Identification of sn-glycerol-1-phosphate dehydrogenase activity from genomic information on a hyperthermophilic archaeon, Sulfolobus tokodaii strain 7

Article abstract of DOI:10.1271/bbb.70.282

sn-Glycerol-1-phosphate dehydrogenase is responsible for the formation of sn-glycerol-1-phosphate, the backbone of membrane phospholipids of Archaea. This activity had never been detected in cell-free extract of Sulfolobus sp. Here we report the detection of this activity on the thermostable ST0344 protein of Sulfolobus tokodaii expressed in Escherichia coli, which was predicted from genomic information on S. tokodaii. This is another line of evidence for the general mechanism of sn-glycerol-1-phosphate formation by the enzyme.

Full text of DOI:10.1271/bbb.70.282

Biosci. Biotechnol. Biochem., 70 (1), 282–285, 2006
Note
Identification of sn-Glycerol-1-phosphate Dehydrogenase Activity
from Genomic Information on a Hyperthermophilic Archaeon,
Sulfolobus tokodaii Strain 7
y
Yosuke KOGA,1; Mami OHGA,1 Masanari TSUJIMURA,2
2
Hiroyuki MORII,1 and Yutaka KAWARABAYASI
1Department of Chemistry, School of Medicine, University of Occupational and Environmental Health,
Yahatanishi-ku, Kitakyushu 807-8555, Japan
2National Institute of Advanced Industrial Science and Technology, Higashi, Tsukuba 305-8566, Japan
Received August 18, 2005; Accepted October 7, 2005
sn-Glycerol-1-phosphate dehydrogenase is responsi-
ble for the formation of sn-glycerol-1-phosphate, the
backbone of membrane phospholipids of Archaea. This
activity had never been detected in cell-free extract of
Sulfolobus sp. Here we report the detection of this
activity on the thermostable ST0344 protein of Sulfolo-
bus tokodaii expressed in Escherichia coli, which was
predicted from genomic information on S. tokodaii. This
is another line of evidence for the general mechanism of
sn-glycerol-1-phosphate formation by the enzyme.
The activity of G-1-P dehydrogenase has been detected
in all Archaea so far examined (methanogenic, extreme-
ly halophilic, thermoacidophilic, and hyperthermophilic
archaea) except for the hyperthermoacidophilic Sulfolo-
bus species.6) Several attempts to detect the activity in
the crude homogenate of Sulfolobus acidocaldarius cells
or partially purified fractions of it were unsuccessful.
The reason is not known, but it is assumed to be a low
level of the activity. Also, it can be thought that a
different mechanism of G-1-P structure formation might
be working in Sulfolobus cells. Generalization of the
mechanism of G-1-P formation by G-1-P dehydrogenase
requires detection of the activity from Sulfolobus cells.
Sulfolobus tokodaii is a member of the Sulfolobus genus
isolated in hot springs in Beppu, Japan,7) which grows
optimally at 80 ꢀC and pH 2.5–3.0. The genome of
S. tokodaii has been sequenced, and an open reading
flame (ORF) with similarity to the characterized egsA
gene has been identified (ST0344).8) The primary
structures of ST0344 and G-1-P dehydrogenases from
M. thermautotrophicus, S. acidocaldarius, and Aeropy-
rum pernix show significant similarities (Fig. 1). This
communication reports confirmation of G-1-P dehydro-
genase activity on the recombinant ST0344 protein
expressed in Escherichia coli cells and partial character-
ization of the biochemical features of this protein.
Key words: sn-glycerol-1-phosphate dehydrogenase;
membrane phospholipid; Archaea; Sulfolo-
bus tokodaii
Archaea are distinguished as a group of organisms of
a third domain from the domains Bacteria and Eucarya
by their small subunit ribosomal RNA sequences1) as
well as various biochemical properties. Polar lipid
structures of membranes are one of the most character-
istic differences distinguishing Archaea from organisms
of the other domains. The glycerophosphate backbones
of phospholipids in cells of Archaea and Bacteria are
enantiomers, that is, the archaeal backbone is sn-
glycerol-1-phosphate (G-1-P) and the bacterial one is
sn-glycerol-3-phosphate (G-3-P).2) There has been found
no exception as to this difference. This is the most
fundamental difference by which Archaea and Bacteria
are discriminated. These enantiomers are synthesized
from dihydroxyacetonephosphate (DHAP) by G-1-P
dehydrogenase in Archaea3) and by G-3-P dehydrogen-
ase in Bacteria.4) The gene encoding G-1-P dehydrogen-
ase (egsA) has been detected in all the archaeal species
of which whole genomes have been sequenced, and has
not been found in any bacterial or eucaryal species.5)
Construction of expression vector: For polymerase
chain reaction (PCR) amplification of ST0344 ORF of
S. tokodaii strain 7 (JCM10535), primer P1, TTAA-
CATATGGAGCTGAAAGAACATATAAT, and primer
P2, TTAACTCGAGTTAGTCAATAATTCCAGTCT,
were designed from the 50 sequence and 30 sequence
respectively of ST0344. The PCR products were
digested with restriction enzymes NdeI and XhoI (shown
by underlines, New England Biolabs, Beverly, MA) and
y
To whom correspondence should be addressed. Fax: +81-93-693-9921; E-mail: kogay@med.uoeh-u.ac.jp
Abbreviations: G-1-P, sn-glycerol-1-phosphate; G-3-P, sn-glycerol-3-phosphate; DHAP, dihydroxyacetonephosphate; ORF, open reading flame;
PCR, polymerase chain reaction; MOPS, 3-(N-morpholino)propanesulfonic acid; MES, 2-(N-morpholino)ethanesulfonic acid; HEPES, N-2-
hydroxyethylpiperazine-N0-2-ethanesulfonic acid

sn-Glycerol-1-phosphate Dehydrogenase in Sulfolobus tokodaii
283
Fig. 1. Multiple Alignment of ST0344 and G-1-P Dehydrogenases from Aeropyrum pernix, M. thermautotrophicus, and S. acidocaldarius.
ligated by T4 DNA ligase (New England Biolabs) with
vector pET21(a) digested with the same restriction
enzymes. The ligated DNA was introduced into the
E. coli DH5ꢀ (Takara Bio, Otsu, Japan). After con-
firmation of the nucleotide sequence, the plasmid was
referred to as pST0344.
determined by the bicinchoninic acid method described
by Smith et al.9)
sn-Glycerol-1-phosphate dehydrogenase (DHAP-re-
ducing) activity: The activity in the direction of DHAP
reduction was measured at 65 ꢀC in 1.5 ml cuvettes
containing 1.2 ml of the following assay mixture: 50 mM
MOPS buffer (pH 6.8 at 21 ꢀC or pH 6.5 at 65 ꢀC) or
50 mM 2-(N-morpholino)ethanesulfonic acid (MES)
buffer (pH 6.2 at 21 ꢀC or pH 6.0 at 65 ꢀC), 0.25 mM
NADPH, 1.67 mM DHAP, and 1.1 mg of the partially
purified protein. Decrease in absorbance at 340 nm was
recorded for 1 to 2 min after the addition of DHAP.
Blank values were recorded in the absence of DHAP.
The recombinant ST0344 protein showed DHAP reduc-
ing activity of 25.4 nmol/min/mg protein at 65 ꢀC at
pH 6.8 and 27.8 nmol/min/mg protein at pH 6.2 in the
presence of NADPH. In the case in which NADH was
used instead of NADPH, about one third of the activity
was detected. However, G-1-P (prepared by the method
of Nishihara et al.10)) oxidation activity was scarcely
detected on the recombinant ST0344 protein because the
equilibrium of the reaction favored DHAP reduction as
in other Archaea. The specific activity detected here was
considerably lower than those of the reported G-1-P
dehydrogenases (314 mmol/min/mg for M. thermauto-
trophicus,10) and 3.22 mmol/min/mg for Aeropyrum
pernix11)). It is not known whether the low activity is
due to the intrinsic nature of the enzyme or to artifactual
effects.
Expression and purification of recombinant protein:
The plasmid pST0344 was introduced into E. coli strain
BL21-Codon Plus (DE3)-RIL (Stratagene, La Jolla, CA)
cells. Transformed E. coli was grown in two 2 l of LB
medium containing 100 mg/ml ampicillin at 25 ꢀC.
Recombinant ST0344 protein was induced by the
addition of 0.5 mM isopropyl-1-thio-ꢁ-D-galactoside.
After incubation at 25 ꢀC for a further 5 h, the cells
were collected by centrifugation and suspended in
50 ml of 50 mM 3-(N-morpholino)propanesulfonic acid
(MOPS) buffer (pH 6.8). The pHs of the buffers used
here were adjusted at room temperature (21 ꢀC). The
suspended cells were ruptured with a French pressure
cell press (SLM/Aminco Instruments, Madison, WI).
The supernatant fraction of the cell extract was heated at
80 ꢀC for 20 min, and then the precipitates were removed
by centrifugation at 20;000 ꢁ g for 20 min. The super-
natant was used as the heat-treated soluble fraction. The
protein components in the fraction showed one major
band with a molecular mass of approximately 30 to
40 kD on SDS–polyacrylamide gel electrophoresis,
which corresponds to the molecular weight of the
monomer of ST0344 protein from S. tokodaii (37,792)
(Fig. 2). Therefore, we assumed that the heat-treated
soluble fraction contained almost homogeneous ST0344
gene product, and the fraction was used in the
subsequent experiments without further purification.
The soluble fraction contained 3.63 mg protein/ml
Confirmation of G-1-P as the product of DHAP
reduction by G-1-P dehydrogenase and NADPH: The
reaction mixture (5.0 ml) for DHAP reduction (glycero-
phosphate formation) contained 50 mM MOPS buffer
(pH 6.8), 10 mM DHAP, 8 mM NADPH, and the heat-

284
Y. KOGA et al.
treated soluble fraction containing 10 mg of protein. The
mixture was incubated for 4 h at 65 ꢀC. After the
reaction was completed, the mixture was treated as
described by Nishihara et al.6) to remove protein and
nicotinamide nucleotides. The coenzyme-free solution
was lyophilized and dissolved in 2.2 ml of water. G-1-P
and G-3-P in the product were measured by enzymatic
methods using purified M. thermautotrophicus G-1-P
dehydrogenase heterologously expressed in E. coli cells,
as described previously,12) and using rabbit muscle G-3-
P dehydrogenase (Boehringer Mannheim, Mannheim,
Germany),13) respectively. The amounts of G-1-P and G-
3-P measured 2.77 mmol and 0.071 mmol respectively,
revealing that almost all the formed glycerophosphate
was G-1-P. These results indicate that the product of
the ST0344 gene from S. tokodaii was really G-1-P
dehydrogenase.
1
2
3
200
116
97.4
66.2
45.0
Properties of S. tokodaii G-1-P dehydrogenase: The
ST0344 protein showed the highest activity at pH 6.2 in
MES buffer or MOPS buffer. At pH 6.8, 86–91% of the
highest activity was detected. About one third of the
highest activity was observed at pH 5.6 (MES) buffer
and at pH 7.7 (N-2-hydroxyethylpiperazine-N0-2-ethane-
sulfonic acid (HEPES) buffer) (Fig. 3A). Precipitate was
formed at pH below 5.6 (acetate buffer). The optimum
pH of this enzyme was slightly lower than that of the
neutrohilic archaeon M. thermautotrophicus,10) or
A. pernix.11) Since it is assumed that the intracellular
pH is 5 to 6, it appears that this pH profile of this
enzyme reflects the intracellular pH.
31.0
21.5
14.4
6.50
The recombinant ST0344 protein from S. tokodaii
exhibited thermophilic and thermostable G-1-P dehy-
drogenase activity. The activity increased as the reaction
temperature rose from 37 ꢀC to 85 ꢀC (Fig. 3B). At
temperatures higher than 85 ꢀC, activity could not be
determined due to precipitation of the enzyme. The
activity at 85 ꢀC was 74 times higher than that at 37 ꢀC.
The activity of the homogenate remained after heating
for 30 min at various temperatures was measured. A
slight increase in activity was observed with preincuba-
tion at 50 ꢀC to 80 ꢀC (Fig. 3C). The heated protein at
80 ꢀC showed 28% higher activity than the unheated
soluble fraction. Heating at 100 ꢀC for 30 min com-
Fig. 2. SDS-PAGE of the Heat-Treated Cell Homogenate of E. coli
in Which S. tokodaii ST0344 Gene Was Expressed.
Protein bands were detected with Coomassie Brilliant Blue R-
250. Lane 1, molecular weight markers (SDS-PAGE Molecular
Weight Standards, Broad Range, Bio-Rad, Hercules, CA); lane 2,
the E. coli cell homogenate (5 ml) in which the ST0344 gene was
expressed; lane 3, the supernatant fraction of the heat-treated E. coli
cell homogenates filtrated with a membrane filter (0.22 mm pore
size). The molecular weight markers were: 6.5 kDa, aprotinin;
14.4 kDa, lysozyme; 21.5 kDa, trypsin inhibitor; 31 kDa, carbonic
anhydrase; 45 kDa, ovalbumin; 66.2 kDa, serum albumin; 97.0 kDa,
phosphorylase; 116 kDa, ꢁ-galactosidase; 200 kDa, myosin.
30
100
60
A
B
C
50
75
25
40
30
20
10
0
50
20
25
15
0
5.5
6
6.5
7
7.5
8
8.5
40
50
60
70
80
90
100 110
30
40
50
60
70
80
90
Preincubation Temperature (°C)
pH
Temperature (°C)
Fig. 3. Properties of G-1-P Dehydrogenase from S. tokodaii.
A, pH dependence of G-1-P dehydrogenase activity. Closed circle, MES buffer (pH 5.6–6.5); open circle, MOPS buffer (pH 6.2–7.4); closed
triangle, HEPES buffer (pH 7.0–8.0). B, Effect of reaction temperature on G-1-P dehydrogenase activity. C, Effect of preincubation temperature
on G-1-P dehydrogenase activity. The enzyme solution was preincubated at the temperatures shown for 30 min before activity was measured at
65 ꢀC.

sn-Glycerol-1-phosphate Dehydrogenase in Sulfolobus tokodaii
285
two lines of descent. J. Mol. Evol., 46, 54–63 (1998).
pletely inactivated the enzyme. Because the recombinant
ST0344 protein was prepared by heating of the soluble
fraction of E. coli cell-free extracts at 80 ꢀC for 20 min,
heat treatment might have a more effect on this activity.
The Michaelis constants (Km) of the enzyme for
DHAP and NADPH were determined to be 0.47 mM and
0.067 mM respectively. The Vmax was 32.8 nmol/min/
mg under the assay conditions described above. The Km
values were comparable to those of G-1-P dehydrogen-
ase from M. thermautotrophicus,10) while the Vmax
value was remarkably low.
Previous attempts to detect G-1-P dehydrogenase
activity in crude or partially fractionated homogenates
of Sulfolobus sp. have been unsuccessful. The reason is
not obvious. It is possible that the mechanism of
formation of the G-1-P backbone of phospholipids in
organisms of the genus Sulfolobus are different from
that of other Archaea. For example, G-1-P might be
synthesized from glycerol by phosphorylation by a new
glycerol kinase (G-1-P forming). But the glycerol kinase
found in S. acidocaldarius catalyzed formation of G-3-P
from glycerol and ATP the same as in other Archaea.14)
In this study we detected G-1-P dehydrogenase activity
for the first time on the recombinant ST0344 protein of
S. tokodaii. The ST0344 protein partially purified by
heat treatment showed extremely low specific activity.
This might be one of the reasons detection of the activity
in Sulfolobus cell homogenate was unsuccessful. The
G-1-P stereo structure of polar lipid backbone of
S. tokodaii was found to be synthesized by G-1-P
dehydrogenase, which extends the generalization of the
mechanism of G-1-P formation by this activity. The
properties of the enzyme showed a slightly acidophilic
and highly thermophilic nature. This is acclimatized to
the intracellular environment of the organism, and this
suggests, in turn, that the enzyme is in fact working in
the cells.
3) Nishihara, M., and Koga, Y., sn-Glycerol-1-phosphate
dehydrogenase in Methanobacterium thermoautotrophi-
cum: key enzyme in biosynthesis of the enantiomeric
glycerophosphate backbone of ether phospholipids of
archaebacteria. J. Biochem., 117, 933–935 (1995).
4) Kito, M., and Pizer, L. I., Purification and regulatory
properties of the biosynthetic L-glycerol-3-phosphate
dehydrogenase from Escherichia coli. J. Biol. Chem.,
244, 3316–3323 (1969).
5) Daiyasu, H., Hiroike, T., Koga, Y., and Toh, H., The
analysis of membrane stereochemistry with the homol-
ogy modeling of sn-glycerol-1-phosphate dehydrogen-
ase. Protein Eng., 15, 987–995 (2002).
6) Nishihara, M., Yamazaki, T., Oshima, T., and Koga, Y.,
sn-Glycerol-1-phosphate-forming activities in Archaea:
separation of archaeal phospholipid biosynthesis and
glycerol catabolism by glycerophosphate enantiomers.
J. Bacteriol., 181, 1330–1333 (1999).
7) Suzuki, T., Iwasaki, T., Uzawa, T., Hara, K., Nemoto,
N., Kon, T., Ueki, T., Yamagishi, A., and Oshima, T.,
Sulfolobus tokodaii sp. nov. (f. Sulfolobus sp. strain 7),
a new member of the genus Sulfolobus isolated from
Beppu hot springs, Japan. Extremophiles, 6, 39–44 (2002).
8) Kawarabayasi, Y., Hino, Y., Horikawa, H., Jin-no, K.,
Takahashi, M., Sekine, M., Baba, S., Ankai, A., Kosugi,
H., Hosoyama, A., Fukui, S., Nagai, Y., Nishijima, K.,
Ohtsuka, R., Nakazawa, H., Takamiya, M., Kato, Y.,
Yoshizawa, T., Tanaka, T., Kudoh, Y., Yamazaki, J.,
Kushida, N., Oguchi, A., Aoki, K., Masuda, S., Yanagi,
M., Nishimura, M., Yamagishi, A., Oshima, T., and
Kikuchi, H., Complete genome sequence of an aerobic
thermoacidophilic crenarchaeon, Sulfolobus tokodaii
strain 7. DNA Res., 8, 123–140 (2001).
9) Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia,
A. K., Gartner, F. H., Provenzano, M. D., Fujimoto,
E. K., Goeke, N. M., Olson, B. J., and Klenk, D. C.,
Measurement of protein using bicinchoninic acid. Anal.
Biochem., 150, 76–85 (1985).
10) Nishihara, M., and Koga, Y., Purification and properties
of sn-glycerol-1-phosphate dehydrogenase from Meth-
anobacterium thermoautotrophicum: characterization of
the biosynthetic enzyme for the enantiomeric glycero-
phosphate backbone of ether polar lipids of Archaea.
J. Biochem., 122, 572–576 (1997).
11) Han, J. S., Kosugi, Y., Ishida, H., and Ishikawa, K.,
Kinetic study of sn-glycerol-1-phosphate dehydrogenase
from the aerobc hyperthermophilic archaeon, Aeropyrum
pernix K1. Eur. J. Biochem., 269, 969–976 (2002).
12) Noguchi, S., Maeda, M., Nishihara, M., Koga, Y., and
Sone, N., Expression and use of Methanobacterium
thermoautotrophicum sn-glycerol-1-phosphate dehydro-
genase for the assay of sn-glycerol 1-phosphate in
Archaea. J. Ferment. Bioeng., 86, 266–270 (1998).
13) Michal, G., and Lang, G., L-(ꢂ)-Glycerol-3-phosphate.
In ‘‘Methods of Enzymatic Analysis’’ Vol. 3, ed.
Bergmeyer, H. U., Verlag Chemie, Weinheim,
pp. 1415–1418 (1974).
Acknowledgment
This work was partly supported by Grants-in-Aid
for Scientific Research from the Japan Society for the
Promotion of Science, and by a special grant from the
Protein 3000 Program of the Ministry of Education,
Culture, Sports, Science and Technology.
References
1) Woese, C. R., Kandler, O., and Wheelis, M. L., Towards
a natural system of organisms: proposal for the domains
Archaea, Bacteria, and Eucarya. Proc. Natl. Acad. Sci.
U.S.A., 87, 4576–4579 (1990).
2) Koga, Y., Kyuragi, T., Nishihara, M., and Sone, N., Did
archaeal and bacterial cells arise independently from
noncellular precursors? A hypothesis stating that the
advent of membrane phospholipids with enantiomeric
glycerophosphate backbones caused the separation of the
14) Ohnuma, S., Kato, T., and Nishino, T., Stereospecificity
of glycerol kinase in the extremely thermophilic archae-
on, Sulfolobus acidocaldarius. Seikagaku (in Japanese),
67, 895 (1995).