, J = 4.2
Hz, 1H), 5.26 (s, 2H), 4.91-4.87 (m, 1H), 4.72 (t, J = 4.8 Hz, 2H),
4.45 (t, J = 5.1 Hz, 1H), 4.44-4.39 (m, 1H), 4.34 (d, J = 14.4 Hz,
1H), 4.31 (d, J = 14.4 Hz, 1H), 3.81 (s, 3H), 3.22 (t, J = 7.2 Hz,
2H), 3.09 (t, J = 7.8 Hz, 2H), 2.16 (s, 3H). HRMS calcd for
C25H30N9O7 568.2262 (M þ H)þ, found 568.2290.
In summary, our study has produced potent inhibitors of
hIMPDHs and has provided clues for the design of selective
inhibitors of mtIMPDH. This work has also validated our
general design of inhibitors based the modular nature of
IMPDH enzymes, an approach which is expected to find
broad applications in exploring NAD mimics as inhibitors
of NAD-utilizing enzymes.
(E)-4-(6-Methoxy-7-methyl-3-oxo-4-((2-(trimethylsilyl)ethoxy)-
methoxy)-1,3-dihydroisobenzofuran-5-yl)-2-methylbut-2-enal (15).
To a mixture of NaOH (100 mg, 2.5 mmol) in CH2Cl2 (4 mL)

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 12 4775
and H2O (4 mL) were added Adogen 464 (0.41 mL, 0.28 mmol)
and aldehyde 1414 (380 mg, 1.38 mmol). After stirring for 20 min,
2-(trimethylsilyl)ethoxymethyl chloride (SEMCl, 0.44 mL, 2.5
mmol) was added dropwise. The resulting mixture was allowed
to stir at rt for 3 h, and the organic layer was separated and then
concentrated. The residue was purified by silica gel column
chromatography (10%/30% EtOAc/hexanes) to give aldehyde
15 as a clear syrup (492 mg, 88%). 1H NMR (CDCl3, 600 MHz)
δ 9.38 (s, 1H), 6.56 (t, J = 6.9 Hz, 1H), 5.45 (s, 2H), 5.16 (s, 2H),
3.85-3.80 (m, 4H), 3.78 (s, 3H), 2.12 (s, 3H), 1.93 (s, 3H), 0.95 (t,
J = 8.4 Hz, 2H), 0.00 (s, 9H). HRMS calcd for C21H30O6NaSi
429.1703 (M þ Na)þ, found 429.1704.
EtOAc/hexanes) to give azide 19 as a wax-like solid (418 mg, 37%).
1H NMR (CDCl3, 600 MHz) δ 5.42 (s, 2H), 5.14 (s, 2H), 3.88-3.82
(m, 5H), 3.48 (t, J = 7.5 Hz, 2H), 3.04 (t, J = 7.5 Hz, 2H), 2.20 (s,
3H), 0.98 (t, J = 8.4 Hz, 2H), 0.30 (s, 9H). HRMS calcd for
C18H27N3O5NaSi 416.1612 (M þ Na)þ, found 416.1620.
20,30-O,O-Isopropylidene-50-O-propargyl adenosine (21). Asolu-
tion of alkyne 2023 (1.28 g, 2.85 mmol) in methanolic ammonia
(ca. 7N, 30 mL) was allowed to stir at rt overnight and then
concentrated. The residue was purified by silica gel column
chromatography to give alkyne 21 as a white solid (903 mg,
92%). 1H NMR (CDCl3, 600 MHz) δ 8.38 (s, 1H), 8.04 (s, 1H),
6.20 (d, J = 1.8 Hz, 1H), 5.79 (s, 2H), 5.33 (d, J = 5.4 Hz, 1H),
5.02 (dd, J = 6.6, 2.4 Hz, 1H), 4.52 (dd, J = 7.2, 3.6 Hz, 1H), 4.13
(d, J = 1.8 Hz, 2H), 3.78 (dd, J = 10.2, 3.6 Hz, 1H), 3.73 (dd, J =
10.2, 4.8 Hz, 1H), 2.44 (s, 1H), 1.64 (s, 3H), 1.40 (s, 3H). HRMS
calcd for C16H20N5O4 346.1515 (M þ H)þ, found 346.1512.
6-(2-(4-(20,30-O,O-Isopropylidene-adenosin-50-yl)methyl-1H-
1,2,3-triazol-1-yl)ethyl)-5-methoxy-4-methyl-7-((2-(trimethylsilyl)-
ethoxy)methoxy)isobenzofuran-1(3H)-one (22). In a manner simi-
lar to that described for the preparation of protected triazole 13,
alkyne 21 (361 mg, 0.92 mmol) and azide 19 (260 mg, 0.75 mmol)
underwent a click reaction to give protected triazole 22 as a light-
orange solid (476 mg, 86%). 1H NMR (CD3OD, 600 MHz) δ 8.23
(s, 1H), 8.18 (s, 1H), 7.65 (s, 1H), 6.19 (d, J = 1.8 Hz, 1H), 5.35-
5.30 (m, 3H), 5.20 (s, 2H), 5.00 (d, J = 6.0 Hz, 1H), 4.68-4.57 (m,
2H), 4.53 (s, 2H), 4.47-4.44 (m, 1H), 3.81 (t, J = 8.4 Hz, 2H), 3.76
(s, 3H), 3.65 (dd, J = 10.8, 3.6 Hz, 1H), 3.60 (dd, J = 10.8, 4.0 Hz,
1H), 3.36-3.34 (m, 2H), 2.14 (s, 3H), 1.60 (s, 3H), 1.38 (s, 3H),
0.90 (t, J = 8.1 Hz, 2H), 0.03 (s, 9H). HRMS calcd for C34H47-
N8O9Si 739.3235 (M þ H)þ, found 739.3234.
(E)-5-Methoxy-4-methyl-6-(3-methyl-4-(prop-2-yn-1-ylamino)-
but-2-en-1-yl)-7-((2-(trimethylsilyl)ethoxy)methoxy)isobenzofuran-
1(3H)-one (16). In a manner similar to that described for the
preparation of alkyne 11, aldehyde 15 (353 mg, 0.87 mmol) and
propargylamine (50 μL, 0.87 mmol) underwent reductive amina-
1
tion to give alkyne 16 as a yellowish syrup (251 mg, 65%). H
NMR (CDCl3, 600 MHz) δ 5.44 (t, J = 6.9 Hz, 1H), 5.41 (s, 2H),
5.13 (s, 2H), 3.86 (t, J = 8.4 Hz, 2H), 3.78 (s, 3H), 3.51 (d, J = 6.6
Hz, 2H), 3.35 (d, J = 1.8 Hz, 2H), 3.21 (s, 2H), 2.22-2.16 (m 4H),
1.85 (s, 3H), 1.44 (brs, 1H), 0.97 (t, J = 8.7 Hz, 2H), 0.02 (s, 9H).
HRMS calcd for C24H36NO5Si 446.2357 (M þ H)þ, found
446.2396.
6-((E)-4-(((1-(50-Deoxy-20,30-O,O-isopropylidene-adenosin-50-yl)-
1H-1,2,3-triazol-4-yl)methyl)amino)-3-methylbut-2-en-1-yl)-5-meth-
oxy-4-methyl-7-((2-(trimethylsilyl)ethoxy)methoxy)isobenzofuran-
1(3H)-one (17). In a manner similar to that described for the
preparation of protected triazole 13, alkyne 16 (238 mg, 0.53
mmol) and azide 12 (354 mg, 1.06 mmol) underwent a click reac-
tion to give protected triazole 17 as a pale solid (265 mg, 64%). 1H
NMR (CD3OD, 600 MHz) δ 8.21 (s, 1H), 8.15 (s, 1H), 7.58 (s,
1H), 6.19 (s, 1H), 5.45 (d, J = 6.0 Hz, 1H), 5.37 (t, J = 6.6 Hz,
1H), 5.34 (s, 2H), 5.22 (s, 2H), 5.18 (dd, J = 5.7, 3.9 Hz, 1H),
4.80-4.72 (m, 2H), 4.56-4.51 (m, 1H), 3.81 (t, J = 8.1 Hz, 2H),
3.78 (s, 3H), 3.70 (d, J = 14.4 Hz, 1H), 3.65 (d, J = 13.8 Hz, 1H),
3.51 (d, J = 6.6 Hz, 2H), 3.08 (s, 2H), 2.18 (s, 3H), 1.82 (s, 3H),
1.56 (s, 3H), 1.35 (s, 3H), 0.91 (t, J = 8.4 Hz, 2H), 0.02 (s, 9H).
HRMS calcd for C37H52N9O8Si 778.3708 (M þ H)þ, found
778.3706.
6-((E)-4-(((1-(50-Deoxy-adenosin-50-yl)-1H-1,2,3-triazol-4-yl)-
methyl)amino)-3-methylbut-2-en-1-yl)-7-hydroxy-5-methoxy-4-
methylisobenzofuran-1(3H)-one (7). In a manner similar to that
described for the preparation of triazole 6, protected triazole 17
(80 mg, 0.10 mmol) was deprotected under acidic conditions.
Triazole 7 was obtained as a pale solid after a preparative thin-
layer chromatography (59 mg, 80%). 1H NMR (CD3OD, 600
MHz) δ 8.14 (s, 1H), 8.08 (s, 1H), 7.78 (s, 1H), 5.94 (d, J = 3.6
Hz, 1H), 5.60 (brs, 1H), 5.23 (s, 2H), 4.94-4.86 (m, 1H), 4.82-
4.78 (m, 1H), 4.47 (t, J = 4.8 Hz, 1H), 4.35 (brs, 1H), 4.07 (d,
J = 13.8 Hz, 1H), 4.01 (d, J = 15.0 Hz, 1H), 3.77 (s, 3H), 3.63-
3.58 (m, 1H), 3.50-3.44 (m, 4H), 2.14 (s, 3H), 1.88 (s, 3H).
HRMS calcd for C28H34N9O7 608.2575 (M þ H)þ, found
608.2626. HRMS calcd for C28H34N9O7 608.2581 (M þ H)þ,
found 608.2581.
6-(2-Azidoethyl)-5-methoxy-4-methyl-7-((2-(trimethylsilyl)ethoxy)-
methoxy)isobenzofuran-1(3H)-one (19). To a solution of alcohol 1817
(1.05 g, 2.84 mmol) and Et3N (0.34 mL, 4.4 mmol) in anhydrous
THF (20 mL) at 0 °C was added dropwise MsCl (0.80 mL, 5.7
mmol). The mixture was allowed to stir at 0 °C for 40 min and warm
to rt. After the reaction mixture was diluted with EtOAc (100 mL),
the resulting solution was washed with water (2 ꢀ 30 mL) and brine
(2 ꢀ 30 mL). The organic layer was dried over Na2SO4 and filtered.
The filtrate was concentrated and redissolved in anhydrous DMF
(10 mL). After NaN3 (380 mg, 5.84 mmol) was added at rt, the
resulting mixture was heated at 80 °C for 2 h and cooled to rt. The
mixture was then diluted with EtOAc (100 mL) and washed with
water (2 ꢀ 30 mL) and brine (2 ꢀ 30 mL). The organic layer was dried
over Na2SO4 and filtered. The filtrate was concentrated, and the
residue was purified by silica gel column chromatography (10%/30%
6-(2-(4-(Adenosin-50-yl)methyl-1H-1,2,3-triazol-1-yl)ethyl)-7-
hydroxy-5-methoxy-4-methylisobenzofuran-1(3H)-one (8). In a
manner similar to that described for the preparation of triazole
6, protected triazole 22 (348 mg, 0.47 mmol) was deprotected
under acidic conditions to give triazole 8 as a light-orange solid
(128 mg, 48%). 1H NMR (DMSO-d6, 600 MHz) δ 9.70 (s, 1H),
8.32 (s, 1H), 8.16 (brs, 1H), 8.04 (s, 1H), 7.35 (brs, 2H), 5.89 (d,
J = 5.4 Hz, 1H), 5.48 (brs, 1H), 5.24 (brs, 3H), 4.58-2.52
(m,3H), 4.87 (t, J = 7.5 Hz, 2H), 4.13 (t, J = 4.2 Hz, 1H), 4.02
(dd, J = 7.8, 4.2 Hz, 1H), 3.68 (dd, J = 10.8, 3.6 Hz, 1H),
3.64-3.58 (m, 4H), 3.14 (t, J = 7.5 Hz, 2H), 2.04 (s, 3H). HRMS
calcd for C25H29N8O8 569.2102 (M þ H)þ, found 569.2134.
(E)-6-(4-Hydroxy-3-methylbut-2-en-1-yl)-5-methoxy-4-methyl-
7-((2-(trimethylsilyl)ethoxy)methoxy)isobenzofuran-1(3H)-one
(23). To a solution of protected aldehyde 15 (1.08 g, 2.67 mmol)
in MeOH (40 mL) and H2O (0.5 mL) at 0 °C was added CeCl3
3
7H2O (1.02 g, 2.74 mmol) and then NaBH4 (280 mg, 7.40 mmol)
in portions. After the addition of NaBH4 was complete, the
mixture was allowed to warm to rt and stirred for 1 h. The
mixture was concentrated and the residue was dissolved in
EtOAc (100 mL) and H2O (30 mL). The mixture was acidified
with 1N HCl solution to pH ≈ 4. The organic layer was
separated and washed with H2O (2 ꢀ 30 mL) and brine (60 mL)
and dried over Na2SO4. After filtration, the filtrate was concen-
trated, and the residue was purified by silica gel column chroma-
tography to give protected alcohol 23 as a clear syrup (621 mg,
57%). 1H NMR (CDCl3, 600 MHz) δ 5.50 (t, J = 6.6 Hz, 1H),
5.41 (s, 2H), 5.13 (s, 2H), 3.99(s, 2H), 3.85(t, J = 8.4Hz, 2H), 3.79
(s, 3H), 3.52 (d, J = 6.6 Hz, 2H), 2.19 (s, 3H), 1.85 (s, 3H), 0.97 (t,
J = 8.4 Hz, 2H), 0.02 (s, 9H). HRMS calcd for C21H33O6Si
409.2046 (M þ H)þ, found 409.2040.
6-((E)-4-(4-(20,30-O,O-Isopropylidene-adenosin-50-yl)methyl-
1H-1,2,3-triazol-1-yl)-3-methylbut-2-en-1-yl)-5-methoxy-4-methyl-
7-((2-(trimethylsilyl)ethoxy)methoxy)isobenzofuran-1(3H)-one (25).
To a solution of protected alcohol 23 (729 mg, 1.78 mmol) and Et3N
(0.50 mL, 3.6 mmol) in THF (20 mL) at 0 °C was added MsCl (0.21
mL, 2.7 mmol). The resulting mixture was allowed to stir at 0 °C for
1 h and warm to rt. After diluted with EtOAc (100 mL), the mixture
was washed with H2O (2 ꢀ 30 mL) and brine (2 ꢀ 30 mL) and dried
over Na2SO4. After filtration, the filtrate was concentrated, and the

4776 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 12
Chen et al.
residue was dissolved in dry DMF (10 mL). After addition of NaN3
(240 mg, 3.69 mmol), the reaction mixture was heated at 60 °C for 2
h and cooled to rt. The mixture was diluted with EtOAc (100 mL),
washed with H2O (2 ꢀ 30 mL) and brine (2 ꢀ 30 mL), and dried
over Na2SO4. After filtration, the filtrate was concentrated and the
residue was purified by column chromatography (10%/30%
EtOAc/hexanes) to give protected azide 24 as a clear syrup (656
mg, 85%, a mixture of isomers as indicated by 1H NMR), which
was used directly for the subsequent CuAAC reaction.
6-((E)-4-(4-(Adenosin-50-yl)methyl-1H-1,2,3-triazol-1-yl)-3-meth-
ylbut-2-en-1-yl)-7-hydroxy-5-methoxy-4-methylisobenzofuran-
1(3H)-one (9). To a mixture of protected azide 24 (603 mg, 1.39
mmol) in tert-BuOH (5 mL) and H2O (5 mL) were added
Cloning, Protein Overexpression, Purification, and Enzyme
Assays. General. Chemically competent Escherichia coli Mach1
and BL21 STAR (DE3), plasmids pCR2.1-TOPO and pENTR/
D-TOPO, and Gateway LR Clonase were purchased from
Invitrogen (Carlsbad, CA). The TEV protease expression vector
pRK793 was obtained from Addgene (plasmid number 8827)
and expressed as previously described.34 Restriction enzymes
were purchased from New England Biolabs (Ipswich, MA).
PrimeSTAR HS DNA polymerase was purchased from TA-
KARA Bio Inc. (Otsu, Shiga, Japan). Primers for PCR were
obtained from Integrated DNA Technologies (Coralville, IA).
The expression vector pDEST-HisMBP and pET28b were
purchased from Addgene (Cambridge, MA) and EMD bio-
sciences (San Diego, CA), respectively. Ni-NTA and DNA
purification/isolation kits was obtained from Qiagen Sciences
(Germantown, MD). NAD and IMP as well as all biological
buffers and components were purchased from Sigma Aldrich
(St. Louis, MO). Enzymatic activity, kinetic parameters and
inhibition assays were performed on a Molecular Devices M5e
multimode plate reader. (Sunnyvale, CA).
Cloning, Expression, and Purification of mtIMPDH. The Mtb
IMPDH gene guaB2 was amplified by PCR from H37Rv
genomic DNA using the primers CACCCATATGTCCCGTG-
GCATGTCC and CCAAGCTTAGCGCGCGTAGTAGTTG.
The product was initially cloned into the PCR capture vector
pCR2.1 TOPO (Invitrogen) and then subcloned into pET28b
(Novagen) using the NdeI and HindIII sites contained within the
primers. The resulting plasmid pCDD100 expresses GuaB2 with
an N-terminal His tag for ease of purification. pCDD100 was
transformed into BL21 STAR (DE3). Overnight cultures grown
in LB supplemented with kanamycin (50 μg/mL) were used to
inoculate 1 L of LB with the same concentration of kanamycin.
Cultures were grown to an OD600 of 0.7 at 37 °C and induced with
0.4 mM IPTG. The temperature was lowered to 30 °C, and the
cultures were grown an additional 4 h. The culture was centri-
fuged and the cell pellets were resuspended in 20 mL lysis buffer
(50 mM HEPES, 300 mM NaCl, 10 mM imidazole, pH 8.0)
containing 2 mg/mL lysozyme. After 30 min incubation on ice,
the solution was sonicated at 0 °C with four bursts (2 min, 30%
duty cycle, power 6) with a 1 min break between each burst
(Branson Sonifier 250). The lysate was centrifuged at 50000g for
10 min then 2 mL of 50% Ni-NTA was added to the cleared
supernatant. After incubating at 4 °C for 1 h, the lysate was
loaded onto a column and the flow through was collected. The
column was washed with 16 mL of wash buffer (50 mM HEPES,
300 mM NaCl, 20mMimidazole, pH8.0) andelutedwith3 mLof
elution buffer (50 mM HEPES, 300 mM NaCl, 250 mM imida-
zole, pH 8.0) of which the first 0.5 mL was discarded. The protein
solution was desalted on a PD-10 column into storage buffer
(50 mM Tris pH 7.5, 1 mM DTT, 100 mM KCl, 10% glycerol).
Protein concentrations were determined by the Bradford method
using BSA as a standard and stored at -80 °C.35
CuSO4 5H2O (12 mg, 0.048 mmol), sodium ascorbate (45 mg,
3
0.23 mmol), and then alkyne 21 (320 mg, 0.93 mmol). The
mixture was allowed to stir for 2 h at rt and concentrated. The
residue was then dissolved in TFA (4 mL) and H2O (1 mL), and
the mixture was allowed to stir at rt overnight. After concentra-
tion, the residue was coevaporated with MeOH and purified by
preparative thin-layer chromatography (1000 μm, 10% MeOH/
CH2Cl2) to give triazole 9 as a pale solid (84 mg). A portion of
this solid (20 mg) in MeOH (ca. 5 mL) was heated at 60 °C
overnight and allowed to stir at rt for 7 h. The solid was filtered
and washed with MeOH to give pure triazole 9 as an off-
white solid (7.5 mg, estimated yield 5% based on alkyne 21).
1H NMR (DMSO-d6, 600 MHz) δ 9.49 (s, 1H), 8.29 (s, 1H), 8.14
(s, 1H), 7.95 (s, 1H), 7.27 (s, 2H), 5.89 (d, J = 5.4 Hz, 1H), 5.48
(d, J = 5.4 Hz, 1H), 5.42 (t, J = 6.6 Hz, 1H), 5.18-5.30 (m, 3H),
4.86 (s, 2H), 4.50-4.60 (m, 3H), 4.13 (brd, J = 3.0 Hz, 1H), 4.02
(brd, J = 4.2 Hz, 1H), 3.69 (dd, J = 10.5, 3.9 Hz, 1H), 3.65 (s,
3H), 3.61 (dd, J = 10.8, 4.8 Hz, 1H), 2.06 (s, 3H), 1.64 (s, 3H).
HRMS calcd for C28H33N8O8 609.2412 (M þ H)þ, found
609.2412.
Molecular Modeling. All modeling were carried out using the
Schrodinger modeling package.29 The solved X-ray crystallo-
graphic structure of hIMPDH in complex with 6-Cl-IMP (PDB:
1JCN) and hIMPDH2 in complex compound 3a (PDB: 1NF7)
were taken from the Protein Data Bank. The missing hydrogen
atoms were added to both X-ray structures followed by energy
minimization using OPLS 2005 forcefield to optimize all hydro-
gen bonding networks. Because the structure of the mtIMPDH
has not yet been determined, the structure of mtIMPDH
(GuaB2, Rv3411c) from Mycobacterium. tuberculosis was homo-
logymodeledbasedthe solvedX-ray crystallographic structureof
Streptococcus pyogenes (Sp.) IMPDH in complex with inosine at
1.9 A resolution (PDB: 1ZFJ).30 An initial sequence alignment of
˚
Mycobacterium tuberculosis, Thermotoga maritima, Streptococ-
cus pyogenes, and Homo sapiens Type 1 and 2 IMPDH was per-
formed using clustalW to identify the structural conserved re-
gions (see Supporting Information Figure S1). The homology
model of mtIMPDH was then carried out based on this sequence
alignment and the conserved structural regions of Streptococcus
pyogenes, with particular emphasis placed on the NAD binding
site. The mtIMPDH homology model was validated by compar-
ison of the structure and the recently solved X-ray crystal
Cloning, Expression, and Purification of hIMPDH Type I and
II. To simplify expression and purification of hIMPDH type I
and II, new expression vectors were constructed to allow metal
affinity column purification and affinity tag cleavage to yield the
native enzymes. Expression vectors pH1 and pHIA5 containing
IMPDH I and II without affinity tags were kindly provided by
Prof. Liz Hedstrom (Brandeis University). For expression, the
genes were amplified using the forward primers CACCGAA-
AACCTGTATTTTCAGATGGCGGACTACCTGATC and
CACCGAAAACCTGTATTTTCAGATGGCCGACTACC-
TGATTAG for IMPDH I and II, respectively, which attaches
an N-terminal TEV protease site that cleaves before the first
methionine residue, yielding fully native protein and the reverse
primers CTCAGTACAGCCGCTTTTC and CTCAGAAAA-
GCCGCTTCTC. The resulting PCR products were cloned into
pENTR/D-TOPO (Invitrogen) to create the gateway entrance
vectors pCDD026 and pCDD027. To enhance solubility of the
proteins, the destination vector pDEST-HisMBP was recombined
˚
structure of Cryptosporidium parvum IMPDH at 2.8 A (PDB:
3KHJ),31 which showed consistent overlap of key residues within
the NAD binding site. Compound 3a was modeled into the
binding site via superpositioning of the compound 3a/hIMPDH2
complex onto the binding site of hIMPDH1 and mtIMPDH.
Compound 9 was modeled by the replacement of the methylene-
(bisphosphonate) linker in compound 3a. To account for solvent
effect and protein flexibility, the ligand binding site of each model
was further refined by restraint energy minimization using
OPLS 2005 forcefield32 within 20 A TIP3P33 surface constrained
˚
water sphere. To identify key amino residues involved in ligand
binding, the nonbond per residue interaction energies between
each modeled ligand to individual IMPDH residues within the
NAD binding sites were evaluated with a constant dielectric
constant of 4.

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 12 4777
with pCDD026 and pCDD027 using the gateway system
(Invitrogen) to give pCDD032 and pCDD033, which express a
fusion protein of TEV cleavable IMPDH I or IMPDH II with an
N-terminal His tagged MBP solubility enhancer.36
up essentially as described above. Initial velocities were mea-
sured with increasing concentrations of IMP from 1.4 μM to
1 mM (0.5 mM NAD) or NAD from 94 μM to 3 mM (100 μM
IMP) with or without inhibitor (0, 3.33, 10 μM). mtIMPDH
was held constant at 0.15 μM for all reactions, and the data
were fit to competitive, uncompetitive, noncompetitive, and
mixed models of inhibition using the enzyme kinetics module
of SigmaPlot and the model with the highest r2 value was
selected.
For overexpression and purification of IMPDH I and II, the
plasmids pCDD032 and pCDD033 were transformed into BL21
STAR (DE3) (Invitrogen). Starter cultures (5 mL) grown in
ZYM-505237 for 6 h were used to inoculate 100 mL of ZYM-
5052 containing ampicillin (100 μg/mL) and grown at 30 °C to
an OD600 of 15. The culture was centrifuged, and the cell pellet
was resuspended in 20 mL of lysis buffer (50 mM HEPES,
300 mM NaCl, 10 mM imidazole, pH 8.0) containing 2 mg/mL
lysozyme. After 30 min incubation on ice, the solution was
sonicated at 0 °C with four bursts (2 min, 30% duty cycle, power
6) with a 1 min break between each burst (Branson Sonifier 250).
The lysate was centrifuged at 50000g for 10 min, and then 2 mL
of 50% Ni-NTA was added to the cleared supernatant. After
incubating at 4 °C for 1 h, the lysate was loaded onto a column
and the flow through was collected. The column was washed
with 16 mL of wash buffer (50 mM HEPES, 300 mM NaCl,
20 mM imidazole, pH 8.0) and eluted with 3 mL of elution buffer
(50 mM HEPES, 300 mM NaCl, 250 mM imidazole, pH 8.0) of
which the first 0.5 mL was discarded. The protein solution was
desalted on a PD-10 column into TEV cleavage buffer (50 mM
ꢀ
ꢁ
vi=v0
¼
½Eꢁ - ½Iꢁ - Kiapp
ꢁ
qffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
À
Á
2
þ
½Eꢁ - ½Iꢁ - Kiapp þ 4 ½Eꢁ½Kiappꢁ =2 ½Eꢁ
ð1Þ
ð2Þ
3
3
1
vi=v0
¼
À
Á
h
1 þ ½Iꢁ=Kiapp
Acknowledgment. This research was supported by US-
DOD ARMY grant W81XWH-05-01-0216 and by the Center
for Drug Design in the Academic Health Center of the
University of Minnesota to K.P. and the NIH (AI070219) to
C.C.A. We thank Prof. Liz Hedstrom for generously providing
plasmids pH1 and pHIA5. The University of Minnesota Super-
computing Institute provided all the necessary computational
resources. We thank Drs. Takashi Tsuji and Kunisuke Izawa
of Ajinomoto Co., Inc., Japan, for a gift of MPA.
Tris HCl, pH 8.0, 0.5 mM EDTA, 300 mM NaCl, 1 mM DTT).
3
TEV protease was added to a final concentration of 0.15 mg/
mL, and the proteins were allowed to cleave overnight at 4 °C.
The cleaved proteins were purified by adding 500 μL of 50% Ni-
NTA and incubating at 4 °C for 1 h to bind the His-tagged MBP
and His-tagged TEV protease. After the incubation, the Ni-
NTA resin was filtered out of solution and the proteins were
dialyzed twice against buffer A (50 mM Tris pH 7.5, 1 mM DTT,
100 mM KCl, 10% glycerol) and stored at -80 °C. Protein
concentrations were determined by measuring the specific ac-
tivity of the enzymes as previously reported.38
Note Added after ASAP Publication. This paper was pub-
lished on May 19, 2010 with an error in the Results and
Discussion and Experimental Sections. The revised version
was published on May 24, 2010.
Enzyme Assays. IMPDH inhibition assays were performed
under initial velocity conditions in a total volume of 100 μL at
25 °C for 5 min, and the production of NADH was monitored by
following changes in absorbance at 340 nm on a Molecular
Devices M5e multimode plate reader. Assays were set up in
duplicate and contained either hIMPDH type 1 (100 nM),
hIMPDH type 2 (30 nM), or mtIMPDH (400 nM) in reaction
buffer (50 mM Tris, pH 8.0, 100 mM KCl, 1 mM DTT, 100 μM
IMP, 100 μM NAD). Because compound 1 exhibited a large
Kiapp of 62 μM against mtIMPDH with a corresponding Hill-
slope of 1.5, indicative of aggregation and nonspecific inhi-
bition,39 we additionally evaluated 1 against the reaction buffer
containing 0.1% Trition X-100; however, the Kiapp value was
not affected. A 2-fold dilution series of inhibitors in DMSO was
added to UV clear 96-well half area plates (Greiner) to give a
final DMSO concentration of 1%. The Kiapp values were cal-
culated using the Hill equation (eq 1). For inhibitors that
Supporting Information Available: Table of HPLC purities of
compounds 6-9, alignment of Mycobacterium tuberculosis,
Thermogota maritima, Streptococcus pyogenes, and Homo sa-
piens type I and II IMPDH sequences, and structure comparison
of the mtIMPDH homology model and the recently solved
X-ray crystal structure of Cryptosporidium parvum IMPDH
(PDB: 3KHJ). This material is available free of charge via the
Internet at http://pubs.acs.org.
References
(1) Hedstrom, L. IMP dehydrogenase: structure, mechanism, and
inhibition. Chem. Rev. 2009, 109, 2903–2928.
(2) Chong, C. R.; Qian, D. Z.; Pan, F.; Wei, Y.; Pili, R.; Sullivan, D. J.,
Jr.; Liu, J. O. Identification of type 1 inosine monophosphate
dehydrogenase as an antiangiogenic drug target. J. Med. Chem.
2006, 49, 2677–2680.
(3) Mortimer, S. E.; Xu, D.; McGrew, D.; Hamaguchi, N.; Lim, H. C.;
Bowne, S. J.; Daiger, S. P.; Hedstrom, L. IMP dehydrogenase type
1 associates with polyribosomes translating rhodopsin mRNA.
J. Biol. Chem. 2008, 283, 36354–36360.
(4) McLean, J. E.; Hamaguchi, N.; Belenky, P.; Mortimer, S. E.;
Stanton, M.; Hedstrom, L. Inosine 50-monophosphate dehydro-
genase binds nucleic acids in vitro and in vivo. Biochem. J. 2004,
379, 243–251.
displayed tight-binding inhibition (Kiapp < 10 [E]), the Kiapp
3
values were calculated using the Morrison equation (eq 2). In
these equations, the fractional activity (vi/v0) versus inhibitor
concentration were fit by nonlinear regression analysis using
GraphPad Prism version 4.0 to obtain Kiapp values, where vi is
the reaction velocity at a given [I] and v0 is the reaction velocity
of the DMSO control. The steady-state kinetic parameters KM
and kcat of NAD for mtIMPDH were determined by measuring
the initial velocity as a function of NAD concentration from
10 mM down to 78 μM at saturating IMP concentrations
(1 mM) to provide a saturation curve, which was fit by nonlinear
regression analysis to the substrate inhibition equation. The
steady-state kinetic parameters of IMP for mtIMPDH were de-
termined by measuring the initial velocity as a function of IMP
concentration from 1.5 mM down to 2 μM at subinhibitory
NAD concentrations (3 mM), and the data were fit to the
Michaelis-Menten equation. Reactions to determine the Kiapp
and mode of inhibition of compound 9 with mtIMPDH were set
(5) Chen, L.; Pankiewicz, K. W. Recent development of IMP dehy-
drogenase inhibitors for the treatment of cancer. Curr. Opin. Drug
Discovery Dev. 2007, 10, 403–412.
(6) Chen, L.; Petrelli, R.; Felczak, K.; Gao, G.; Bonnac, L.; Yu, J. S.;
Bennett, E. M.; Pankiewicz, K. W. Nicotinamide adenine dinucleo-
tide based therapeutics. Curr. Med. Chem. 2008, 15, 650–670.
(7) Umejiego, N. N.; Gollapalli, D.; Sharling, L.; Volftsun, A.; Lu, J.;
Benjamin, N. N.; Stroupe, A. H.; Riera, T. V.; Striepen, B.;
Hedstrom, L. Targeting a prokaryotic protein in a eukaryotic
pathogen: identification of lead compounds against cryptospor-
idiosis. Chem. Biol. 2008, 15, 70–77.
(8) Maurya, S. K.; Gollapalli, D. R.; Kirubakaran, S.; Zhang, M.;
Johnson, C. R.; Benjamin, N. N.; Hedstrom, L.; Cuny, G. D.

4778 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 12
Chen et al.
Triazole inhibitors of Cryptosporidium parvum inosine 50-mono-
phosphate dehydrogenase. J. Med. Chem. 2009, 52, 4623–4630.
(9) Cole, S. T.; Brosch, R.; Parkhill, J.; Garnier, T.; Churcher, C.;
Harris, D.; Gordon, S. V.; Eiglmeier, K.; Gas, S.; Barry, C. E., III;
Tekaia, F.; Badcock, K.; Basham, D.; Brown, D.; Chillingworth,
T.; Connor, R.; Davies, R.; Devlin, K.; Feltwell, T.; Gentles, S.;
Hamlin, N.; Holroyd, S.; Hornsby, T.; Jagels, K.; Krogh, A.;
McLean, J.; Moule, S.; Murphy, L.; Oliver, K.; Osborne, J.; Quail,
M. A.; Rajandream, M. A.; Rogers, J.; Rutter, S.; Seeger, K.;
Skelton, J.; Squares, R.; Squares, S.; Sulston, J. E.; Taylor, K.;
Whitehead, S.; Barrell, B. G. Deciphering the biology of Myco-
bacterium tuberculosis from the complete genome sequence. Nature
1998, 393, 537–544.
(10) Sassetti, C. M.; Boyd, D. H.; Rubin, E. J. Genes required for
mycobacterial growth defined by high density mutagenesis. Mol.
Microbiol. 2003, 48, 77–84.
(11) Shu, Q.; Nair, V. Inosine monophosphate dehydrogenase
(IMPDH) as a target in drug discovery. Med. Res. Rev. 2008, 28,
219–232.
(22) van Heerden, F. R.; van Zyl, J. J.; Rall, G. J. H.; Brandt,
E. V.; Roux, D. G. Phase-transfer catalysis: a general method of
methoxymethylation of the hydroxyl function. Tetrahedron Lett.
1978, 19, 661–662.
(23) Jawalekar, A. M.; Meeuwenoord, N.; Cremers, J. S.; Overkleeft,
H. S.; van der Marel, G. A.; Rutjes, F. P.; van Delft, F. L.
Conjugation of nucleosides and oligonucleotides by [3 þ 2] cy-
cloaddition. J. Org. Chem. 2008, 73, 287–290.
(24) Gagneux, A.; Winstein, S.; Young, W. G. Rearrangement of allylic
azides. J. Am. Chem. Soc. 1960, 82, 5956–5957.
(25) Feldman, A. K.; Colasson, B.; Sharpless, K. B.; Fokin, V. V. The
allylic azide rearrangement: achieving selectivity. J. Am. Chem.
Soc. 2005, 127, 13444–13445.
(26) Kale, T. A.; Distefano, M. D. Diazotrifluoropropionamido-con-
taining prenylcysteines: syntheses and applications for studying
isoprenoid-protein interactions. Org. Lett. 2003, 5, 609–612.
(27) Wang, W.; Hedstrom, L. Kinetic mechanism of human inosine 50-
monophosphate dehydrogenase type II: random addition of sub-
strates and ordered release of products. Biochemistry 1997, 36,
8479–8483.
(28) Mortimer, S. E.; Hedstrom, L. Autosomal dominant retinitis
pigmentosa mutations in inosine 50-monophosphate dehydro-
genase type I disrupt nucleic acid binding. Biochem. J. 2005, 390,
41–47.
(29) Maestro 9.0, Glide v5.5, Prime v2.1, Macromodel v9.7; Schrodinger,
LLC: New York, NY, 2008.
(12) Hedstrom, L.; Gan, L. IMP dehydrogenase: structural schizophre-
nia and an unusual base. Curr. Opin. Chem. Biol. 2006, 10, 520–525.
(13) Lesiak, K.; Watanabe, K. A.; Majumdar, A.; Powell, J.; Seidman,
M.; Vanderveen, K.; Goldstein, B. M.; Pankiewicz, K. W. Synth-
esis of a methylenebis(phosphonate) analogue of mycophenolic
adenine dinucleotide: a glucuronidation-resistant MAD analogue
of NAD. J. Med. Chem. 1998, 41, 618–622.
(14) Pankiewicz, K. W.; Lesiak-Watanabe, K. B.; Watanabe, K. A.;
Patterson, S. E.; Jayaram, H. N.; Yalowitz, J. A.; Miller, M. D.;
Seidman, M.; Majumdar, A.; Prehna, G.; Goldstein, B. M. Novel
mycophenolic adenine bis(phosphonate) analogues as potential
differentiation agents against human leukemia. J. Med. Chem.
2002, 45, 703–712.
(15) Chen, L.; Gao, G.; Felczak, K.; Bonnac, L.; Patterson, S. E.;
Wilson, D.; Bennett, E. M.; Jayaram, H. N.; Hedstrom, L.;
Pankiewicz, K. W. Probing binding requirements of type I and
type II isoforms of inosine monophosphate dehydrogenase with
adenine-modified nicotinamide adenine dinucleotide analogues.
J. Med. Chem. 2007, 50, 5743–5751.
(30) Zhang, R.; Evans, G.; Rotella, F. J.; Westbrook, E. M.; Beno, D.;
Huberman, E.; Joachimiak, A.; Collart, F. R. Characteristics and
crystal structure of bacterial inosine-50-monophosphate dehydro-
genase. Biochemistry 1999, 38, 4691–4700.
(31) Macpherson, I. S.; Kirubakaran, S.; Gorla, S. K.; Riera, T. V.;
D’Aquino, J. A.; Zhang, M.; Cuny, G. D.; Hedstrom, L. The
structural basis of Cryptosporidium-specific IMP dehydrogenase
inhibitor selectivity. J. Am. Chem. Soc. 2010, 132, 1230–1231.
(32) Jorgensen, W. L.; Maxwell, D. S.; TiradoRives, J. Development
and testing of the OPLS all-atom force field on conformational
energetics and properties of organic liquids. J. Am. Chem. Soc.
1996, 118, 11225–11236.
(16) Chen, L.; Gao, G.; Bonnac, L.; Wilson, D. J.; Bennett, E. M.;
Jayaram, H. N.; Pankiewicz, K. W. Methylenebis(sulfonamide)
linked nicotinamide adenine dinucleotide analogue as an inosine
monophosphate dehydrogenase inhibitor. Bioorg. Med. Chem.
Lett. 2007, 17, 3152–3155.
(17) Chen, L.; Petrelli, R.; Olesiak, M.; Wilson, D. J.; Labello, N. P.;
Pankiewicz, K. W. Bis(sulfonamide) isosters of mycophenolic
adenine dinucleotide analogues: inhibition of inosine monopho-
sphate dehydrogenase. Bioorg. Med. Chem. 2008, 16, 7462–7469.
(18) Kolb, H. C.; Finn, M. G.; Sharpless, K. B. Click Chemistry:
Diverse Chemical Function from a Few Good Reactions. Angew.
Chem., Int. Ed. Engl. 2001, 40, 2004–2021.
(33) Jorgensen, W. L.; Chandrasekhar, J.; Madura, J. D.; Impey, R. W.;
Klein, M. L. Comparison of simple potential functions for simulat-
ing liquid water. J. Chem. Phys. 1983, 79, 926–935.
(34) Kapust, R. B.; Tozser, J.; Fox, J. D.; Anderson, D. E.; Cherry, S.;
Copeland, T. D.; Waugh, D. S. Tobacco etch virus protease:
mechanism of autolysis and rational design of stable mutants with
wild-type catalytic proficiency. Protein Eng. 2001, 14, 993–1000.
(35) Bradford, M. M. A rapid and sensitive method for the quantitation
of microgram quantities of protein utilizing the principle of pro-
tein-dye binding. Anal. Biochem. 1976, 72, 248–254.
(36) Nallamsetty, S.; Austin, B. P.; Penrose, K. J.; Waugh, D. S. Gate-
way vectors for the production of combinatorially-tagged His6-
MBP fusion proteins in the cytoplasm and periplasm of Escherichia
coli. Protein Sci. 2005, 14, 2964–2971.
(37) Studier, F. W. Protein production by auto-induction in high
density shaking cultures. Protein Expression Purif. 2005, 41, 207–
234.
(38) Farazi, T.; Leichman, J.; Harris, T.; Cahoon, M.; Hedstrom, L.
Isolation and characterization of mycophenolic acid-resistant mu-
tants of inosine-50-monophosphate dehydrogenase. J. Biol. Chem.
1997, 272, 961–965.
(39) Feng, B. Y.; Simeonov, A.; Jadhav, A.; Babaoglu, K.; Inglese, J.;
Shoichet, B. K.; Austin, C. P. A high-throughput screen for aggre-
gation-based inhibition in a large compound library. J. Med. Chem.
2007, 50, 2385–2390.
(19) Tron, G. C.; Pirali, T.; Billington, R. A.; Canonico, P. L.; Sorba,
G.; Genazzani, A. A. Click chemistry reactions in medicinal
chemistry: applications of the 1,3-dipolar cycloaddition between
azides and alkynes. Med. Res. Rev. 2008, 28, 278–308.
(20) Gupte, A.; Boshoff, H. I.; Wilson, D. J.; Neres, J.; Labello, N. P.;
Somu, R. V.; Xing, C.; Barry, C. E.; Aldrich, C. C. Inhibition of
siderophore biosynthesis by 2-triazole substituted analogues of 50-
O-[N-(salicyl)sulfamoyl]adenosine: antibacterial nucleosides effec-
tive against Mycobacterium tuberculosis. J. Med. Chem. 2008, 51,
7495–7507.
(21) Liu, F.; Austin, D. J. Synthesis of 50-functionalized adenosine:
suppression of cyclonucleoside formation. Tetrahedron Lett. 2001,
42, 3153–3154.