Design, synthesis, and evaluation of 3C protease inhibitors as anti-enterovirus 71 agents

Article abstract of DOI:10.1016/j.bmc.2008.06.015

Human enterovirus (EV) belongs to the picornavirus family, which consists of over 200 medically relevant viruses. A peptidomimetic inhibitor AG7088 was developed to inhibit the 3C protease of rhinovirus (a member of the family), a chymotrypsin-like protea

Full text of DOI:10.1016/j.bmc.2008.06.015

Bioorganic & Medicinal Chemistry 16 (2008) 7388–7398
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Design, synthesis, and evaluation of 3C protease inhibitors as
anti-enterovirus 71 agents
e
Chih-Jung Kuo a,b, Jiun-Jie Shie c, Jim-Min Fang c,d, , Guei-Rung Yen , John T.-A. Hsu e,f, Hun-Ge Liu a,
*
Sung-Nain Tseng g, Shih-Cheng Chang g,h, Ching-Yin Lee g,h, Shin-Ru Shih g,h, Po-Huang Liang a,b,c,
*
a Institute of Biological Chemistry, Academia Sinica, 128 Academia Road, Taipei 11529, Taiwan
b Taiwan International Graduate Program, Academia Sinica, Taipei 11529, Taiwan
c The Genomics Research Center, Academia Sinica, Taipei 11529, Taiwan
d Department of Chemistry, National Taiwan University, Taipei 106, Taiwan
e Division of Biotechnology and Pharmaceutical Research, National Health Research Institutes, Chu-Nan, Taiwan
f Department of Chemical Engineering, National Tsing Hua University, Hsinchu, Taiwan
g Department of Medical Biotechnology & Laboratory Science, Chang Gung University, Tao-Yuan, Taiwan
h Clinical Virology Laboratory, Department of Clinical Pathology, Chang Gung Memorial Hospital, Tao-Yuan, Taiwan
a r t i c l e i n f o
a b s t r a c t
Article history:
Human enterovirus (EV) belongs to the picornavirus family, which consists of over 200 medically rele-
vant viruses. A peptidomimetic inhibitor AG7088 was developed to inhibit the 3C protease of rhinovirus
(a member of the family), a chymotrypsin-like protease required for viral replication, by forming a cova-
lent bond with the active site Cys residue. In this study, we have prepared the recombinant 3C protease
from EV71 (TW/2231/98), a particular strain which causes severe outbreaks in Asia, and developed inhib-
itors against the protease and the viral replication. For inhibitor design, the P3 group of AG7088, which is
not interacting with the rhinovirus protease, was replaced with a series of cinnamoyl derivatives directly
linked to P2 group through an amide bond to simplify the synthesis. While the replacement caused
Received 25 April 2008
Revised 7 June 2008
Accepted 10 June 2008
Available online 13 June 2008
Keywords:
Protease
Picornaviridae
Inhibitor
Enterovirus
decreased potency, the activity can be largely improved by substituting the
an aldehyde at the P10 position. The best inhibitor 10b showed EC50 of 18 nM without apparent toxicity
(CC50 > 25 M). Our study provides potent inhibitors of the EV71 3C protease as anti-EV71 agents and
a,b-unsaturated ester with
l
Computer modeling
Fluorogenic substrate
facilitates the combinatorial synthesis of derivatives for further improving the inhibitory activity.
Ó 2008 Elsevier Ltd. All rights reserved.
1. Introduction
120,000 cases of infection in children and 78 deaths.10,11 Since
then, a steady number of cases caused by this particular EV strain
Enterovirus (EV), a member of Picornaviridae family, is a pri-
mary causative agent of hand, foot, and mouth diseases in humans
and animals.1 In severe cases, EV can damage the central nervous
systems leading to viral meningitis, encephalitis, and severe myo-
carditis, as well as fatal pulmonary edema.2–4 Children are partic-
ularly vulnerable due to their relative immunodeficiency.5,6 There
are over 5 billion cases of EV infections annually worldwide and
several outbreaks have been reported.7–9 In 1998, a severe out-
break by the EV71 (TW/2231/98) occurred in Taiwan causing about
have been reported annually. In May 2008, Chinese health author-
ities reported a major outbreak of EV71 in Anhui province of China,
which has led to 28 deaths as of May 7.
To date, no effective anti-viral therapy for the diseases caused
by EV is available. Like other picornaviruses such as polioviruses,
rhinoviruses (RV), coxsackieviruses, and hepatitis A viruses, a
virally encoded chymotrypsin-like protease (3C protease) is
required for the proteolytic processing of the large polyproteins
translated from the viral RNA genomes and thus essential for viral
replication.12,13 The RV 3C protease was used as a target to develop
inhibitor AG7088, aiming to treat the common cold.14–16 This pep-
tidomimetic inhibitor (see below for structure) contains a lactam
ring to mimic Gln at the P1 position, fluoro-phenylalanine at P2,
Abbreviations: EV, enterovirus; RV, rhinovirus; SARS-CoV, severe acute respira-
tory syndrome-coronavirus; NiNTA, nickel nitrilo-tri-acetic acid; Dabcyl, 4-(4-
dimethylaminophenylazo)benzoic acid; Edans, 5-[(2-aminoethyl)amino]naphtha-
lene-1-sulfonic acid; Boc, tert-butyloxycarbonyl; Cbz, benzyloxycarbonyl; MES, 2-
N-morpholono-ethanesulfonic acid; DMEM, Dulbecco’s Modified Eagle’s Medium;
FBS, fetal bovine serum.
Val at P3 followed by 5-methyl-3-isoxazole, and an
a,b-unsatu-
rated ester at P10 as a Michael acceptor to form a covalent bond
with the active site Cys residue.17,18 Recent research has shown
that AG7088 is effective against EV6 and EV9 with EC50 of 43 and
15 nM, respectively, likely due to the structural similarity of their
* Corresponding authors. Tel.: +886 2 2785 5696x6070; fax: +886 2 2788 9759
(P.-H.L.).
E-mail address: phliang@gate.sinica.edu.tw (P.-H. Liang).
0968-0896/$ - see front matter Ó 2008 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2008.06.015

C.-J. Kuo et al. / Bioorg. Med. Chem. 16 (2008) 7388–7398
7389
3C proteases judging from their sequence homology.19 This pro-
vides a starting point for developing potent inhibitors against
EV71.
for EV71 3C protease assay to monitor the fluorescence increase
due to the peptide bond cleavage in real time. The Km and kcat of
the enzyme in using this fluorogenic substrate were measured to
be 5.8 0.9 l
M and 0.45 minꢀ1, respectively (Fig. 1C).
O
NH
2.3. Synthesis of inhibitors
We used 3 (the intermediate in synthesizing AG7088)22 as a
starting material for making new AG7088 analogues (Fig. 2) by
modifying the reported methods.23–25 The protecting group tert-
butyloxycarbony (Boc) in 3 was removed and the resulting species
was reacted with Boc-protected Phe to make 4. This molecule con-
O
O
AG7088
N
N
CO2Et
H
H
N
O
O
F
tained P1-lactam ring, P2-Boc-Phe, and P10-
a,b-unsaturated ethyl
ester. To simplify the synthesis, a variety of different acyl chlorides
were coupled with P2-Boc-Phe through an amide bond to make a
library of compounds from 4. Among them, we found that the best
inhibition came from the compounds derived from cinnamoyl
chlorides. As illustrated in Figure 2A, cinnamoyl chlorides 5a–c
with substituents of 3,4-(methylenedioxy), 4-dimethylamino, and
H in the benzene ring, respectively, were incorporated into 4 to
make 6a–c.
In this study we have expressed, purified, and characterized the
recombinant EV71 3C protease and developed a fluorescence-
based enzymatic assay according to the substrate specificity. Based
on the crystal structure of RV 3C protease in complex with
AG7088,17 we designed and synthesized new compounds and eval-
uated their inhibitory activities in both enzymatic and cell-based
To make the analogues containing aldehyde at the P10 position,
2 was condensed with benzyloxycarbonyl (Cbz)-protected Phe to
make 7 (Fig. 2B). The P10-methyl ester in 7 was converted to alde-
hyde to make 8. By adding cinnamoyl chlorides 5a–f into 7, the
methyl esters 9a–f were formed. Compounds 10a-f were synthe-
sized from the reduction, followed by oxidation of the methyl es-
ters 9a–f.
assays. Our findings serve as
development.
a basis for anti-EV71 drug
2. Results
2.1. Preparation of the active protease
The EV71 3C protease expressed with pET16b vector contained
N- or C-terminal hexa-His-tag and both forms were purified by
using Ni–NTA column. In order to observe the effect of additional
residues (hexa-His) on the protease activity, we also expressed
the protease without any tag and purified it by using a cation-ex-
change column followed by a size-exclusion column. The three
forms of the protein were purified to homogeneity as shown in
the SDS–PAGE (Fig. 1A). The yields of the N- and C-terminal His-
tagged forms were higher (2.2 and 3.6 mg/L medium, respectively)
than that of the tag-free protease (0.8 mg/L medium).
The three forms of protease were compared for their activities
using the fluorescence-based assay as described below. It was
found that the protease with a C-terminus His-tag had specific
activity equal to that of the tag-free enzyme, but the enzyme with
N-terminal His-tag displayed 10-fold lower activity, indicating that
additional N-terminal amino acids interfered with the protease
activity. We thus used the protease with C-terminal His-tag in
the following studies.
2.4. Evaluation of inhibitors
Recombinant 3C protease and the fluorogenic substrate were
used to evaluate the IC50 of the synthesized compounds. Com-
pound 4 with the basic features of AG7088 with P1-lactam ring,
P10-
zyme at 20
cinnamoyl groups, 6a–c showed smaller IC50 values of 10.6, 8.2,
and 10.0 M against the enzyme, respectively, when they were
a
,b-unsaturated ester, and P2-Boc-Phe did not inhibit the en-
M (the greatest concentration tested). With additional
l
l
not preincubated with the protease (Table 1). However, the time-
dependent inhibition was observed in a prolonged time window
for 6b as an example (Fig. 3, top panel). From the replot (Fig. 3,
lower panel), the kinact was calculated to be 0.077 minꢀ1 and the
Ki was 2.6
EC50 of 1.8, 2.9 and 1.3
However, 6b and 6c displayed some cellular toxicity with CC50 of
21 and 8 M, respectively.
When replacing ,b-unsaturated ester with an aldehyde at the
lM. In agreement with their Ki values, 6a–c showed
lM, respectively, in the anti-viral assay.
l
a
P10 position, 10a–e displayed 10- to 100-fold smaller EC50 values
compared to 6a–c (Table 1). Both 10b and 10d displayed potent
inhibitory activity with EC50 of 18 and 26 nM, respectively, without
cytotoxicity at the concentration approximately 1000-fold greater
than their EC50. The anti-viral activity of 10d was further demon-
strated by using a western blot analysis. As shown in Figure 4, the
confluent cells infected with EV71 (EV71 TW/2231/98) showed less
quantity of viral protein (3C protease) as detected by using its anti-
body in the presence of increased concentrations of 10d at 0.01,
2.2. Substrate specificity and kinetics of the protease
The peptides corresponding to the autoprocessing sites by the
3C protease including RQAVTQ;GFPTEL between vp2 and vp3,
QTGTIQ;GDRVAD between vp3 and vp1, DEAMEQ;GVSDYI be-
tween 2A and 2C, IEALFQ;GPPKFR between 3A and 3B,
RTATVQ;GPSLDF between 3B and 3C, YFCSEQ;GEIQWN between
3C and 3D, and TSAVLQ;SGFRKM derived from the N-terminal
auto-processing site of a 3C-like protease from severe acute respi-
ratory syndrome-coronavirus (SARS-CoV),20,21 which all contain
Gln followed by a small amino acid (Ser or Gly) to serve as the
cleavage sites, were tested as substrates for 3C protease of EV71
(; indicates the cleavage site). Surprisingly, EV71 3C protease
0.025, 0.05, 0.1, 0.5, and 1
EC50. Compound 10e showed the smallest EC50 of 7 nM with toxic-
ity CC50 of 5 M, giving the selective index (CC50/EC50) of 714.
Compound 8 with a more flexible Cbz group also showed potent
anti-viral activity (EC50 = 0.031 M) but slight toxicity
(CC50 = 24 M). Compound 10f containing 5-methyl-3-isoxazole
showed less inhibitory activity (EC50 = 0.94 M) in the anti-viral as-
lM. The data were consistent with the
l
l
showed
substantially
better
activity
(60-fold)
against
l
TSAVLQ;SGFRKM, the substrate of the SARS-CoV 3C-like protease,
than aganist its own cleavage sites based on the HPLC assay
(Fig. 1B). Therefore, the peptide Dabcyl-KTSAVLQSGFRKME-Edans
with the fluorescence quenching pair (Dabcyl–Edans) was chosen
l
say, indicating importance of the benzene ring in inhibiting the
virus. In the enzymatic assay, these compounds including 10f inhib-
ited the protease potently, so their Ki could not be accurately deter-

7390
C.-J. Kuo et al. / Bioorg. Med. Chem. 16 (2008) 7388–7398
Figure 1. Purification and characterization of EV71 3C protease. (A) SDS–PAGE analysis of the purified proteins from different constructs. Lane 1 represents the MW markers.
Lanes 2, 3, and 4 show the purified proteins without tag, with N-terminal His-tag, and with C-terminal His-tag, respectively. (B) Compared to the peptides derived from its
own auto-activation sites, EV71 3C protease showed the best activity toward the preferred substrate, TSAVLQSGFRKM, of the SARS-CoV 3C-like protease. (C) Using the peptide
containing a fluorescence quenching pair, the initial rates of the protease versus substrate concentrations were measured to obtain the kcat of 0.45 minꢀ1 and Km of
5.8 0.9 lM.
mined under the assay condition as limited by the 0.5
l
M enzyme
in order to accommodate the a,b-unsaturated ester of 6b (a poor
used to detect the activity. When aldehyde at the P10 position of 10b
inhibitor) at the S10 site, its cinnamoyl group is forced away from
the S3 site (see the top view in the left panel and side view in
the right panel) and could not make proper interaction with the
nearby amino acids (e.g., Phe170), leading to significant loss of
binding affinity and inhibitory activity. However, with the alde-
hyde of much smaller size in 10b (a potent inhibitor), the binding
becomes favorable. The aldehyde group of 10b occupies a similar
was replaced with CH2OH or CO2Me, the IC50 values became 40 and
50 lM, respectively, and EC50 > 25 lM (data not shown), indicating
the requirement of aldehyde in inhibiting the 3C protease.
To rationalize the different inhibitory activities of these com-
pounds, a computer program was used to dock 6b (in cyan), 10b
(in yellow), and AG7088 (in salmon) into the active site of EV71
3C protease structure simulated using the structure of RV 3C pro-
tease as a template. From the computer modeling (Fig. 5), we found
position to that of the
a-carbon of AG7088 in the active site, and
is readily accessible by the nucleophile Cys147.

C.-J. Kuo et al. / Bioorg. Med. Chem. 16 (2008) 7388–7398
7391
O
NH
A
NC
NH2
CO2H
c
a, b
NHBoc
CO2Me
HO2C
MeO2C
BocHN
O
CO2Me
L
-Glutamic acid
1
2
NH
O
NH
O
g, h
d, e, f
BocHN
N
H
CO2Et
BocHN
CO2Et
4
3
O
NH
R
O
Cl
H
R
N
N
CO2Et
O
5a−c
H
O
6a R = 3,4-(methylenedioxy)
6b R = 4-dimethylamino
6c R = H
g, i
O
B
NH
Ar
5a−f
e, f
Cl
O
NH
O
O
H
N
a, b
O
N
R
H
O
BocHN
CO2Me
2
7 R = CO2Me
8 R = CHO
c, d
c, d
O
O
NH
NH
O
O
H
H
Ar
N
H
Ar
N
N
N
CO2Me
H
H
O
O
O
9a Ar = 3,4-(OCH2O)C6H3
9b Ar = 4-Me2NC6H4
9c Ar = C6H5
9d Ar = 4-MeC6H4
9e Ar = 4-Cl,2-FC6H3
9f Ar = 5-Methyl-3-isoxazole
10a Ar = 3,4-(OCH2O)C6H3
10b Ar = 4-Me2NC6H4
10c Ar = C6H5
10d Ar = 4-MeC6H4
10e Ar = 4-Cl,2-FC6H3
10f Ar = 5-Methyl-3-isoxazole
Figure 2. Synthesis of EV71 3C protease inhibitors with
a
,b-unsaturated ester (A) and aldehyde (B) at the P10 position. (A) Reagents and conditions: (a) Me3SiCl, MeOH,
0–25 °C, 18 h; then Boc2O, Et3N, 0–25 °C, 4 h; 96%. (b) LiN(SiMe3)2, THF, ꢀ78 °C, 3 h; then BrCH2CN, 3.5 h; 82%. (c) H2, cat. PtO2, MeOH, CHCl3, 25 °C, 12 h; then NaOAc, reflux,
12 h; 81%. (d) NaBH4, LiCl, THF, EtOH, 25 °C, 18 h; 89%. (e) Pyridine-SO3, Me2SO, CH2Cl2, Et3N, ꢀ10 °C, 3 h. (f) [EtO2CCHPO(OEt)2]ꢀNa+, THF, ꢀ78 °C, 1 h; 75% for two steps. (g)
HCl, 1,4-dioxane, 25 °C, 2 h. (h) Boc-L-Phe, HOBt, EDCI, (i-Pr)2NEt, DMF, 0–25 °C, 18 h; 72% for two steps. (i) Prepared cinnamoyl chloride 5a–c, N-methylmorpholine, THF,
0–25 °C, 5 h; 53–66% for two steps. (B) Reagents and conditions: (a) HCl, 1,4-dioxane, 25 °C, 2 h. (b) Cbz-L-Phe, HOBt, EDCI, (i-Pr)2NEt, DMF, 0–25 °C, 20 h; 75% for two steps.
(c) LiBH4, THF, CH2Cl2, 0 °C, 3 h. (d) Dess–Martin periodinane, CH2Cl2, 0–25 °C, 3 h; 55–71% for two steps. (e) H2, Pd/C, MeOH, 25 °C, 3 h. (f) Prepared cinnamoyl chloride 5a–f,
N-methylmorpholine, THF, 0–25 °C, 5 h; 45–68% for two steps.
blocked the viral replication in the cell-based assay with similar
activity. In order to set up an assay for finding the protease inhib-
itors, we have expressed, purified, and characterized the recombi-
nant EV71 3C protease. By testing the potential substrates, we
unexpectedly found that the protease showed the best activity
3. Discussion
In this study, we have verified that EV71 3C protease is a target
for anti-EV 71 drug discovery based on the enzyme- and cell-based
assays. The compounds, which inhibited the protease activity, also

7392
C.-J. Kuo et al. / Bioorg. Med. Chem. 16 (2008) 7388–7398
Table 1
IC50, EC50, and CC50 of the peptidomimetic inhibitors against the EV71 3C protease
Compound
IC50
>20
10.6 0.4
8.2 1.7 (2.6
10.0 1.3
<0.5
<0.5
<0.5
<0.5
<0.5
(
l
M)
EC50
>20
1.8 0.1
2.9 0.1
(
l
M)
CC50 (lM)
4
n.d.
>25
21.4 1.6
8.0 0.2
23.6 0.4
>25
>25
>25
>25
5.1 0.7
>25
6a (JMF1528)
6b (JMF1810)
6c (JMF1813)
8 (JMF1897)
10a (JMF1807)
10b (JMF1860)
10c (JMF1857)
10d (JMF1859)
10e (JMF1900)
10f (JMF1904)
l
Ma)
1.3 0.1
0.031 0.001
0.16 0.02
0.018 0.003
0.096 0.006
0.026 0.002
0.007 0.001
0.94 0.36
Figure 4. Inhibition of EV71 protein accumulation in RD cells by 10d treatment.
Cell lysates (40 g protein per lane) were prepared from either mock-infected (lane
<0.5
<0.5
l
1) or EV71-infected (lanes 2–8) RD cells at 48 hours post infection and resolved
with 12% SDS–PAGE. Western blot analysis for 3C protease or b-actin was
conducted as described in Section 2. Lane 1, mock-infected cells not treated with
n.d., not determined.
a
Ki measured from time-dependent inhibition.
10d; lanes 2–8, cells were treated with 0, 0.01, 0.025, 0.05, 0.1, 0.5, or 1 lM 10d,
respectively; The bands corresponding to EV71 3C protease (20 kDa) are indicated.
Expression of b-actin was used to control equal protein loading.
Therefore, P1-lactam group is important and Leu or Val at the P3
position seems not important for the anti-virus activity. However,
with only P1-lactam, P2-Phe, and P10-
a,b-unsaturated ester, the
key features of AG7088, do not guarantee the protease-binding
affinity (no enzyme inhibition was found for compound 4 at
20
l
M). Addition of cinnamoyl group at P3 and simultaneous
,b-unsaturated ester with aldehyde yield
replacement of P10-
a
potent inhibition as rationalized by the computer modeling. Alde-
hyde group, which can form reversible covalent bond with the
catalytic Cys, is important for inhibition since other compounds
with CH2OH or CO2Me at P10 did not effectively inhibit the 3C pro-
tease. Our study provides potent EV71 3C protease inhibitors effec-
tive as anti-EV71 agents and facilitates the combinatorial synthesis
of derivatives for further improving the inhibitory activity.
4. Experimental
4.1. General methods
All the reagents were commercially available and used without
further purification unless indicated otherwise. All solvents were
of anhydrous grade unless indicated otherwise. All non-aqueous
reactions were carried out in oven-dried glassware under a slight
positive pressure of argon unless otherwise noted. Reaction mix-
tures were magnetically stirred and monitored by thin-layer chro-
matography on silica gel. Flash chromatography was performed on
silica gel of 60–200 lm particle size. Yields are reported for spec-
Figure 3. Enzyme inhibition studies of 6b. Drop of enzymatic activities against the
incubation time in the presence of 1–10 M 6b is shown (upper panel). The lower
l
troscopically pure compounds. Melting points were recorded on
an Electrothermal MEL-TEMPÒ 1101D melting point apparatus.
NMR spectra were recorded on Bruker AVANCE 600, 400 and 300
spectrometers. Chemical shifts are given in d values relative to tet-
ramethylsilane (TMS); coupling constants J are given in Hz. Inter-
nal standards were CDCl3 (dH = 7.24) or DMSO-d6 (dH = 2.49) for
1H-NMR spectra; CDCl3 (dC = 77.0) or DMSO-d6 (dC = 39.5) for
13C-NMR spectra. The splitting patterns are reported as s (singlet),
d (doublet), t (triplet), q (quartet), m (multiplet), br (broad), and dd
(double of doublets). IR spectra were recorded on a Thermo Nicolet
380 FT-IR spectrometer. High resolution ESI mass spectra were
recorded on a Bruker Daltonics spectrometer.
panel shows the replot of the half-life (t1/2) of enzyme inactivation as a function of
the reciprocal of the slow inactivator concentration. The kinact is 0.077 minꢀ1 and Ki
is 2.6 lM for the time-dependent inactivator 6b based on the kinetic data.
against a substrate peptide derived from the N-terminal auto-
cleavage site of SARS-CoV 3C-like protease. Using this fluorogenic
peptide, we evaluated a series of AG7088 analogues as inhibitors
of EV71 3C protease, which were further tested for their anti-viral
activities.
Compared to the complicated procedure to synthesize AG7088,
which requires synthesis and assembly of three moieties, we re-
port potent AG7088 analogues that can be easily synthesized and
used as anti-EV71 agents in this study. In contrast to the tripeptide
aldehyde inhibitors of RV 3C protease, which contain Gln or unnat-
ural amino acid at P1, Phe at P2, and Cbz-Leu at the P3 position,
4.2. Expression and purification of EV71 3C protease
The gene encoding EV71 3C protease was cloned from viral
cDNA obtained from Chang-Gung memorial hospital (Tao-Yuan,
Taiwan) by using a polymerase chain reaction (PCR). The forward
primer 50-CATGCCATGGCATCATCATCATCATCATGGCCGAGCTTGGA
C-30 and the backward primer 50-GCGCTCGAGTCATTGTTCACT
showing moderate EC50 in the
l
M range,26 our inhibitors 10b
and 10d with the lactam ring at the P1 position, Phe at P2, cinnam-
oyl derivatives at P3, and aldehyde at P10 exhibit great inhibitory
activities in enzymatic and anti-viral assays without cytotoxicity.

C.-J. Kuo et al. / Bioorg. Med. Chem. 16 (2008) 7388–7398
7393
Figure 5. Computer modeling of the complex structures of EV71 protease with 6b and 10b based on the published structure (PDB code 1CQQ) of RV protease with AG7088
bound. The carbon skeletons of 6b, 10b, and AG7088 are shown in cyan, yellow, and salmon, respectively. The oxygen atoms are shown in red and nitrogen atoms are shown
in blue. The side view is shown in the right panel.
GCAAAAGTATCC-30, which contain NcoI and XhoI restriction sites
(underlined), were used to express N-terminal His-tagged prote-
ase; and the forward primer 50-CATGCCATGGGGCCGAGCTTGGAC-
30 and the backward primer 50- GCGCTCGAGTCAATGATGATG
ATGATGATGTTGTTCACTGCAAAAGTATCC- 30) were used for C-ter-
minal His-tagged protease. For expression of tag-free protease,
the forward primer 50-CATGCCATGGGGCCGAGCTTGGAC-30 and
backward primer 50-GCGCTCGAGTCATTGTTCACTGCAAAAGTATCC-
30 containing the same restriction sites were used. The PCR prod-
ucts were digested with NcoI and XhoI, and the DNA fragments
were cloned into pET16b (Novagen). The plasmid containing prote-
ase gene was used to transform E. coli JM109 competent cells and
the transformed cells were streaked on a Luria-Bertani (LB) agar
The purified protein was confirmed by N-terminal sequencing and
mass spectrometry. The protein concentration used in all experi-
ments was determined from the absorbance at 280 nm. For prepar-
ing untagged protein, SP sepharose, a cation exchange column, was
applied to purify the protease. The untagged protein was eluted by
a linear gradient of NaCl from 200 to 1000 mM. Subsequently, the
eluted sample was subjected to a size-exclusion chromatography
(Sephadex 200, 10/300 GL column) for further purification.
4.3. Protease activity assay
The peptides for testing as the protease substrates were synthe-
sized via solid phase using a 433A peptide synthesizer (Applied
Biosystems, USA). Starting with 0.10 mmol (0.101 g) of p-hydroxy-
methyl phenoxymethyl polystyrene resin (1.01 mmol/g), the syn-
thesis was performed using a stepwise FastMoc protocol (Applied
Biosystems, USA). The amino acids were introduced using the man-
ufacturer’s prepacked cartridges (1 mmol each). For examining the
plate containing 100
nies were selected from the agar plate and grown in 5 mL LB cul-
ture containing 100 g/mL ampicillin overnight at 37 °C. The
lg/mL ampicillin. Ampicillin-resistant colo-
l
correct constructs based on gene sequencing were subsequently
transformed into E. coli Origami B(DE3) (Novagen) for protein
expression. A 5-mL overnight culture of a single colony was used
substrate specificity of the protease, each peptide at 50
lM was
to inoculate 500 mL of fresh LB medium containing 25
l
g/mL kana-
incubated with 0.5 M protease for 6 and 12 h, and the resulting
l
mycin and 50 g/mL ampicillin. The cells were grown to A600 = 0.6
l
mixture was injected into C-18 reverse-phase HPLC for analysis
using the above-mentioned conditions. The areas of the product
peaks were integrated to calculate the reaction rate of each peptide
substrate under the catalysis of the protease.
and induced with 1 mM isopropyl-b-thiogalactopyranoside. After
4–5 h, the cells were harvested by centrifugation at 7000g for
15 min.
Purification of His-tagged protease was conducted at 4 °C. The
cell paste obtained from 2 L cell culture was suspended in an
80 mL lysis buffer containing 25 mM Tris–HCl, pH 7.5, and
150 mM NaCl. A French-press instrument (AIM-AMINCO spectron-
ic Instruments) was used to disrupt the cells at 12,000 psi. The lysis
solution was centrifuged and the debris was discarded. The cell-
free extract was loaded onto a 20-mL Ni–NTA column, which
was equilibrated with 25 mM Tris–HCl, pH 7.5, 150 mM NaCl,
and 5 mM imidazole. The column was washed with 5 mM imidaz-
ole followed by a 30 mM imidazole-containing buffer. His-tagged
protease was eluted with 25 mM Tris–HCl, pH 7.5, 150 mM NaCl,
and 300 mM imidazole. The protein solution was dialyzed against
a 2ꢁ 2 L buffer containing 12 mM Tris–HCl, pH 7.5, 120 mM NaCl,
0.1 mM EDTA, 7.5 mM b-mercaptoethanol, and 1 mM DTT.
The best peptide substrate was attached with a fluorescence
quenching pair, and the fluorogenic peptide (Dabcyl-KTSAVLQ
SGFRKME-Edans) was used to measure the protease activity. The
kinetic constants for the fluorogenic peptide were measured in
10 mM MES at pH 6.5 (the optimal pH for EV71 3C protease) at
25 °C. Enhanced fluorescence due to the cleavage of the peptide
was monitored at 538 nm with excitation at 355 nm using a fluo-
rescence plate reader (Fluoroskan Ascent from ThermoLabsystems,
Finland). The enzyme concentration used in measuring Km and kcat
values was 0.5 lM and the substrate concentrations were from 0.5-
to 5-fold of an estimated Km value. Substrate concentration was
determined by using the extinction coefficients 5438 Mꢀ1 cmꢀ1
at 336 nm (Edans) or 15,100 Mꢀ1 cmꢀ1 at 472 nm (Dabcyl). The ini-
tial rates within 10% substrate consumption at different substrate

7394
C.-J. Kuo et al. / Bioorg. Med. Chem. 16 (2008) 7388–7398
concentrations were used to calculate the kinetic parameters using
Michaelis–Menten equation fitted with the KaleidaGraph com-
puter program.
165.5, 155.3, 149.3, 137.8, 129.1 (2ꢁ), 128.0 (2ꢁ), 126.3, 119.5,
78.0, 59.8, 56.2, 47.2, 38.2, 37.4, 37.2, 34.9, 28.0, 27.2, 14.1 (3ꢁ);
HRMS calcd for
496.2427.
C
25H35N3NaO6: 496.2424 (M++Na); found:
4.4. Synthesis of AG7088 analogues
4.4.5. Ethyl 4-{2-[3,4-(methylenedioxy)cinnamoyl]amino-1-
oxo-3-phenyl}propylamino-5-(2-oxo-3-pyrrolidyl)-2-
pentenoate (6a)
Known compounds 1–3 and 6a were prepared as previously re-
ported.22–24 The synthesis of new compounds is described below in
details.
To an ice cooled suspension of 3,4-(methylenedioxy)cinnamic
acid (96 mg, 0.5 mmol) in THF (3 mL), PCl5 (125 mg, 0.6 mmol)
was added. The mixture was stirred for 10 min at 0 °C, and then
for 30 min at room temperature to prepare an acid chloride solu-
tion.25 To a solution of HCl in 1,4-dioxane (4.0 M, 2 mL) was added
a solution of 4 (190 mg, 0.4 mmol) in 1,4-dioxane (2 mL) at room
temperature. The mixture was stirred for 2 h, and then concen-
trated under reduced pressure to yield a crude ammonium salt.
The material was dissolved in THF (15 mL) and DMF (1 mL) and
cooled to 0 °C. The above acid chloride solution and N-methylmor-
pholine (0.33 mL, 3 mmol) were added sequentially, and the ice
bath was removed. After being stirred for 5 h at room temperature,
the reaction mixture was partitioned between CH2Cl2 (20 mL) and
water (10 mL). The organic layer was washed with water (2ꢁ
10 mL), and brine (10 mL), dried over Na2SO4, filtrated, and con-
centrated. The residue was purified by flash column chromatogra-
phy (MeOH/CH2Cl2, 1:99) to provide 6a (144 mg, 58%). White solid;
mp 103–105 °C; TLC (MeOH/CH2Cl2, 1:99) Rf = 0.24; IR (KBr) 3283,
4.4.1. (2S,4S)-2-tert-Butoxycarbonylamino-4-cyanomethyl-
pentanedioic acid dimethyl ester (1)
Oil; TLC (EtOAc/hexane, 3:7) Rf = 0.13; IR (neat) 3371, 2982,
2263, 1743, 1719, 1520, 1441, 1370, 1250, 1169, 1054 cmꢀ1 1H
;
NMR (CDCl3, 300 MHz) d 5.09 (1H, d, J = 8.6 Hz), 4.37 (1H, dd,
J = 13.6, 8.6 Hz), 3.74 (3H, s), 3.73 (3H, s), 2.82 (3H, m), 2.14 (2H,
m), 1.42 (9H, s); 13C NMR (CDCl3, 75 MHz) d 172.4,169.3, 153.3,
117.1, 82.3, 52.7, 52.6, 51.0, 38.2, 33.8, 28.2 (3ꢁ), 19.0; HRMS calcd
for C14H23N2O6 (M++H): 315.1478; found: 315.1554.
4.4.2. 2S-tert-Butoxycarbonylamino-3-(2-oxopyrrolidin-3S-yl)-
propionic acid methyl ester (2)
White solid; TLC (EtOAc) Rf = 0.27; IR (KBr) 3304, 2981, 1745,
1699, 1524, 1260 cmꢀ1 1H NMR (CDCl3, 300 MHz) d 6.03 (1H, br
;
s, NH), 5.49 (1H, d,J = 7.9 Hz), 4.32–4.29 (1H, m), 3.27 (3H, s),
3.34–3.29 (2H, m), 2.47–2.41 (2H, m), 2.15–2.05 (1H, m), 1.88–
1.75 (2H, m), 1.41 (9H, s); 13C NMR (CDCl3, 75 MHz)
d
2919, 1653, 1447, 1241 cmꢀ1 1H NMR (CDCl3, 400 MHz) d 7.81
;
175.7,172.7, 155.5, 79.3, 51.9, 45.3, 40.1, 38.0, 33.4, 27.9 (3ꢁ),
27.6; HRMS calcd for C13H23N2O5 (M++H): 287.1529; found:
287.1611.
(1H, d, J = 7.0 Hz), 7.50 (1H, d, J = 15.5 Hz), 7.29–7.20 (4H, m),
7.00–6.94 (2H, m), 6.79–6.67 (3H, m), 6.31–6.26 (2H, m), 5.99
(2H, s), 5.75 (1H, d, J = 15.5 Hz), 5.10–5.00 (1H, m), 4.57–4.40
(1H, m), 4.18 (2H, q, J = 7.1 Hz), 3.31–3.19 (3H, m), 3.08–3.06
(1H, m), 2.23–2.12 (2H, m), 2.10–1.81 (2H, m), 1.80–1.40 (2H,
m), 1.30 (3H, t, J = 7.0 Hz); 13C NMR (CDCl3, 100 MHz) d 171.2,
166.2, 165.8, 165.7, 149.2, 148.2, 146.8, 141.3, 136.5, 129.7,
129.1, 128.5 (2ꢁ), 126.9 (2ꢁ), 124.1, 121.2, 118.3, 108.5, 106.4,
101.4, 60.5, 54.8, 54.3, 49.5, 40.7, 38.9, 34.8, 29.7, 14.2; HRMS calcd
for C30H34N3O7: 548.2397 (M++H); found: 548.2399; Anal. calcd for
4.4.3. 4S-tert-Butoxycarbonylamino-5-(2-oxopyrrolidin-3S-yl)-
pent-2-enoic acid ethyl ester (3)
White foam; TLC (EtOAc/hexane, 1:1) Rf = 0.32; 1H NMR (CDCl3,
400 MHz) d 6.82 (1H, dd, J = 15.6, 5.1 Hz), 6.31 (1H, br s, NH), 5.92
(1H, dd, J = 15.6, 1.4 Hz), 5.27 (1H, d, J = 8.1 Hz), 4.37–4.26 (1H, m),
4.15 (2H, q, J = 7.2 Hz), 3.34–3.29 (2H, m), 2.48–2.44 (2H, m), 2.01–
1.91 (2H, m), 1.81–1.74 (1H, m), 1.59–1.53 (1H, m), 1.27 (9H, s),
1.24 (3H, t, J = 7.2 Hz); HRMS calcd for C16H27N2O5 (M++H):
327.1842; found: 327.1912.
C30H33N3O7: C 65.80, H 6.07, N 7.67; found: C 65.71, H 6.17, N 7.65.
4.4.6. Ethyl 4-{2-[4-(dimethylamino)cinnamoyl]amino-1-oxo-
3-phenyl}propyl-amino-5-(2-oxo-3-pyrrolidyl)-2-pentenoate
(6b)
4.4.4. Ethyl 4-[2-(tert-butoxycarbonyl)amino-1-oxo-3-
phenyl]propylamino-5-(2-oxo-3-pyrrolidyl)-2-pentenoate (4)
A solution of HCl in 1,4-dioxane (4.0 M, 10 mL) was added to a
solution of 3 (652 mg, 2 mmol) in 1,4-dioxane (5 mL) at room tem-
perature. The mixture was stirred for 2 h, and then concentrated
under reduced pressure to give a crude ammonium salt. The mate-
Compound 6b was prepared by following the procedure for pre-
paring 6a, except using 4-(dimethylamino)cinnamic acid. (Yield:
53%) Light yellow solid; mp 92–94 °C; TLC (MeOH/CH2Cl2, 1:99)
Rf = 0.21; IR (KBr) 3275, 2910, 1665, 1421, 1221 cmꢀ1 1H NMR
;
(DMSO-d6, 600 MHz) d 8.30 (1H, d, J = 8.1 Hz), 8.20–8.12 (1H, m),
7.58 (1H, s), 7.39–7.18 (8H, m), 6.91–6.75 (2H, m), 6.71 (2H, d,
J = 8.9 Hz), 5.67 (1H, d, J = 15.8 Hz), 4.69–4.60 (1H, m), 4.58–4.49
(1H, m), 4.11 (2H, q, J = 7.0 Hz), 3.18–2.80 (10H, m), 2.35–2.27
(1H, m), 2.12–2.07 (1H, m), 1.91–1.81 (1H, m), 1.68–1.57 (1H,
m), 1.51–1.43 (1H, m), 1.20 (3H, t, J = 7.0 Hz); 13C NMR (DMSO-
d6, 150 MHz) d 178.8, 171.5, 167.9, 166.0, 151.5, 149.6, 140.7,
138.2, 129.6, 129.3 (2ꢁ), 128.5 (2ꢁ), 126.7 (2ꢁ), 122.7, 120.3,
117.0, 112.3 (2ꢁ), 60.3, 54.9, 48.1, 40.1 (2ꢁ), 38.5, 38.0, 37.8,
rial and Boc-L-Phe (584 mg, 2.2 mmol) were dissolved in DMF
(20 mL) and cooled to 0 °C, followed by the addition of N,N-diiso-
propylethylamine (1.0 mL, 6 mmol), HOBt (338 mg, 2.5 mmol),
and EDCI (479 mg, 2.5 mmol). The mixture was removed from
the ice bath, stirred for 18 h at room temperature, and diluted with
CH2Cl2 (50 mL). The mixture was washed with 10% aqueous citric
acid (20 mL), water (20 mL), and brine (20 mL). The organic phase
was dried over Na2SO4, filtrated, and concentrated. The residual oil
was purified by flash column chromatography (EtOAc/hexane, 2:1)
to afford the desired product 4 (682 mg, 72% for two steps). White
foam; TLC (EtOAc) Rf = 0.45; IR (neat) 3257, 2910, 1659, 1421,
35.3, 27.8, 14.6; HRMS calcd for
C31H38N4NaO5: 569.2740
(M++Na); found: 569.2756; Anal. calcd for C31H38N4O5: C 68.11,
H 7.01, N 10.25; found: C 68.07, H 7.13, N 10.19.
1209 cmꢀ1
; d 8.09 (1H, d,
1H NMR (DMSO-d6, 600 MHz)
J = 8.7 Hz), 7.55 (1H, s), 7.26–7.16 (5H, m), 7.01 (1H, d, J = 8.1 Hz),
6.76 (1H, dd, J = 15.7, 4.7 Hz), 5.63 (1H, dd, J = 15.7, 1.4 Hz), 4.55–
4.45 (1H, m), 4.13–4.08 (3H, m), 3.13 (1 H, t, J = 9.2 Hz), 3.03 (1H,
dd, J = 16.4, 9.1 Hz), 2.87 (1 H, dd, J = 13.5, 6.0 Hz), 2.78 (1H, dd,
J = 13.5, 9.2 Hz), 2.32–2.29 (1H, m), 2.12–2.07 (1H, m), 1.85–1.80
(1H, m), 1.64–1.60 (1H, m), 1.48–1.40 (1H, m), 1.31 (9H, s), 1.20
(3H, t, J = 7.1 Hz); 13C NMR (DMSO-d6, 150 MHz) d 178.3, 171.5,
4.4.7. Ethyl 4-[2-(4-cinnamoyl)amino-1-oxo-3-phenyl]propyla-
mino-5-(2-oxo-3-pyrrolidyl)-2-pentenoate (6c)
Compound 6c was prepared by following the procedure for pre-
paring 6a, except using cinnamoyl chloride. (Yield: 66%) Colorless
solid; mp 87–89 °C; TLC (MeOH/CH2Cl2, 1:99) Rf = 0.28; IR (KBr)
;
3271, 2925, 1666, 1456, 1241 cmꢀ1 1H NMR (DMSO-d6,
600 MHz) d 8.47–8.40 (1H, m), 8.35 (1H, d, J = 8.6 Hz), 7.58–7.54

C.-J. Kuo et al. / Bioorg. Med. Chem. 16 (2008) 7388–7398
7395
(3H, m), 7.43–7.37 (4H, m), 7.28–7.25 (4H, m), 7.18 (1H, d,
J = 6.1 Hz), 6.87–6.70 (2H, m), 5.67 (1H, dd, J = 15.8, 1.5 Hz),
4.72–4.61 (1H, m), 4.58–4.50 (1H, m), 4.11 (2H, q, J = 7.1 Hz),
3.28–2.95 (3H, m), 2.93–2.87 (1H, m), 2.25–2.34 (1H, m), 2.15–
1.79 (2H, m), 1.69–1.40 (2H, m), 1.20 (3H, t, J = 7.1 Hz); 13C NMR
(DMSO-d6, 150 MHz) d 178.8, 171.3, 166.1, 165.3, 149.5, 139.4,
137.9, 135.2, 129.9, 129.6 (2ꢁ), 129.4 (2ꢁ), 128.6 (2ꢁ), 127.9
(2ꢁ), 126.9, 122.3, 120.2, 60.4, 55.0, 48.0, 38.3, 38.0, 37.8, 35.3,
27.8, 14.6; HRMS calcd for C29H33N3NaO5: 526.2318 (M++Na);
found: 526.2323; Anal. calcd for C29H33N3O5: C 69.17, H 6.60, N
8.34; found: C 69.01, H 6.69, N 8.37.
(3H, m), 2.85–2.81 (1H, m), 2.26–2.14 (2H, m), 1.91–1.88 (1H,
m), 1.65–1.62 (2H, m); 13C NMR (DMSO-d6, 150 MHz) d 201.3
178.7, 172.7, 156.3, 138.3, 137.5, 129.7 (2ꢁ), 128.7 (2ꢁ), 128.5
(2ꢁ), 128.1, 127.9 (2ꢁ), 126.7, 65.7, 62.1, 56.8, 56.7, 38.0, 37.6,
29.7, 27.7; HRMS calcd for C24H28N3O3: 438.2029 (M++H); found:
438.2031; Anal. calcd for C24H27N3O3: C 65.89, H 6.22, N 9.60;
found: C 65.76, H 6.53, N 9.51.
4.4.10. 3-[5-Methylisoxazol-3-yl] acrylic acid ethyl ester
To a solution of 5-methylisoxazole-3-carboxaldehyde (1.0 g,
9 mmol) and (carbethoxymethylene) triphenylphosphorane
(4.70 g, 13.5 mmol) in toluene (30 mL) was refluxed for 5 h and
concentrated under reduced pressure to give a crude product.
The residual solid was purified by flash column chromatography
4.4.8. Methyl 2-[2-(benzyloxycarbonyl)amino-1-oxo-3-
phenyl]propylamino-3-(2-oxo-3-pyrrolidyl)-propionate (7)
A solution of HCl in 1,4-dioxane (4.0 M, 10 mL) was added to a
solution of 2 (573 mg, 2 mmol) in 1,4-dioxane (5 mL) at room tem-
perature. The mixture was stirred for 2 h, and then concentrated
under reduced pressure to yield a crude ammonium salt. The mate-
(EtOAc/hexane, 1:9) to afford the
a,b-unsaturated ethyl ester
(1.32 g, 81%) as a white solid mp 35–37 °C; 1H NMR (CDCl3,
600 MHz) d 7.60 (1H, d, J = 16.1 Hz), 6.42 (1H, d, J = 16.1 Hz), 6.14
(1H, s), 4.25 (2H, q, J = 7.1 Hz), 2.43 (3H, s), 1.31 (3H, t,
J = 7.1 Hz); 13C NMR (CDCl3, 150 MHz) d 170.3, 165.7, 159.8,
131.9, 125.2, 99.3, 60.9, 14.2, 12.2; HRMS calcd for C9H12NO3:
182.0817 (M++H); found: 182.0816.
rial and Cbz-L-Phe (660 mg, 2.2 mmol) were dissolved in DMF
(20 mL) and cooled to 0 °C, followed by the addition of N,N-diiso-
propylethylamine (1.0 mL, 6 mmol), HOBt (340 mg, 2.5 mmol),
and EDCI (482 mg, 2.5 mmol). The mixture was removed from
the ice bath, stirred for 20 h at room temperature, and diluted with
CH2Cl2 (50 mL). The mixture was washed with 10% aqueous citric
acid (20 mL), water (20 mL), and brine (20 mL). The organic phase
was dried over Na2SO4, filtrated, and concentrated. The residual oil
was purified by flash column chromatography (EtOAc/hexane, 2:1)
to afford the desired product 7 (702 mg, 75% for two steps). White
foam; TLC (EtOAc) Rf = 0.40; IR (neat) 3222, 2935, 1622, 1437
4.4.11. 3-[5-Methylisoxazol-3-yl] acrylic acid
The above
a,b-unsaturated ethyl ester (1.32 g, 7.3 mmol) was
dissolved in THF (40 mL), and was added aqueous LiOH (1 N,
15 mL, 15 mmol). The reaction mixture was stirred for 1 h at room
temperature, and then 10% aqueous citric acid was added to make
the pH 2–3. The mixture was extracted with EtOAc (5ꢁ 20 mL), and
the combined organic layers were washed with brine. The organic
layer was dried over MgSO4, filtrated, and concentrated under re-
duced pressure. The residual solid (1.11 g) was used directly with-
out further purification. Colorless solid, mp 175–177 °C; 1H NMR
(DMSO-d6, 600 MHz) d 7.38 (1H, d, J = 16.0 Hz), 6.74 (1H, s), 6.67
(1H, d, J = 16.0 Hz), 2.43 (3H, s); 13C NMR (DMSO-d6, 150 MHz) d
170.8, 167.1, 160.3, 131.0, 127.7, 100.4, 12.2; HRMS calcd for
C7H8NO3: 154.0504 (M++H); found: 154.0506.
cmꢀ1 1H NMR (DMSO-d6, 600 MHz) d 8.58 (1H, d, J = 7.8 Hz),
;
7.64 (1H, s), 7.50 (1H, d, J = 8.4 Hz), 7.49–7.15 (10H, m), 4.94 (1H,
d, J = 12.8 Hz), 4.92 (1H, d, J = 12.8 Hz), 4.37–4.34 (1H, m), 4.30–
4.26 (1H, m), 3.60 (3H, s), 3.14–2.98 (3H, m), 2.77–2.70 (1H, m),
2.33–2.26 (1H, m), 2.09–2.05 (2H, m), 1.63–1.57 (2H, m); 13C
NMR (DMSO-d6, 150 MHz) d 178.4, 172.7, 172.4, 156.3, 138.5,
137.5, 129.6 (2ꢁ), 128.7 (2ꢁ), 128.5 (2ꢁ), 128.1, 127.8 (2ꢁ),
126.7, 65.6, 56.5, 52.4, 50.7, 38.7, 38.0, 37.7, 32.9, 27.6; HRMS calcd
for C25H29N3NaO6: 491.1954 (M++Na); found: 491.1960.
4.4.12. Methyl 2-{2-[3,4-(methylenedioxy)cinnamoyl]amino-1-
oxo-3-phenyl}propyl-amino-3-(2-oxo-3-pyrrolidyl)-propionate
(9a)
4.4.9. 2-[2-(Benzyloxycarbonyl)amino-1-oxo-3-
phenyl]propylamino-3-(2-oxo-3-pyrrolidyl)-propan-1-al (8)
Compound 7 (235 mg, 0.5 mmol) was dissolved in CH2Cl2
(10 mL). LiBH4 solution (1 M in THF, 0.6 mL, 0.75 mmol) was added
to the above solution at 0 °C. After the reaction mixture was stirred
for 3 h at 0 °C, the reaction was quenched by adding saturated
NH4Cl solution (5 mL). All volatiles were removed under reduced
pressure and the aqueous residue was extracted with CH2Cl2 (5ꢁ
10 mL). The combined organic layers were washed with brine,
dried over MgSO4, filtrated, and concentrated. The crude product
(225 mg) was used in the next step without further purification.
The above alcohol (225 mg) was dissolved in CH2Cl2 (20 mL) and
was treated with Dess–Martin periodinane (640 mg, 1.5 mmol) at
0 °C. The reaction mixture was warmed to room temperature and
stirring was continued for 3 h. The reaction was quenched with a
mixture of Na2S2O3 (1.26 g) in aqueous saturated NaHCO3
(20 mL). The resulting mixture was stirred until the organic layer
turned clear. The organic layer was separated and the aqueous
layer was extracted with CH2Cl2 (3ꢁ 10 mL). The combined organic
layers were dried over Na2SO4, filtrated, and concentrated. The res-
idue was purified by flash column chromatography (MeOH/CH2Cl2,
1:19) to afford the desired product 8 (148 mg, 68% for two steps).
White foam; TLC (MeOH/CH2Cl2, 1:9) Rf = 0.55; IR (neat) 3433,
To an ice cooled suspension of 3,4-(methylenedioxy)cinnamic
acid (96 mg, 0.5 mmol) in THF (3 mL), PCl5 (125 mg, 0.6 mmol)
was added. The mixture was stirred for 10 min at 0 °C, and then
30 min at room temperature to prepare an acid chloride solution
(25). Compound 7 (187 mg, 0.4 mmol) in CH3OH (10 mL) was trea-
ted with Pd/C (20 mg) and then put under a hydrogen atmosphere
at room temperature for 3 h. The catalyst was then removed by fil-
tration through Celite followed by washing with CH3OH. The fil-
trate was concentrated in vacuo to afford the deprotecting amine
product (131 mg). The material was dissolved in THF (15 mL)
and DMF (1 mL) and cooled to 0 °C. The above acid chloride solu-
tion and N-methylmorpholine (0.33 mL, 3 mmol) were added
sequentially, and the ice bath was removed. After being stirred
for 5 h at room temperature, the reaction mixture was partitioned
between CH2Cl2 (20 mL) and water (10 mL). The organic layer was
washed with water (2ꢁ 10 mL), and brine (10 mL), dried over
Na2SO4, filtrated, and concentrated. The residue was purified by
flash column chromatography (MeOH/CH2Cl2, 1:99) to provide 9a
(124 mg, 61%). White foam; TLC (MeOH/CH2Cl2, 1:19) Rf = 0.20;
IR (neat) 3501, 2934, 1756, 1655, 1417 cmꢀ1 1H NMR (DMSO-d6,
;
400 MHz) d 8.64 (1H, d, J = 8.7 Hz), 8.17 (1H, d, J = 8.9 Hz), 7.63
(1H, s), 7.27–7.16 (6H, m), 7.10 (1H, s), 7.04–7.02 (1H, m), 6.94–
6.92 (1H, m), 6.52 (1H, d, J = 15.7 Hz), 6.05 (2H, s), 4.71–4.68 (1H,
m), 4.37–4.31 (1H, m), 3.62 (3H, s), 3.29–3.04 (2H, m), 2.85–2.78
(1H, m), 2.32–2.27 (2H, m), 2.14–1.95 (2H, m), 1.64–1.59 (2H,
m); 13C NMR (DMSO-d6, 100 MHz) d 178.2, 172.5, 172.0, 165.3,
2922, 1744, 1656, 1402 cmꢀ1 1H NMR (DMSO-d6, 600 MHz) d
;
9.32 (1H, s), 8.57 (1H, d, J = 6.8 Hz), 8.00 (1H, d, J = 7.5 Hz), 7.80
(1H, br s), 7.33–7.21 (10H, m), 4.95 (1H, d, J = 13.7 Hz), 4.92 (1H,
d, J = 13.7 Hz), 4.40–4.35 (1H, m), 4.25–4.13 (1H, m), 3.23–3.02

7396
C.-J. Kuo et al. / Bioorg. Med. Chem. 16 (2008) 7388–7398
148.8, 148.2, 139.1, 138.1, 129.4 (2ꢁ), 128.3 (2ꢁ), 126.6, 123.5,
120.3, 120.2, 108.8, 106.5, 101.7, 54.2, 52.2, 50.6, 40.4, 37.9, 37.8,
32.7, 27.5; HRMS calcd for C27H29N3NaO7: 530.1903 (M++Na);
found: 530.1910.
3.16–3.06 (3H, m), 2.84–2.80 (1H, m), 2.32–2.29 (1H, m), 2.13–
2.07 (2H, m), 1.65–1.61 (2H, m); 13C NMR (DMSO-d6, 150 MHz) d
178.4, 172.7, 172.0, 164.8, 138.2, 135.07, 135.00, 130.79, 130.75,
129.6 (2ꢁ), 128.5 (2ꢁ), 126.7, 125.8, 122.1, 117.2, 117.1, 54.5,
52.4, 50.7, 38.7, 38.1, 38.0, 32.8, 27.6; HRMS calcd for
4.4.13. Methyl 2-{2-[4-(dimethylamino)cinnamoyl]amino-1-
oxo-3-phenyl} propyl-amino-3-(2-oxo-3-pyrrolidyl)-propionate
(9b)
C
26H27ClFN3NaO5: 538.1521 (M++Na); found: 538.1527.
4.4.17. Methyl 2-{2-[3-(5-methylisoxazol-3-yl)acryloyl]amino-
1-oxo-3-phenyl}propyl-amino-3-(2-oxo-3-pyrrolidyl)-
propionate (9f)
Compound 9b was prepared by following the procedure to pre-
pare 9a, except using 4-(dimethylamino)cinnamic acid (Yield:
45%). Light yellow foam; TLC (MeOH/CH2Cl2, 1:19) Rf = 0.12; IR
Compound 9f was prepared by following the procedure to pre-
pare 9a, except using the prepared 3-(5-methylisoxazol-3-yl) ac-
rylic acid. (Yield: 48%) White foam; TLC (MeOH/CH2Cl2, 1:19)
(neat) 3528, 2901, 1733, 1627, 1459 cmꢀ1 1H NMR (DMSO-d6,
;
600 MHz) d 8.61 (1H, d, J = 7.9 Hz), 8.10 (1H, d, J = 8.3 Hz), 7.64
(1H, s), 7.34 (2H, d, J = 8.8 Hz), 7.28–7.22 (3H, m), 7.18 (1H, d,
J = 15.6 Hz), 7.28–7.22 (2H, m), 6.69 (2H, d, J = 8.8 Hz), 6.39 (1H,
d, J = 15.6 Hz), 4.68–4.64 (1H, m), 4.35–4.31 (1H, m), 3.61 (3H, s),
3.14–3.02 (3H, m), 2.93 (6H, s), 2.79 (1H, dd, J = 13.9, 10.1 Hz),
2.32–2.25 (1H, m), 2.12–2.04 (2H, m), 1.64–1.59 (2H, m); 13C
NMR (DMSO-d6, 150 MHz) d 178.4, 172.7, 171.6, 162.8, 151.5,
138.1, 133.2, 132.4 (2ꢁ), 129.7 (2ꢁ), 129.6 (2ꢁ), 128.5, 126.8,
120.2, 118.5, 111.9 (2ꢁ), 55.3, 52.4, 50.8, 38.7 (2ꢁ), 38.0, 37.4,
32.9, 27.6; HRMS calcd for C28H34N4NaO5: 529.2427 (M++Na);
found: 529.2431.
Rf = 0.14; IR (neat) 3321, 1702, 1668, 1532, 1328, 1180 cmꢀ1 1H
;
NMR (DMSO-d6, 600 MHz) d 8.71 (1H, d, J = 7.6 Hz), 8.57 (1H, d,
J = 8.2 Hz), 7.65 (1H, s), 7.30–7.18 (6H, m), 6.78 (1H, d,
J = 15.9 Hz), 6.47 (1H, s), 4.72–4.68 (1H, m), 4.38–4.34 (1H, m),
3.64 (3H, s), 3.17–3.08 (3H, m), 2.85–2.81 (1H, m), 2.42 (3H, s),
2.31–2.29 (1H, m), 2.12–2.09 (2H, m), 1.66–1.61 (2H, m); 13C
NMR (DMSO-d6, 150 MHz) d 178.4, 172.6, 171.9, 170.8, 164.2,
160.3, 138.1, 129.6, 129.5, 128.5 (2ꢁ), 126.9, 126.79, 126.71,
100.2, 54.5, 52.4, 50.8, 40.5, 38.0, 37.9, 32.8, 27.6, 12.2; HRMS calcd
for C24H28N4NaO6: 491.1907 (M++Na); found: 491.1912.
4.4.14. Methyl 2-[2-(cinnamoyl)amino-1-oxo-3-phenyl]propyla-
mino-3-(2-oxo-3-pyrrolidyl)-propionate (9c)
4.4.18. 2-{2-[3,4-(Methylenedioxy)cinnamoyl]amino-1-oxo-3-
phenyl}propyl amino-3-(2-oxo-3-pyrrolidyl)-propan-1-al (10a)
White foam; TLC (MeOH/CH2Cl2, 1:9) Rf = 0.45; IR (neat) 3321,
Compound 9c was prepared by following the procedure to pre-
pare 9a, except using cinnamoyl chloride (Yield: 68%). White foam;
TLC (MeOH/CH2Cl2, 1:19) Rf = 0.20; IR (neat) 3530, 2912, 1750,
2909, 1721, 1638, 1472 cmꢀ1 1H NMR (DMSO-d6, 600 MHz) d
;
9.30 (1H, s), 8.67 (1H, d, J = 7.6 Hz), 8.30 (1H, d, J = 8.2 Hz), 7.65
(1H, s), 7.31–7.18 (7H, m), 7.12 (1H, s), 6.94 (1H, d, J = 8.0 Hz),
6.55 (1H, d, J = 15.8 Hz), 6.06 (2H, s), 4.78–4.69 (1H, m), 4.17–
4.13 (1H, m), 3.23–3.06 (3H, m), 2.92–2.90 (1H, m), 2.25–2.10
(2H, m), 1.95–1.85 (1H, m), 1.63–1.60 (2H, m); 13C NMR (DMSO-
d6, 150 MHz) d 201.3, 178.6, 172.5, 165.4, 148.9, 148.4, 139.3,
138.1, 129.6 (2ꢁ), 128.5 (2ꢁ), 128.4, 126.8, 123.7, 120.3, 109.0,
106.6, 101.9, 60.2, 56.8, 54.6, 38.3, 37.6, 29.6, 27.7; HRMS calcd
for C26H27N3NaO6: 500.1798 (M++Na); found: 500.1800; Anal.
calcd for C26H27N3O6: C 65.40, H 5.70, N 8.80; found: C 65.31, H
5.85, N 8.79.
1621, 1421 cmꢀ1 1H NMR (DMSO-d6, 600 MHz) d 8.72 (1H, d,
;
J = 7.9 Hz), 8.38 (1H, d, J = 8.3 Hz), 7.68 (1H, s), 7.54 (2H, d,
J = 7.1 Hz), 7.41–7.26 (8H, m), 7.20–7.17 (1H, m), 6.70 (1H, d,
J = 15.8 Hz), 4.75–4.71 (1H, m), 4.39–4.32 (1H, m), 3.64 (3H, s),
3.15–3.06 (3H, m), 2.84–2.80 (1H, m), 2.35–2.28 (1H, m), 2.12–
2.09 (2H, m), 1.64–1.61 (2H, m); 13C NMR (DMSO-d6, 150 MHz) d
178.4, 172.7, 172.1, 165.2, 139.4, 138.2, 135.2, 129.9, 129.6 (2ꢁ),
129.4 (2ꢁ), 128.5 (2ꢁ), 128.0 (2ꢁ), 126.7, 122.3, 54.4, 52.4, 50.7,
39.7, 38.1, 38.0, 32.8, 27.6; HRMS calcd for
486.2005 (M++Na); found: 486.2008.
C26H29N3NaO5:
4.4.15. Methyl 2-{2-[4-(methyl)cinnamoyl]amino-1-oxo-3-
phenyl}propylamino-3-(2-oxo-3-pyrrolidyl)-propionate (9d)
Compound 9d was prepared by following the procedure to pre-
pare 9a, except using 4-methylcinnamic acid (yield: 58%). White
foam; TLC (MeOH/CH2Cl2, 1:19) Rf = 0.14; IR (neat) 3512, 2921,
4.4.19. 2-{2-[4-(Dimethylamino)cinnamoyl]amino-1-oxo-3-
phenyl}propyl amino-3-(2-oxo-3-pyrrolidyl)-propan-1-al (10b)
Light yellow foam; TLC (MeOH/CH2Cl2, 1:19) Rf = 0.20; IR (neat)
3411, 2934, 1728, 1681, 1432 cmꢀ1; 1H NMR (DMSO-d6, 600 MHz)
d 9.29 (1H, s), 8.62 (1H, d, J = 7.6 Hz), 8.20 (1H, d, J = 8.1 Hz), 7.63
(1H, s), 7.34 (2H, d, J = 8.7 Hz), 7.28–7.15 (6H, m), 6.68 (2H, d,
J = 8.7 Hz), 6.43 (1H, d, J = 15.5 Hz), 4.73–4.66 (1H, m), 4.16–4.09
(1H, m), 3.22–3.19 (1H, m), 3.10–3.03 (3H, m), 2.92 (6H, s), 2.15–
2.11 (2H, m), 2.02–2.06 (2H, m), 1.66–1.50 (1H, m); 13C NMR
(DMSO-d6, 150 MHz) d 201.0, 178.2, 170.3, 165.6, 151.1, 139.5,
137.8, 129.1 (2ꢁ), 128.8 (2ꢁ), 128.1 (2ꢁ), 126.3, 122.2, 116.2,
111.9 (2ꢁ), 59.7, 57.4, 56.4, 39.7 (2ꢁ), 37.9, 37.3, 28.3, 27.2; HRMS
calcd for C27H32N4NaO4: 499.2321 (M++Na); found: 499.2325;
Anal. calcd for C27H32N4O4: C 68.05, H 6.77, N 11.76; found: C
68.12, H 6.69, N 11.70.
1746, 1681, 1421 cmꢀ1 1H NMR (DMSO-d6, 600 MHz) d 8.72
;
(1H, d, J = 7.9 Hz), 8.33 (1H, d, J = 8.3 Hz), 7.68 (1H, s), 7.43 (2H,
d, J = 8.0 Hz), 7.33–7.17 (8H, m), 6.64 (1H, d, J = 15.8 Hz), 4.76–
4.68 (1H, m), 4.40–4.32 (1H, m), 3.63 (3H, s), 3.15–3.06 (3H, m),
2.84–2.80 (1H, m), 2.35–2.28 (4H, m), 2.12–2.09 (2H, m), 1.65–
1.60 (2H, m); 13C NMR (DMSO-d6, 150 MHz) d 178.4, 172.7,
172.2, 165.4, 139.7, 139.3, 138.3, 132.5, 129.9 (2ꢁ), 129.6 (2ꢁ),
128.5 (2ꢁ), 127.9 (2ꢁ), 126.7, 121.2, 54.4, 52.4, 50.7, 40.1, 38.09,
38.02, 32.8, 27.6, 21.4; HRMS calcd for C27H31N3NaO5: 500.2161
(M++Na); found: 500.2167.
4.4.16. Methyl 2-{2-[(4-chloro-2-fluoro)cinnamoyl]amino-1-
oxo-3-phenyl}propyl amino-3-(2-oxo-3-pyrrolidyl)-propionate
(9e)
4.4.20. 2-[2-(Cinnamoyl)amino-1-oxo-3-phenyl]propylamino-
3-(2-oxo-3-pyrrolidyl)-propan-1-al (10c)
White foam; TLC (MeOH/CH2Cl2, 1:9) Rf = 0.55; IR (neat) 3412,
Compound 9e was prepared by following the procedure to pre-
pare 9a, except using 4-chloro-2-fluorocinnamic acid (yield: 50%).
White foam; TLC (MeOH/CH2Cl2, 1:19) Rf = 0.16; IR (neat) 3529,
2911, 1742, 1602, 1412 cmꢀ1 1H NMR (DMSO-d6, 600 MHz) d
;
9.31 (1H, s), 8.67 (1H, d, J = 7.5 Hz), 8.43 (1H, d, J = 8.1 Hz), 7.63
(1H, s), 7.55 (2H, d, J = 7.2 Hz), 7.42–7.18 (9H, m), 6.73 (1H, d,
J = 15.8 Hz), 4.73–4.71 (1H, m), 4.18–4.16 (1H, m), 3.17–3.08 (3H,
m), 2.93–2.89 (1H, m), 2.23–2.12 (2H, m), 1.92–1.88 (1H, m),
1.66–1.61 (2H, m); 13C NMR (DMSO-d6, 150 MHz) d 201.3, 178.6,
172.4, 165.2, 139.4, 138.1, 135.2, 129.9, 129.6 (2ꢁ), 129.4 (2ꢁ),
2918, 1752, 1670, 1413 cmꢀ1 1H NMR (DMSO-d6, 600 MHz) d
;
8.69 (1H, d, J = 7.8 Hz), 8.50 (1H, d, J = 8.2 Hz), 7.67–7.64 (2H, m),
7.51 (1H, d, J = 9.1 Hz), 7.38–7.17 (7H, m), 6.80 (1H, d,
J = 15.9 Hz), 4.75–4.70 (1H, m), 4.40–4.33 (1H, m), 3.64 (3H, s),

C.-J. Kuo et al. / Bioorg. Med. Chem. 16 (2008) 7388–7398
7397
128.6 (2ꢁ), 127.9 (2ꢁ), 126.8, 122.3, 56.9, 54.6, 39.5, 38.3, 37.6,
29.6, 27.7; HRMS calcd for C25H27N3NaO4: 456.1899 (M++Na);
found: 456.1901; Anal. calcd for C25H27N3O4: C 69.27, H 6.28, N
9.69; found: C 69.51, H 6.42, N 9.57.
0.5 lM enzyme. The reduction of enzyme activity with the incuba-
tion time of the enzyme with the inhibitor was fitted with a single
exponential equation to obtain the kobs of inactivation at different
inhibitor concentrations. From the kobs of inactivation, the half-life
(t1/2) can be calculated (t1/2 = ln2/kobs). The half-life for inactivation
at each inactivator concentration was plotted against 1/[inactiva-
4.4.21. 2-{2-[4-(Methyl)cinnamoyl]amino-1-oxo-3-
phenyl}propylamino-3-(2-oxo-3-pyrrolidyl)-propan-1-al (10d)
White foam; TLC (MeOH/CH2Cl2, 1:9) Rf = 0.50; IR (neat) 3372,
tor] to yield a line. The intersection at the y-axis was ln2/kinact,
from which the value of kinact was determined. The extrapolated
negative x-axis intercept was ꢀ1/Ki.
2928, 1751, 1621, 1487 cmꢀ1 1H NMR (DMSO-d6, 600 MHz) d
;
9.32 (1H, s), 8.67 (1H, d, J = 7.4 Hz), 8.39 (1H, d, J = 8.0 Hz), 7.63
(1H, s), 7.44 (2H, d, J = 7.6 Hz), 7.36 (1H, d, J = 15.8 Hz), 7.44–7.14
(7H, m), 6.67 (1H, d, J = 15.8 Hz), 4.75–4.71 (1H, m), 4.18–4.16 (1
H, m), 3.17–3.09 (3H, m), 2.94–2.90 (1H, m), 2.31 (3H, s), 2.22–
2.12 (2H, m), 1.94–1.89 (1H, m), 1.67–1.60 (2H, m); 13C NMR
(DMSO-d6, 150 MHz) d 201.3, 178.7, 172.4, 165.4, 139.4, 138.1,
129.9, 129.6 (2ꢁ), 129.3, 128.6 (2ꢁ), 128.5, 127.9 (2ꢁ), 126.8,
125.7, 121.3, 56.9, 54.6, 38.3, 37.6, 29.6, 27.7, 21.5, 21.3; HRMS
calcd for C26H29N3NaO4: 470.2056 (M++Na); found: 470.2059;
Anal. calcd for C26H29N3O4: C 69.78, H 6.53, N 9.39; found: C
69.59, H 6.61, N 9.31.
4.6. Anti-viral assay
This assay measured the ability of a tested compound to pre-
vent the infection of EV71 on human embryonic rhabdomyosar-
coma cells (RD cells). The 96-well tissue culture plates were
seeded with 200
l
L of RD cells at a concentration of 1.1 ꢁ 105
cells/mL in Dulbecco’s Modified Eagle’s Medium (DMEM) with
10% fetal bovine serum (FBS). The plates were incubated for 24–
30 h at 37 °C and were used at about 90% confluence. Virus (100
TCID50) mixed with different concentrations of the tested com-
pounds was added to the cells and incubated at 35 °C for 1 h. After
4.4.22. 2-{2-[(4-Chloro-2-fluoro)cinnamoyl]amino-1-oxo-3-
phenyl}propyl amino-3-(2-oxo-3-pyrrolidyl)-propan-1-al (10e)
White foam; TLC (MeOH/CH2Cl2, 1:9) Rf = 0.45; IR (neat) 3421,
adsorption, the infected cell plates were overlaid with 50 lL of
DMEM plus 2% FBS and 0.1% DMSO. The plate was incubated at
35 °C for 72 h. At the end of incubation, the plates were fixed by
the addition of 100 lL of 4% formaldehyde for 1 h at room temper-
2900, 1732, 1677, 1521 cmꢀ1
;
1H NMR (DMSO-d6, 600 MHz) d
9.32 (1H, s), 8.69 (1H, d, J = 7.4 Hz), 8.59 (1H, d, J = 8.0 Hz), 7.67–
7.63 (2H, m), 7.50–7.16 (8H, m), 6.83 (1H, d, J = 15.9 Hz), 4.80–
4.72 (1H, m), 4.21–4.13 (1H, m), 3.16–3.08 (3H, m), 2.93–2.90
(1H, m), 2.24–2.13 (2H, m), 1.91–1.89 (1H, m), 1.66–1.61 (2H,
m); 13C NMR (DMSO-d6, 150 MHz) d 201.2, 178.7, 172.3, 164.9,
138.0, 130.85, 130.81, 129.6, 129.3 (2ꢁ), 128.64, 128.60, 126.8,
125.7, 122.1, 122.0, 117.2, 117.0, 56.9, 54.7, 38.3, 37.6, 29.6, 27.7,
21.5; HRMS calcd for C25H26ClFN3O4: 486.1596 (M++H); found:
486.1599; Anal. calcd for C25H25ClFN3O4: C 61.79, H 5.19, N 8.65;
found: C 61.69, H 5.43, N 8.61.
ature. After the removal of formaldehyde, the plates were stained
with 0.1% crystal violet for 15 min at room temperature. The plates
were washed and dried, and the density of the remaining cells in
the wells was measured at 570 nm. The concentration required
for a tested compound to reduce the virus-induced cell death by
50% relative to the virus control was defined as EC50. All assays
were performed in triplicate and at least twice.
4.7. Western blot analysis
The ability of 10d to inhibit viral protein accumulation was per-
formed by using RD cells grown in DMEM supplemented with 10%
fetal calf serum. The confluent cells in 12-well plates were infected
with EV71 (EV71 TW/2231/98) at a multiplicity of infection (MOI)
of 0.01 in the absence or presence of 10d at 0.01, 0.025, 0.05, 0.1,
4.4.23. 2-{2-[3-(5-Methylisoxazol-3-yl)acryloyl]amino-1-oxo-3-
phenyl}propyl amino-3-(2-oxo-3-pyrrolidyl)-propan-1-al (10f)
White foam; TLC (MeOH/CH2Cl2, 1:9) Rf = 0.60; IR (neat) 3441,
2918, 1706, 1672, 1410 cmꢀ1 1H NMR (DMSO-d6, 600 MHz) d
;
9.31 (1H, s), 8.69–8.65 (2H, m), 7.63 (1H, s), 7.28–7.18 (6H, m),
6.80 (1H, d, J = 14.9 Hz), 6.48 (1H, s), 4.78–4.64 (1H, m), 4.20–
4.13 (1H, m), 3.15–3.09 (3H, m), 2.92–2.88 (1H, m), 2.38 (3H, s),
2.22–2.13 (2H, m), 1.92–1.88 (1H, m), 1.65–1.62 (2H, m); 13C
NMR (DMSO-d6, 150 MHz) d 201.2, 178.6, 172.1, 170.8, 164.2,
160.3, 138.0, 129.6, 129.3 (2ꢁ), 128.6 (2ꢁ), 126.7, 125.7, 100.2,
62.1, 56.9, 54.7, 38.2, 37.6, 29.6, 27.7, 12.2; HRMS calcd for
0.5 or 1 lM. After 48 h post infection, total cell lysate was har-
vested and subjected to 12% SDS–PAGE. Protein samples were sub-
sequently transferred to PVDF membrane and probed with a
mouse monoclonal antibody against EV71 3C protease and anti-
b-actin antibody. A rabbit anti-mouse antibody conjugated with
horseradish peroxidase (1:2000; Amersham biosciences) was used
as the secondary antibody. The horseradish peroxidase was de-
tected by an enhanced chemiluminescence detection system
(ECL; Amersham Pharmacia, Freiburg, Germany).
C
23H26N4NaO5: 461.1801 (M++Na); found: 461.1209; Anal. calcd
for C23H26N4O5: C 63.00, H 5.98, N 12.78; found: C 63.01, H 6.02,
N 12.75.
4.8. Computer modeling
4.5. Enzyme inhibition assay
Construction of EV71 3C protease structural model was based
on the X-ray crystal structure of RV 3C protease with AG7088
bound (PDB code 1CQQ) as template using the software of Discov-
ery studio 1.7 (Accelrys, Inc.). Docking of 6b and 10b in the active
site was performed with an automated ligand-docking program of
Discovery studio 1.7. The docking utilized a genetic algorithm and
a set of parameters to control the precise operation via defined
binding sites, specified ligand conformations, energy grid parame-
ters, variable numbers of Monte Carol trials, and selected score
type.
For IC50 measurements, the reactions were performed with
0.5 lM protease and 10 lM fluorogenic peptide in a buffer of 10
mM MES at pH 6.5 and 25 °C. The fluorescence change resulted
from the reaction was followed with time using a 96-well fluores-
cence plate reader. The initial velocities of the enzymatic reaction
in the first 5 min of reactions were plotted against the different
inhibitor concentrations to obtain the IC50 by fitting with Eq. 1.
AðIÞ ¼ Að0Þ ꢁ f1 ꢀ ½½Iꢂ=ð½Iꢂ þ IC50Þꢂg
ð1Þ
In Eq. 1, A(I) is the enzyme activity with inhibitor concentration
[I], A(0) is the enzyme activity without inhibitor, and [I] is the
inhibitor concentration. For the Ki measurements from time-
Acknowledgment
dependent inhibition, 1–10 lM of inhibitor 6b was used to inhibit
Authors thank the financial support from Academia Sinica.

7398
C.-J. Kuo et al. / Bioorg. Med. Chem. 16 (2008) 7388–7398
R.; Tikhe, J.; Ford, C. E.; Meador, J. W.; Ferre, R. A.; Brown, E. L.; Binford, S. L.;
References and notes
Brothers, M. A.; DeLisle, D. M.; Worland, S. T. Proc. Natl. Acad. Sci. U.S.A. 1999,
96, 11000–11007.
1. Melnick, J. L. Enterovirus: polioviruses, coxsackieviruses, echoviruses, and
newer enteroviruses. in Virology, 3rd ed.
2. Blomberg, K.; Lycke, E.; Ahlfors, K.; Johnsson, T.; Wolontis, S.; von Zeipel, G.
Lancet 1974, 2, 112.
3. Chang, L. Y.; Lin, T. Y.; Hsu, K. H.; Huang, Y. C.; Lin, K. L.; Hsueh, C.; Shih, S. R.;
Ning, H. C.; Hwang, M. S.; Wang, H. S.; Lee, C. Y. Lancet 1999, 354, 1682–1686.
4. Lum, L. C.; Wong, K. T.; Lam, S. K.; Chua, K. B.; Goh, A. Y. Lancet 1988, 352, 1391.
5. Chen, C. Y.; Chang, Y. C.; Huang, C. C.; Lui, C. C.; Lee, K. W.; Huang, S. C. Am. J.
Neuroradiol. 2002, 22, 200–205.
6. Chonmaitree, T.; Menegus, M. A.; Schervish-Swierkosz, E. M.; Schwalenstocker,
E. Pediatrics 1981, 67, 489–493.
7. Gilber, G. L.; Dickson, K. E.; Waters, M. J.; Kennett, M. L.; Land, S. A.; Sneeddon,
M. Pediatr. Infect. Dis. J. 1988, 7, 484–488.
8. Alexander, J. P.; Baden, L.; Pallansch, M. A.; Anderson, L. J. J. Infect. Dis. 1994,
169, 905–908.
9. Samuda, G. M.; Chang, W. K.; Yeung, C. Y.; Tang, P. S. Pediatr. Infect. Dis. 1987, 6,
206–208.
18. Johnson, T. O.; Hua, Y.; Luu, H. T.; Brown, E. L.; Chan, F.; Chu, S. S.; Dragovich, P.
S.; Eastman, B. W.; Ferre, R. A.; Fuhrman, S. A.; Hendrickson, T. F.; Maldonado,
F. C.; Matthews, D. A.; Meador, J. W.; Patick, A. K.; Reich, S. H.; Skalitzky, D. J.;
Worland, S. T.; Yang, M.; Zalman, L. S. J. Med. Chem. 2002, 45, 2016–2023.
19. Binford, S. L.; Maldonado, F.; Brothers, M. A.; Weady, P. T.; Zalman, L. S.;
Meador, J. W.; Matthews, D. A.; Patick, A. K. Antimicrob. Agents Chemother. 2005,
49, 619–626.
20. Fan, K.; Wei, P.; Feng, Q.; Chen, S.; Huang, C.; Ma, L.; Lai, B.; Pei, J.; Liu, Y.; Chen,
J.; Lai, L. J. Biol. Chem. 2004, 279, 1637–1642.
21. Kuo, C. J.; Chi, Y. H.; Hsu, T. A.; Liang, P. H. Biophys. Biochem. Res. Commun. 2004,
318, 862–867.
22. Shie, J. J.; Fang, J. M.; Kuo, T. H.; Kuo, C. J.; Liang, P. H.; Huang, H. J.; Wu,
Y. T.; Jan, J. T.; Cheng, Y.-S. E.; Wong, C. H. Bioorgan. Med. Chem. 2005, 13,
5240–5252.
23. Dragovich, P. S.; Prins, T. J.; Zhou, R.; Webber, S. E.; Marakovits, J. T.; Fuhrman,
S. A.; Patick, A. K.; Matthews, D. A.; Lee, C. A.; Fore, C. E.; Burke, B. J.; Rejto, P. A.;
Hendrickson, T. F.; Tuntland, T.; Brown, E. L.; Meador, J. W., III; Ferre, R. A. J.
Med. Chem. 1999, 42, 1213–1224.
10. Ho, M.; Chen, E. R.; Hsu, K. H.; Twu, S. J.; Chen, K. T.; Tsai, S. F.; Wang, J. R.; Shih,
S. R. N. Engl. J. Med. 1999, 341, 929–935.
11. Ho, M. J. Microbiol. Immunol. Infect. 2000, 33, 205–216.
12. Roeckert, R. R. In Fields Virology; Fields, B. N. et al., Eds.; Ravel Publishers:
Philadelphia, 1996; pp 609–654.
24. Tian, Q.; Nayyar, N. K.; Babu, S.; Chen, L.; Tao, J.; Lee, S.; Tibbetts, A.; Moran, T.;
Liou, J.; Guo, M.; Kennedy, T. P. Tetrahedron Lett. 2001, 42, 6807–6809.
´
25. López, M. A.; Rodrıguez, Z.; González, M.; Tolón, B.; Avila, R.; González, I.;
´
Garmendıa, L.; Mamposo, T.; Carrasco, R.; Pellón, R.; Vélez, H.; Fini Eur. J. Med.
13. Porter, A. G. P. J. Virol. 1993, 67, 6917–6921.
14. Turner, R. B. Antiviral Res. 2001, 49, 1–14.
Chem. 2004, 39, 657–664.
26. Webber, S. E.; Okano, K.; Little, T. L.; Reich, S. H.; Xin, Y.; Fuhrman, S. A.;
Matthews, D. A.; Love, R. A.; Hendrickson, T. F.; Patrick, A. K.; Meador, J. W.;
Ferre, R. A.; Brown, E. L.; Ford, C. E.; Binford, S. L.; Worland, S. T. J. Med. Chem.
1998, 41, 2786–2805.
15. Witherell, G. Curr. Opin. Investig. Drugs 2000, 1, 297–302.
16. McKinlay, M. A. Curr. Opin. Pharmacol. 2001, 1, 477–481.
17. Matthews, D. A.; Dragovich, P. S.; Webber, S. E.; Fuhrman, S. A.; Patick, A. K.;
Zalman, L. S.; Hendrickson, T. F.; Love, R. A.; Prins, T. J.; Marakovits, J. T.; Zhou,