Guanine specific DNA cleavage by photoirradiation of dibenzoyldiazomethane - Oligonucleotide conjugates

Article abstract of DOI:10.1021/ja970598j

Photoirradiation of dibenzoyldiazomethane (DBDM) produced highly electrophilic benzoylketene via Wolff rearrangement. DBDM derivative possessing an aminoalkyl side chain induced a DNA cleavage selectively at guanine (G) residues upon photoirradiation and subsequent piperidine treatment. In order to devise photochemical DNA cleavers that can specifically alkylate a guanine residue proximal to the target sequence of long DNA fragments, a sew reagent, DBDM-OSu, which facilitates the connection of DBDM unit to various DNA binders, was developed. DBDM-oligonucleotide (ODN) conjugates 5 and 6 were obtained by the coupling of 5'-aminohexyl 8-mer [H₂N-CH₂)₆-d(ACGTCAGG)-3'] and 15-mer [H₂N-(CH₂)₆-d(ACGTCAGGTGGCACT)-3'], respectively, with DBDM-OSu in aqueous acetonitrile in the presence of sodium bicarbonate. Photoirradiation of 5 and 6 in the presence of 25-mer 5'-d(AGTGCCACCTGACGTCTG₁₈CTCTCTC)-3' having a complementary sequence induced cross-linking of both oligomers. A distinct cleavage band at guanine residue (G₁₈) was observed upon heating the cross-linked oligomers with piperidine. A similar DNA cleavage reaction of 5'-d(AGTGCCACCTGACG₁₄TG₁₆CG₁₈TG₂₀CG₂₂-TCT)-3' having multiple guanine sites in the presence of DBDM-ODN conjugate 6 indicated that the most effectively cleaved site is G₁₆. These results demonstrated that DBDM-oligonucleotide conjugates can serve as a new class of photonucleases that can cleave single-stranded DNA at predetermined guanine sites. Furthermore, the reagent DBDM-OSu can be used as a convenient and effective photoinducible electrophile for the cross-linking or the modification of biopolymers.

Full text of DOI:10.1021/ja970598j

7626
J. Am. Chem. Soc. 1997, 119, 7626-7635
Guanine Specific DNA Cleavage by Photoirradiation of
Dibenzoyldiazomethane-Oligonucleotide Conjugates
Kazuhiko Nakatani,†,‡ Junya Shirai,‡ Shinsuke Sando,‡ and Isao Saito*,‡
Contribution from the PRESTO, Science and Technology Corporation of Japan and Department
of Synthetic Chemistry and Biological Chemistry, Faculty of Engineering, Kyoto UniVersity,
Kyoto 606-01, Japan
ReceiVed February 24, 1997X
Abstract: Photoirradiation of dibenzoyldiazomethane (DBDM) produced highly electrophilic benzoylketene via Wolff
rearrangement. DBDM derivative possessing an aminoalkyl side chain induced a DNA cleavage selectively at guanine
(G) residues upon photoirradiation and subsequent piperidine treatment. In order to devise photochemical DNA
cleavers that can specifically alkylate a guanine residue proximal to the target sequence of long DNA fragments, a
new reagent, DBDM-OSu, which facilitates the connection of DBDM unit to various DNA binders, was developed.
DBDM-oligonucleotide (ODN) conjugates 5 and 6 were obtained by the coupling of 5′-aminohexyl 8-mer [H2N-
(CH2)6-d(ACGTCAGG)-3′] and 15-mer [H2N-(CH2)6-d(ACGTCAGGTGGCACT)-3′], respectively, with DBDM-
OSu in aqueous acetonitrile in the presence of sodium bicarbonate. Photoirradiation of 5 and 6 in the presence of
25-mer 5′-d(AGTGCCACCTGACGTCTG18CTCTCTC)-3′ having a complementary sequence induced cross-linking
of both oligomers. A distinct cleavage band at guanine residue (G18) was observed upon heating the cross-linked
oligomers with piperidine. A similar DNA cleavage reaction of 5′-d(AGTGCCACCTGACG14TG16CG18TG20CG22-
TCT)-3′ having multiple guanine sites in the presence of DBDM-ODN conjugate 6 indicated that the most effectively
cleaved site is G16. These results demonstrated that DBDM-oligonucleotide conjugates can serve as a new class of
photonucleases that can cleave single-stranded DNA at predetermined guanine sites. Furthermore, the reagent DBDM-
OSu can be used as a convenient and effective photoinducible electrophile for the cross-linking or the modification
of biopolymers.
Introduction
sugar backbone by photogenerated radicals,13-19 and a photo-
induced DNA alkylation.20-22 Among these approaches DNA
Much current interest has been focused on the design of
artificial DNA-cleaving molecules that are chemically stable
and activatable by photoirradiation, particularly by a pulse of
light.1 The advantage of such photoactivatable DNA-cleaving
molecules is that their action can be controlled within time and
space by choosing proper irradiation methods. Various strate-
gies for photoinduced DNA cleavage have been intensively
investigated. These included a generation of active oxygen
species2-4 or photoreactive metal center,5 an electron transfer
from DNA nucleobases,6-12 hydrogen abstraction from DNA
(6) (a) Steenken, S. Chem. ReV. 1989, 89, 503-520. (b) Candeias, L.
P.; Steenken, S, J. Am. Chem. Soc. 1993, 115, 2437-2440.
(7) Dunn, D. A.; Lin, V. H.; Kochevar, I. E. Biochemistry 1992, 31,
11620-11625.
(8) (a) Sugiyama, H.; Tsutsumi, K.; Fujimoto, K.; Saito, I. J. Am. Chem.
Soc. 1993, 115, 4443-4448. (b) Saito, I.; Takayama, M.; S. Kawanishi, J.
Am. Chem. Soc. 1995, 117, 5590-5591. (c) Saito, I.; Takayama, M.;
Sugiyama, H.; Nakatani, K.; Tsuchida, A.; Yamamoto, M. J. Am. Chem.
Soc. 1995, 117, 6406-6407. (d) Saito, I.; Takayama, M.; Sugiyama, H.;
Nakamura, T. In DNA and RNA CleaVers and Chemotherapy of Cancer
and Viral Diseases; Meunier, B.; Ed: NATO ASI Series; Kluwer Academic
Publishers: Dordrecht, The Netherlands, 1996; pp 163-176. (e) Sugiyama,
H.; Saito, I. J. Am. Chem. Soc. 1996, 118, 7063-7068.
(9) Ito, K.; Inoue, S.; Yamamoto, K.; Kawanishi, S. J. Biol. Chem. 1993,
268, 13221-13227.
* Corresponding author: Phone number: (+81)-75-753-5656. Fax
number: (+81)-75-753-5676. E-mail address: saito@sbchem.kyoto-u.ac.jp.
† PRESTO, Science and Technology Corporation of Japan.
‡ Department of Synthetic Chemistry and Biological Chemistry.
X Abstract published in AdVance ACS Abstracts, August 1, 1997.
(1) For recent reviews on photoinduced DNA cleavage, see: (a) Saito,
I.; Nakatani, K. Bull. Chem. Soc. Jpn. 1996, 69, 3007-3019. (b) Bioorganic
Photochemistry, Photochemistry and the Nucleic Acids; Morrison, H., Ed.;
John Wiley and Sons: New York, 1990; Vol. 1.
(10) Cadet, J.; Berger, M.; Bunchko, G. W.; Joshi, R. C.; Raoul, S.;
Ravanet, J.-L. J. Am. Chem. Soc. 1994, 116, 7403-7404.
(11) (a) Armitage, B.; Changjun, Y.; Devadoss, C.; Schuster, G. B. J.
Am. Chem. Soc. 1994, 116, 9847-9859. (b) Breslia, D.; Schuster, G. B. J.
Am. Chem. Soc. 1996, 118, 2313-2319. (c) Ly, D.; Kan, Y.; Armitage, B.;
Schuster, G. B. 1996, 118, 8747-8748.
(2) (a) Kawanishi, S.; Inoue, S.; Sano, S.; Aiba, H. J. Biol. Chem. 1986,
261, 6090-6095. (b) Blazek, E. R.; Peak, J. G.; Peak, M. J. Photochem.
Photobiol. 1989, 49, 607-613. (c) Schneider, J. E.; Price, S. Maidlt, L.;
Gutteridge, J. M. C.; Floyd, R. A. Nucleic Acids Res. 1990, 18, 631-635.
(d) Buchko, G. W.; Cadet, J.; Berger, M.; Ravanat, J.-L. Nucleic Acids
Res. 1990, 18, 4847-4851. (e) Devasagayam, T. P. A.; Steenken, S.;
Obendorf, M. S. W.; Schulz, W. A.; Sies, H. Biochemistry 1991, 30, 6283-
6289. (f) Sies, H.; Menck, C. F. M. Mutat. Res. 1992, 275, 367-375. (g)
Ravanat, J.-L.; Cadet, J. Chem. Res. Toxicol. 1995, 8, 379-388.
(3) (a) Saito, I.; Takayama, M.; Matsuura, T.; Matsugo, S.; Kawanishi,
S. J. Am. Chem. Soc. 1990, 112, 883-884. (b) Matsugo, S.; Kawanishi, S.;
Yamamoto, K.; Sugiyama, H.; Matsuura, T.; Saito, I. Angew. Chem., Int.
Ed. Engl. 1991, 30, 1351-1353. (c) Saito, I. Pure Appl. Chem. 1992, 64,
1305-1310.
(12) Hall, D. B.; Holmlin, R. E.; Barton, J. K. Nature 1996, 382, 731-
735.
(13) Perrouault, L.; Asseline, U.; Rivallet, C.; Thuong, N. T.; Bisagni,
E.; Giovannangeli, C.; Le Doan, T.; He´le`ne, C. Nature 1990, 344, 358-
360.
(14) Nielsen, P. E.; Hirort, C.; Sonnichsen, S. H.; Buchardt, O.; Dahl,
O.; Norden, B. J. Am. Chem. Soc. 1992, 114, 4967-4975.
(15) Quadda, J. C.; Levy, M. J., Jr.; Hecht, S. M. J. Am. Chem. Soc.
1993, 115, 12171-12172.
(16) (a) Nakatani, K.; Isoe, S.; Maekawa, S.; Saito, I. Tetrahedron Lett.
1994, 35, 605-608. (b) Saito, I.; Sakurai, T.; Kurimoto, T.; Takayama, M.
Tetrahedron Lett. 1994, 35, 4797-4800. (c) Nakatani, K.; Maekawa, S.;
Tanabe, K.; Saito, I. J. Am. Chem. Soc. 1995, 117, 10635-10644.
(17) Condorelli, G.; Costanzo, L. L.; De Guidi, G.; Giuffrida, S.; Sortino,
S. Photochem. Photobiol. 1995, 62, 155-161.
(4) For reactions of oxygen radicals with DNA, see a review: Breen, A.
P.; Murphy, J. A. Free Radical Biol. Med. 1995, 18, 1033-1077.
(5) (a) Barton, J. K. Science 1986, 233, 727-734. (b) Lee, I.; Barton J.
K.; Biochemistry, 1993, 32, 6121-6127. (c) Sitlani, A; Long, E. C.; Pyle,
A. M.; Barton, J. K. J. Am. Chem. Soc. 1992, 114, 2303-2312.
(18) Matsugo, S.; Nakano, S.; Adachi, K.; Konishi, T. J. Chem. Soc.,
Chem. Commun. 1995, 311-312.
(19) Wender, P. A.; Touami, S. M.; Alayrac, C.; Philipp. U. C. J. Am.
Chem. Soc. 1996, 118, 6522-6533.
S0002-7863(97)00598-2 CCC: $14.00 © 1997 American Chemical Society

Guanine Specific DNA CleaVage
J. Am. Chem. Soc., Vol. 119, No. 33, 1997 7627
Scheme 1
alkylation by highly electrophilic species generated by light-
triggered reactions is particularly attractive, since electrophilic
species have an intrinsic reaction selectivity to nucleophilic
nucleobases such as guanine and adenine. Photochemical
methods for the generation of such electrophiles so far reported
are (i) the photodecomposition of arylazide eventually producing
azaheptatetraene via aryl nitrene,20a (ii) photoheterolysis of
quinolylmethylisothioronium salt generating quinolylmethyl
carbocation,20b (iii) photoenolization of 5-methylnaphthoquinone
giving a quinone methide,21 and (iv) the generation of oxonium
cation from hemithioacetal by photoinduced electron transfer.22
We focused our attention on chemically stable R-diazocar-
bonyl compounds as the precursor for such photoinducible
electrophile, because R-diazo ketones absorb light at UVA
(320-400 nm) region and efficiently undergo Wolff rearrange-
ment to produce electrophilic ketenes.16a,c We are especially
interested in dibenzoyldiazomethane (1, DBDM) which can
produce highly electrophilic benzoylketene by Wolff rearrange-
ment.23,24 It was already demonstrated that benzoylketene 2
produced by photoirradiation of 1 can be effectively trapped
by amines in aqueous solvents.23 Preliminary experiments for
DNA cleavage by DBDM derivative 3 at 366 nm irradiation
indicated an effective DNA cleavage at 50 µM drug concentra-
tion.23 Encouraged by these results, we have attempted to design
a novel type of photonuclease consisting of DBDM-oligonucleo-
tide (ODN) conjugate, which may cleave DNA at predetermined
guanine sites.25,26 We herein disclosed that under photoirra-
diation conditions DNA cleavage by DBDM derivative 3 having
an aminoalkyl side chain occurs selectively at guanine residues
after hot piperidine treatment. Upon photoirradiation and
subsequent hot piperidine treatment, DBDM-ODN conjugates
5 and 6 cleaved single-stranded DNA at the guanine residues
proximal to the target sequence.
Results and Discussion
Photoreaction of DBDM with Guanosine Derivatives.
Photoirradiation of DBDM 1 at 366 nm in aqueous solvent gave
rise to 2-phenylacetophenone 8 by decarboxylation of â-keto
acid 7 which was produced by water addition to the photo-
generated benzoylketene 2 (Scheme 1).23 In the presence of
amines such as amino acid derivatives like glycine ethyl ester
(Gly-OEt) and NR-Boc-L-lysine methyl ester (NR-Boc-L-Lys-
OMe), benzoylketene 2 was shown to be effectively trapped to
give the corresponding amides 9 and 10, respectively.23 Based
on these previous results, we have examined the reaction of
guanosine derivatives with ketene 2 produced by photoirradia-
tion of 1. Photoirradiation of 1 with 3,5-di-O-(tert-butyldi-
phenylsilyl)-2′-deoxyguanosine (11) in benzene with high
pressure Hg lamp through a Pyrex filter produced guanosine
derivative 12 in 15% yield (Scheme 2). The thermal generation
of ketene from 1 in refluxing benzene in the presence of 11
also produced 12 with an increased yield (58%). These
experiments suggest that acylation of N-2 amino group of
guanine base by photogenerated benzoylketene 2 would be a
major reaction in the photoirradiation of DBDM in the presence
of duplex DNA.
(20) (a) Nielsen, P. E.; Jeepsen, C.; Egholm, M.; Buchardt, O. Nucleic
Acids Res. 1988, 16, 3877-3888. (b) Henriksen, U.; Larsen, C.; Karup,
G.; Jeepsen, C.; Nielsen, P. E.; Buchardt, O. Photochem. Photobiol. 1991,
53, 299-305.
(21) (a) Chatterjee, M.; Rokita, S. E. J. Am. Chem. Soc. 1990, 112, 6397-
6397. (b) Chatterjee, M.; Rokita, S. E. J. Am. Chem. Soc. 1994, 116, 1690-
1697.
(22) Saito, I.; Takayama, M.; Sakurai, T. J. Am. Chem. Soc. 1994, 116,
2653-2654.
(23) Nakatani, K.; Shirai, J.; Tamaki, R.; Saito, I. Tetrahedron Lett. 1995,
36, 5363-5366.
(24) (a) Baumann, N. HelV. Chim. Acta 1972, 55, 2716-2723. (b)
Tomioka, H.; Hayashi, N.; Asano, T.; Izawa, Y. Bull. Chem. Soc. Jpn. 1983,
56, 758-761.
(25) For reviews on chemical nucleases, see: (a) Thuong, N. T.; He´le`ne,
C. Angew. Chem., Int. Ed. Engl. 1993, 32, 666-690 (b) Sigman, D. S.;
Bruice, T. W.; Mazumder, A.; Sutton, C. L. Acc. Chem. Res. 1993, 26,
98-104.
Synthesis of DBDM Derivative 3 and DBDM-Transferring
Reagent DBDM-OSu (4). At first, DNA cleavage by DBDM
derivative 3 possessing an aminoalkyl side chain was intended
under photoirradiation with 366 nm light. The synthesis of 3
was accomplished as shown in Scheme 3. Ester hydrolysis of
readily available dibenzoylmethane derivative 1316b followed
(26) For recent examples of photoactivatable oligonucleotide conjugates,
see: (a) Boutorine, A. S.; Tokuyama, H.; Takasugi, M.; Isobe, H.;
Nakamura, E.; He´le`ne, C. Angew. Chem., Int. Ed. Engl. 1994, 33, 2462-
2465. (b) Magda, D.; Wright, M.; Miller, R. A.; Sessler, J. L.; Sansom, P.
I. J. Am. Chem. Soc. 1995, 117, 3629-3630. (c) Sessler, J. L.; Sansom, P.
I.; Kra´l, V.; O’Connor, D.; Iverson, B. J. Am. Chem. Soc. 1996, 118, 12322-
12330, and references cited therein. See also ref 21b.

7628 J. Am. Chem. Soc., Vol. 119, No. 33, 1997
Nakatani et al.
Scheme 2a
a Conditions: (a) high pressure Hg lamp, Pyrex, benzene (15%); (b) benzene reflux (58%).
Scheme 3a
a Reagents: (a) LiOH, H2O, THF; (b) N-Boc-1,4-diaminobutane, PyBoP, DMF; (c) TsN3, Et3N, DMF; (d) HCl, EtOAc.
Scheme 4a
a Reagents: (a) ethylene glycol, p-TsOH; (b) NaH, acetophenone, THF reflux; (c) HCl, THF; (d) NaBH4, EtOH, CH2Cl2; (e) TsN3, Et3N; (f)
N,N′-disuccinimidyl carbonate, 2,6-lutidine, CH3CN.
by coupling of the resulting acid 14 with N-Boc-1,4-diamino-
butane produced amide 15. Diazo transfer from tosyl azide to
15 and subsequent deprotection of the terminal amino group
successfully gave 3. It is noteworthy that DBDM can tolerate
the highly acidic conditions for the deprotection of Boc group.
In order to devise photochemical DNA cleavers that can
specifically alkylate a guanine residue proximal to the target
site of long DNA fragments, we have designed a new reagent,
DBDM-OSu (4), which facilitates the connection of the DBDM
unit to various DNA binders, including DNA oligomers pos-
sessing an aminoalkyl linker. The synthesis of 4 was ac-
complished from methyl 4-formylbenzoate as depicted in
Scheme 4. The utility of 4 was demonstrated by the reaction
with amines in aqueous DMF in the presence of sodium
bicarbonate to give DBDM adducts 20-22 in good yields (Table
1). In the case of NR-Boc-L-Lys-OMe (entry 1), DBDM-lysine
adduct 20 was isolated after deprotection of Boc group. These
DBDM adducts were subjected to DNA cleavage assay using
plasmid relaxation method, eventually showing that DBDM-
lysine adduct 20 having a cationic side chain effectively cleaved
DNA under photoirradiation conditions.
Synthesis of DBDM-Oligonucleotide Conjugates. DBDM
was next tethered to oligonucleotides possessing hexamethyl-
eneamino linker at the 5′-end (Scheme 5). Thus, two DBDM-
oligonucleotide (ODN) conjugates 5 and 6 were synthesized
by coupling of 4 with 5′-aminohexyl 8-mer [H2N-(CH2)6-
d(ACGTCAGG)-3′] (ODN8, Table 2) and 15-mer [H2N-(CH2)6-
d(ACGTCAGGTGGCACT)-3′] (ODN15), respectively, in 50%
aqueous acetonitrile in the presence of sodium bicarbonate at
ambient temperature. Structures of 5 and 6 were confirmed by
enzymatic digestion with snake venom phosphodiesterase (sv
PDE) and calf intestine alkaline phosphatase (AP) to give
DBDM derivative 22 together with dA, dG, dC, and dT in a
ratio of 2:3:2:1 and 3:5:4:3, respectively (Figure 1).
DNA Cleavage by DBDM Derivative 3 under Photoirra-
diation Conditions. Photoinduced DNA cleavage by DBDM

Guanine Specific DNA CleaVage
J. Am. Chem. Soc., Vol. 119, No. 33, 1997 7629
Table 1. Coupling Reactions of 4 with Various Amino
Table 2. Sequences of Oligonucleotides (ODNs) and
DBDM-ODN Conjugates
Compounds in Aqueous Solventsa
ODNs and DBDM-ODN conjugates
ODN8 H2N-(CH2)6-d(ACGTCAGG)-3′
ODN15 H2N-(CH2)6-d(ACGTCAGGTGGCACT)-3′
5
6
23
24
DBDM-CH2-O(CO)NH-(CH2)6-d(ACGTCAGG)-3′
DBDM-CH2-O(CO)NH-(CH2)6-d(ACGTCAGGTGGCACT)-3′
5′-d(AGTGCCACCTGACGTCTGCTCTCTC)-3′
5′-d(AGTGCCACCTGACGTGCGTGCGTCT)-3′
a An aqueous DMF solution of 4 and amine was stirred in the
presence of sodium bicarbonate at ambient temperature for 1 h.
b DBDM ) C6H5COC(N2)COC6H4-. c Isolated yield.
Scheme 5a
Figure 1. HPLC profiles for (a) a coupling of 5′-aminohexyl 8-mer
H2N-(CH2)6-d(ACGTCAGG)-3′ (ODN8) with DBDM-OSu 4 giving
DBDM-ODN conjugate 5 and (b) product analysis of the mixture
obtained by enzymatic digestion of 5 with snake venom phosphodi-
esterase (sv PDE) and calf intestine alkaline phosphatase (AP) giving
four nucleosides and DBDM derivative 22. Each HPLC peak was
identified by comigration with authentic sample.
Photochemical G-selective cleavage is known to occur in one
electron transfer oxidation6-12 and in singlet oxygen oxidation.2
Recently, we8 and others9-12 have demonstrated that photo-
induced electron transfer from DNA occurred selectively at 5′-G
of the 5′-GG-3′ step. The photoinduced DNA cleavage by 3
occurred almost equally at all Gs, suggesting that electron
transfer from guanine base to photoexcited DBDM chromophore
is at the very most a minor process. The reaction of guanine
base with singlet oxygen produced various oxidation products,
and this reaction is known to induce spontaneous cleavage at
G with no sequence selectivity without piperidine treatment.2g,30,31
Since photoirradiation of 3 with labeled DNA resulted in a weak
but spontaneous strand cleavage at all Gs without piperidine
treatment (Figure 2, lane 1), a considerable amount of singlet
oxygen process may be involved in the G-selective DNA
cleavage by 3 under the conditions.
In order to know the participation of singlet oxygen in the
photoinduced DNA cleavage, we carried out the photoreaction
of DBDM derivative 3 with DNA in the presence of singlet
oxygen quencher, sodium azide (Figure 3). Upon addition of
sodium azide, spontaneous G cleavage was no more detected
(lane 1), implying that oxidation of G by singlet oxygen is
suppressed under the conditions. Weak smear bands observed
for heat-treated DNA (lane 2) became distinct and intense by
hot piperidine treatment, being accompanied with a band shift
to 5′-end (lane 3). Strong cleavage bands in lane 3 were in
accordance with Maxam-Gilbert G-bands (lane 4). In addition
to these intense G bands, weak nonselective bands were also
observed at all bases. Since the DNA cleavage at G was
enhanced by hot piperidine treatment with a band shift to 5′-
a Reagents and conditions: (a) ODN8, NaHCO3, aqueous CH3CN
for 5; (b) ODN15, NaHCO3, aqueous CH3CN for 6; (c) sv PDE, AP.
derivative 3 was carried out using 32P-labeled DNA fragment
and analyzed by polyacrylamide gel electrophoresis. Thus, 32P-
5′-end-labeled EcoR I/Rsa I fragment of pBR322 DNA in
sodium cacodylate buffer was illuminated with 366 nm-light
in the presence of 3. The DNA recovered by ethanol precipita-
tion was heated at 90 °C for 30 min in the absence or presence
of piperidine and analyzed by electrophoresis on a sequencing
gel containing 8% polyacrylamide and 7 M urea.27 The result
of DNA cleavage by 3 was shown in Figure 2. Faint but
characteristic DNA cleavage bands were observed for nonheated
and heated DNAs (lanes 1 and 2). After heating with piperidine,
the intensity of these bands considerably increased with each
band being shifting to 5′-end (lane 3). By comparing the DNA
cleavage pattern in lane 3 with Maxam-Gilbert A+G bands
(lane 4), it was confirmed that the DNA cleavage occurred
selectively at the guanine (G) residues after hot piperidine
treatment. The DNA cleavage bands in lane 3 indicated that
the G cleavage has no significant sequence selectivity. Band
shift to 5′-end by heating with piperidine (lane 2 Vs lane 3)
strongly suggests that the photoinduced G cleavage proceeded
via the modification of the guanine base by a photogenerated
ketene from 3.28,29
(28) Baker, B. F.; Dervan P. B. J. Am. Chem. Soc. 1989, 111, 2700-
2712.
(29) (a) Maxam, A. M.; Gilbert, W. Proc. Natl. Acad. Sci. U.S.A. 1977,
74, 560-564. (b) Nishikawa K.; Adams, B. L.; Hecht, S. M. J. Am. Chem.
Soc. 1982, 104, 326-328 and references cited therein.
(30) Raoul, S.; Cadet, J. J. Am. Chem. Soc. 1996, 118, 1892-1898.
(31) (a) Sheu, C.; Foote, C. S. J. Am. Chem. Soc. 1995, 117, 474-477.
(b) Sheu, C.; Foote, C. S. J. Am. Chem. Soc. 1995, 117, 6439-6442.
(27) Maxam, A. M.; Gilbert, W. Methods Enzymol. 1980, 65, 499-560.

7630 J. Am. Chem. Soc., Vol. 119, No. 33, 1997
Nakatani et al.
Figure 3. Photoinduced cleavage of 32P-5′-end-labeled DNA by 3 in
the presence of sodium azide. The reaction mixture containing 3 (50
µM) and 32P-5′-end-labeled DNA (pBR322 DNA, EcoR I-RsaI frag-
ment, 167 bp) in sodium cacodylate buffer (5 mM, pH 7.0) in the
presence of calf thymus DNA (1 µM) and sodium azide (100 mM)
was photoirradiated with transilluminator (366 nm) at 0 °C for 1 h.
Photoirradiated DNA recovered by ethanol precipitation was treated
as described below and electrophoresed on a sequencing gel containing
8% polyacrylamide and 7 M urea: lane 1, nonheated DNA; lane 2,
heated DNA (90 °C, 30 min); lane 3, heated DNA (90 °C, 30 min) in
the presence of piperidine (10% v/v); lane 4, A+G sequencing reaction.
sequence. Single-stranded 25-mer 5′-d(AGTGCCACCTGA-
CGTCTG18CTCTCTC)-3′ (23) has a complementary sequence
(shown in italic) to 8-mer conjugate 5 and a targeted guanine
(G18) in the middle (Table 2). The site of the target G18 is three
bases away from the 3′-end of the complementary sequence. A
solution of 5 and 32P-5′-end-labeled 25-mer 23 in sodium
cacodylate buffer containing sodium azide to suppress singlet
oxygen process and sonicated calf thymus DNA was irradiated
with 366 nm light at 0 °C, and the DNA recovered by ethanol
precipitation was analyzed by denatured polyacrylamide se-
quencing gel as indicated in Figure 4. While no appreciable
DNA cleavage was observed upon only heating, intense cross-
linked bands that migrated more slowly than 23 were detected
(lanes 1 and 2). Upon heating with piperidine, the intensity of
the cross-linked bands decreased with a concomitant appearance
of a distinct cleavage band at G18 (lane 3). The results indicate
that a major reaction occurred in the photoirradiation of 5 with
23 is the cross-linking of both oligomers. Heating the photo-
irradiated mixture containing cross-linked oligomers with pip-
eridine led to the formation of the cleavage band at G18, whereas
a considerable portion of the cross-linked oligomer was stable
to hot piperidine treatment. A major cross-linking reaction
between 23 and 5 would probably be the acylation of guanine
Figure 2. Photoinduced cleavage of 32P-5′-end-labeled DNA by 3.
The reaction mixture containing 3 (50 µM) and 32P-5′-end-labeled DNA
(pBR322 DNA, EcoR I-RsaI fragment, 514 bp) in sodium cacodylate
buffer (5 mM, pH 7.0) in the presence of calf thymus DNA (1 µM)
was photoirradiated with transilluminator (366 nm) at 0 °C for 1 h.
Photoirradiated DNA recovered by ethanol precipitation was treated
as described below and electrophoresed on a sequencing gel containing
8% polyacrylamide and 7 M urea: lane 1, nonheated DNA; lane 2,
heated DNA (90 °C, 30 min); lane 3, heated DNA (90 °C, 30 min) in
the presence of piperidine (10% v/v); lane 4, A+G sequencing reaction.
end, the G cleavage must proceed via the formation of alkali
labile abasic sites which are produced by a photochemical
modification of G base. Photogenerated benzoylketene is the
most likely species responsible for the G modification, whereas
the minor nonselective cleavage is probably due to the hydrogen
abstraction from deoxyribose by photogenerated carbene from
the DBDM chromophore.20a
Cleavage of Single-Stranded DNA by DBDM-ODN Con-
jugates 5 and 6. We next focused our attention to the specific
cleavage of the single-stranded DNA by DBDM-ODN conju-
gates at predetermined guanine sites proximal to the target

Guanine Specific DNA CleaVage
J. Am. Chem. Soc., Vol. 119, No. 33, 1997 7631
Figure 4. Photoinduced cleavage of 32P-5′-end-labeled 25-mer 23 in
the presence of DBDM-ODN conjugate 5. The reaction mixture
containing 5 (50 µM) and 32P-5′-end-labeled 23 in sodium cacodylate
buffer (10 mM, pH 7.0) in the presence of sodium azide (100 mM)
and sonicated calf thymus DNA (10 µM base pair concentration) was
photoirradiated with a transilluminator (366 nm) at 0 °C for 1 h.
Photoirradiated DNA recovered by ethanol precipitation was treated
as described below and electrophoresed on a sequencing gel containing
15% polyacrylamide and 7 M urea: lane 1, nonheated DNA; lane 2,
heated DNA (90 °C, 30 min); lane 3, heated DNA (90 °C, 30 min) in
the presence of piperidine (10% v/v); lanes 4 and 5, Maxam-Gilbert
A+G and C+T sequencing reactions, respectively. Shown below are
base sequences of 5 and 23 with the cleavage site being indicated by
an arrow. Photoinduced cross-links are revealed by the appearance of
the bands (as indicated X) migrating more slowly than the 25-mer.
Figure 5. Photoinduced cleavage of 32P-5′-end-labeled 25-mer 23 in
the presence of (a) 8-mer DBDM-ODN conjugate 5 and (b) 15-mer
DBDM-ODN conjugate 6. The reaction mixture containing DBDM-
ODN conjugate 5 (50 µM) or 6 (1 µM) and 32P-5′-end-labeled 23 in
sodium cacodylate buffer (10 mM, pH 7.0) in the presence of sodium
azide (100 mM) and sonicated calf thymus DNA (10 µM base pair
concentration) was photoirradiated with a transilluminator (366 nm) at
0 °C for 1 h. Photoirradiated DNA recovered by ethanol precipitation
was treated as described below and electrophoresed on a sequencing
gel containing 15% polyacrylamide and 7 M urea: lane 1, 5, nonheated
DNA; lane 2, 5, heated DNA (90 °C, 30 min) in the presence of
piperidine (10% v/v); lane 3, 6, nonheated DNA; lane 4, 6, heated DNA
(90 °C, 30 min) in the presence of piperidine (10% v/v); lane 5,
Maxam-Gilbert A+G sequencing reaction.
N-2 amino group by photogenerated benzoylketene as indicated
in the model photoreaction of DBDM 1 with guanosine
derivative 11 giving 12. While the exact nature of the reaction
eventually resulting in a specific cleavage at G18 by hot
piperidine treatment was not clear at this moment, we suggest
that acylation of the most nucleophilic guanine N7 by electro-
philic benzoylketene would be the origin for the G18 cleavage
by hot piperidine treatment of the cross-linked oligomer.
hydrogen abstraction by photogenerated carbene were also
detected in both photoreactions. A relatively strong cleavage
band was also observed at G14 in the photoreaction of 6. The
relative intensity of the cross-linked band and the G18 cleavage
band to the band of unchanged 23 was compared for 5 and 6
(Table 3). As clear from Table 3, with increasing the length of
the complementary strand of the conjugate, the efficiency for
both cross-linking and G18 cleavage increased considerably.
In order to know the site selectivity for the G cleavage,
photoinduced cleavage of 25-mer ODN 5′-d(AGTGCCACC-
TGACG14TG16CG18TG20CG22TCT)-3′ (24) having five guanine
residues G14, G16, G18, G20, and G22 near the 3′-end of the
complementary sequence (italic) was investigated. The photo-
reaction of 6 in the presence of 24 was carried out and analyzed
by polyacrylamide gel electrophoresis (Figure 6). The site of
It was expected that the efficiency for both cross-linking and
strand cleavage would increase with increasing length of the
complementary sequence of DBDM-ODN conjugates due to
increased duplex stability. In order to compare the lengths of
DBDM-ODN conjugates, we examined the photoreactions of
8-mer conjugate 5 and 15-mer conjugate 6 in the presence of
23 by polyacrylamide gel electrophoresis (Figure 5). Melting
temperatures for duplexes 5/23 and 6/23 measured in 100 mM
sodium chloride and 10 mM sodium cacodylate buffer (pH 7.0)
at 100 µM base concentration were 37.0 and 64.5 °C, respec-
tively. In each case, distinct cross-linked bands were observed,
and hot piperidine treatment produced the intense cleavage band
at G18. Minor bands at T17, C16, and T15 probably due to the

7632 J. Am. Chem. Soc., Vol. 119, No. 33, 1997
Nakatani et al.
Table 3. Relative Intensity of Cross-linked Bands and G Cleavage
Bands to the Band of Unchanged 23 Obtained from Densitometry of
the Gel Shown in Figure 5a
suggest a hairpin-like conformation of the single-stranded region
of the duplex comprised by 24 and 6. A similar observation
for the cleavage of single-stranded DNA at a distal base from
the target sequence has been reported for oligonucleotide-
phenazine di-N-oxide conjugate under nonphotochemical condi-
tions.32
relative intensity (%)
5
6
lane 1
32.0
lane 2
lane 3
47.4
lane 4
cross-linked bands
G18 band
23.3
8.3
0.8
36.8
15.2
3.9
Conclusion
G14 band
Photoinduced DNA cleavage by DBDM derivatives occurred
selectively at guanine residues. Studies using DBDM-ODN
conjugates indicated that the major reaction occurred between
single-stranded DNA and the DBDM conjugate was the cross-
linking between both oligomers. Acylation of N7 and N-2
amino group of guanine residues by photogenerated electrophilic
ketene was suggested to be the major reaction for the cross-
linking. Upon heating with piperidine, cross-linked oligomers
at guanine N7 were immediately decomposed to result in a
selective cleavage at the cross-linked site. DNA cleavage
experiments using ODN having multiple guanine sites indicated
that the most efficient cleavage site is the guanine which is next
to the 3′-end of the complementary sequence.
a The relative intensity (%) of cross-linked bands and cleavage bands
(G18, G14) to the band of unchanged 23 (100%) was calculated by
using band density determined by densitometric analysis of the gel
shown in Figure 5.
In general, it was not easy for conventional photochemical
DNA cleavers to cut DNA at specific single site, due to the
diffusion of photogenerated reactive species.13,26 The DBDM-
linked ODN can effectively produce electrophilic ketene pos-
sessing an intrinsic reaction selectivity toward most nucleophilic
guanine base among other nucleobases. Therefore, special
emphasis is given to that DBDM-ODN conjugates are a very
useful class of photonucleases that can cleave DNA at a
predetermined guanine site. Furthermore, the reagent DBDM-
OSu (4) can be used as a convenient and effective photoinduc-
ible electrophile for the cross-linking or modification of
biomolecules.
Experimental Section
Melting points were determined with a Yanagimoto micro melting
point apparatus and are uncorrected. 1H NMR spectra were measured
with Varian GEMINI 200 (200 MHz) or JEOL JNM R-400 (400 MHz)
spectrometers. Coupling constants (J values) are represented in Hz.
13C NMR spectra were measured with Varian GEMINI 200 (50 MHz)
spectrometer. The chemical shifts are expressed in ppm downfield from
tetramethylsilane, using residual solvent as an internal standard. IR
spectra were recorded on a JASCO FT-IR-5M spectrophotometer. A
JASCO 660 spectrophotometer was used for absorption spectra
measurements. Mass spectra were recorded on a JEOL JMS DX-300
or a JEOL JMS SX-102A spectrometer. Photoirradiation at 366 nm
was carried out using a Funakoshi TEL-33 transilluminator. Sequence
gel electrophoresis was carried out on a Gibco BRL Model S2
apparatus. Densitometric analysis of the gel was carried out using BIO-
RAD GS-700 imaging densitometer with analytical software Molecular
Analyst (ver. 2.1). Wakogel C-200 was used for silica gel flash
chromatography. Precoated TLC plates Merck silica gel 60 F254 was
used for monitoring reactions and also for preparative TLC. HPLC
was performed on cosmosil 5C18AR and 5C18MS columns and
DAISOPAC SP-120-5-ODS-AP column with Gilson Chromatography
Model 305 using UV detector Model 118 at 254 nm. Gel permeation
chromatography (GPC) was carried out on JAI LC-908 using polysty-
rene column. Ether and tetrahydrofuran (THF) were distilled under
N2 from sodium/benzophenone ketyl prior to use. All enzymes used
in these studies were from commercial sources. [γ-32P]ATP (6000 Ci/
mmol) was obtained from Amersham.
Figure 6. Photoinduced cleavage of 32P-5′-end-labeled 25-mer 24 in
the presence of DBDM-ODN conjugate 6. The reaction mixture
containing 6 (1 µM) and 32P-5′-end-labeled 24 in sodium cacodylate
buffer (10 mM, pH 7.0) in the presence of sodium azide (100 mM)
and sonicated calf thymus DNA (10 µM base pair concentration) was
photoirradiated with a transilluminator (366 nm) at 0 °C for 1 h.
Photoirradiated DNA recovered by ethanol precipitation was treated
as described below and electrophoresed on a sequencing gel containing
15% polyacrylamide and 7 M urea: lane 1, nonheated DNA; lane 2,
heated DNA (90 °C, 30 min); lane 3, heated DNA (90 °C, 30 min) in
the presence of piperidine (10% v/v); lane 4, Maxam-Gilbert A+G
sequencing reaction.
the most effective guanine cleavage after hot piperidine treat-
ment was G16, the most proximal site to the 3′-end of the
complementary sequence (lane 3). Cleavages at G14, G18, and
G20 were very weak compared to G16, although a moderate
cleavage band was detected at G22 which is located on seven
bases away from the 3′-end of the complementary sequence.
The efficient cleavage at the most distal guanine, G22, may
Photoreaction of DBDM with Guanosine Derivative 11.
A
benzene solution (2 mL) of 1 (10 mg, 0.04 mmol) and 3′,5′-O-di(tert-
butyldiphenylsilyl)-2′-deoxyguanosine (11) (10 mg, 0.01 mmol) was
(32) Nagai, K.; Hecht, S. M. J. Biol. Chem. 1991, 266, 23994-24002.
(33) Sambrook, J.; Fritsch, E. F.; Maniatis, T. Molecular Cloning. A
Laboratory Mannual, 2nd ed.; Cold Spring Harbor Laboratories Press: Cold
Spring Harbor, NY, 1989.

Guanine Specific DNA CleaVage
J. Am. Chem. Soc., Vol. 119, No. 33, 1997 7633
irradiated with high pressure mercury lamp (400 W) through a Pyrex
filter at 0 °C for 2 h. After concentration, the crude product was purified
by silica gel column chromatography to give 12 (1.9 mg, 15%).
Alternatively, a benzene solution of 1 (150 mg, 0.60 mmol) and 11
(150 mg, 0.20 mmol) was refluxed for 3 h to give 12 (116 mg, 58%)
after concentration and purification by silica gel column chromatog-
raphy: 1H NMR (CDCl3, 400 MHz) δ 11.74 (major isomer) and 11.92
(minor isomer) (br, total 1H), 10.45 (major isomer) and 10.47 (br, total
1H), 7.15-7.75, 7.97 (m, 2H), 6.35 (dd, J ) 8.1, 5.5 Hz, major isomer),
6.19 (dd, J ) 8.2, 5.5 Hz, minor isomer), 5.78-5.80 (1H), 4.53 (minor
isomer) and 4.59 (major isomer) (total 1H), 4.06 (minor isomer) and
4.11 (major isomer) (total 1H), 3.33-3.44 and 3.52-3.62 (2H), 2.09-
2.43 (2H), 0.90-0.92 and 1.10-1.12 (9H, tert-Bu); FABMS (NBA)
(relative intensity), m/e 966 [(M + H)+] (10), 374 (100, base peak);
HRMS calcd for C20H16O3N5 [(M + H - ribose with two TBDPS)+]
374.1255, found 374.1239.
Methyl 4-(1,3-Dioxo-3-phenylpropyl)benzoate (13). To a suspen-
sion of sodium hydride (1.56 g, 60% oil dispersion, 39.0 mmol, washed
with THF) in anhydrous THF (50 mL) was added a THF solution (20
mL) of acetophenone (3.65 g, 30.4 mmol) and dimethyl terephthalate
(5.83 g, 30.0 mmol) for 30 min at room temperature, and the mixture
was heated at reflux for 7 h. The reaction mixture was cooled on ice
and quenched with addition of concentrated HCl (3.2 mL). The crude
material obtained by concentration in Vacuo was dissolved into CH2Cl2
and washed with water. The organic phase was washed with brine,
dried over anhydrous MgSO4, filtered, and concentrated in Vacuo. The
crude product was roughly purified by flash chromatography (SiO2,
100% CH2Cl2) to give a yellow solid (6.29 g) containing mainly 13:
1H NMR (400 MHz, CDCl3) δ 16.7 (br, 1H), 8.13-7.95 (7H), 7.57-
7.44 (5H), 6.85 (s, 1H), 3.92 (s, 3H); 13C NMR (50 MHz, CDCl3) δ
187.4, 183.7, 166.5, 139.6, 135.5, 133.3, 132.9, 129.9, 128.8, 127.4,
127.1, 93.8, 52.3. This material was used for the preparation of 15
without further purification.
N-(N′-tert-Butoxycarbonyl-4-aminobutyl)-4-(1,3-dioxo-3-phenyl-
propyl)benzamide (15). To a solution of 7 (6.29 g, 22.3 mmol) in
THF (100 mL) was added a solution of LiOH (8.15 g, 194 mmol) in
water (100 mL) at 5 °C, and the mixture was stirred at room temperature
for 18 h. The reaction mixture was poured into water and extracted
with CH2Cl2. The organic phase was discarded. The alkaline aqueous
layer was acidified with 1 N HCl, and a resulted pale green precipitate
was filtered off. Recrystallization of the precipitate from ethanol gave
4-(1,3-dioxo-3-phenylpropyl)benzoic acid (14) (4.92 g, 83%) as a pale
yellow solid. This material was used for the following reaction without
further purification. To a solution of 14 (504 mg, 1.88 mmol), PyBOP
(benzotriazole-1-yloxytri(pyrolidino)phosphonium hexafluorophos-
phonate) (1.63 g, 3.13 mmol), and triethylamine (580 mg, 5.74 mmol,
0.80 mL) in DMF (10 mL) was added N-tert-butoxycarbonyl-1,4-
diaminobutane (530 mg, 2.81 mmol) at 0 °C, and the mixture was stirred
at ambient temperature for 16 h. The reaction mixture was diluted
with H2O and extracted with ethyl acetate. The organic phase was
washed with 5% KHSO4 and brine, dried over anhydrous MgSO4,
filtered, and concentrated in Vacuo. The crude product was purified
by flash chromatography (SiO2, 0-5% methanol/EtOAc) to give 15
(706 mg, 86%) as a white solid: mp 160.0-161.5 °C; 1H NMR (CDCl3,
400 MHz) δ 8.04-7.88 (6H), 7.58-7.46 (3H), 6.86 (s, 1H), 6.71 (br,
1H), 4.63 (br, 1H), 3.50 (q, 2H, J ) 6.3 Hz), 3.16 (m, 2H), 1.66 (m,
2H), 1.60 (m, 2H), 1.42 (s, 9H); 13C NMR (CDCl3, 50 MHz) δ 187.0,
184.3, 166.9, 156.5, 138.1, 138.1, 135.6, 132.9, 128.9, 127.5, 127.4,
93.7, 79.4, 39.8, 39.7, 28.3, 27.8, 26.1; FABMS (NBA) m/e 439 [(M
+ H)+]. Anal. Calcd for C25H30O5N2: C, 68.47; H, 6.90; N, 6.39.
Found: C, 68.26; H, 6.87; N, 6.39.
1H), 4.67 (br, 1H), 3.43 (q, 2H, J ) 6.3 Hz), 3.12 (q, 2H, J ) 6.5 Hz),
1.60 (m, 2H), 1.54 (m, 2H), 1.41 (s, 9H); 13C NMR (CDCl3, 50 MHz)
δ 186.0, 185.9, 166.3, 156.3, 139.3, 138.0, 136.8, 132.9, 128.54, 128.49,
128.3, 127.0, 84.5, 79.4, 39.8, 28.4, 27.8, 26.2; IR (CHCl3) 1703, 1697,
1651, 1515, 1318, 1285, 1264, 1169 cm-1; FABMS (NBA) m/e 465
[(M + H)+].
N-(4-Aminobutyl)-4-(2-diazo-1,3-dioxo-3-phenylpropyl)benz-
amide Hydrochloride (3). A solution of 16 (102 mg, 0.22 mmol) in
HCl (3.2 N in EtOAc, 10 mL) was stirred at room temperature for 2 h.
Solvent was removed in Vacuo, and the crude product was purified by
recrystallization from methanol-ether to give hydrochloride of 3 (46.9
1
mg, 53%) as a white solid: mp 133 °C dec; H NMR (CD3OD, 400
MHz) δ 7.82-7.63 (6H), 7.49 (m, 2H), 7.38 (m, 2H), 3.44 (m, 2H),
2.97 (m, 2H), 1.72 (m, 4H); 13C NMR (CD3OD, 50 MHz) δ 188.3,
188.1, 169.4, 141.6, 139.0, 138.73, 134.1, 129.8, 129.7, 128.5, 86.1,
40.4, 40.1, 27.4, 25.9; UV (H2O) 366.0 (ꢀ 220) 287.6 (ꢀ 3421); FABMS
(NBA) m/e 365 [(M - Cl)+]. Anal. Calcd for C20H21O3N4Cl: C,
59.93; H, 5.28; N, 13.98. Found: C, 60.01; H, 5.23; N, 13.68.
1-[4-(1,3-Dioxolan-2-yl)phenyl]-3-phenyl-1,3-propandione (17).
To a mixture of methyl 4-formylbenzoate (2.53 g, 15.4 mmol) and
ethylene glycol (5.00 g, 80.7 mmol) in benzene (50 mL) was added a
catalytic amount of p-toluenesulfonic acid (28.8 mg, 0.15 mmol), and
the mixture was refluxed for 6 h with azeotropical removal of H2O.
The reaction mixture was diluted with CHCl3, washed with saturated
NaHCO3 and brine, dried over anhydrous MgSO4, filtered, and
concentrated in Vacuo. The crude material was purified by bulb-to-
bulb distillation to yield methyl 4-(1,3-dioxolan-2-yl)benzoate (3.04
g, 95%) as a colorless oil: bp 130-135 °C (5 mmHg); TLC Rf (hexane:
ethyl acetate ) 4:1) 0.41; 1H NMR (CDCl3, 400 MHz) δ 8.03 (dt, 2H,
J ) 8.6, 1.8 Hz), 7.53 (dt, 2H, J ) 8.2, 1.8 Hz), 5.83 (s, 1H), 4.09 (m,
2H), 4.03 (m, 2H), 3.89 (s, 3H); 13C NMR (CDCl3, 50 MHz) δ 167.0,
142.9, 130.9, 129.8, 126.5, 103.0, 65.3, 52.0; IR (neat) 1730, 1719,
1436, 1280, 1113, 1085, 1019 cm-1. Anal. Calcd for C11H12O4: C,
63.45; H, 5.81. Found: C, 63.17; H, 5.87. To a suspension of washed
NaH (576 mg, 23.9 mmol) in THF (25 mL) was added a solution of
acetophenone (2.17 g, 18.0 mmol) and acetal (3.75 g, 18.0 mmol) in
THF (25 mL) at room temperature for 2 h, and the resulting mixture
was refluxed for 1.5 h. After the reaction mixture was cooled to
ambient temperature, it was diluted with ethyl acetate and neutralized
with 1 N HCl. The organic layer was separated, washed with brine,
dried over anhydrous MgSO4, filtered, and concentrated in Vacuo. The
crude product was purified by silica gel chromatography (0-20% ethyl
acetate/hexane gradient elution) to give 17 (2.63 g, 49%) as a colorless
oil: bp 170-173 °C (0.5 mmHg); TLC Rf (hexane:ethyl acetate )
4:1) 0.29; 1H NMR (CDCl3, 400 MHz) δ 7.96-8.00 (4H), 7.55-7.60
(2H), 7.53 (m, 1H), 7.46-7.50 (2H), 6.84 (s, 1H), 5.87 (s, 1H), 4.12
(m, 2H), 4.06 (m, 2H); 13C NMR (CDCl3, 50 MHz) δ 186.3, 185.3,
142.5, 136.3, 135.6, 132.6, 128.8, 127.3, 126.9, 103.0, 93.3, 65.3; IR
(neat) 1601, 1564, 1302, 1229, 1086 cm-1
.
Anal. Calcd for
C18H16O4: C, 72.96; H, 5.44. Found: C, 73.14; H, 5.54.
1-(4-Hydroxymethylphenyl)-3-phenyl-1,3-propandione (18). To
a solution of 17 (2.63 g, 8.88 mmol) in THF (100 mL) was added
concentrated HCl (4.6 mL, 56 mmol), and the mixture was stirred at
ambient temperature for 2 h. The reaction mixture was neutralized
with 1 N NaOH (56 mL), diluted with CHCl3 (100 mL), washed with
saturated NaHCO3 and brine, dried over anhydrous Na2SO4, filtered,
and concentrated in Vacuo to give 4-(1,3-dioxo-3-phenylpropyl)-
benzaldehyde (2.15 g, 92%) as a yellow powder: TLC Rf (hexane:
ethyl acetate ) 4:1) 0.41; mp 141.0-142.0 °C (recrystallized from
1
CHCl3-hexane); H NMR (CDCl3, 400 MHz) δ 10.09 (s, 1H), 8.12
(m, 2H), 7.97-8.01 (4H), 7.58 (m, 1H), 7.47-7.52 (2H), 6.89 (s, 1H);
13C NMR (CDCl3, 50 MHz) δ 191.8, 187.9, 183.1, 140.7, 138.8, 135.6,
133.1, 130.0, 128.9, 127.8, 127.5, 94.2; IR (CHCl3) 1705, 1600, 1564,
1227 cm-1. Anal. Calcd for C16H12O3: C, 76.18; H, 4.79. Found:
C, 75.92; H, 4.72. To a solution of the aldehyde (1.28 g, 5.08 mmol)
in 30% ethanol in CH2Cl2 (83 mL) was added sodium borohydride
(220 mg, 5.82 mmol) at -78 °C, and the mixture was stirred at -78
°C for 1 h. The reaction was quenched with addition of acetoaldehyde
(20 mL), and the resulting mixture was warmed to ambient temperature,
diluted with CHCl3 (20 mL), washed with saturated NaHCO3 and brine,
dried over anhydrous Na2SO4, filtered, and concentrated in Vacuo. The
crude product was purified by silica gel chromatography (0-40% ethyl
N-(N′-tert-Butoxycarbonyl-4-aminobutyl)-4-(2-diazo-1,3-dioxo-3-
phenylpropyl)benzamide (16). To a solution of 15 (157 mg, 0.36
mmol) and triethylamine (80.2 mg, 0.79 mmol, 0.11 mL) in DMF (2
mL) was slowly added p-toluenesulfonyl azide (286 mg, 1.45 mmol)
at 0 °C, and the mixture was stirred at ambient temperature for 4 h.
The reaction mixture was diluted with H2O and extracted with EtOAc.
The organic phase was washed with brine, dried over anhydrous
Na2SO4, filtered, and concentrated in Vacuo. The crude product was
purified by flash chromatography (SiO2, 0-5% methanol/CH3Cl) to
give 16 (134 mg, 80%) as a white foam: 1H NMR (CDCl3, 400 MHz)
δ 7.72 (m, 2H), 7.58-7.54 (4H), 7.44 (m, 1H), 7.31 (m, 2H), 6.76 (br,

7634 J. Am. Chem. Soc., Vol. 119, No. 33, 1997
Nakatani et al.
acetate/hexane gradient elution) to give 18 (641 mg, 50%) as colorless
needles: TLC Rf (hexane:ethyl acetate ) 1:1) 0.44; mp 105.0-106.0
°C (recrystallized from CHCl3-hexane); 1H NMR (CDCl3, 400 MHz)
δ 16.8 (m, 1H), 7.96-7.99 (4H), 7.54 (m, 1H), 7.45-7.50 (4H), 6.84
(s, 1H), 4.78 (s, 2H); 13C NMR (CDCl3, 50 MHz) δ 186.0, 185.8, 145.7,
135.7, 134.9, 132.6, 128.8, 127.6, 127.3, 127.0, 93.1, 64.6; IR (CHCl3)
7.44 (m, 1H), 7.27-7.34 (4H), 5.05 (s, 2H), 4.80 (br, 1H), 3.60 (t, J )
6.4 Hz, 2H), 3.60 (t, J ) 6.4 Hz, 2H), 3.17 (m, 2H), 1.46-1.58 (4H),
1.30-1.40 (4H); FABMS (NBA), m/e 424 [(M + H)+]; HRMS calcd
for C23H25N3O5 [(M + H)+] 424.1872, found 424.1852.
Preparation of Oligonucleotides ODN8 and ODN15 Having an
Aminoalkyl Linker. The hexamethyleneamino linker was attached
in the last step of the synthesis of 5′-d(ACGTCAGGTGGCACT)-3′ or
5′-d(ACGTCAGG)-3′ using a monomethoxytrityl (MMTr) protected
precursor (Clontech) that was designed for the routine protocols of
automated coupling. The monomethoxytrityl protected amino arm
linker-oligonucleotide was purified by reverse phase chromatography
on a DAISOPAC column (6.0 × 150 mm, elution with a solvent mixture
of 0.1 M triethylamine acetate, pH 7.0, linear gradient over 40 min
from 5% to 45% acetonitrile at a flow rate of 1.5 mL/min, MMTr
protected ODN8: t ) 25.8 min, MMTr protected ODN15: t ) 28.8
min). The protecting group was removed by treating the crude product
with 80% acetic acid for 1 h under ambient temperature. The acetic
acid was removed using vacuum rotary evaporator to dryness. The
deprotected MMTr group was removed from the aqueous phase by
extraction with diethyl ether. The purity of ODN was confirmed to be
over 95% by HPLC analysis on a DAISOPAC column (6.0 × 150
mm, elution with a solvent mixture of 0.1 M triethylamine acetate, pH
7.0, linear gradient over 40 min from 5% to 45% acetonitrile at a flow
rate of 1.5 mL/min, ODN8: t ) 7.5 min, ODN15: t ) 10.5 min).
DBDM-ODN Conjugates 5 and 6. To an acetonitrile solution (20
µL) of 4 (42 µg, 100 nmol) was added ODN8 or ODN15 (0.42 mM,
10 µL) and 10 µL of saturated NaHCO3 and kept at ambient temperature
for about 1 h. Monitor of the coupling reaction and purification of
DBDM-ODN conjugate were carried out by HPLC on a DAISOPAC
column (6.0 × 150 mm, elution with a solvent mixture of 0.1 M
triethylamine acetate, pH 7.0, linear gradient over 30 min from 5% to
35% acetonitrile at a flow rate of 1.5 mL/min, 5: t ) 19.5 min, 6: t
) 23.4 min). Structures of 5 and 6 were confirmed by enzymatic
digestion with calf intestine alkaline phosphatase and snake venom
phosphodiesterase to produce four nucleosides and DBDM derivative
22 on HPLC (Figure 1) (DAISOPAC column, 6.0 × 150 mm, elution
with a solvent mixture of 0.1 M triethylamine acetate, pH 7.0, linear
gradient over 60 min from 5% to 65% acetonitrile at a flow rate of 1.5
mL/min, 2′-deoxycytidine: t ) 3.1 min, 2′-deoxyguanosine: t ) 4.8
min, thymidine: t ) 5.8 min, 2′-deoxyadenosine: t ) 7.2 min, 22: t
) 41.3 min). The concentrations of 5 and 6 were determined by
comparison of the peak areas of the four nucleosides obtained by
enzymatic digestion with those of authentic samples.
Preparation of 32P-5′-End-Labeled DNA Restriction Fragments.
Digestion of supercoiled pBR322 plasmid DNA with EcoR I restriction
endonuclease followed by treatment with bacterial alkaline phosphotase
gave a linearized pBR322 with hydroxyl terminus at its 5′-end.
Labeling at the 5′-end of the linearized DNA was achieved by treatment
with [γ-32P]ATP and T4 polynucleotide kinase using standard proce-
dure.33 After labeling, the labeled DNA was further digested with Rsa
I restriction endonuclease to yield two 5′-end-labeled DNA fragments
(167 and 514 base pair) which were purified on 6% preparative
nondenaturing polyacrylamide gel. The labeled DNA was recovered
from the gel by a crush and soak method.27
Photoinduced Cleavage of 32P-5′-End-Labeled DNA by 3. Cleav-
age reactions were carried out in a 100 µL total volume containing
calf thymus DNA (1 µM base pair concentration), 3 × 104 cpm 32P-
5′-end-labeled DNA restriction fragment, and 3 (50 µM) in 5 mM
sodium cacodylate buffer at pH 7.0. The solution was irradiated at a
distance of 10 cm with transilluminator (366 nm) at 0 °C for 1 h. After
irradiation, the reaction mixture was ethanol precipitated with addition
of 3 M sodium acetate (20 µL) and ethanol (900 µL). The precipitated
DNA was washed with 80% cold ethanol (100 µL) and dried in Vacuo.
The recovered DNA was dissolved in 100 µL of water or 10% (v/v)
piperidine and heated at 90 °C for 30 min. The DNA was recovered
by ethanol precipitation and resuspended in 10-15 µL of 80%
formamide loading buffer (80% formamide, 1 mM EDTA, 0.1% xylene
cyanole, and 0.1% bromophenol blue). All DNA samples obtained
above and Maxam-Gilbert G+A and C+T sequencing markers27 were
heat denatured at 90 °C for 1 min and quick-chilled on ice. The samples
(1-2 µL, 3×103 cpm) were loaded onto 8% polyacrylamide and 7 M
urea sequencing gel and electrophoresed at 1900 V for approximately
1611, 1601, 1563, 1466, 1381, 1096 cm-1
.
Anal. Calcd for
C16H14O3: C, 75.57; H, 5.55. Found: C, 75.48; H, 5.32.
2-Diazo-1-(4-hydroxymethylphenyl)-3-phenyl-1,3-propandione (19).
To a mixture of 18 (530 mg, 2.09 mmol) and triethylamine (275 mg,
2.72 mmol) in CH2Cl2 (10 mL) was slowly added p-toluenesulfonyl
azide (1.24 g, 6.30 mmol), and the mixture was stirred at ambient
temperature for 15 h. Solvent was removed under reduced pressure,
and the crude product was purified by silica gel chromatography (25-
50% ethyl acetate/hexane gradient elution) to give 19 (585 mg, 99%)
1
as a pale yellow foam: TLC Rf (hexane:ethyl acetate ) 1:1) 0.39; H
NMR (CDCl3, 400 MHz); δ 7.53-7.58 (4H), 7.44 (m, 1H), 7.28-
7.34 (4H), 4.66 (d, 2H, J ) 3.8 Hz), 1.99 (brs, 1H); 13C NMR (CDCl3,
50 MHz) δ 186.6, 186.5, 146.2, 137.0, 136.0, 132.8, 128.7, 128.5, 128.4,
126.4, 84.0, 64.2; FABMS (NBA), m/e 281 [(M + H)+].
4-(2-Diazo-3-phenyl-1,3-propanedion-1-yl)phenylmethyl N-Hy-
droxysuccinimidyl Carbonate (DBDM-OSu) (4). To a mixture of
N,N-disuccinimidyl carbonate (1.50 g, 5.84 mmol) and 19 (580 mg,
2.07 mmol) in DMF (7 mL) was added 2,6-lutidine (338 mg, 3.15
mmol), and the mixture was stirred at ambient temperature for 15 h.
Solvent was removed in Vacuo (below 35 °C), and the crude residue
was purified by gel permeation chromatography (GPC) to give 4 (712
mg, 82%) as a yellow foam: TLC Rf (toluene:ethyl acetate ) 2:1)
1
0.63; H NMR (CDCl3, 400 MHz) δ 7.51-7.57 (4H), 7.43 (m, 1H),
7.28-7.34 (4H), 5.26 (s, 2H), 2.83 (s, 4H); 13C NMR (CDCl3, 50 MHz)
δ 186.4, 186.2, 168.7, 151.7, 137.7×2, 136.9, 132.9, 128.9, 128.5,
128.4, 128.0, 84.9, 71.4, 25.2; UV (CH3CN) 298.8 (ꢀ 2700); IR (CHCl3)
1813, 1789, 1743, 1643, 1263, 1220 cm-1; FABMS (NBA), m/e 422
[(M + H)+]; HRMS calcd for C21H16O7N3 [(M + H)+] 422.0989, found
422.1023.
DBDM-Lysine Adduct 20. To a solution of 4 (81.6 mg, 0.19 mmol)
and NR-Boc-lysine methyl ester (278 mg, 1.1 mmol) in DMF (4 mL)
and H2O (4 mL) was added saturated NaHCO3 (2 mL), and the mixture
was stirred for 1 h. The reaction mixture was diluted with EtOAc and
H2O, and the organic layer was separated, dried over anhydrous MgSO4,
filtered, and concentrated in Vacuo. The crude product was purified
by GPC to give adduct (118 mg, quantitative). This material was
dissolved in EtOAc (20 mL) and treated with concentrated HCl (0.5
mL) at 0 °C for 10 min. Solvent was removed under reduced pressure
to give 20 (72.1 mg, 76%) as a pale yellow foam: 1H NMR (CDCl3,
400 MHz) δ 7.60-7.63 (4H), 7.49 (m, 1H), 7.32-7.39 (4H), 5.07 (s,
2H), 4.02 (t, 1H, J ) 6.4 Hz), 3.82 (s, 3H), 3.13 (t, 2H, J ) 6.6 Hz),
1.85-2.00 (2H), 1.30-1.60 (4H); FABMS (NBA), m/e 467 [(M +
H)+]; HRMS calcd for C24H27O6N4 [(M + H)+] 467.1931, found
467.1957.
DBDM-Phenylalanine Adduct 21. To a solution of 4 (84 mg, 0.20
mmol) and L-phenylalanine ethyl ester hydrochloride (154 mg, 0.67
mmol) in DMF (2 mL) and water (2 mL) was added saturated NaHCO3
(1.2 mL) and stirred at ambient temperature for 1 h. The reaction
mixture was diluted with EtOAc and H2O, and the organic layer was
washed with water and brine, dried over anhydrous MgSO4, filtered,
and concentrated in Vacuo. The crude product was purified by GPC
to give 21 (100 mg, 99%) as a white solid: TLC Rf (toluene:ethyl
acetate ) 2:1) ) 0.63; 1H NMR (CDCl3, 400 MHz) δ 7.53-7.57 (4H),
7.43 (m, 1H), 7.20-7.34 (7H), 7.10 (m, 2H), 5.23 (d, 1H, J ) 8.2
Hz), 5.06 (s, 2H), 4.61 (dt, 1H, J ) 8.2, 7.1 Hz), 4.16 (q, 2H, J ) 7.0
Hz), 3.11 (dd, 1H, J ) 13.9, 5.9 Hz), 3.08 (dd, 1H, J ) 13.7, 5.9 Hz),
1.22 (t, 3H, J ) 7.1 Hz); FABMS (NBA), m/e 500 [(M + H)+]; HRMS
calcd for C28H25O6N3 [(M + H)+] 500.1823, found 500.1857.
DBDM-6-Amino-1-butanol Adduct 22. To a solution of 4 (25.2
mg, 0.06 mmol) and 6-amino-1-hexanol (14.6 mg, 0.13 mmol) in
CH3CN (1 mL) and H2O (1 mL) was added saturated NaHCO3 (100
µL), and the mixture was stirred for 30 min. The reaction mixture
was concentrated and extracted with chloroform. The organic layer
was dried over anhydrous MgSO4, filtered, and concentrated in Vacuo.
The crude product was purified by GPC to give 22 (17.8 mg, 70%) as
a pale yellow oil: 1H NMR (CDCl3, 400 MHz) δ 7.56-7.57 (4H),

Guanine Specific DNA CleaVage
J. Am. Chem. Soc., Vol. 119, No. 33, 1997 7635
2 h. The gel was dried and exposed to X-ray film with intensifying
sheet at -70 °C.
of 10 cm at 0 °C for 1 h. After irradiation, the reaction mixture was
ethanol precipitated with addition of 50 µL of 3 M sodium acetate and
900 µL of ethanol. The precipitated DNA was washed with 200 µL
of 80% cold ethanol and dried in Vacuo. The precipitated DNA was
dissolved in 100 µL of water or in 100 µL of 10% piperidine (v/v) and
heated at 90 °C for 30 min. The solution was concentrated to dryness
using vacuum rotary evaporator and resuspended in 10-15 µL of 80%
formamide loading buffer (a solution of 80% v/v formamide, 1 mM
EDTA, 0.1% xylene cyanol, and 0.1% bromophenol blue). All DNA
samples obtained above and Maxam-Gilbert G+A and C+T sequenc-
ing markers were heat denatured at 90 °C for 1 min and quick-chilled
on ice. The samples (1-2 µL, 5-10 × 103 cpm) were loaded onto
15% (19:1) polyacrylamide and 7 M urea sequencing gels and
electrophoresed at 1900 V for approximately 2 h. The gel was dried
and exposed to X-ray film with intensifying sheet at -70 °C.
Preparation of 32P-5′-End-Labeled 25-Mer Oligomers 23 and 24.
Single-stranded 25-mer DNA oligomers 5′-d(AGTGCCACCTGA-
CGTCTCGTCTCT)-3′ (23) and 5′-d(AGTGCCACCTGACGTGCGT-
GCGTCT)-3′ (24) were purchased from Funakoshi CO., Ltd. Con-
centration of oligonucleotides was determined by HPLC analysis of
2′-deoxynucleosides after enzymatic digestion of the ODN. The 25-
mer ODN (450 pmol/strand) was 5′-end-labeled by phosphorylation
with 5 µL of [γ-32P]ATP (Amersham, 370 MBq/µL) and 4 µL of T4
polynucleotide kinase (Takara, 10 units/µL) using standard procedures.33
The 5′-end-labeled DNA was recovered by ethanol precipitation and
further purified by 15% preparative nondenaturing gel electrophoresis
and isolated by the crush and soak method.
Photoinduced Cleavage of 32P-5′-End-Labeled 25-Mers by DBDM-
ODN Conjugates. Photoinduced cleavage of 25-mer ODN was carried
out in a 50 µL total volume containing sonicated calf thymus DNA
(10 µM base pair concentration), 3 × 104 cpm 32P-5′-end-labeled 25-
mer ODN, NaCl (100 mM), NaN3 (100 mM), and 5 (50 µM) or 6 (1
µM) in 10 mM sodium cacodylate buffer at pH 7.0. The reaction
mixture was irradiated with a transilluminator (366 nm) at a distance
Acknowledgment. This work was supported by Grant-in-
Aid for Priority Research, Ministry of Education and CREST
of Japan Science and Technology Corporation.
JA970598J