Discovery of selective protein arginine methyltransferase 5 inhibitors and biological evaluations

Article abstract of DOI:10.1111/cbdd.12881

Protein arginine methyltransferase 5 (PRMT5) is an important protein arginine methyltransferase that catalyzes the symmetric dimethylation of arginine resides on histones or non-histone substrate proteins. It has been thought as a promising target for many diseases, particularly cancer. Despite the potential applications of PRMT5 inhibitors in cancer treatment, very few of PRMT5i have been publicly reported. In this investigation, virtual screening and structure–activity relationship studies were carried out to discover novel PRMT5i, which finally led to the identification of a number of new PRMT5i. The most active compound, P5i-6, exhibited a considerable inhibitory potency against PRMT5 with an IC₅₀ value of 0.57?μm, and a high selectivity for PRMT5 against other tested PRMTs. It displayed a very good antiviability activity against two colorectal cancer cell lines, HT-29 and DLD-1, and one hepatic cancer cell line, HepG2, in a sensitivity assay against 36 different cancer cell lines. Western blot assays indicated that P5i-6 selectively inhibited the symmetric dimethylations of H4R3 and H3R8 in DLD-1 cells. Overall, P5i-6 could be used as a chemical probe to investigate new functions of PRMT5 in biology and also served as a good lead compound for the development of new PRMT5-targeting therapeutic agents.

Full text of DOI:10.1111/cbdd.12881

Received Date : 30-Mar-2016
Revised Date : 21-Jul-2016
Accepted Date : 23-Sep-2016
Article type
: Research Article
Discovery of Selective Protein Arginine Methyltransferase 5 (PRMT5) Inhibitors and
Biological Evaluations
Sen Ji,1,# Shuang Ma,1,# Wen-Jing Wang,1,# Shen-Zhen Huang,1 Tian-qi Wang,3 Rong Xiang,3
Yi-Guo Hu,1 Qiang Chen,1 Lin-Li Li,2,* and Sheng-Yong Yang1,*
1State Key Laboratory of Biotherapy/Collaborative Innovation Center of Biotherapy, West
China Hospital, West China Medical School, Sichuan University, Chengdu, Sichuan 610041,
China
2West China School of Pharmacy, Sichuan University, Sichuan, China
3Department of Clinical Medicine, School of Medicine, Nankai University, Tianjin, 300071,
China
* To whom correspondence should be addressed. Tel.: +86-28-85164063; Fax:
+86-28-85164060; E-mail: ysylilinli@sina.com (L-L, Li) oryangsy@scu.edu.cn(S.-Y. Yang)
#These authors contributed equally to this work.
This article has been accepted for publication and undergone full peer review but has not
been through the copyediting, typesetting, pagination and proofreading process, which may
lead to differences between this version and the Version of Record. Please cite this article as
doi: 10.1111/cbdd.12881
This article is protected by copyright. All rights reserved.

Abstract
PRMT5 is an important protein arginine methyltransferase that catalyzes the symmetric
dimethylation of arginine resides on histones or non-histone substrate proteins. It has been
thought as a promising target for many diseases, particularly cancer. Despite the potential
applications of PRMT5 inhibitors in cancer treatment, very few of PRMT5i have been
publicly reported. In this investigation, virtual screening and structure-activity relationship
(SAR) studies were carried out to discovery novel PRMT5i, which finally led to the
identification of a number of new PRMT5i. The most active compound, P5i-6, exhibited a
considerable inhibitory potency against PRMT5 with an IC50 value of 0.57μM, and a high
selectivity for PRMT5 against other tested PRMTs. It displayed a very good anti-viability
activity against two colorectal cancer cell lines, HT-29 and DLD-1, and one hepatic cancer
cell line, HepG2, in a sensitivity assay against 36 different cancer cell lines. Western Blot
assays indicated that P5i-6 selectively inhibited the symmetric dimethylations of H4R3 and
H3R8 in DLD-1 cells. Overall, P5i-6 could be used as a chemical probe to investigate new
functions of PRMT5 in biology and also served as a good lead compound for the
development of new PRMT5-targeting therapeutic agents.
Introduction
Protein arginine methyltransferases (PRMTs) are a family of enzymes that can catalyze
the transfer of one or two methyl groups from S-adenosylmethionine (AdoMet) to the
guanidino nitrogen atoms of arginine resides on histones and non-histone proteins.1-4 PRMTs
have been demonstrated to play important roles in a wide variety of cellular functions,
including chromatin remodeling, RNA metabolism, signal transduction, embryonic
development, and DNA damage repair.5-8 To date, 9 PRMTs have been identified in human,
This article is protected by copyright. All rights reserved.

which can be divided into four categories (type I-IV) according to the products of enzymatic
reactions. Type I enzymes catalyze the formation of ω-NG monomethylarginine (ω-MMA)
and asymmetric ω-NG, NG-dimethylarginine (ω-aDMA); Type II enzymes catalyze the
formation of ω-MMA and symmetric ω-NG, NG-dimethylarginine (ω-sDMA); Type III
enzymes catalyze the formation of ω-MMA only, and Type IV enzymes catalyze the
formation of δ-NG-MMA.3, 4, 9
Among all the PRMTs, PRMT5, which belongs to the type II PRMTs, has attracted
increasing attention in recent years particularly.10 PRMT5 is 637 amino acids long and maps
to human chromosome 14q11.2.9, 11 It can symmetrically di-methylate the two-terminal
ω-guanidino nitrogen atoms of arginine residues on substrate proteins, including histone H4
at arginine 3 (H4R3me2s)12-14, histone H3 at arginine 8 (H3R8me2s)15, and many other
non-histone proteins such as FGF-216, NF-kB17, HOXA918, and p5319, 20. PRMT5 is involved
in the transcriptional repression of some tumor suppressor genes, including suppressor of
tumorigenicity 7 (ST7)15, 21, nonmetastatic 23 (NM23)15, retinoblastoma (Rb) family22, and
programmed cell death 4 (PDCD4)23. Besides, PRMT5 has been shown to interact with many
other genes, such as p5319, E2F-124, IL-225, cyclin E126, TRAIL receptor27, MITF28, Schwann
Cell Factor 1 (SC1/PRDM4)29, 30, the CDK4 complex31, and E-cadherin32, to participate in
many cellular processes. Overexpression or dysregulation of PRMT5 was found in a variety
of cancers. Recent studies have further demonstrated that this overexpression or
dysregulation significantly contributed to the tumorigenesis and development. For example,
Nicholas et al.28 recently observed a significant upregulation of PRMT5 in human metastatic
melanoma cell lines. Powers et al.23found that PRMT5 was highly expressed in breast cancer,
which promoted tumor development by altering tumor suppressor programmed cell death 4
(PDCD4). In a recent study, Bao et al.33identified a substantial overexpression of PRMT5 in
epithelial ovarian cancer, and that this overexpression was associated with poor disease
This article is protected by copyright. All rights reserved.

prognosis. A study by Ibrahim et al.32indicated that a high cytoplasmic expression of PRMT5
was closely related to the high-grade subtypes of primary lung adenocarcinomas and a poor
prognosis. All of these indicate that PRMT5 might be a promising therapeutic target in the
treatment of cancer.
Due to the potential therapeutic value of PRMT5 inhibitors in cancer therapy, discovery
of PRMT5 inhibitors has been one of the research focuses in both industry and academia.34-39
However, up to now, very few of PRMT5 inhibitors have been publicly reported.40-42 Thus, in
this investigation we tried to discovery new potent PRMT5 inhibitors with the aid of
computer-aided virtual screening and structure-activity relationship (SAR) analysis.
RESULTS AND DISCUSSION
1. Virtual Screening led to the discovery of a number of hit compounds
Structure-based virtual screening has been demonstrated to be an effective tool for hit or
lead discovery, especially in the cases that no ligand or very few of ligands is known.43-45 Due
to the lack of PRMT5 inhibitors, we thus performed a structure-based virtual screening to
identify new PRMT5 inhibitors. Currently, there are four X-ray crystal structures of PRMT5
available in RCSB Protein Data Bank (PDB); their PDB entries are 3UA346, 3UA446, 4G5647,
and 4GQB48. 3UA3 and 3UA4 correspond to the structures of Caenorhabditiselegans
PRMT5, and 4G56 is for the structure of Xenopuslaevis PRMT5-MEP50 complexed with
S-adenosylhomocysteine (SAH). The remaining 4GQB is for the structure of human PRMT5
in complex with MEP50, an SAH analog, and a peptide substrate derived from histone H4.
4GQB was chosen as the reference structure for the subsequent virtual screening because it is
a human PRMT5 structure and has the highest resolution (2.06Å).
This article is protected by copyright. All rights reserved.

To narrow the screening range and also increase the success rate, we constructed a
focused library in advance. The construction of the focused library was based on the
observation that the active pocket of PRMT5, defined as the binding site of both the cofactor
SAM and substrate (see Figure 1A), contains three important residues, namely Glu435,
Glu444, and Leu437, which form a perfect hydrogen bonding interaction network with the
arginine side chain of substrates (see Figure 1B). To retrieve compounds that can also forma
good hydrogen bonding interaction network with the three residues, we first carefully
selected fragments that can form multiple hydrogen bonds, including 1, 2-diamines,
benzimidamide, semicarbazone, amines, et al. Some fragment examples are shown in Figure
1C. Then we searched chemical libraries including SPECS, Chemdiv, Enamine, and our
in-house database for compounds that contain any of the selected fragments. These
compounds formed a focused library, which includes 1060 small molecules.
Molecular docking-based virtual screening was then carried out to retrieve new PRMT5
inhibitors from the constructed focused library. GOLD version 4.0 was employed for the
docking study. From top 100 compounds ranked by the scoring function GoldScore, we
carefully selected 56 compounds and subjected to experimental validation. Among the 56
compounds tested, 6 compounds (see Figure 2A) showed an inhibitory rate larger than 50%
at a concentration of 50μM. The most active compound corresponds to P5i-6, which showed
an inhibitory rate of 93% at a concentration of 50μM, and an IC50 value of 0.57μM (see
Figure 2B). To further improve its potency, chemical structure modification and SAR studies
will be carried out to this compound in the follows.
This article is protected by copyright. All rights reserved.

2. Chemical synthesis
To discuss the SAR of P5i-6, we synthesized 25 compounds and purchased 12
compounds from the market. Synthetic routes for the 25 compounds are outlined in Scheme
1-3. Scheme 1 shows the general synthetic routes for compounds 4a-o. Reaction of
5-bromofuran-2-carbaldehyde (1) and triisopropyl borate in n-BuLi easily afforded
5-formylfuran-2-ylboronic acid (2), which then reacted with various substituted iodobenzene
catalyzed by palladium to give intermediates 3a-o in good yields. Target compounds 4a-o
were finally obtained through reactions between semicarbazide hydrochloride and
corresponding intermediates 3a-o in ethanol with good yields.
Compounds 6a-c were synthesized through the similar reaction routes as those for
compounds 4a-o, which are shown in Scheme 2. Treatment of 5-formylfuran-2-ylboronic
acid 2 with substituted iodine-containing heterocycles in the presence of sodium carbonate
and bis(triphenylphosphine)palladium(II) chloride afforded 5a-c. The intermediates 5a-c then
reacted with semicarbazide hydrochloride to give target compounds 6a-c in good yields.
Scheme 3 presents the synthetic routes for compounds 9a-g. Commercially available
(4-chlorophenyl) boronic acid 7 reacted with halogenated aromatic rings, which contain an
aldehyde group, in the Suzuki reaction condition to produce intermediates 8a-g. Then target
compounds 9a-g were obtained through reactions of semicarbazide hydrochloride with
corresponding intermediates 8a-g in the presence of sodium acetate.
This article is protected by copyright. All rights reserved.

3. SAR analysis
The SAR analysis was mainly focused on three regions (see Figure 2C): the two
terminal ends, i.e. the 2-methylenehydrazinecarboxamide moiety (R1) and the phenyl ring
(R2), and the middle furan ring (R3).
3.1 Replacement of the 2-methylenehydrazinecarboxamide moiety (R1)
To examine the replacement effect of the 2-methylenehydrazinecarboxamide moiety
(R1), 11 compounds (1a-k) with different groups at the R1 position were purchased from the
market. Potencies of these compounds against PRMT5 were first measured at a fixed
concentration of 50μM. For compounds having an inhibition rate larger than 50% at the
concentration of 50μM, their IC50 values were measured further. Table 1 shows the measured
bioactivities of these compounds. Compound P5i-7, in which an oxygen atom was simply
replaced by a sulfur atom in the 2-methylenehydrazinecarboxamide moiety, showed a slightly
reduced but comparable potency against PRMT5 compared with compound P5i-6. However,
compounds P5i-8~P5i-16with different groups at the R1 position significantly decreased the
bioactivity. These results indicate that the 2-methylenehydrazinecarboxamide group is a
better choice for the R1 position.
3.2 Variation of the phenyl ring (R2)
To explore the effect of variation of the phenyl ring (R2), different groups were
introduced at the R2 position. A total of 18 compounds (4a-o and 6a-c) were synthesized and
2 compounds (P5i-17 and P5i-18) were purchased from the market. Bioactivities of these
compounds are displayed in Table 2. From Table 2, we can see that removal of
This article is protected by copyright. All rights reserved.

chlorobenzene (P5i-17) or chlorobenzene replaced by -NO2 (P5i-18) led to a complete loss of
activity, implying the importance of chlorobenzene at the R2 position. Compound 4a with an
unsubstituted phenyl group showed a decreased activity (IC50=12μM). For compounds 4e, 4g,
4h, 4i, and 4j, which contain substituents fluoride, nitro, methoxyl, hydroxyl, and amine,
respectively, at the para- position of the phenyl ring, their potencies were significantly
decreased compared with that of P5i-6. For the remaining compounds, which have
substituted phenyl, pyridinyl, or pyrimidinyl at the ortho-, meta- and/or para-positions of the
phenyl ring, their activities were also substantially reduced compared with that of P5i-6.
3.3 Substitution of the middle furan ring (R3)
We finally examined the replacement effect of the middle furan ring (R3). A total of 7
compounds (9a-g) with different groups at the R3 position were synthesized. Bioactivities of
these compounds are displayed in Table 3. Replacement of the furan ring by thiophene led to
a significant decrease in bioactivity. A plausible explanation for this could be that the sulfur
atom possesses a larger size than oxygen, which expands the angle between the R1 arm and
the R2 arm. In addition, compounds containing a meta-substituted six-membered aromatic
ring at R3 (9b, 9f, and 9g) showed a much higher bioactivity compared with the
para-substituted counterparts 9c, 9d and 9e. This again demonstrates the importance of a
suitable angle between the R1 arm and the R2 arm.
This article is protected by copyright. All rights reserved.

4. Predicted binding mode of compound P5i-6 with PRMT5
The above SAR analysis indicates that P5i-6 is the most active compound against
PRMT5 among all the synthesized and purchased compounds. We then analyzed the
interaction mode between P5i-6 and PRMT5. Figure 3 shows the predicted binding mode
of P5i-6 with PRMT5. As expected, the 2-methylenehydrazinecarboxamide moiety of
P5i-6 forms a good hydrogen bonding interaction network with residues Glu435, Leu437,
and Glu444 (the hydrogen bonding interaction region). The chlorobenzene moiety perfectly
locates in a hydrophobic groove formed by Val326, Phe300, Phe580, Phe577, and Try304
(the hydrophobic region), and good hydrophobic interactions are formed between the
chlorobenzene group and residues Phe300, Tyr304, Val326, and Phe580. The middle furan
ring, which looks like a bridge that connects the 2-methylenehydrazinecarboxamide and
chlorobenzene moieties, is situated at the juncture of the hydrogen bonding interaction
region and the hydrophobic region.
5. PRMT Enzyme Selectivity of Compound P5i-6
To evaluate the PRMT enzyme selectivity of P5i-6, we measured the IC50 values of
P5i-6 against other PRMTs including PRMT1, PRMT3, CARM1 (PRMT4), PRMT6,
PRMT7 and PRMT8; PRMT2 and PRMT9 were not included because these enzymes are not
available at this moment. The results showed that the IC50 values of P5i-6 against PRMT1, 3,
4, 6, 7 and 8 were all larger than 100μM (Table 4), suggesting that P5i-6 has a considerable
good selectivity for PRMT5 against other tested PRMTs.
This article is protected by copyright. All rights reserved.

6. In vitro sensitivity of various cancer cell lines to P5i-6
The in vitro sensitivity of various cancer cell lines to P5i-6 was examined with 36 cancer
cell lines, which cover 17 different cancer types. In this assay, the concentration of P5i-6 was
fixed as 10μM and the growth inhibition rate (%) of tumor cells after P5i-6 treatment for 5
days was measured. The results are summarized in Figure 4. Obviously, several cancer cell
lines showed a considerable inhibition rate upon P5i-6 treatment, and the most sensitive
cancer cell lines include two colorectal cancer cell lines, HT-29 and DLD-1, and one hepatic
cancer cell line, HepG2. For the other tumor cell lines, P5i-6 exhibited very weak or no
activity, implying that, at least to some extent, the tumor cell growth inhibitory activity of
P5i-6 is not due to its toxic effect.
7. Anti-proliferation effects of P5i-6 against colorectal cancer cell line DLD-1
The tumor cell growth inhibition rate changes over time of P5i-6 were measured on
colorectal cancer cell line DLD-1 for 12 days, which results are summarized in Figure 5A.
Obviously the tumor cell proliferation was inhibited in a dose- and time-dependent manner.
The inhibitory effect of P5i-6 against DLD-1 cells was also evident in a colony formation
assay, in which a small number of cells were plated and incubated with a series of
concentrations of P5i-6 for 11 days (Figure 5B). We further examined the influence of P5i-6
treatment on the cell cycle of DLD-1 cells using flow cytometry. The results indicated that a
high concentration of P5i-6 (50μM or 100μM) led to an increase in the S phase population
(see Figure 5C), indicating a S/G2 phase arrest in DLD-1 cells.
This article is protected by copyright. All rights reserved.

8. Inhibition of histone methylation in intact cells
Finally, we examined the inhibitory effects of P5i-6 to the methylation of substrates of
PRMT5 in intact cells by Western Blot. Again, DLD-1 cells were chosen. The results are
shown in Figure 5D. P5i-6 treatment dose-dependently decreased the symmetric
dimethylation levels of H4R3 (H4R3me2s) and H3R8 (H3R8me2s), while the asymmetric
dimethylation of H4R3 (H4R3me2a) was not affected. These results confirmed, to some
extent, the selectivity of P5i-6 for PRMT5 against other types of PRMTs.48, 49 Furthermore,
we detected the ST7 mRNA expression in the time points of day 1 and day 2 after P5i-6
treatment; ST7 is a typical target gene of PRMT5.15, 21, 39 As shown in Figure 5E, a 1.3-fold
increase in ST7 mRNA expression was observed at day 2, whereas no obvious effect was
observed at day 1. These results suggested that P5i-6 suppressed the catalytic activity of
PRMT5.
3. CONCLUSIONS
Structure-based virtual screening and subsequent SAR studies led to the discovery of a
number of new PRMT5 inhibitors. The most active compound, P5i-6, exhibited a
considerable inhibitory potency against PRMT5 with an IC50 value of 0.57μM, and a high
selectivity for PRMT5 against other tested PRMTs. 36 different cancer cells were selected to
test their sensitivity to P5i-6. Several cancer cell lines including two colorectal cancer cell
lines, HT-29 and DLD-1, and one hepatic cancer cell line, HepG2, showed a considerable
inhibition rate upon P5i-6 treatment. Flow cytometry was used to examine the influence of
P5i-6 on cell cycles, which results indicated that P5i-6 treatment arrested the DLD-1 cells in
This article is protected by copyright. All rights reserved.

S/G2 phase. Western Blot assays performed on DLD-1 showed that P5i-6 could selectively
inhibit the symmetric dimethylation of histone H4R3 and H3R8. Collectively, P5i-6 is a
selective PRMT5 inhibitor and could be used as a chemical probe to investigate new
functions of PRMT5 in biology. It also could be served as a good lead compound for the
development of new PRMT5-targeting therapeutic agents.
4. EXPERIMENTAL SECTION
4.1 Molecular docking. All the molecular docking studies were carried out by GOLD
version 4.0 with semi-flexible docking being used. The crystal structure of human PRMT5
(PDB code: 4GQB) was taken as a reference structure for the molecular docking. Before the
molecular docking, the receptor protein was prepared by the Discovery Studio (DS) 3.1
(Accelrys Inc., San Diego, CA, USA) software package with standard preparation procedures
(protein preparation protocol), which include removing water molecules, adding hydrogen
atoms to the protein, and assigning force field (here the CHARMm force field was adopted).
The active pocket was defined as the SAH analog and the peptide binding sites. Radius of the
site sphere was increased to 16.2Å so that the sphere can cover both the SAM and the
substrate binding sites. To explore ring conformations of ligand during docking, the
parameter of ‘Flip Ring Corners’ was chosen, which enables a limited conformational search
of cyclic systems by allowing free corners of rings to flip above or below the plane of their
neighboring atoms. Other parameters were set to default. GoldScore incorporated into the
GOLD program package was employed to predict the binding interaction between small
molecules and the receptor protein.
This article is protected by copyright. All rights reserved.

4.2 Compound Sources. Chemical libraries screened include Specs, Enamine, and Chemdiv,
as well as our in-house database. Selected compounds were purchased in milligram quantities
from chemical vendors. Purity of compounds was >= 95%, as declared by the chemical
vendor.
4.3 Chemistry methods
General procedure for the synthesis of 5-formylfuran-2-ylboronic acid (2) A 500 mL
double-neck flask was charged with toluene (100 mL) and cooled to below-60 °C, and a
solution of n-BuLi (1.6 M in hexanes, 48.6 mL,77.8 mmol) was added dropwise over 30 min.
After the temperature reached to 60°C, a solution of 5-bromofuran-2-carbaldehyde (70.7
mmol) in toluene (30 mL) was added dropwise to keep the temperature below -50°C. A black
solid precipitated, and the resultant slurry was stirred for 40 min. THF (30 mL) was added
dropwise to keep the internal temperature below -50°C, and the resultant slurry was stirred
for 30 min. To the suspension was added triisopropylborate 84.9 mmol) in one portion via
syringe. The solution was warmed to 15 °C, the reaction was quenched with HCl (aq) (70.0
mL), and the solution was transferred to a pear shape separatory funnel. The aqueous layer
was collected, the organic layer was washed with water (30 mL), and the combined aqueous
layers were neutralized to pH 7 with NaOH (aq) (12 N) and extracted with EA (300mLx3).
The combined organics were concentrated in vacuo, and the residue was dissolved in
CH2Cl2/CH3OH (1:1, 140 mL) filtered. The solids were collected by filtration to afford the
title compound 2 (6.8 g, 78% yield) as an off-white solid.
General procedure for the synthesis of 5-(4-chlorophenyl)-furan-2-carbaldehyde (3) To a
mixture of 5-formylfuran-2-ylboronicacid (2) (1.1eq) and the substituted iodobenzene (1.0eq)
This article is protected by copyright. All rights reserved.

in MeCN:H2O=1:1 (50mL), anhydrous sodiumcarbonate 1.4g (2.0eq) and Pd(PPh3)2Cl2
470mg (0.1eq) was added. The reaction mixture was stirred in 80℃ for 3h, and then cooled
to room temperature. The solvent was removed in vacuo. The mixture was treated with water
(100 mL) and extracted with EtOAc (3 × 60 mL). The combined organic layers were
removed in vacuo. The residue obtained was purified by column chromatography (eluent
gradient CH2Cl2:MeOH = 80:1) and recrystallized from EtOAc and petroleum ether to get 3
as brown solid.
General
procedure
for
the
synthesis
of
2-((5-(4-chlorophenyl)furan-2-yl)methylene)hydrazinecarboxamidee (4) To a mixture of
5-(4-chlorophenyl)furan-2-carbaldehyde(3) 100mg (1.0eq) in EtOH 10mL, the
semicarbazidehydrochloride 54mg (1.0eq) in H2O 50mL was added dropwise. The reaction
mixture was stirred in room temperature for 2h, a white solid precipitated. The solid was
filtered in vacuo. The product was washed with water (10 mL) and MeOH (10mL). The
residue obtained was purified by column chromatography (eluent gradient
CH2Cl2:MeOH=20:1) and recrystallized from EtOAc and petroleum ether to get 4 (110mg,
86% yield) as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.36 (s, 1H), 7.91-7.73 (m, 3H),
7.49 (d, J = 8.5 Hz, 2H), 7.12 (d, J = 3.5 Hz, 1H), 6.94 (dd, J = 14.9, 3.5 Hz, 1H), 6.46 (s,
2H).
2-((5-phenylfuran-2-yl)methylene)hydrazinecarboxamide (4a) The title compound was
obtained in 90% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.34 (s, 1H), 7.80 (d,
J = 6.0 Hz, 3H), 7.44 (t, J = 7.7 Hz, 2H), 7.32 (t, J = 7.4 Hz, 1H), 7.07 (d, J = 3.5 Hz, 1H),
6.92 (d, J = 3.5 Hz, 1H), 6.45 (s, 2H).
This article is protected by copyright. All rights reserved.

2-((5-(2-chlorophenyl)furan-2-yl)methylene)hydrazinecarboxamide
(4b)
The
title
compound was obtained in 85% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.39
(s, 1H), 8.00 (dd, J = 7.9, 1.6 Hz, 1H), 7.81 (s, 1H), 7.64 -7.53 (m, 1H), 7.46 (td, J = 7.7, 1.2
Hz, 1H), 7.36 (td, J= 7.8, 1.6 Hz, 1H), 7.26 (d, J = 3.6 Hz, 1H), 6.98 (d, J = 3.6 Hz, 1H), 6.40
(d, J = 44.6 Hz, 2H).
2-((5-(3-chlorophenyl)furan-2-yl)methylene)hydrazinecarboxamide
(4c)
The
title
compound was obtained in 88% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.35
(s, 1H), 7.86 (t, J= 1.7 Hz, 1H), 7.78 (s, 1H), 7.76 (s, 1H), 7.47 (t, J= 7.9 Hz, 1H), 7.37 (dd, J
= 8.0, 1.1 Hz, 1H), 7.21 (d, J= 3.6 Hz, 1H), 6.94 (d, J= 3.6 Hz, 1H), 6.47 (s, 2H).
2-((5-(3-fluorophenyl)furan-2-yl)methylene)hydrazinecarboxamide
(4d)
The
title
compound was obtained in 86% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.36
(s, 1H), 7.77 (s, 1H), 7.65 (d, J= 7.6 Hz, 2H), 7.48 (dd, J= 14.2, 7.7 Hz, 1H), 7.18 (t, J= 2.8
Hz, 1H), 7.01-6.85 (m, 1H), 6.48 (s, 2H).
2-((5-(4-fluorophenyl)furan-2-yl)methylene)hydrazinecarboxamide (4e) The title compound
was obtained in 82% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.31 (s, 1H),
7.85 (dd, J= 8.8, 5.4 Hz, 2H), 7.77 (s, 1H), 7.28 (t, J = 8.9 Hz, 2H), 7.05 (d, J = 3.5 Hz, 1H),
6.91 (d, J = 3.5 Hz, 1H), 6.43 (s, 2H).
2-((5-(2-nitrophenyl)furan-2-yl)methylene)hydrazinecarboxamide (4f) The title compound
was obtained in 86% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.41 (s, 1H),
7.97-7.91 (m, 1H), 7.88 (d, J= 8.0 Hz, 1H), 7.73 (dd, J= 5.5, 2.0 Hz, 2H), 7.62 -7.54 (m, 1H),
7.62 – 7.55 (m, 1H), 7.03 (d, J= 3.6 Hz, 1H), 6.96 (d, J= 3.6 Hz, 1H), 6.41 (s, 2H).
2-((5-(4-nitrophenyl)furan-2-yl)methylene)hydrazinecarboxamide (4g) The title compound
This article is protected by copyright. All rights reserved.

was obtained in 86% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.28 (s, 1H),
9.76(s,1H), 7.76 (s, 1H), 7.74 (d, J= 1.9 Hz, 1H), 7.73 (d, J= 1.9 Hz, 1H), 7.02 (d, J= 2.7 Hz,
1H), 6.99 (d, J= 2.7 Hz, 1H), 6.91 (d, J= 3.5 Hz, 1H), 6.87 (d, J= 3.5 Hz, 1H), 6.42 (s, 2H).
2-((5-(4-methoxyphenyl)furan-2-yl)methylene)hydrazinecarboxamide (4h) The title
compound was obtained in 86% yield, as white solid:1H NMR (400 MHz, DMSO-d6)δ 10.28
(s, 1H), 7.76 (s, 1H), 7.74 (d, J= 1.9 Hz, 1H), 7.73 (d, J= 1.9 Hz, 1H), 7.02 (d, J= 2.7 Hz, 1H),
6.99 (d, J = 2.7 Hz, 1H), 6.91 (d, J= 3.5 Hz, 1H), 6.87 (d, J= 3.5 Hz, 1H), 6.42 (s, 2H), 3.80
(s, 3H).
2-((5-(4-hydroxyphenyl)furan-2-yl)methylene)hydrazinecarboxamide
(4i)
The
title
compound was obtained in 86% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.24
(s, 1H), 9.76 (s, 1H), 7.74 (d, J= 9.2 Hz, 1H), 7.62 (d, J= 8.5 Hz, 2H), 6.87-6.79 (m, 4H),
6.39 (s, 2H).
2-((5-(4-aminophenyl)furan-2-yl)methylene)hydrazinecarboxamide (4j) The title compound
was obtained in 86% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.19 (s, 1H),
7.71 (s, 1H), 7.46 (d, J= 8.4 Hz, 2H), 6.80 (d, J= 3.4 Hz, 1H), 6.67 (d, J= 3.4 Hz, 1H), 6.60 (d,
J= 8.5 Hz, 2H), 6.36 (s, 2H), 5.43 (s, 2H).
2-((5-(2,4-dichlorophenyl)furan-2-yl)methylene)hydrazinecarboxamide (4k) The title
compound was obtained in 95% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.37
(s, 1H), 8.07 (t, J= 8.2 Hz, 1H), 7.78 (s, 2H), 7.69 (s, 1H), 7.67 (s, 1H), 7.25 (d, J= 3.6 Hz,
1H), 6.94 (d, J= 3.6 Hz, 1H), 6.48 (s, 2H).
2-((5-(2,3-dichlorophenyl)furan-2-yl)methylene)hydrazinecarboxamide (4l)
The title
compound was obtained in 90% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.42
This article is protected by copyright. All rights reserved.

(s, 1H), 7.97 (dd, J= 8.0, 1.4 Hz, 1H), 7.81 (s, 1H), 7.64 (dd, J= 8.0, 1.4 Hz, 1H), 7.47 (t, J=
8.0 Hz, 1H), 7.35 (dd, J= 7.2, 3.8 Hz, 1H), 7.01 (d, J= 3.7 Hz, 1H), 6.47 (s, 2H).
2-((5-(2-amino-4-chlorophenyl)furan-2-yl)methylene)hydrazinecarboxamide (4m) The title
compound was obtained in 86% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.29
(s, 1H), 7.78 (s, 1H), 7.53 (d, J= 8.4 Hz, 1H), 6.96-6.91 (m, 1H), 6.91- 6.85 (m, 2H), 6.64 (dd,
J= 8.4, 2.1 Hz, 1H), 6.40 (s, 2H), 5.71 (s, 2H).
2-((5-(3,4-dichlorophenyl)furan-2-yl)methylene)hydrazinecarboxamide (4n) The title
compound was obtained in 92% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.41
(s, 1H), 8.02 (d, J= 8.6 Hz, 1H), 7.80 (s, 1H), 7.75 (d, J= 2.1 Hz, 1H), 7.53 (dd, J= 8.6, 2.1
Hz, 2H), 7.29 (d, J = 3.6 Hz, 1H), 6.99 (d, J= 3.7 Hz, 1H), 6.47 (s, 2H).
2-((5-(5-chloro-2-methoxyphenyl)furan-2-yl)methylene)hydrazinecarboxamide (4o) The
title compound was obtained in 86% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ
10.33 (s, 1H), 7.85 (d, J = 2.6 Hz, 1H), 7.79 (s, 1H), 7.36 (d, J= 2.6 Hz, 1H), 7.34 (d, J = 2.7
Hz, 1H), 7.18 (s, 1H), 7.15 (s, 1H), 7.08 (d, J= 3.5 Hz, 1H), 6.93 (d, J= 3.5 Hz, 1H), 6.47 (s,
2H), 3.94 (s, 3H).
2-((5-(5-chloropyridin-2-yl)furan-2-yl)methylene)hydrazinecarboxamide (6a) The title
compound was obtained in 86% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.42
(s, 1H), 8.63 (d, J= 2.1 Hz, 1H), 8.00 (d, J= 2.5 Hz, 1H), 7.98 (d, J= 2.5 Hz, 1H), 7.91 (s, 1H),
7.88 (s, 1H), 7.23 (d, J= 3.6 Hz, 1H), 6.99 (d, J= 3.6 Hz, 1H), 6.48 (s, 2H).
2-((5-(6-chloropyridin-3-yl)furan-2-yl)methylene)hydrazinecarboxamide (6b) The title
compound was obtained in 96% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.38
(s, 1H), 8.87 (d, J= 2.2 Hz, 1H), 8.22 (dd, J= 8.4, 2.4 Hz, 1H), 7.79 (s, 1H), 7.58 (d, J= 8.4
This article is protected by copyright. All rights reserved.

Hz, 1H), 7.26 (d, J= 3.5 Hz, 1H), 6.95 (d, J= 3.6 Hz, 1H), 6.49 (s, 2H).
2-((5-(2,4-dimethoxypyrimidin-5-yl)furan-2-yl)methylene)hydrazinecarboxamide (6c) The
title compound was obtained in 86% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ
10.31 (s, 1H), 8.89 (s, 1H), 7.76 (s, 1H), 6.89 (s, 2H), 6.49 (s, 2H), 4.07 (s, 3H), 3.96 (s, 3H).
General procedure for the synthesis of 4'-chlorobiphenyl-4-carbaldehyde (8) To a mixture
of 4-chlorophenylboronic acid (7) (1.1 eq) and the substituted aromatic aldehyde (1.0 eq) in
MeCN:H2O=1:1 (50 mL), anhydroussodiumcarbonate 1.26g (2.0 eq) and Pd(PPh3)4 740mg
(0.1 eq) was added. The reaction mixture was stirred in 80℃ under N2 for 3h, then cooled to
room temperature. The solvent was removed in vacuo. The mixture was treated with water
(100 mL) and extracted with EtOAc (3 × 60 mL). The combined organic layers were
removed in vacuo. The residue obtained was purified by column chromatography (eluent
gradient CH2Cl2:MeOH=80:1) and recrystallized from EtOAc and petroleum ether to get 8 as
brown solid.
2-((5-(4-chlorophenyl)thiophen-2-yl)methylene)hydrazinecarboxamide (9a) The title
compound was obtained in 85% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ
10.36 (s, 1H), 7.91-7.73 (m, 3H), 7.49 (d, J = 8.5 Hz, 2H), 7.12 (d, J = 3.5 Hz, 1H), 6.94 (dd,
J = 14.9, 3.5 Hz, 1H), 6.46 (s, 2H).
2-((4'-chloro-[1,1'-biphenyl]-3-yl)methylene)hydrazinecarboxamide
(9b)
The
title
compound was obtained in 87% yield, as white solid:1HNMR (400 MHz, DMSO-d6) δ 10.36
(s, 1H), 8.07 (s, 1H), 7.92 (s, 1H), 7.79 (d, J= 8.5 Hz, 2H), 7.71 (d, J = 7.7 Hz, 1H), 7.65 (d,
J= 7.8 Hz, 1H), 7.53 (d, J = 8.5 Hz, 2H), 7.48 (t, J= 7.7 Hz, 1H), 6.62 (s, 2H).
2-((4'-chloro-[1,1'-biphenyl]-4-yl)methylene)hydrazinecarboxamide
(9c)
The
title
This article is protected by copyright. All rights reserved.

compound was obtained in 80% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.33
(s, 1H), 7.87 (s, 1H), 7.82 (d, J= 8.3 Hz, 2H), 7.75 (d, J= 8.5 Hz, 2H), 7.70 (d, J= 8.3 Hz, 2H),
7.53 (d, J= 8.5 Hz, 2H), 6.55 (s, 2H).
2-((5-(4-chlorophenyl)pyridin-2-yl)methylene)hydrazinecarboxamide (9d) The title
compound was obtained in 92% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.56
(s, 1H), 8.87 (d, J= 1.2 Hz, 1H), 8.26 (d, J= 8.4 Hz, 1H), 8.19-8.05 (m, 1H), 7.93 (s, 1H),
7.83 (d, J= 8.4 Hz, 2H), 7.57 (d, J= 8.4 Hz, 2H), 6.69 (s, 2H).
2-((6-(4-chlorophenyl)pyridin-3-yl)methylene)hydrazinecarboxamide
(9e)
The
title
compound was obtained in 90% yield, as an white solid:1HNMR (400 MHz, DMSO-d6) δ
10.51 (s, 1H), 8.94 (s, 1H), 8.31 (d, J = 8.1 Hz, 1H), 8.17 (d, J= 8.3 Hz, 2H), 8.02 (d, J= 8.3
Hz, 1H), 7.91 (s, 1H), 7.56 (d, J= 8.3 Hz, 2H), 6.66 (s, 2H).
2-((5-(4-chlorophenyl)pyridin-3-yl)methylene)hydrazinecarboxamide
(9f)
The
title
compound was obtained in 95% yield, as white solid:1H NMR (400 MHz, DMSO-d6) δ 10.55
(s, 1H), 8.85 (s, 2H), 8.52 (s, 1H), 7.94 (s, 1H), 7.86 (d, J = 8.4 Hz, 2H), 7.58 (d, J = 8.4 Hz,
2H), 6.75 (s, 2H).
2-((6-(4-chlorophenyl)pyridin-2-yl)methylene)hydrazinecarboxamide (9g) The title
compound was obtained in 88% yield, as white solid:1HNMR (400 MHz, DMSO) δ 10.62 (s,
1H), 8.15 (dd, J= 13.0, 7.7 Hz, 3H), 7.96 (s, 1H), 7.95 - 7.88 (m, 2H), 7.56 (d, J= 8.5 Hz, 2H),
6.70 (s, 2H).
4.4 In vitro Enzymatic Assays
All in vitro enzymatic assays were carried out by Shanghai ChemPartner Co. (998 Halei
Road, Pudong New Area, Shanghai, 201203, China). To measure the IC50 values, 10
This article is protected by copyright. All rights reserved.

concentrations of the target compound were tested. All enzymes were purchased from BPS
bioscience (PRMT1, BPS, Cat. No. 51041; PRMT3, BPS, Cat. No. 51043; PRMT4, BPS, Cat.
No. 51047; PRMT5, BPS, Cat. No. 51045; PRMT8, BPS, Cat. No. 51052) or Biogenie
(PRMT7, Biogenie, Cat. No. M1055). SAM and SAH were purchased from Sigma. Inc
(SAM, Sigma, Cat. No. A7007-100MG; SAH, Sigma, Cat. No. A9384-25MG). Compounds
were prepared as 10mM stock in DMSO and diluted to final concentration in DMSO when
needed. The PRMT enzymes and substrates were incubated with indicated concentrations of
compounds in a 384-well plate for 60 min at room temperature. After the reaction, acceptor
and donor solutions were added to label the residual substrates of PRMT enzymes. The
labeling process was lasting for 60 min at room temperature, followed by the reading
endpoint with EnSpire with Alpha mode. The IC50 values were calculated with GraphPad
Prism 5.
Inhibition %=(Max-Signal)/ (Max-Min)*100
Y=Bottom + (Top-Bottom)/(1+10^((LogIC50-X)*Hill Slope))
Y is inhibition % and X is compound concentration.
SAM was added as a positive control at each experiment.
4.5 Cell lines and culture conditions
All cell lines used were obtained from American Type Culture Collection. These cell
lines were cultured in culture medium supplemented with 10% FBS (Caoyuanlvye), 100
U/ml penicillin, and 100 U/ml streptomycin and maintained at 37°C in a CO2 incubator with
5% CO2
This article is protected by copyright. All rights reserved.

4.6 Cell viability assays
In cell viability assays, tumor cells were seeded in 96-well plates with 10μM compound
or the same amount of DMSO for 5 days. After the drug treatment, 20μL of 5 mg/mL MTT
(Sigma-Aldrich) reagent was added to each well and incubated for 2–4 hours, and 100%
DMSO was used to dissolve the oxidative product. Finally, the light absorption (OD) values,
which are proportional to viable cell numbers, were measured with a SpectraMAX M5
microplate spectrophotometer. All experiments were performed in triplicate.
For the analysis of long-term proliferation of DLD-1 cells, cells were plated in 6-well
plates at an appropriate density, on days 4 8 and 12, the cells were counted and split back to
the original plating density in fresh medium with compound P5i-6. Cells were stained with
trypan blue to counting the viable cells.
Western blot assays
The Western blot assays were carried out with a similar method as described in
literature.49 DLD-1 cells were cultured with indicated concentrations of compound P5i-6,
followed by the lysing with RIPA lysis buffer (Beyotime). All the antibodies were purchased
from Abcam.
Quantitative RT-PCR (qRT-PCR)
mRNA was isolated with trizol according to the manufacturer’s protocol (Invitrogen).
cDNA was generated using the iScriptTMcDNA Synthesis Kit (Bio-Rad), and the RT-PCR
reactions were performed using SsoAdvanced SYBR Green Supermix (Bio-Rad) following
the manufacturer’s instructions. The primers used for qRT-PCR were: ST7 forward:
TGAAAATCAACGACAACTTG reverse: ATATTAGTGAGGAAGTGCCT TP73 forward:
This article is protected by copyright. All rights reserved.

GCACCACGTTTGAGCACCTCT reverse: GCAGATTGAACTGGGCCATGA gapdh
forward: TGGAAGGACTCATGACCACA reverse: TTCAGCTCAGGGATGACCTT.
Colony formation assay
DLD-1 cells were seeded in 6-well plates incubated with compound P5i-6. After
treatment for 14 days, cells were stained by crystal violet.
Cell cycle analysis
Flow cytometry was used for cell cycle assays. DLD-1 cells were treated with
compound P5i-6 for 24 h, and then the cells were harvested and washed with PBS. Cell Cycle
and Apoptosis Analysis Kit (Beyotime) was used for cell cycle analysis according to the
manufacturer’s protocol.
ACKNOWLEDGMENT
This work was supported by the 973 Program (2013CB967204), the National Natural Science
Foundation of China (81325021, 81473140, 81573349) and the Program for Changjiang
Scholars and Innovative Research Team in University (IRT13031).
References
1. Yang Y., Bedford M.T. (2013) Protein arginine methyltransferases and cancer. Nat. Rev.
Cancer;13:37-50.
2. Copeland R.A., Solomon M.E., Richon V.M. (2009) Protein methyltransferases as a
target class for drug discovery. Nat. Rev. Drug Discov;8:724-732.
This article is protected by copyright. All rights reserved.

3. Bedford M.T., Clarke S.G. (2009) Protein arginine methylation in mammals: who, what,
and why. Mol. Cell;33:1-13.
4. Wolf S.S. (2009) The protein arginine methyltransferase family: an update about
function, new perspectives and the physiological role in humans. Cell. Mol. Life Sci;
66:2109-2121.
5. Bedford M.T., Richard S. (2005) Arginine methylation: an emerging regulatorof protein
function. Mol. Cell;18:263-272.
6. Tan C.P., Nakielny S. (2006) Control of the DNA methylation system component MBD2
by protein arginine methylation. Mol. Cell. Biol;26:7224-7235.
7. Pal S., Sif S. (2007) Interplay between chromatin remodelers and protein arginine
methyltransferases. J. Cell. Physiol;213:306-315.
8. Lee Y.H., Stallcup M.R. (2009) Minireview: protein arginine methylation of nonhistone
proteins in transcriptional regulation. Mol. Endocrinol;23:425-433.
9. Branscombe T.L., Frankel A., Lee J.H. (2001) PRMT5 (Janus kinase-binding protein 1)
catalyzes the formation of symmetric dimethylarginine residues in proteins. J. Biol.
Chem;276:32971-32976.
10. Mundade R., Wei H., Lu T. (2014) PRMT5, A Pivotal Player in Cancer. Austin. J.
Pharmacol. Ther;2:1-4.
11. Krause C.D., Yang Z.H., Kim Y.S. (2007) Protein arginine methyltransferases: Evolution
and assessment of their pharmacological and therapeutic potential. Pharmacol.
Ther;113:50-87.
12. Zhao Q., Rank G., Tan Y.T., Li H., Moritz R.L., Simpson R.J., Cunningham, J.M. (2009)
This article is protected by copyright. All rights reserved.

PRMT5-mediated methylation of histone H4R3 recruits DNMT3A, coupling histone and
DNA methylation in gene silencing. Nat. Struct. Mol. Biol;16:304-311.
13. Majumder S., Alinari L., Roy S., Miller T., Datta J., Sif S., Jacob S.T. (2010)
Methylation of histone H3 and H4 by PRMT5 regulates ribosomal RNA gene transcription. J.
Cell. Biochem;109:553-63.
14. Yue M., Li Q., Zhang Y., Zhao Y., Zhang Z., Bao S. (2013) Histone H4R3 methylation
catalyzed by SKB1/PRMT5 is required for maintaining shoot apical meristem. PLoS
One;8:e83258.
15. Pal S., Vishwanath S.N., Erdjument-Bromage H., Tempst P., Sif S. (2004) Human
SWI/SNF-associated PRMT5 methylates histone H3 arginine 8 and negatively regulates
expression of ST7 and NM23 tumor suppressor genes. Mol. Cell. Biol;24:9630-9645.
16. Bruns A.F., Grothe C., Claus P. (2009) Fibroblast growth factor 2 (FGF-2) is a novel
substrate for arginine methylation by PRMT5. Biol. Chem;390:59-65.
17. Wei H., Wang B., Miyagi M., She Y., Gopalan B., Huang D.B., Lu T. (2013) PRMT5
dimethylates R30 of the p65 subunit to activate NF-kappaB. Proc. Natl. Acad. Sci. U. S.
A;110:13516-13521.
18. Bandyopadhyay S., Harris D.P., Adams G.N., Lause G.E., McHugh A., Tillmaand E.G.,
DiCorleto P.E. (2012) HOXA9 methylation by PRMT5 is essential for endothelial cell
expression of leukocyte adhesion molecules. Mol. Cell. Biol;32:1202-1213.
19. Scoumanne A., Zhang J., Chen X. (2009) PRMT5 is required for cell-cycle progression
and p53 tumor suppressor function.Nucleic Acids Res;37:4965-4976.
20. Berger S.L. (2008) Out of the jaws of death: PRMT5 steers p53. Nat. Cell
This article is protected by copyright. All rights reserved.

Biol;10:1389-1390.
21. Pal S., Baiocchi R.A., Byrd J.C., Grever M.R., Jacob S.T., Sif S. (2007) Low levels of
miR-92b/96 induce PRMT5 translation and H3R8/H4R3 methylation in mantle cell
lymphoma. EMBO J; 26:3558-3569.
22. Wang L., Pal S., Sif S. (2008) Protein arginine methyltransferase 5 suppresses the
transcription of the RB family of tumor suppressors in leukemia and lymphoma cells. Mol.
Cell. Biol;28:6262-6277.
23. Powers M.A., Fay M.M., Factor R.E., Welm A.L., Ullman K.S. (2011) Protein Arginine
Methyltransferase 5 Accelerates Tumor Growth by Arginine Methylation of the Tumor
Suppressor Programmed Cell Death 4. Cancer Res;71:5579-5587.
24. Cho E.C., Zheng S., Munro S., Liu G., Carr S.M., Moehlenbrink J., McGouran J. (2012)
Arginine methylation controls growth regulation by E2F-1. EMBO J;31:1785-1797.
25. Richard S., Morel M., Cleroux P. (2005) Arginine methylation regulates IL-2 gene
expression: a role for protein arginine methyltransferase 5 (PRMT5). Biochem
J;388:379-386.
26. Fabbrizio E., El Messaoudi S., Polanowska J., Paul C., Cook J.R., Lee J.H., Sardet C.
(2002) Negative regulation of transcription by the type II arginine methyltransferase PRMT5.
Embo Rep;3:641-645.
27. Tanaka H., Hoshikawa Y., Oh-hara T., Koike S., Naito M., Noda T., Fujita N. (2009)
PRMT5, a novel TRAIL receptor-binding protein, inhibits TRAIL-induced apoptosis via
nuclear factor-κB activation. Mol. Cancer Res;7:557-569.
28. Nicholas C., Yang J., Peters S.B., Bill M.A., Baiocchi R.A., Yan F., Grever M.R. (2013)
This article is protected by copyright. All rights reserved.

PRMT5 Is Upregulated in Malignant and Metastatic Melanoma and Regulates Expression of
MITF and p27Kip1. PloS one;8:e74710.
29. Chittka A., Nitarska J., Grazini U., Richardson W.D. (2012) Transcription factor positive
regulatory domain 4 (PRDM4) recruits protein arginine methyltransferase 5 (PRMT5) to
mediate histone arginine methylation and control neural stem cell proliferation and
differentiation. J. Biol. Chem;287:42995-3006.
30. Chittka A. (2013) Differential regulation of SC1/PRDM4 and PRMT5 mediated protein
arginine methylation by the nerve growth factor and the epidermal growth factor in PC12
cells. Neurosci. Lett;550:87-92.
31. Aggarwal P., Vaites L.P., Kim J.K., Mellert H., Gurung B., Nakagawa H., Diehl J.A.
(2010) Nuclear cyclin D1/CDK4 kinase regulates CUL4 expression and triggers neoplastic
growth via activation of the PRMT5 methyltransferase.Cancer Cell;18:329-340.
32. Ibrahim R., Matsubara D., Osman W., Morikawa T., Goto A., Morita S., Fukayama M.
(2014) Expression of PRMT5 in lung adenocarcinoma and its significance in
epithelial-mesenchymal transition. Hum. Pathol;45:1397-1405.
33. Bao X., Zhao S., Liu T., Liu Y., Liu Y., Yang X. (2013) Overexpression of PRMT5
promotes tumor cell growth and is associated with poor disease prognosis in epithelial
ovarian cancer. J. Histochem. Cytochem;61:206-217.
34. Gu Z.P., Gao S., Zhang F., Wang Z., Ma W., Davis R.E., Wang Z. (2012) Protein
arginine methyltransferase 5 is essential for growth of lung cancer cells. Biochem
J;446:235-241.
35. Yan F., Alinari L., Lustberg M.E., Martin L.K., Cordero-Nieves H.M.,
This article is protected by copyright. All rights reserved.

Banasavadi-Siddegowda Y., Jacob N.K. (2014) Genetic validation of the protein arginine
methyltransferase PRMT5 as a candidate therapeutic target in glioblastoma. Cancer
Res;74:1752-1765.
36. Han X., Li R., Zhang W., Yang X., Wheeler C.G., Friedman G.K., Gillespie G.Y. (2014)
Expression of PRMT5 correlates with malignant grade in gliomas and plays a pivotal role in
tumor growth in vitro. J. Neurooncol;118:61-72.
37. Chung J., Karkhanis V., Tae S., Yan F., Smith P., Ayers L.W., Sif S. (2013) Protein
arginine methyltransferase 5 (PRMT5) inhibition induces lymphoma cell death through
reactivation of the retinoblastoma tumor suppressor pathway and polycomb repressor
complex 2 (PRC2) silencing. J. Biol. Chem;288:35534-35547.
38. Gu Z.P., Li Y., Lee P., Liu T., Wan C., Wang Z. (2012) Protein Arginine
Methyltransferase 5 Functions in Opposite Ways in the Cytoplasm and Nucleus of Prostate
Cancer Cells.Plos One;7:e44033.
39. Yan F., Alinari L., Lustberg M.E., Martin L.K., Cordero-Nieves H.M.,
Banasavadi-Siddegowda Y., Jacob N.K. (2014) Genetic validation of the protein arginine
methyltransferase PRMT5 as a candidate therapeutic target in glioblastoma. Cancer
Res;74:1752-1765.
40. Ang C.M. (2014) 2-(hetero)aryl-benzimidazole and imidazopyridine derivatives as
inhibitors of asparagime emethyl transferase. WO 2014/128465 A1.
41. Kenneth W. (2014) PRMT5 inhibitors and uses thereof. US 2014/0221345 A1.
42. Kaniskan H.U., Konze K.D., Jin J. (2014) Selective Inhibitors of Protein
Methyltransferases. J. Med. Chem;58:1596-1629.
This article is protected by copyright. All rights reserved.

43. Yu X.R., Tang Y., Wang W. J., Ji S., Ma S., Zhong L., Li L.L. (2015). Discovery and
structure–activity analysis of 4-((5-nitropyrimidin-4-yl) amino) benzimidamide derivatives as
novel protein arginine methyltransferase 1 (PRMT1) inhibitors. Bioorg Med Chem
Lett.;25:5449-5453.
44. Li G.B., Yang L.L., Wang W.J., Li L.L., Yang S.Y. (2013) ID-Score: a new empirical
scoring function based on a comprehensive set of descriptors related to protein−Ligand
interactions. J.Chem Inf Model;53:592–600.
45.Yang J., Wang L.J., Liu J.J., Zhong L., Zheng R.L., Xu Y., Li L.L. (2012) Structural
optimization
and
structure–activity
relationships
of
N2-(4-(4-methylpiperazin-1-yl)phenyl)-N8-phenyl-9H-purine-2,8-diamine derivatives, a new
class of reversible kinase inhibitors targeting both EGFR-activating and resistance mutations.
J. Med Chem;55:10685−10699.
46. Sun L., Wang M., Lv Z., Yang N., Liu Y., Bao S., Xu R.M. (2011) Structural insights
into protein arginine symmetric dimethylation by PRMT5. Proc. Natl. Acad. Sci. U. S.
A.;108:20538-20543.
47. Ho M.C., Wilczek C., Bonanno J.B., Xing L., Seznec J., Matsui T., Brenowitz M. (2013)
Structure of the arginine methyltransferase PRMT5-MEP50 reveals a mechanism for
substrate specificity. PLoS One;8:e57008.
48. Antonysamy S. Bonday Z., Campbell R.M., Doyle B., Druzina Z., Gheyi T., Russell M.
(2012) Crystal structure of the human PRMT5: MEP50 complex. Proc. Natl. Acad.
Sci;109:17960-17965.
49. Bogdanovich S., Kim Y., Mizutani T., Yasuma R., Tudisco L., Cicatiello V., Tarallo V.
This article is protected by copyright. All rights reserved.

(2016) Human IgG1 antibodies suppress angiogenesis in a target-independent manner. Signal
Transduct Target Ther;1:15001.
Figure 1. (A) The defined active pocket of PRMT5,which contains both the cofactor SAM
binding site and the substrate binding site. (B)The hydrogen bonding interaction network
formed between the arginine side chain (left) or an arginine tail-like fragment (right) and
residuesGlu435, Glu444, and Leu437. (C) Some fragment examples that may form multiple
hydrogen bonds.
Figure 2. (A) Chemical structures of the 6 compounds (P5i-1 - P5i-6) obtained in a virtual
screening that showed an inhibitory rate larger than 50% against PRMT5 at a concentration
of 50μM. (B) The dose-response curve of P5i-6 in an enzyme activity assay against PRMT5.
(C) Schematic showing regions for SAR analysis.
Figure 3. The predicted binding mode of P5i-6in the active pocket of PRMT5
Figure 4. Tumor cell growth inhibition rates of P5i-6 at a fixed concentration of 10μM
Figure 5. (A) The tumor cell growth inhibition rate changes over time of P5i-6 performed on
colorectal cancer cell line DLD-1 for 12 days. Cell vitality was measured using MTT assay at
the indicated time points. The growth inhibitory rate is present as percentage of control
values (mean SEM, n=3). (B) DLD-1 cells were incubated with indicated concentrations of
P5i-6. After an 11 days’ treatment, the colonies were stained with crystal viole. (C) Cell cycle
analysis of DLD-1 cells with the treatment of P5i-6 for 5 days. Graphs represent the mean of
duplicates SEM. (D) The inhibitory effects of P5i-6 to the methylation of substrates of
PRMT5 in intact cells by Western Blot. A series doses of P5i-6 were added in cultured
DLD-1 cells and incubated in 37°C for 3 days before harvest. Specific antibodies for
symmetric dimethyl arginine and asymmetric dimethyl of histone4 and symmetric dimethyl
arginine of histone3 were used to detect the methylated histone. (E) P5i-6 induced the
transcription of ST7 in DLD-1 cells. DLD-1 cells were incubated with 10μM or 50μM P5i-6
for 1 day or 2 days before harvesting for the RT-PCR assay (mean SEM, n=3). As a control,
gapdh was also detected.
This article is protected by copyright. All rights reserved.

Table 1. Bioactivities of compounds P5i-7~P5i-16.
%Inhibition at
Compound
R1 Group
IC50(µM)a
0.72
50µMa
83
P5i-7
N.D.
N.D.
N.I.
18
P5i-8
P5i-9
N.D.
N.I.
P5i-10
58
67
P5i-11
13
N.I.
20
N.D.
N.D.
N.D.
N.D.
P5i-12
P5i-13
P5i-14
P5i-15
N.I.
N.D.
N.I.
P5i-16
a IC50 determination experiments were performed in duplicate;
N.I. = no inhibition;
N.D. = not determined
This article is protected by copyright. All rights reserved.