Oxidative stress-induced structural changes in the microtubule-associated flavoenzyme Irc15p from Saccharomyces cerevisiae

Article abstract of DOI:10.1002/pro.3517

The genome of the yeast Saccharomyces cerevisiae encodes a canonical lipoamide dehydrogenase (Lpd1p) as part of the pyruvate dehydrogenase complex and a highly similar protein termed Irc15p (increased recombination centers 15). In contrast to Lpd1p, Irc15p lacks a pair of redox active cysteine residues required for the reduction of lipoamide and thus it is very unlikely that Irc15p performs a similar dithiol-disulfide exchange reaction as reported for lipoamide dehydrogenases. We expressed IRC15 in Escherichia coli and purified the produced protein to conduct a detailed biochemical characterization. Here, we show that Irc15p is a dimeric protein with one FAD per protomer. Photoreduction of the protein generates the fully reduced hydroquinone without the occurrence of a flavin semiquinone radical. Similarly, reduction with NADH or NADPH yields the flavin hydroquinone without the occurrence of intermediates as observed for lipoamide dehydrogenase. The redox potential of Irc15p was ?313 ± 1 mV and is thus similar to lipoamide dehydrogenase. Reduced Irc15p is oxidized by several artificial electron acceptors such as potassium ferricyanide, 2,6-dichlorophenol-indophenol, 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide, and menadione. However, disulfides such as cystine, glutathione, and lipoamide were unable to react with reduced Irc15p. Limited proteolysis and SAXS-measurements revealed that the NADH-dependent formation of hydrogen peroxide caused a substantial structural change in the dimeric protein. Therefore, we hypothesize that Irc15p undergoes a conformational change in the presence of elevated levels of hydrogen peroxide, which is a putative biomarker of oxidative stress. This conformational change may in turn modulate the interaction of Irc15p with other key players involved in regulating microtubule dynamics.

Full text of DOI:10.1002/pro.3517

Article
Protein Science
DOI 10.1002/pro.3517
Oxidative stress induced structural changes in the microtubule-associated
flavoenzyme Irc15p from Saccharomyces cerevisiae
Karin Koch1‡, Emilia Strandback1‡, Shalinee Jha1, Gesa Richter2, Benjamin Bourgeois2,
Tobias Madl2 and Peter Macheroux1,*
1Institute of Biochemistry, Graz University of Technology, Austria
2Institute of Molecular Biology and Biochemistry, Medical University of Graz, Austria
*to whom correspondence should be addressed:
Prof. Dr. Peter Macheroux
Graz University of Technology
Institute of Biochemisty
Petersgasse 12/2
A-8010 Graz, Austria
Tel.: +43-316-873 6450
Fax: +43-316-873 6952
Email: peter.macheroux@tugraz.at
‡ The first two authors have contributed equally to this work.
This article has been accepted for publication and undergone full peer review but has not been
through the copyediting, typesetting, pagination and proofreading process which may lead to
differences between this version and the Version of Record. Please cite this article as
doi: 10.1002/pro.3517
© 2018 The Protein Society
Received: Jun 27, 2018; Revised: Sep 21, 2018; Accepted: Sep 24, 2018
This article is protected by copyright. All rights reserved.

Abstract: The genome of the yeast Saccharomyces cerevisiae encodes a canonical
lipoamide dehydrogenase (Lpd1p) as part of the pyruvate dehydrogenase complex and a
highly similar protein termed Irc15p (increased recombination centers 15). In contrast to
Lpd1p, Irc15p lacks a pair of redox active cysteine residues required for the reduction of
lipoamide and thus it is very unlikely that Irc15p performs a similar dithiol-disulfide exchange
reaction as reported for lipoamide dehydrogenases. We expressed IRC15 in Escherichia coli
and purified the produced protein to conduct a detailed biochemical characterization. Here,
we show that Irc15p is a dimeric protein with one FAD per protomer. Photoreduction of the
protein generates the fully reduced hydroquinone without the occurrence of a flavin
semiquinone radical. Similarly, reduction with NADH or NADPH yields the flavin
hydroquinone without the occurrence of intermediates as observed for lipoamide
dehydrogenase. The redox potential of Irc15p was -313 ± 1 mV and is thus similar to
lipoamide dehydrogenase. Reduced Irc15p is oxidized by several artificial electron
acceptors, such as potassium ferricyanide, 2,6-dichlorophenol-indophenol, 3-(4,5-dimethyl-2-
thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide and menadione. However, disulfides, such as
cystine, glutathione and lipoamide were unable to react with reduced Irc15p. Limited
proteolysis and SAXS-measurements revealed that the NADH-dependent formation of
hydrogen peroxide caused a substantial structural. Therefore, we hypothesize that Irc15p
undergoes a conformational change in the presence of elevated levels of hydrogen peroxide,
which is a putative biomarker of oxidative stress. This conformational change may in turn
modulate the interaction of Irc15p with other key players involved in regulating microtubule
dynamics.
Keywords: oxidative stress; thiol modification; flavin adenine dinucleotide; lipoamide
dehydrogenase; microtubule-binding protein;
Abbreviations
A. vinelandii, Azotobacter vinelandii; DCPIP, 2,6-dichlorophenol-indophenol; DTT,
dithiothreitol; E. coli, Escherichia coli; Irc15, increased recombination centers 15; LPD,
lipoamide dehydrogenase; MQ, menadione; MTT, 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-
2H-tetrazolium bromide; ROS, reactive oxygen species; S. cerevisiae, Saccharomyces
cerevisiae; S. seoulensis, Streptomyces seoulensis; STH, soluble pyridine nucleotide
transhydrogenases;
2
This article is protected by copyright. All rights reserved.

Introduction
Reactive oxygen species (ROS), such as hydrogen peroxide (H2O2), superoxide anions
−
(·O2 ), and hydroxyl radicals (·OH) are constantly generated during aerobic respiration.
Organisms employ various strategies to preserve an intrinsic balance in the overall redox
environment within the cell by simultaneously producing low levels of ROS essential for
physiological signaling processes. An imbalance between the production of ROS and the
antioxidant defenses to eliminate these toxic intermediates can lead to oxidative damage to
DNA, lipids, and proteins, generating cellular stress.1 In the recent past, an increasing
number of proteins have been identified that use reversible ROS-mediated thiol modifications
to regulate their function. Similar to other post-translational modifications, oxidative thiol
modifications are fully reversible, the extent of which depend on the reactivity and
accessibility of cysteine thiols and the concentration of ROS present. Under oxidative stress
conditions in the cell, these thiol modifications can become irreversible, leading to deleterious
effects on protein structure and function.2-4
In this study we report an uncharacterized flavoprotein from the yeast
Saccharomyces cerevisiae, which was found to be structurally sensitive to oxidative damage.
The genome of S. cerevisiae features 68 genes that were identified to encode a flavoprotein.
Despite being a widely utilized model organism biochemical information on the
flavoproteome is rather limited. For example, Irc15p (increased recombination centers 15)
has a sequence similarity of 59% to the FAD-containing yeast lipoamide dehydrogenase 1
(Lpd1p)5. Although it was demonstrated that Irc15p is associated with microtubules and
regulates their dynamics6, it is currently unclear whether the protein carries a flavin cofactor
not to mention the potential properties and function of the putative enzymatic activity. This
lack of information prompted us to recombinantly produce Irc15p and study its properties.
Lipoamide dehydrogenases (LPDs) orchestrate the reversible transfer of electrons
between dihydrolipoamide to the enzyme-bound FAD cofactor and NAD+. Generally, LPDs
possess a second redox active group that is composed of two cysteine residues capable of
forming an internal disulfide. This internal dithiol-disulfide exchange communicates the
electrons between the lipoamide and the FAD cofactor and is thus an essential asset of
LPDs7,8. LPDs also constitute a component of oxoacid dehydrogenases that are large
multienzyme complexes. In these complexes, LPDs reoxidize the covalently bound lipoamide
cofactor of the transacylase component.9 Interestingly, Irc15p lacks the two essential
cysteines required for the formation of a disulfide and therefore it is most unlikely that Irc15 is
a redundant LPD or even exhibits similar enzymatic properties. Apparently, IRC15 evolved
after the whole genome duplication of S. cerevisiae and the duplicated LPD1 sequence
subsequently evolved to attain a new function (“neofunctionalization”)10,11. This new function
appears to be connected to the regulation of microtubule dynamics and chromosome
3
This article is protected by copyright. All rights reserved.

segregation.6 However, it is not known what exactly this function is let alone whether this
function is compatible with the properties of a putative LPD homolog.
LPDs are members of the family of flavoprotein disulfide reductases that catalyze
the NAD(P)H-dependent reduction of disulfide containing substrates. To perform this reaction
the enzymes are equipped with a flavin cofactor and another non-flavin redox center. Initially
only three members, namely LPD, glutathione reductase and thioredoxin reductase
composed the enzyme family, which has expanded significantly in recent years.7 In 2012, the
family was classified according to the nature and position of the non-flavin redox center into
five sub groups.8 Group one comprises the flavoprotein disulfide reductases with the
classical sequence motif CXXXXC, such as LPD. Members of group two are structurally
related but contain a second cysteine based redox center. Enzymes from group three contain
only one cysteine, which either forms a cysteine sulfenic acid or a cysteine-coenzyme A
mixed disulfide during the reaction. Members of group four contain the classical sequence
motif but catalyze a non-disulfide reductase reaction. Finally, members of group five feature
two cysteines that are widely separated in the primary sequence.
In addition to these five sub-groups, several proteins described in the literature exhibit
high sequence similarity with flavoprotein disulfide reductases, but lack some significant
features. For example, pyridine nucleotide transhydrogenases (STH) catalyzes the reversible
transfer of electrons between NADH and NADP+ and lack at least one of the redox active
cysteines and a histidine residue essential for catalytic activity.7,12 These enzymes are also
closely related to LPD, for example, STH from Escherichia coli exhibits 27% identity and 45%
similarity to several LPDs.13 However, also LPDs themselves are able to catalyze
transhydrogenase reactions.14 Another example is LpdA from Mycobacterium tuberculosis,
which lacks one cysteine as well as the catalytic histidine and glutamate. Like STH the
protein is not able to catalyze the reduction of disulfides but instead features quinone
reductase activity. The physiological relevance of this protein is unknown.15 In the present
work, we recombinantly produced Irc15p in E. coli. The purified Irc15p shows the typical
characteristics of a flavoenzyme. We have demonstrated that Irc15p is efficiently reduced by
NADH but lacks disulfide reductase activity. However, reduced Irc15p reduces a range of
artificial electron acceptors, such as potassium ferricyanide, 2,6-dichlorophenol-indophenol
(DCPIP) and quinones. The potential role of Irc15p as a microtubule-associated protein is
discussed in light of our findings concerning the enzymatic properties and structural changes
that occur upon exposure to hydrogen peroxide.
4
This article is protected by copyright. All rights reserved.

Results
Biochemical characterization of Irc15p
Initially, Irc15p was produced with a C-terminal hexa-histidine tag as described by Keyes and
Burke.6 However, the protein could not be purified successfully due to weak binding to the Ni‐
NTA sepharose resin. Therefore, we employed a C-terminal nona-histidine tag enabling the
successful purification of ~13 mg of protein from 1 L culture with a purity of >95% as judged
by visual inspection of SDS-PAGE and by using the program ImageJ
(http://imagej.nih.gov/ij/)16 (Figure 1, panel A). The presence of DTT in the buffer was critical
to prevent the precipitation of Irc15p.
Analytical size exclusion chromatography yielded a molecular mass of ~115 kDa
confirming that Irc15p forms a homodimer as previously reported by Keyes and Burke.6 The
protein peak was associated with a yellow color indicating the presence of a flavin cofactor in
agreement with the high sequence similarity to the FAD-dependent LPD (Figure 1, panel B).
To assess the chemical identity of the flavin cofactor, Irc15p was denatured and the
released flavin was analyzed by HPLC. A peak was obtained at a retention time of 9.1 min
closely corresponding to the retention time of authentic FAD (9.05 min). Furthermore, the
purified protein exhibited the absorption characteristics of a flavoprotein and also looks very
similar to lipoamide dehydrogenases, with two distinct peaks at 377 and 453 nm with a
shoulder at ~470 nm.17 Denaturation of the protein resulted in a slight bathochromic shift of
the absorption maxima at 453 nm (Figure 2, panel A). Using an extinction coefficient of
11.300 M-1 cm-1 at 450 nm for free FAD18 an extinction coefficient of 11.900 M-1 cm-1 at 453
nm was calculated for Irc15p. This extinction coefficient was used to determine the
concentration of Irc15p in further experiments. The A280/A450 ratios of purified Irc15p were
usually between 4.3 and 4.5.
Photoreduction of Irc15p in the presence of EDTA led to the formation of the fully
reduced flavin (hydroquinone) without the formation of a semiquinone radical (Figure 2, panel
B). After reoxidation and removal of precipitated protein the obtained UV-vis absorption
spectrum was similar to the initial spectrum indicating that reduction is fully reversible and
does not give rise to chemical alterations of the flavin (Figure 2, panel B).
The redox potential of the FAD cofactor was determined with the xanthine/xanthine
oxidase system in the presence of safranin T (EM = -289 mV). According to the method of
Minnaert19 a plot of log(Irc15pox/Irc15pred) versus log(dyeox/dyered) was used to estimate the
redox potential to -313 ± 1 mV (six independent measurements). In agreement with the
photoreduction, reduction of Irc15p occurred without formation of a semiquinone and
accordingly the slope of the logarithmic plot was close to unity indicating that the reference
dye as well as the isoalloxazine moiety of the flavin took up two electrons (Figure 3).
5
This article is protected by copyright. All rights reserved.

Sequence alignment and homology modeling
A multiple sequence alignment using the amino acid sequence of Irc15p and the sequences
of LPD from S. cerevisiae, E. coli, Streptomyces seoulensis and Azotobacter vinelandii was
generated (Figure 4). The sequence identities of Irc15p and various LPDs are presented in
Table 1.20,21
A structural model of Irc15p was computationally generated using Lpd1p from S.
cerevisiae (PDB entry: 1V59) as template (Figure 5, panel A and B).22,23 A comparison of the
close environment of the FAD cofactor from Irc15p (Figure 5, panel C) and Lpd1p (Figure 5,
panel D) reflects a high sequence conservation: out of 16 residues that are within 4 Å of the
flavin isoalloxazine ring only four are different. Notably, among these are the two cysteines,
C44 and C49, which make up the dithiol/disulphide redox centre of Lpd1p. These are
replaced by tyrosine and alanine, respectively. The two amino acid residues that compose
the catalytic diad, i.e. H457 and E462 are conserved in both proteins.17
Enzymatic properties and thermal stability of Irc15p
To gain information on the specificity of the electron donor, the reductive half-reaction was
studied using stopped-flow spectrophotometry. Reduction of Irc15p with NADH was fast and
monophasic. The rate of reduction was analysed as a function of substrate concentration and
fitted to a hyperbolic equation yielding a limiting reductive rate of 250 ± 3 s−1 and a
dissociation constant of 100 ± 5 µM (Figure 6, panel A). As noted above, no semiquinone
radical was observed (Figure 6, panel A, inset). In contrast to reduction by NADH, the
reduction with NADPH exhibited two phases (Figure 6, compare panel B and C) and the
bimolecular rate constant determined at 100 µM NAD(P)H is an order of magnitude lower
(NADH = 1.2∙106 M-1∙s-1, NADPH = 3.4∙105 M-1∙s-1).
To evaluate the enzymatic activity of Irc15p, assays with NAD(P)H and several
potential electron acceptors were performed (Table 2). No activity was observed with
disulfides such as lipoic acid, glutathione or cystine. On the other hand, the enzyme showed
diaphorase activity with the non-specific electron acceptors potassium ferricyanide, 3-(4,5-
dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT), and 2,6-dichlorophenol-
indophenol (DCPIP) and quinone reductase activity with menadione (MQ). Furthermore the
reduced cofactor was reoxidized by molecular oxygen, however at a comparatively sluggish
rate. A clear preference for NADH as electron donor is only observed in steady-state assays
employing potassium ferricyanide as electron acceptor.
The potassium ferricyanide assay was further used to determine the influence of
various pH values and salt concentrations on the enzymatic activity of Irc15p. The highest
activity was observed at pH 7.0 without salt in the assay buffer. Below and above pH 7.0 the
6
This article is protected by copyright. All rights reserved.

activity is reduced by about 14-49%, and the presence of 150 mM NaCl decreased the
activity at pH 7.0 by 40%.
The thermal stability of Irc15p was monitored using a thermal shift assay, performed
with the fluorescent dye SYPRO® Orange.24 Under optimal conditions, Irc15p displays a
rather high thermal stability of about 70 °C (Table 3).
Additionally, measurements were performed in the presence and absence of NADH,
NAD+, NADPH and NADP+, as summarized in Table 4. Interestingly a significant decrease in
melting temperature could be observed after addition of an excess of NADH or NADPH.
Limited proteolysis
To further study the effect of NAD(P)H on the protein stability, limited proteolysis using tryptic
digestion was performed under oxic and anoxic conditions in the presence and absence of
NADH. As displayed in Figure 7A, Irc15p is more sensitive to proteolysis in the presence of
NADH and molecular oxygen showing degradation already after 1 hour whereas the control
sample is stable overnight. Interestingly, when the same experiment was performed under
anoxic conditions, no degradation was detectable after six hours and became apparent only
after 16 hours.
Hydrogen peroxide production
Since our limited proteolysis experiments demonstrated that NADH and molecular oxygen
play a synergistic role, we hypothesized that the reduction of Irc15p by NADH and
subsequent reoxidation by dioxygen led to the generation of hydrogen peroxide, which in turn
may oxidize cysteine residues accessible on the surface of the protein. To assess this, we
determined the production of hydrogen peroxide over a period of time by Irc15p in the
presence of NADH under aerobic conditions. As expected, there was a marked increase in
the level of hydrogen peroxide in the presence of NADH. In contrast, Irc15p without NADH
showed no significant peroxide production (see Figure 7B).
SAXS measurements of Irc15p
In order to further investigate the potential impact of thiol oxidation on the overall structure of
the protein, SAXS measurements were employed. Irc15p formed a dimer in solution with a
radius of gyration (Rg) of 3.64  0.02 and with a maximum distance (Dmax) of 14 nm.
However, incubation of Irc15p with NADH in the presence of molecular oxygen resulted in a
substantial change of the radius of gyration (Rg) and of the maximal diameter (Dmax
)
7
This article is protected by copyright. All rights reserved.

indicating that the dimer adopts a more extended conformation (Irc15p with NADH measured
directly: Rg = 3.56  0.01, Dmax = 13 nm, Irc15p with NADH measured after 12 hours: Rg =
5.44  0.03, Dmax = 21 nm, Figure 7, panel B). The SAXS data implicate that the presence of
NADH is extending the conformation of Irc15p by 60%.
Discussion
In this study, we have demonstrated that Irc15p is a flavoprotein with FAD as the cofactor.
Recombinant Irc15p features characteristic spectral properties that are similar to those
reported for LPDs (Figure 2, panel A). In contrast to LPDs, reduction of Irc15p does not give
rise to the typical red charge transfer absorption at longer wavelength (~530 nm) owing to the
lack of a pair of redox active cysteines near the FAD cofactor.25,26 Instead, reduction by light
as well as with NAD(P)H yielded the fully reduced FAD hydroquinone without the occurrence
of a semiquinone radical (Figures 2, panel B and Figure 6).
The redox potential determined for Irc15p is shifted by 93 mV to -313 ± 1 mV
compared to free flavin (= -220 mV). The redox potentials determined for LPD from E. coli
were Eox/EH2 = -264 mV and EH2/EH4 = -314 mV and were assigned to the redox potentials
of the disulfide/dithiol and the FAD/FADH2 couple, respectively25. In order to confirm this
assignment, Hopkins et al.27 created two variants lacking either one of the two participating
thiol groups, i.e. the variants C44S and C49S. The redox potentials of these variants were -
379 and -345 mV, respectively, suggesting that the more negative redox potential
determined for wild-type LPD belongs to the FAD/FADH2 couple. Thus the redox potential of
the FAD/FADH2 couple of Irc15p is very similar to that of LPD suggesting that the
environment of the FAD cofactors in these proteins is comparable.
Furthermore, we have demonstrated that the thermal stability of the protein is rather
high (Tm = 70 °C). This is not unusual as the reported melting temperature for LPD from A.
vinelandii is even higher (Tm = 80 °C).28 Interestingly, it was shown that an exchange of Y16
to phenylalanine leads to a decrease of the melting temperature to 72 °C, since Y16
stabilizes the interaction of the subunits via hydrogen bond formation to H470.29 In Irc15p
phenylalanine is found in position 16 and H470 is replaced by serine. Therefore, the lower
melting temperature of Irc15p may be accounted for, at least in part, by the amino acid
changes in these positions.
To determine the substrate specificity of Irc15p the reductive half reaction was
investigated using either NADH or NADPH. These measurements established a clear
preference for NADH as electron donor proceeding with a limiting rate of kred = 250 s-1
(Figure 6). Thus, the limiting rate of Irc15p is an order of magnitude lower than that of
lipoamide dehydrogenase (250 s-1 vs. >3000 s-1).30,31 Since Irc15p is associated with
microtubules and was shown to regulate their dynamics, the rapid reduction by NADH and
8
This article is protected by copyright. All rights reserved.

the obvious conformational change occurring in the presence of NADH sheds new light on its
potential role in processes such as mitosis. In recent years, several studies concluded that
the NAD+/NADH ratio and the overall redox status are regulatory elements of the cell cycle
and the dynamics of the cytoskeleton.32-34 It was shown that the NAD+/NADH ratio is high
during the G0 phase, decreases during the S phase before it increases again in the G2
phase. However, no information is available of the NAD+/NADH ratio during mitosis.33
Furthermore, it has been demonstrated that NAD+ has an influence on the stability and
curvature of microtubules. Since it is not interacting directly with the polymer it has been
proposed, that NAD+ affects microtubule binding proteins on the plus-end of the polymer.34
How exactly the redox state influences the cell cycle and the cytoskeletal dynamics is not
known, but several proteins regulating the cell cycle as well as tubulin contain redox sensitive
elements like cysteines or cofactors where modifications may occur.35,36 Therefore, it is
conceivable that reduced Irc15p interacts with these proteins and reduces oxidized groups,
e.g. disulfides, to enable for example the polymerization of tubulins. This reactivity would
clearly fit to the mode of action found in LPDs, where an internal disulfide in proximity to the
isoalloxazine moiety of FAD is reduced to the dithiol via reduction of the flavin by NAD(P)H.
In search for such an activity we tested a variety of disulfides, such as cystine, glutathione
and lipoamide but we were unable to detect any reduction of these compounds (Table 2).
However, we discovered that artificial electron acceptors such as potassium ferricyanide,
DCPIP, MTT and MQ were good to excellent electron acceptors (Table 2).
A similar observation was reported for LpdA from Mycobacterium tuberculosis,
which contains five homologs of flavoprotein disulfide reductases7. Apparently, LpdA does
not reduce disulfide containing compounds but similar to Irc15p reduces quinones.7
Interestingly, LpdA lacks one of the two cysteines near the FAD and the catalytic His-Glu
diad, in other words it shares the absence of the dithiol-disulfide redox center with Irc15p but
on the other hand also lacks the catalytic diad, which is present in Irc15p. Since the catalytic
diad is important in the oxidative half reaction of disulfide reductases, i.e. the formation of the
internal disulfide by oxidation through the external disulfide (the “dithiol-disulfide exchange
reaction”), its presence in Irc15p suggests that it has retained the ability to catalyze a similar
reaction.
Limited proteolysis experiments performed in the presence and absence of NADH
under oxic and anoxic conditions showed that Irc15p became more susceptible to
degradation in the presence of NADH and oxygen. Furthermore, we showed that the
formation of hydrogen peroxide was responsible for the increased sensitivity toward tryptic
digestion. In keeping with this, SAXS measurements for Irc15p indicated time-dependent
conformational change in Irc15p that resulted in a more extended and possibly more flexible
structure. This structural change can be attributed to the presence of 11 cysteine residues
9
This article is protected by copyright. All rights reserved.

per subunit of Irc15p, many of which are present on the surface. Cysteine is the most
reactive and oxygen-sensitive amino acid due to the presence of the side chain thiol group.
ROS-mediated oxidation of these thiols involves formation of sulfenic, sulfinic and sulfonic
acids. While the sulfenic intermediates can be re-converted to their reduced form, thereby
modulating protein activity, the sulfinic and sulfonic acid states are irreversible in nature and
can cause decreased protein stability. This phenomenon is called hyperoxidation and can be
induced during oxidative stress.37 NADH-mediated generation of H2O2 shown here mimics
oxidative stress conditions in the yeast cell, where the excessive ROS accumulation may
result from a plethora of sources such as electron leakage originating in the mitochondrial
transport chain, hyperoxia, upregulation of certain enzymes such as D-amino acid oxidases
and peroxisomal acyl-coenzyme A oxidases, xenobiotics and environmental factors such as
heat stress.1 The study presented here showed that the yeast flavoprotein Irc15p is
susceptible to redox-regulated conformational change, which can potentially impair its
interaction with tubulin leading to a negative regulation of the microtubule dynamics.6
Materials & Methods
Materials
All chemicals, reagents and enzymes were of highest quality and from Sigma-Aldrich (St.
Louis, USA), Roth (Karlsruhe, Germany) or Thermo Fisher Scientific (Waltham, USA), unless
otherwise noted. Columns for affinity chromatography (Ni-NTA-sepharose), size exclusion
chromatography (Superdex 200 10/300 GL) and buffer exchange (PD-10 desalting column)
were from GE Healthcare (Little Chalfont, UK). The E. coli strains Top10 and RosettaTM(DE3)
were from Invitrogen (Carlsbad, USA) and Merck (Darmstadt, Germany), respectively. The
plasmid pET21d was from Merck (Darmstadt, Germany).
Cloning of IRC15 for large scale expression in E. coli
All strains were generated using standard genetic techniques38,39. Briefly, genomic DNA from
S. cerevisiae was extracted with the yeast DNA extraction kit from VWR (Radnor, USA).
According to the sequence for IRC15 from the Saccharomyces genome database40 the
following primers were designed and synthesized from VBC (Vienna, Austria): fw_5’-
GAACCATGGCAATGGGAGGTGAAGACGAAATATTAAGCAC-3’;
rev_5’-
GAGCCTCGAGTTAATGGTGATGATGGTGATGATGATGATGTTCCCGGACATGTACGCCA
G -3’. To construct the heterologous expression vector pET21d(+)IRC15 introducing an
additional C-terminal 9x-histidine tag the restriction enzymes NcoI/XhoI were used. Individual
clones were sequenced before transforming the plasmid into E. coli RosettaTM(DE3) cells.
10
This article is protected by copyright. All rights reserved.

Heterologous production and purification of Irc15p
A single colony of E. coli Rosetta(DE3) comprising pET21d(+)IRC15 was used to inoculate a
pre-culture that was aerobically incubated (37 °C, 16 h, 150 rpm) in terrific broth media
(bacto-tryptone 12 g/L, bacto-yeast extract 24 g/L, glycerol 4g/L, KH2PO4 2.31 g/L and
K2HPO4 12.54 g/L) supplemented with 100 µg·mL-1 ampicillin and 20 µg·mL-1
chloramphenicol. 1% pre-culture was used to inoculate the main-culture supplemented with
100 µg·mL-1 ampicillin and 10 µg·mL-1 chloramphenicol, which was incubated aerobically at
37 °C with agitation at 150 rpm until an OD600 of ~0.6 was reached. Production of the
recombinant protein was induced by addition of 0.5 mM isopropyl-β-D-thiogalactoside and the
culture was further incubated for 16 h at 20 °C. Cells were harvested by centrifugation at
4.500 g at 4 °C and washed once with 1% saline solution. Cell pellets were resuspended in 4
mL/g pellet buffer A (50 mM HEPES, 150 mM NaCl, 1 mM dithiothreitol, pH 7.0)
supplemented with 30 mM imidazole, 1 mM phenylmethylsulfonyl fluoride dissolved in
dimethylsulfoxide, 10 µM flavin adenine dinucleotide disodium salt hydrate. Furthermore, 1
μL of protease inhibitor cocktail for the purification of histidine-tagged proteins from Sigma-
Aldrich (St. Louis, USA) was added per 1 g of cell pellet. Cell disruption was achieved by
sonication with a Labsonic L instrument from Braun Biotech International (Berlin, Germany)
with 120 Watt for 3 x 3 min in an ice-water bath with 3 min pauses between each cycle. The
cell lysate was centrifuged at 38.850 g for 45 min at 4 °C, and the supernatant was loaded
onto a 5-mL HisTrap HP column previously equilibrated with buffer A supplemented with 30
mM imidazole. The column was washed with five column volumes with buffer containing 50
mM HEPES, pH 7.0, 150 mM NaCl, 1 mM DTT and 100 mM imidazole. Then the column was
washed with buffer A supplemented with 100 mM imidazole and subsequently proteins were
eluted with buffer A supplemented with 350 mM imidazole. Fractions containing target
protein were pooled and concentrated with centrifugal filter units (Amicon Ultra-15, 50 kDa;
Millipore, Massachusetts, USA). Concentrated protein was re-buffered to buffer B (50 mM
HEPES, 50 mM NaCl, 1 mM DTT, pH 7.0) with a PD-10 desalting column. The protein
solutions were shock frozen and stored at −80 °C if not used immediately.
Determination of molecular mass of Irc15p
The subunit molecular mass of purified Irc15p was determined by SDS-PAGE with a 12.5%
separating gel and 5% stacking gel under reducing conditions described by Laemmli41. The
molecular mass marker PageRuler™ (prestained protein ladder 10-180 kDa) from Thermo
Fisher Scientific (Waltham, USA) was used.
To determine the native molecular mass of Irc15p size exclusion chromatography with
Buffer A using a Superdex 200 10/300 GL column attached to an Äktapurifier™ system from
GE Healthcare (Little Chalfont, UK) was performed. Protein elution was monitored at 280 nm
11
This article is protected by copyright. All rights reserved.

and 450 nm. The column was calibrated with molecular mass standards according to the
instructions from GE healthcare.
Determination of the flavin cofactor bound to Irc15p
To determine the nature of the flavin cofactor concentrated protein samples were treated with
8 M guanidine hydrochloride (pH 2 adjusted with concentrated HCl). Denatured protein was
removed by centrifugation (13.000 g, 5 min) and the solution was neutralized with
concentrated NaOH. To remove residual protein centrifugal filter units (Amicon Ultra-0.5 mL
10 kDa; Millipore, Massachusetts, USA) were used. The flow-through was concentrated at 50
°C under reduced pressure and subsequently analysed by HPLC (UltiMate® 3000 HPLC
system from Dionex, California, USA) using an Atlantis® dC18 5 μM (4.6 x 250 mm) column.
As liquid phase a 0.1% TFA solution and acetonitrile containing 0.1% TFA were used. The
concentration of the organic solvent was increased within 20 min from 0% to 95% in a linear
gradient (T = 25 °C; flow rate = 1 mL/min). The samples were analysed using a diode array
detector at 280, 370 and 450 nm. The retention times of authentic FAD, FMN and riboflavin
were 9.05, 9.75 and 10.4 min, respectively.
Determination of the redox potential
The redox potential was determined by the dye-equilibration method using the
xanthine/xanthine oxidase electron delivering system as described by Massey42. Reactions
were carried out in buffer C (50 mM HEPES, 50 mM NaCl, pH 7) supplemented with methyl
viologen (2.5 μM) as mediator, 500 µM xanthine, and xanthine oxidase in catalytic amounts
(~40 nM) and lasted 0.5-2 h at 25 °C. The protein concentration for a typical experiment was
∼10 μM. The concentrations given are final values after mixing in the flow cell. Experiments
were performed with a SF-61SX2 stopped flow device from TgK Scientific Limited (Bradford-
on-Avon, UK) equipped with an auto-shutter to reduce photochemical effects during the
experiment. To maintain anoxic conditions the device was positioned in a glove box from
Belle Technology (Weymouth, UK). Absorption spectra during the course of reduction were
recorded with a KinetaScanT diode array detector from TgK Scientific Limited (Bradford-on-
Avon, UK). Safranin T was used as a reference dye for the analysis (-289 mV). The amounts
of oxidized and reduced Irc15p and safranin T were quantitated at 430 nm and 530 nm,
respectively. The reduction-oxidation potentials were calculated from plots of
log(Irc15pox/Irc15pred) versus log(dyeox/dyered) according to Minnaert19 using Excel 2010
(Microsoft, Redmond, WA, USA).
12
This article is protected by copyright. All rights reserved.

Sequence alignment and homology modeling
A multiple sequence alignment was generated with the program Clustal Omega21 with
sequences taken from the Saccharomyces genome database40 and from the UniProt
database20. A computational prediction approach was employed to construct the model
structure of Irc15p. Tertiary structure of the protein was generated using protein homology-
based molecular modeling software Swiss-Model22 and ab initio threading based software I-
TASSER23. Both the programs used Lpd1p from S. cerevisiae (PDB entry: 1V59) as the top
threading template for automated model building.
Methods using UV-visible absorption spectroscopy
Absorption spectra were recorded with a Specord 200 plus spectrophotometer from Analytik
Jena (Jena, Germany) at 25 °C using 1-cm quartz cuvettes.
Extinction coefficient: The extinction coefficient of Irc15p was determined according to
Macheroux18. Briefly, Irc15p bound FAD was released by addition of 0.2% SDS. Absorption
spectra were recorded before and after denaturation of the enzyme. The calculation yielded
an extinction coefficient of 11.900 M-1 cm-1 at 453 nm for Irc15p.
Anoxic photoreduction: Photoreduction was carried out as described by Macheroux18. Briefly,
~10 µM Irc15p in 1 mL buffer B (50 mM HEPES, 50 mM NaCl, 1 mM DTT, pH 7.0)
supplemented with 1 mM EDTA was deoxygenated by incubation for 2 h in a glove box from
Belle Technology (Weymouth, UK). A 10 W LED floodlight (Luminea) was used to reduce the
cofactor by light irradiation. Absorption spectra were recorded after each reduction step until
no further spectral changes were observed. Thereafter the sample was exposed to air and a
spectrum was recorded after complete reoxidation.
Steady state kinetics: Initial-velocity kinetic measurements were performed in triplicates with
NAD(P)H as electron donor and the disulfide containing electron acceptors lipoic acid,
glutathione and cystine and the artificial electron acceptors potassium ferricyanide, MQ, MTT
and DCPIP. Reaction mixtures were setup in buffer C (50 mM HEPES, 50 mM NaCl, pH 7).
All reactions were initiated by addition of 5 µL enzyme stock solution supplemented with 200
nM DTT to the reaction mixture – final enzyme concentrations were 10 nM. Controls were
performed in the absence of enzyme. Rates of reduction with MQ, oxygen and disulfide
containing substrates were determined by fitting the observed absorption change at 380 nm
in the first minute using adapted extinction coefficients (NADH ɛ380 nm = 1.210 M-1·cm-1 or
NADPH ɛ380 nm = 1.280 M-1·cm-1). For the other electron acceptors pertinent wavelengths and
13
This article is protected by copyright. All rights reserved.

extinction coefficients were used (ferricyanide ε420 nm = 1.040 M-1·cm-1; MTT ε578 nm = 13.000
M-1·cm-1; DCPIP ε600 nm = 21.000 M-1·cm-1)37.
Thermal shift assay
Thermal shift assays were performed as described by Ericsson et al.24. 20 µL of ~13 µM
Irc15p protein solution was pipetted into a white 96-well RT-PCR plate from Bio-Rad
(California, USA) both at different pH, in the absence and presence of 150 mM NaCl and in
buffer B in the presence and absence of a final concentration of 50 mM NADH, 50 mM NAD+,
50 mM NADPH, 50 mM NADP+ or 50 mM sodium dithionite. Two µL of a 1:500 dilution of
SYPRO® orange from Molecular Probes (Oregon, USA) was added. The plates were sealed
with an Optical-Quality Sealing Tape from Bio-Rad (California, USA) and heated in a CFX
Connect™ Real-Time PCR detection system from Bio-Rad (California, USA) from 20 to 95
°C in increments of 0.5 °C/5 sec. Fluorescence changes of the dye were detected at a
wavelength between 470 and 500 nm. Melting temperatures (Tm) were determined using
CFX Manager 3.0 software from Bio-Rad (California, USA).
Determination of kinetic rates
The protein was deoxygenated by incubation for 2 h in a glove box from Belle Technology
(Weymouth, UK) kept in nitrogen atmosphere. The reductive half-reaction was investigated
by mixing protein (~20 μM) in buffer B with 25-2.500 µM NADH or 25-1.000 µM NAD(P)H.
The concentrations given are final values after mixing in the flow cell. Experiments were
performed with a SF-61SX2 stopped flow device from TgK Scientific Limited (Bradford-on-
Avon, UK) positioned in an anoxic glove box from Belle Technology (Weymouth, UK) at 4 °C.
Changes in flavin absorption were followed with a PM-61s photomultiplier from TgK Scientific
Limited (Bradford-on-Avon, UK) at 453 nm.
Limited proteolysis
12 µM Irc15p in buffer D (50 mM HEPES, 50 mM NaCl, 5 mM EDTA and 1 mM DTT, pH 7.0)
in the presence and absence of 50 mM NADH and under oxic or anoxic conditions was
digested using 5 µg/mL trypsin from Promega (Madison, WI, USA). The reactions were also
supplemented with 8 mM DTT. The reactions were performed at 37 °C. Reactions in the
absence of dioxygen were conducted in a glove box from Belle Technology (Weymouth, UK)
filled with nitrogen gas. After preincubation of trypsin at 37 °C for 15 minutes, the digestion
was started and samples were taken out after different time points (0, 1, 2, 3, 4, 5, 6 and 16
hours). The reactions were stopped by adding SDS sample buffer and the samples were
boiled at 95 °C for 10 minutes. The samples were then analysed by SDS-PAGE with a 12.5%
separating and 5% stacking gel.43,44
14
This article is protected by copyright. All rights reserved.

Hydrogen peroxide assay
A time-dependent generation of H2O2 by Irc15p in the presence and absence of NADH was
monitored using the Pierce™ Quantitative Peroxide Assay Kit (ThermoFischer Scientific). For
the assay, 20 µM Irc15p in buffer C (50mM HEPES, 50 mM NaCl, pH 7.0) was incubated
with 50 mM NADH at room temperature. A sample without NADH, also incubated at room
temperature, was used as a control. The reactions were terminated at 0, 1 and 16 h by
addition of 10% TCA solution. Samples of this reaction mixture (10 µl) were added to 100 µl
of the working reagent in a 96-well plate and incubated for 20 min at room temperature.
Working reagent was prepared according to the protocol specified in the kit (1 vol of reagent
A in 100 vol of reagent B). Absorbance was recorded at 595 nm on a plate reader (FLUOStar
Omega plate reader, BMG Labtech). The values were normalized to account for the intrinsic
absorption of the working reagent. A standard curve containing 0 to 100 μM of H2O2 was
prepared to determine the amount of H2O2 present in each sample.
Small-angle X-ray scattering
For successful SAXS measurements, an additional purification step of Irc15p was needed.
Therefore, Irc15p in buffer D (50 mM HEPES, 50 mM NaCl, 5 mM EDTA and 1 mM DTT, pH
7.0) was purified by size exclusion chromatography on a Superdex 200 Increase 10/300 GL
column from GE Healthcare (Little Chalfont, UK) connected to an ÄKTApurifier™ system (GE
Healthcare, Little Chalfont, UK). The protein containing fractions were then collected,
centrifuged and used for further sample preparation.
For the SAXS measurements, three separate reaction mixtures were prepared,
including one control with a concentration of 119 µM Irc15p and two samples with a
concentration of 61 µM Irc15p, measured after 0 and 12 hours incubation with 50 mM NADH
at 4 °C. Buffers for background corrections were also prepared from buffer D with either 119
µM or 61 µM FAD in the absence or presence of 50 mM NADH. All samples contained 8.3
mM DTT to prevent precipitation of Irc15p.
SAXS data for Irc15p were recorded with an in-house SAXS instrument (SAXSspace,
Anton Paar, Graz, Austria) equipped with a Kratky camera, a sealed X-ray tube source and a
Mythen2 R 1K Detector (Dectris). Thereby Irc15p and the buffers for background
substraction where loaded via an ASX autosampler and measured in a flow cell. The
scattering patterns were measured with a 180-min exposure time (180 frames, each 1 min).
Radiation damage was excluded on the basis of a comparison of individual frames of the
180-min exposures, wherein no changes were detected. A range of momentum transfer of
−1
0.010 < s < 0.63 Å was covered (sꢀ=ꢀ4π sin(θ)/λ, where 2θ is the scattering angle, and λ is
the X-ray wavelength, in this case 1.5 Å.
15
This article is protected by copyright. All rights reserved.

Obtained SAXS data were processed using the SAXSanalysis package (Anton Paar,
version 3.0). and analyzed using the ATSAS package (version 2.8.2, Hamburg, Germany).
The data were desmeared using GIFT (PCG-Software). The forward scattering (I(0)), the
radius of gyration, (Rg), the maximum dimension (Dmax) and the interatomic distance
distribution function (P(r)) were computed with GNOM45. The masses of the solutes were
evaluated based on their Porod volume.
Acknowledgements
The authors are grateful for the support by the interuniversity program in natural sciences
(NAWI Graz) and appreciate the help of Chaitanya R. Tabib for his support with the HPLC
analysis and Eva-Maria Frießer for the help with routine work, as protein expression and
purification. This work was supported by the Bavarian Ministry of Sciences, Research and
the Arts (Bavarian Molecular Biosystems Research Network, to T.M.), the President’s
International Fellowship Initiative of CAS (No.2015VBB045, to T.M.), the National Natural
Science Foundation of China (No. 31450110423, to T.M.), the Austrian Science Fund (FWF:
P28854 and I3792 to T.M.), the Austrian Research Promotion Agency (FFG: 864690), the
Integrative Metabolism Research Center Graz, the Austrian infrastructure program
2016/2017, BioTechMed/Graz, the OMICS center Graz as well as the Deutsche
Forschungsgemeinschaft (DFG) with the grant MA5703/1-1 (to T.M.).
Author contributions
P.M. initiated the project; K.K., E.S., G.R., S.J., B.B., T.M. and P.M. designed the
experiments and interpreted the data. K.K. and E.S. produced and purified Irc15p. K.K, E.S.
and S.J. performed analytical, biochemical and enzymatic experiments. G.R. and B.B.
performed SAXS measurements. K.K., E.S., S.J. G.R., B.B. and P.M. wrote the manuscript.
16
This article is protected by copyright. All rights reserved.

References
1. Farrugia G, Balzan R (2012) Oxidative stress and programmed cell death in yeast.
Front Oncol 2:64.
2. Zeida A, Babbush R, Lebrero MCG, Trujillo M, Radi R, Estrin DA (2012) Molecular basis
of the mechanism of thiol oxidation by hydrogen peroxide in aqueous solution:
Challenging the SN2 paradigm. Chem Res Toxicol 25:741-746.
3. Groitl B, Jakob U (2014) Thiol-based redox switches. Biochim Biophys Acta 1844:1335-
1343.
4. Lindhoud S, van den Berg WA, van den Heuvel RH, Heck AJ, van Mierlo CP, van
Berkel WJ (2012) Cofactor binding protects flavodoxin against oxidative stress. PLoS
ONE 7:e41363.
5. Gudipati V, Koch K, Lienhart WD, Macheroux P (2014) The flavoproteome of the yeast
Saccharomyces cerevisiae. Biochim Biophys Acta 1844:535-544.
6. Keyes BE, Burke DJ (2009) Irc15 is a microtubule-associated protein that regulates
microtubule dynamics in Saccharomyces cerevisiae. Curr Biol 19:472-478.
7. Argyrou A, Blanchard JS (2004) Flavoprotein disulfide reductases: Advances in
chemistry and function. Prog Nucleic Acid Res Mol Biol 78:89-142.
8. Miller S, Flavoprotein disulfide reductases and structurally related flavoprotein
thiol/disulfide-linked oxidoreductases, in: Hille R, Miller S, Palfey B (Eds) (2012) Handb.
Flavoproteins Vol. 2 Complex Flavoproteins, Dehydrogenases Phys. Methods. Walter de
Gruyter & Co, Berlin, pp. 165–201.
9. Mattevi A, Obmolova G, Kalk KH, van Berkel WJ, Hol WG (1993) Three-dimensional
structure of lipoamide dehydrogenase from pseudomonas fluorescens at 2.8 A
resolution. Analysis of redox and thermostability properties. J Mol Biol 230:1200-1215.
10. Kellis M, Birren BW, Lander ES (2004) Proof and evolutionary analysis of ancient
genome duplication in the yeast Saccharomyces cerevisiae. Nature 428:617-624.
11. Byrne KP, Wolfe KH (2005) The yeast gene order browser: Combining curated
homology and syntenic context reveals gene fate in polyploid species. Genome Res
15:1456-1461.
17
This article is protected by copyright. All rights reserved.

12. French CE, Boonstra B, Bufton KA, Bruce NC (1997) Cloning, sequence, and properties
of the soluble pyridine nucleotide transhydrogenase of Pseudomonas fluorescens. J
Bacteriol 179:2761-2765.
13. Boonstra B, French CE, Wainwright I, Bruce NC (1999) The udhA gene of Escherichia
coli encodes a soluble pyridine nucleotide transhydrogenase. J Bacteriol 181:1030-
1034.
14. Komuniecki R, Saz HJ (1979) Purification of lipoamide dehydrogenase from Ascaris
muscle mitochondria and its relationship to NADH:NAD+ transhydrogenase activity.
Arch Biochem Biophys 196:239-247.
15. Argyrou A, Blanchard JS (2001) Mycobacterium tuberculosis lipoamide dehydrogenase
is encoded by Rv0462 and not by the lpdA or lpdB genes. Biochemistry 40:11353-
11363.
16. Schneider CA, Rasband WS, Eliceiri KW (2012) NIH image to ImageJ: 25 years of
image analysis. Nat Methods 9:671-675.
17. Benen J, van Berkel W, Zak Z, Visser T, Veeger C, de Kok A (1991) Lipoamide
dehydrogenase from Azotobacter vinelandii: Site-directed mutagenesis of the His450-
Glu455 diad. Spectral properties of wild type and mutated enzymes. Eur J Biochem
202:863-872.
18. Macheroux P. (1999) UV-visible spectroscopy as a tool to study flavoproteins. Methods
Mol Biol 131:1-7.
19. Minnaert K. (1965) Measurement of the equilibrium constant of the reaction between
cytochrome c and cytochrome a. Biochim Biophys Acta 110:42-56.
20. UniProt Consortium, Bateman A (2015) UniProt: A hub for protein information. Nucleic
Acids Res 43:204.
21. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H,
Remmert M, Soding J, Thompson JD, Higgins DG (2011) Fast, scalable generation of
high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol
7:539.
22. Arnold K, Bordoli L, Kopp J, Schwede T (2006) The SWISS-MODEL workspace: A web-
based environment for protein structure homology modelling. Bioinformatics 22:195-201.
18
This article is protected by copyright. All rights reserved.

23. Zhang Y. (2008) I-TASSER server for protein 3D structure prediction. BMC
Bioinformatics 9:40.
24. Ericsson UB, Hallberg BM, Detitta GT, Dekker N, Nordlund P (2006) Thermofluor-based
high-throughput stability optimization of proteins for structural studies. Anal Biochem
357:289-298.
25. Wilkinson KD, Williams CH,Jr (1979) Evidence for multiple electronic forms of two-
electron-reduced lipoamide dehydrogenase from Escherichia coli. J Biol Chem 254:852-
862.
26. Youn H, Kwak J, Youn HD, Hah YC, Kang SO (1998) Lipoamide dehydrogenase from
Streptomyces seoulensis: Biochemical and genetic properties. Biochim Biophys Acta
1388:405-418.
27. Hopkins N, Williams CH Jr (1995) Lipoamide dehydrogenase from Escherichia coli
lacking the redox active disulfide: C44S and C49S. redox properties of the FAD and
interactions with pyridine nucleotides. Biochemistry 34:11766-11776.
28. van Berkel WJ, Regelink AG, Beintema JJ, de Kok A (1991) The conformational stability
of the redox states of lipoamide dehydrogenase from Azotobacter vinelandii. Eur J
Biochem 202:1049-1055.
29. Benen J, van Berkel W, Veeger C, de Kok A (1992) Lipoamide dehydrogenase from
Azotobacter vinelandii. the role of the C-terminus in catalysis and dimer stabilization. Eur
J Biochem 207:499-505.
30. Matthews RG, Ballou DP, Williams CH,Jr (1979) Reactions of pig heart lipoamide
dehydrogenase with pyridine nucleotides. evidence for an effector role for bound
oxidized pyridine nucleotide. J Biol Chem 254:4974-4981.
31. Benen J, van Berkel W, Dieteren N, Arscott D, Williams C Jr, Veeger C, de Kok A
(1992) Lipoamide dehydrogenase from Azotobacter vinelandii: Site-directed
mutagenesis of the His450-Glu455 diad. kinetics of wild-type and mutated enzymes. Eur
J Biochem 207:487-497.
32. Yu F, Dai R, Goh S, Zheng L, Luo Y (2009) Logic of a mammalian metabolic cycle: An
oscillated NAD+/NADH redox signaling regulates coordinated histone expression and S-
phase progression. Cell Cycle 8:773-779.
19
This article is protected by copyright. All rights reserved.

33. da Veiga Moreira J, Peres S, Steyaert JM, Bigan E, Pauleve L, Nogueira ML, Schwartz
L (2015) Cell cycle progression is regulated by intertwined redox oscillators. Theor Biol
Med Model 12:2.
34. Harkcom WT, Ghosh AK, Sung MS, Matov A, Brown KD, Giannakakou P, Jaffrey SR
(2014) NAD+ and SIRT3 control microtubule dynamics and reduce susceptibility to
antimicrotubule agents. Proc Natl Acad Sci U S A 111:2443.
35. Menon SG, Goswami PC (2007) A redox cycle within the cell cycle: Ring in the old with
the new. Oncogene 26:1101-1109.
36. Wilson C, Gonzalez-Billault C (2015) Regulation of cytoskeletal dynamics by redox
signaling and oxidative stress: Implications for neuronal development and trafficking.
Front Cell Neurosci 9:381.
37. Lim JC, Choi HI, Park YS, Nam HW, Woo HA, Kwon KS, Kim YS, Rhee SG, Kim K,
Chae HZ (2008) Irreversible oxidation of the active-site cysteine of peroxiredoxin to
cysteine sulfonic acid for enhanced molecular chaperone activity. J Biol Chem
283:28873-28880.
38. Pashley C, Kendall S (2003) Cloning in plasmid vectors. Methods Mol Biol 235:121-135.
39. Swords WE. (2003) Chemical transformation of E. coli. Methods Mol Biol 235:49-53.
40. Cherry JM, Hong EL, Amundsen C, Balakrishnan R, Binkley G, Chan ET, Christie KR,
Costanzo MC, Dwight SS, Engel SR, Fisk DG, Hirschman JE, Hitz BC, Karra K, Krieger
CJ, Miyasato SR, Nash RS, Park J, Skrzypek MS, Simison M, Weng S, Wong ED (2012)
Saccharomyces genome database: The genomics resource of budding yeast. Nucleic
Acids Res 40:700-705.
41. Laemmli UK. (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227:680-685.
42. V. Massey. A simple method for the determination of redox potentials. In: Curti B,
Ronchi S, Zanetti G (eds) (1990) Flavins and flavoproteins, Walter de Gruyter & Co,
Berlin, pp. 59-60.
43. Lienhart WD, Gudipati V, Uhl MK, Binter A, Pulido SA, Saf R, Zangger K, Gruber K,
Macheroux P (2014) Collapse of the native structure caused by a single amino acid
exchange in human NAD(P)H:Quinone oxidoreductase(1.). FEBS J 281:4691-4704.
20
This article is protected by copyright. All rights reserved.

44. Chen S, Deng PS, Bailey JM, Swiderek KM (1994) A two-domain structure for the two
subunits of NAD(P)H:Quinone acceptor oxidoreductase. Protein Sci 3:51-57.
45. Svergun DI. (1992) Determination of the regularization parameter in indirect-transform
methods using perceptual criteria. Journal of Appl Crystallogr 25:495-503.
46. Heinrich P, Ronft H, Schartau W, Kresze GB (1983) Lipoamide dehydrogenase from
baker's yeast. improved purification and some molecular, kinetic, and immunochemical
properties. Hoppe Seylers Z Physiol Chem 364:41-50.
47. Schrödinger LLC (2002) The PyMOL molecular graphics system version 1.5.0.4.
21
This article is protected by copyright. All rights reserved.

Tables
Table 1
Sequence identity of Irc15p in comparison to other LPDs from S. cerevisiae, E. coli,
Streptomyces seoulensis and Azotobacter vinelandii.
Percent identity to Irc15p
S. cerevisiae_Lpd1p
A. vinelandii_Lpd
S. seoulensis_Lpd
E. coliK12_Lpd
40
30
28
27
Table 2
Specific activities with standard deviations of Irc15p with NAD(P)H [μmol/min-1/mg-1] as
electron donor in comparison with the specific activity of LPD from S. seoulensis26 and LPD
from S. cerevisiae (in brackets)46 with NADH. Reduction of ferricyanide, DCPIP and MTT was
determined at 420, 600 and 578 nm, respectively. All other reactions were monitored at 380
nm.
Specific Activity
with NADH
Specific Activity
with NADPH
Specific Activity of LPD
Substrate
with NADH
[μmol/min-1/mg-1]a
[μmol/min-1/mg-1]a
[μmol/min-1/mg-1]c
7.87
(1670.0d)
61.4
(2.0d)
7.18
-
Ferricyanide
DCPIPb
179.5  3.41
3.88  0.14
17.9  1.14
4.72  0.22
MQ*,b
19.7  0.82
19.3  2.12
MTT*
1.62  0.08
1.28  0.02
Lipoic acid*
Cystine*
Glutathione*
Oxygen*
0
0
15.6
0.80
0.18
0
0
0
0
0
1.0  0.02
1.0  0.02
aThe reaction mixture for the measurements of Irc15p contained 50 mM HEPES, pH 7.0, 50
mM NaCl, 10 nM DTT, 500 µM NAD(P)H, 500 µM electron acceptors (except MQ and
b
c
DCPIP). The concentration of DCPIP and MQ were 50 and 200 µM, respectively. The
reaction mixture for the measurements of LPD from S. seoulensis contained 50 mM sodium
d
phosphate buffer, pH 7.4, 0.3 mM substrates and 0.2 mM NADH. The reaction mixture for
the potassium ferricyanide assay of LPD1 from S. cerevisiae contained 165 mM sodium
acetate, pH 4.8, 0.7 mg/mL bovine serum albumin, 1 mM EDTA, 600 µM NADH, 670 µM
potassium ferricyanide. The DCPIP assay contained phosphate buffer, pH 7.2, 0.7 mg/mL
bovine serum albumin, 1 mM EDTA; 600 µM NADH and 40 μΜ DCPIP.
22
This article is protected by copyright. All rights reserved.

Table 3
Activity and thermal stability of Irc15p at various pH and in the absence and presence of
NaCl. Melting points are given as the average of two independent measurements.
Buffer composition
Activity [%]
Tm [°C]
50 mM HEPES, pH 6.0
51
100
86
70
69
62
56
69
50 mM HEPES, pH 7.0
50 mM HEPES, pH 8.0
50 mM Tris/HCl, pH 9.0
46
50 mM HEPES, pH 7.0, 150 mM NaCl
61
The reaction mixture for the activity assay contained also 10 nM DTT, 500 µM NADH and
500 µM ferricyanide.
Table 4
Thermal stability of Irc15p in 50 mM HEPES, 50 mM NaCl, 1 mM DTT, pH 7.0 in the
presence and absence of 50 mM NADH, 50 mM NAD+, 50 mM NADPH, 50 mM NADP+ and
50 mM sodium dithionite. Melting points are determined as the average of two independent
measurements.
Condition
Tm [°C]
Control
68
47
64
45
68
65
NADH
NAD+
NADPH
NADP+
Sodium dithionite
23
This article is protected by copyright. All rights reserved.

Figure legends
Figure 1: Determination of the purity and molecular mass of Irc15p using SDS-PAGE and
analytical size exclusion chromatography. (A) Determination of purity and subunit molecular
mass of Irc15p by SDS-PAGE after purification by affinity chromatography. Lane 1,
PageRuler™ prestained protein ladder (10-180 kDa); lane 2, protein extract before induction;
lane 3, protein extract after induction of IRC15; lane 4, protein fraction after purification by Ni-
NTA-sepharose. The subunit molecular mass of Irc15p was estimated to ~55 kDa. (B)
Determination of native molecular mass of Irc15p (solid and dotted line display the
absorption at 280 nm and 450 nm, respectively) using analytical size exclusion
chromatography. The insert shows a plot of the partition coefficient (Kav) against the
logarithm of molecular mass of standard proteins (ferritin, 440 kDa; aldolase, 158 kDa;
conalbumin, 75 kDa; ovalbumin, 43 kDa; ribonuclease A, 13.7 kDa). The calculated
molecular mass of Irc15p (~ 113 kDa, black circle) indicates that Irc15p is present as a
dimer.
Figure 2: UV/Vis absorption spectroscopy. (A) UV-visible absorption spectrum of Irc15p
before (solid line) and after denaturation (dashed line). Denaturation of purified Irc15p was
carried out in buffer B (50 mM HEPES, 50 mM NaCl, 1 mM DTT, pH 7.0) containing 0.2%
SDS. (B) Absorption spectra observed during the anaerobic photoreduction of Irc15p in
50 mM HEPES, 50 mM NaCl, 1 mM DTT, 1 mM EDTA, pH 7.0. The solid black line
represents the spectrum before irradiation. The reduction proceeds as indicated by the arrow
with the dashed dotted line representing the final spectrum. After reoxidation by dioxygen the
protein was partially denatured. The solution was cleared by centrifugation and the spectrum
recorded (dashed line).
Figure 3: Redox potential determination of Irc15p in the presence of safranine T. (A) The
absorption spectrum of the fully oxidized and fully reduced species are represented by a
solid and dashed black line, respectively. Selected spectra of the course of reduction are
represented in different shades of blue. Ten μM Irc15p was reduced by the xanthine/xanthine
oxidase electron delivering system in the presence of safranine T over a time period of
~100 min. Data points for evaluation were extracted at 430 nm and 530 nm for Irc15p and for
the dye safranine T, respectively. (B) Double logarithmic plot of the concentration of
oxidized/reduced Irc15p vs. the concentration of oxidized/reduced safranine T (Nernst plot).
24
This article is protected by copyright. All rights reserved.

Figure 4: Alignment of the Irc15p protein sequence with sequences of LPD from S.
cerevisiae, E. coli, S. seoulensis and A. vinelandii. The mitochondrial targeting sequence of
Lpd1p is highlighted in red. The amino acid signature near the redox-active disulfide is
highlighted in yellow. The respective sequence in Irc15p is highlighted in green. The catalytic
His-Glu diad is highlighted in blue. Other residues in the active site are highlighted in petrol.
Residues involved in structural stabilization are highlighted in purple.
Figure 5: Overall structural similarity of Irc15p and LPD1p. (A) and (B): Structural
superposition of LPD1p (grey, PDB code: 1V59) and Irc15p (blue/green). The FAD cofactor
is displayed in yellow and NADH is shown in magenta. Close-up view of the active sites of
Irc15p (C) and LPD1p (D). Residues close to the FAD isoalloxazine ring are illustrated as
grey sticks for both protomers (Lpd1p) or in colors corresponding to the respective protomer
(Irc15p). Figures were prepared with the software PyMOL47.
Figure 6: Pre-steady-state kinetics of Irc15p to determine reductive rates for NADH. (A) The
rate of reduction was determined under anoxic conditions with the stopped flow device
equipped with a diode array detector. At least three independent measurements were
performed (error bars are shown as standard deviations). The inset displays selected
absorption spectra of the reduction of ~20 µM Irc15p with 375 µM NADH. (B) Absorption
change at 450 nm of the reduction of ~20 µM Irc15p with 1250 µM NADH. (C) Absorption
change at 450 nm of the reduction of ~20 µM Irc15p with 1000 µM NADPH.
Figure 7: Limited proteolysis, hydrogen peroxide formation and SAXS data for Irc15p in the
presence and absence of NADH. (A) SDS-PAGE from the limited proteolysis experiment
illustrating the effect of NADH and oxygen on the stability of the protein. Each gel has the
marker PageRuler™ prestained protein ladder in lane 1, the remaining lanes display the
samples incubated for 0-16 hours. (B) Hydrogen peroxide formation in Irc15p over time (0, 1
and 16 hours) and in the presence and absence of NADH. (C) SAXS data comparing the
experimental radial density distribution (P(r)) of Irc15p incubated with NADH measured after
0 and 12 hours compared to a control sample without NADH.
25
This article is protected by copyright. All rights reserved.

26
This article is protected by copyright. All rights reserved.

27
This article is protected by copyright. All rights reserved.

28
This article is protected by copyright. All rights reserved.

29
This article is protected by copyright. All rights reserved.