Preparation and biological evaluation of 5-substituted retinoic acids

Article abstract of DOI:10.1016/j.bmc.2008.08.025

Various 5-substituted retinoic acids were prepared by a palladium-catalyzed cross coupling reactions of vinyl nonaflates and E- or Z-3-tributylstannyl-2-beten-1-ol as a key reaction. These coupling products were then converted to the corresponding all-E- and 9Z-retinoic acid analogs via Horner-Emmons reaction and subsequent basic hydrolysis, and their biological activities were evaluated. The all-E-derivatives, 5-butyl and isobutyl analogs exhibited stronger effects for anti-proliferative and differentiation-inducing activities in HL-60 cells. In contrast, in 9Z-derivatives, none of the analogs showed any activity.

Full text of DOI:10.1016/j.bmc.2008.08.025

Bioorganic & Medicinal Chemistry 16 (2008) 8471–8481
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Preparation and biological evaluation of 5-substituted retinoic acids q
*
*
Akimori Wada , Naomi Matsuura, Yukari Mizuguchi, Kimie Nakagawa, Masayoshi Ito, Toshio Okano
Kobe Pharmaceutical University, 4-19-1, Motoyamakita-machi, Higashinada, Kobe 658-8558, Japan
a r t i c l e i n f o
a b s t r a c t
Article history:
Various 5-substituted retinoic acids were prepared by a palladium-catalyzed cross coupling reactions of
vinyl nonaflates and E- or Z-3-tributylstannyl-2-beten-1-ol as a key reaction. These coupling products
were then converted to the corresponding all-E- and 9Z-retinoic acid analogs via Horner–Emmons reac-
tion and subsequent basic hydrolysis, and their biological activities were evaluated. The all-E-derivatives,
5-butyl and isobutyl analogs exhibited stronger effects for anti-proliferative and differentiation-inducing
activities in HL-60 cells. In contrast, in 9Z-derivatives, none of the analogs showed any activity.
Ó 2008 Elsevier Ltd. All rights reserved.
Received 2 July 2008
Revised 7 August 2008
Accepted 8 August 2008
Available online 12 August 2008
Keywords:
Retinoid receptors
Retinoic acid analog
Coupling reaction
Vinyl nonaflate
Alkenyl stannane
1. Introduction
butenols.7 To apply this methodology for preparation of 5-substi-
tuted retinoic acid analogs, we planned a synthetic strategy as
The vitamin A metabolites all-E-retinoic acid (ATRA) 1 and 9Z-
retinoic acid (9CRA) 2 are the ligand molecules for the retinoic acid
receptors (RARa, b, c) and retinoid X receptors (RXRa, b, c, respec-
shown in Scheme 1. We chose the vinylnonaflate as segment A be-
cause the reactivity of nonaflate for the coupling reaction is greater
than that of the corresponding triflate.8 The vinylnonaflates A, the
key intermediates of our synthetic strategy, would be easily de-
rived from the corresponding aldehydes B, and the aldehydes B
could be obtained from the keto ester C (Scheme 1).
tively.2 These receptors are members of the nuclear receptor super-
family and are ligand-dependent factors that play important roles
in a myriad of biological functions including cell differentiation,
cell proliferation, and embryonic development, through regulation
of gene transcription.2,3 The RXRs form heterodimers with other
nuclear receptors proteins such as the RARs, the thyroid hormone
receptor (TR), the vitamin D receptor (VDR) and the peroxisome
proliferator-activated receptors (PPARs). Currently, great efforts
are underway for the preparation of receptor-selective retinoid
complexes in order not only to define the functions of each recep-
tor but also to develop therapeutic agents.4 As part of our studies of
the stereoselective synthesis of retinoids,5–7 we wish to describe
here a novel synthesis of 5-substituted all-E- and 9Z-retinoic acids
and their biological evaluation.
9
CO2H
R
R
1a:R=Me, all-E-retinoic acid (ATRA)
CO2H
CO2Et
2a: R=Me, 9
Z
-retinoic acid
ONf
O
2. Chemistry
OH
(EtO)2P
Bu3Sn
R
E or Z
We have developed a stereoselective synthesis of retinoid mono
isomers and their related analogs by the Stille coupling reactions of
vinyl triflate or nonaflate, which were derived from 2,6,6-tri-
methyl-1-cyclohexene-1-acetaldehyde, with 3-tributylstannyl-2-
A
O
CHO
R
CO2Me
q
B
C
See Ref. 1.
* Corresponding authors. Tel.: +81 78 441 7561; fax: +81 78 441 7562 (A.W.).
E-mail address: a-wada@kobepharma-u.ac.jp (A. Wada).
Scheme 1. Synthetic plan for 5-substituted retinoic acid.
0968-0896/$ - see front matter Ó 2008 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2008.08.025

8472
A. Wada et al. / Bioorg. Med. Chem. 16 (2008) 8471–8481
1)
n
-BuLi,
OH
R
O
O
R
1) NaH, R-X
(Ph3SiO)3VO
PhCO2H
TMS
2) MgCl2 H2O
CO2Me
2) TBAF
3
4
5
OH
9
Bu3Sn
Y
ONf
n-C4F9SO2F
8
CHO
R
R
R
Pd2(dba)3, Ph3As
7
9: Y=CH2OH
6
MnO2
10: Y=CHO
O
Bu3Sn
8'
CO2Et
(EtO)2P
n-BuLi,
OH
11
9
n
11
-BuLi,
9
13
Y
R
13
Y
R
R
Y
12: Y=CO2Et
1: Y=CO2H
9': Y=CH2OH
10': Y=CHO
12': Y=CO2Et
2: Y=CO2H
KOH, EtOH
MnO2
KOH, EtOH
Scheme 2. Synthetic route of retinoic acid analogs.
6-Substituted 2,2-dimethylcyclohexanones 4 were prepared
from the b-keto ester 3 by the introduction of alkyl chain according
to the usual method and subsequent demethoxycarbonylation9 in
good yield. Treatment of 4 with lithium (trimethylsilyl)acetylene
gave the adduct and, following treatment with tetrabutylammo-
nium fluoride, afforded the hydroxyacetylene 5 in excellent yields.
the less potent branched analogs 1c exhibited approximately one-
third of the anti-proliferative activity of 1a (Table 3). The analogs
1d and 1e, having more bulky subustituents, were markedly less
active. With the exception of 2e, which had almost no measurable
activity, the 9CRA analogs exhibited approximately one-tenth of
the activity of ATRA 1 (Table 4).
The methods for rearrangement of
a
-acetylenic alcohol into
a
,b-
To evaluate the differentiation-inducing activity of analogs, the
expression of cell surface CD11b antigen, a marker of granulocyte/
monocyte/macrophage differentiation, was measured by flow
cytometric analysis. The apoptosis-inducing activities in HL-60
cells were determined from the agarose gel electrophoresis of the
DNA samples from HL-60 cells treated with increasing concentra-
tions of ATRA, 9CRA, and the corresponding analogs. These results
are summarized in Tables 3 and 4. In the differentiation-inducing
activity, the analog 1b showed almost the same activity of ATRA.
It is noteworthy that analog 1c showed threefold higher activity
than that of ATRA. On the other hand, the 9Z-analogs exhibited
very limited effects on the differentiation-inducing activity. This
observation is consistent with earlier observations that in the
structure–activity relationship of retinobenzoic acid, a medium-
sized and hydrophobic alkyl group seems to be important for the
differentiation-inducing acitivity.12 With regard to apoptosis-
inducing activity, none of the all-E- or the 9Z- analogs showed this
ability toward HL-60 cells.
In order to determine whether the above biological activity was
mediated by retinoidal receptors, the analogs were tested in two
kinds of transcriptional assays. Initially, we assessed the transacti-
vation activity towards a human RARb gene promoter with three
copies of retinoic acid responsive elements (RAREs) in transfected
MG-63 cells. As shown in Figure 2, all-E analogs 1b and 1c at
10ꢀ6 M exhibited a comparable or even higher RARb/RARE medi-
ated gene expression than that of ATRA, the natural ligand of RAR.
However, none of the 9Z-analogs exhibited higher transactiva-
tion activity than that of 9CRA. In the transactivation activities of
analogs toward a rat cellular retinoic acid-binding protein II
(CRABPII) gene including RXREs in transfected MG-63 cells, none
of the analogs exhibited higher transactivation activity than
9CRA, the natural ligand of RXR (Fig. 3). Although we tested the
unsaturated compound using oxo-metallic catalysts have re-
ported.10 In the case of the application of this rearrangement to
the cyclohexanol derivatives, our group has found good reaction
conditions giving the b,c-unsaturated carbonyl compounds in good
yield using tris(triphenylsilyl) vanadate, triphenylsilanol and ben-
zoic acid.11 Adopting these reaction conditions, the acetylenic alco-
hols 5 were converted into the corresponding aldehydes 6 in 81–
92% yields. Enol nonaflates 7 were prepared in moderate to good
yields by treatment with nonafluorobutanesulfonyl fluoride (NfF)
using potassium tert-butoxide as a base in THF.
The coupling reactions of enolnonaflates 7 with E- or Z-3-tribu-
tylstannyl-2-butenol 8 or 80 in the presence of 5 mol% of tris(diben-
zylideneacetone)dipalladium (0) (Pd2(dba)3) and triphenylarsin
(Ph3As) as a ligand at room temperature in DMF afforded the alco-
hols 9 and 90, respectively. These alcohols were oxidized by MnO2
to give the aldehydes 10 and 100 without isomerization of the dou-
ble bonds. These aldehydes were easily converted into the esters
12 and 120 by condensation with triethyl 3-phosphonocrotonate
11 accompanied by a small amount of the regioisomer at the 13
position. Basic hydrolysis and subsequent recrystallization affor-
ded the all-E- and 9Z-5-substituted retinoic acids 1 and 2 in pure
form (Scheme 2, Tables 1 and 2).
3. Biological evaluation
To examine the anti-proliferative effect of the novel compounds
on HL-60 cell growth, we measured the cell cycle phase distribu-
tion of HL-60 cells treated with increasingly higher concentrations
of ATRA and the retinoic acid analogs. Dose–response curves of
ATRA (Fig. 1) and its analogs indicated that compound 1b showed
twofold stronger anti-proliferative activity than did ATRA 1a, while
binding affinities of analogs for human RXRa-Gal4 expressed in

A. Wada et al. / Bioorg. Med. Chem. 16 (2008) 8471–8481
8473
Table 1
Table 3
Yields of reactions for the synthesis of enol nonaflates (%)
Biological activity of the ATRA analogsa
Substituent R
4 Yielda 5 Yield 6 Yield 7 Yield 10 Yield 10’ Yielda
Compound Anti-proliferative
activity
Differentiation-
inducing activity
Apoptosis-inducing
activity
1
2
3
4
Bu
i-Bu
PhCH2
61
46
67
96
96
97
81
92
88
83
59
60
75
56
48
38
49
65
65
57
58
70
1a (ATRA)
100
193
35
100
129
310
2
1b
1c
1d
1e
ꢀ
ꢀ
ꢀ
ꢀ
2-Naphtyl-CH2 77
Quant.
2
a
Yield in 2 steps.
<0.81
<0.22
a
Anti-proliferative activity was assessed by cell cycle evaluation, as described in
Section 4. Differentiation inducing activity was measured by expression of cell
surface CD11b antigen as determined by flow cytometry. The data were normalized
with respect to the values obtained for ATRA. The apoptosis-inducing activities in
HL-60 cells were determined from the agarose gel electrophoresis by judging the
DNA fragmentation; +:positive, ꢀ:negative.
Table 2
Yields of reactions for the synthesis of 5-substituted retinoic acids
Substituent R
Product
Yield (%)a
Product
Yield (%)
1
2
3
4
5
6
7
8
Bu
i-Bu
PhCH2
2-Naphtyl-CH2
Bu
i-Bu
PhCH2
2-Naphtyl-CH2
12a
12b
12c
12d
120a
120b
120c
120d
94 (15:1)
92 (14:1)
95 (41:1)
89 (50>:1)
92 (13:1)
93 (12:1)
89 (26:1)
89 (50>:1)
1b
1c
1d
1e
2b
2c
2d
2e
82
75
69
79
70
75
86
Quant.
Table 4
Biological activity of the 9CRA analogsa
Compound Anti-proliferative
activity
Differentiation-
inducing activity
Apoptosis- inducing
activity
2a (9CRA)
184
14
16
11
<0.81
110
9
10
a
Ratio of all-E-: 13Z-isomers in the case of 12 or 9Z-: 9Z,13Z- isomers in the case
2b
2c
2d
2e
ꢀ
ꢀ
ꢀ
ꢀ
of 120.
6
<0.22
a
Anti-proliferative activity was assessed by cell cycle evaluation, as described in
Section 4. Differentiation inducing activity was measured by expression of cell
surface CD11b antigen as determined by flow cytometry. The data were normalized
with respect to the values obtained for ATRA. The apoptosis-inducing activities in
HL-60 cells were determined from the agarose gel electrophoresis by judging the
DNA fragmentation; +:positive, ꢀ:negative.
transfected MG63 cells, the results were almost the same as those
of RXRE assay (data not shown).
It is well documented that ATRA has the ability to induce differ-
entiation of HL-60 cells into granulocytes/macrophages via binding
to RAR but lacks the ability to induce apoptosis.13 In contrast, 9CRA
has the ability to induce both HL-60 cell differentiation and apop-
tosis via binding to RXR.14 Our results obtained above were consis-
tent with these observations. Thus, the lack of biological activity of
the 9Z-analogs in all assays was probably due to the lack of the
binding affinity for RAR and RXR, hence, stronger gene expressions
through both signaling pathways of RAR/RARE and RXR/RXRE were
not found. The higher activities of 1b and 1c toward the anti-pro-
liferative, differentiation activities of HL-60 cells are attributed to
their binding affinity for RAR. The reason of weak anti-proliferative
activity of 1c compared to that of ATRA is not clear at the present
time. These results indicate that the all-E-analogs having a med-
ium-alkyl substituent are potent candidates for development of
an RAR agonist.
liferative, differentiation, and apoptosis activities of HL-60 cells.
The influence of such modification on the 5 position was more
prominent in the ATRA analogs than the 9CRA variants. However,
it is important to note that an excessively bulky substituent
greatly reduces the potency to regulate cell proliferation and
differentiation.
In summary, we have developed a novel method for the
stereoselective synthesis of 5-substituted retinoic acid using a
Stille coupling reaction between a vinyl nonaflate with E- or Z-
alkenylstannane. The all-E-analogs having butyl and isobutyl
substituents exhibited stronger anit-prolifelative and differentia-
tion-inducing activities than did ATRA due to their binding affinity
to RARs.
In this study, we examined the influence of regulatory activity
of 5-substituted analogs of ATRA and 9CRA toward the anti-pro-
Figure 1. Cell cycle regulatory activity of ATRA and its analogs in HL-60 cells. Percentage of cells in G0/G1 phase (A) and S phase (B) as a function of concentration in culture in
the absence of 9CRA analogs (10ꢀ11–10ꢀ6 M). G0/G1-specific cell cycle arrest is evidenced by an increase in the relative number of G0/G1 DNA cells.

8474
A. Wada et al. / Bioorg. Med. Chem. 16 (2008) 8471–8481
pGL3-RARE [MG63]
4.5
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0.0
***
***
***
***
*
*
EtOH
1a
1b
1c
1d
1e
2a
2b
2c
2d
2e
Figure 2. Transcriptional activity of ATRA, 9CRA and their analogs toward a human RARb-RARE expression gene in transfected MG-63 cell. The cells were cotransfected with a
luciferase reporter plasmid (pGVB2 vector) containing a human RARb gene promoter including a RARE and a pRL-CMV vector as an internal control. Luciferase activities
induced by ATRA, 9CRA and its analogs in MG-63 cells were quantified and represented as fold-induction as compared with luciferase activity observed in the control cells.
Results represent the mean of three experiments (values in column) at 10ꢀ6 M, and standard errors (vertical bars).
pGL3-RXRE [MG63]
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0.0
***
*
EtOH
1a
1b
1c
1d
1e
2a
2b
2c
2d
2e
Figure 3. Transcriptional activity of ATRA, 9CRA and their analogs toward a rat CRBPII-RXRE expression gene in transfected MG-63 cell. The cells were cotransfected with a
luciferase reporter plasmid (pGVB2 vector) containing a rat CRABPII gene promoter including a RXRE and a pRL-CMV vector as aninternal control. Luciferase activities induced
by ATRA, 9CRA and its analogs in MG-63 cells were quantified and represented as fold-induction as compared with luciferase activity observed in the control cells. Results
represent the mean of three experiments (values in column) at 10ꢀ6 M, and standard errors (vertical bars).
fied by CC (Et2O–hexane, 1:4) to give 3-alkylated keto ester (14.5 g,
70%) as a colorless oil.
4. Experimental
A mixture of this keto ester (17 g, 54.5 mmol) and MgCl26H2O
(5 equiv) in DMSO (50 mL) was heated under reflux for 18 h.
After cooling, water (150 mL) was added, and the organics were
extracted with ether (3 ꢁ 80 mL), followed by standard workup
to give the crude ketone. The residue was purified by CC
(Et2Oꢀhexane, 1:6) to afford the ketone 4 (9.7 g, 70%) as a pale
yellow oil.
4.1. General methods
Melting points were determined on a Yanagimoto micro melt-
ing point apparatus and are uncorrected. UV spectra were recorded
on a JASCO Ubest-55 instrument in EtOH. IR spectra were recorded
on a Perkin-Elmer FT-IR Paragon 1000 spectrometer in CHCl3. 1H
NMR spectra were obtained on a Varian Gemini-300 NMR or a Var-
ian VXR-500 spectrometer with tetramethylsilane as an internal
standard in CDCl3. 13C NMR and 19F NMR were obtained on a Var-
ian VXR-500 (125 and 470 MHz) NMR spectrometer in CDCl3,
respectively. Mass spectra were determined on a Hitachi M-4100
instrument. Column chromatography (CC) under reduced pressure
(ca. 30 mmHg) was performed using Merck Silica gel 60. All reac-
tions were carried out under a nitrogen atmosphere. THF and ether
were purified by distillation from benzophenone sodium ketyl un-
der nitrogen. Materials obtained from commercial suppliers were
used without further purification. Standard workup means that
the organic layers were finally washed with brine, dried over anhy-
drous sodium sulfate (Na2SO4), filtered, and concentrated in vacuo
below 30 C using a rotary evaporator.
4.2.1. 6-Butyl-2,2-dimethylcyclohexanone (4a)
The 3-butyl keto ester was prepared from keto ester (3, 5.0 g,
27.17 mmol) and butyl iodide (7.0 g, 38.04 mmol) in 85% yield
(5.56 g) as
a colorless liquid, and this keto ester (5.04 g,
21.00 mmol) was converted to the ketone (4a) in 72% yield
(2.75 g) as a colorless oil.
:
IR mmax cmꢀ1 1699; 1H NMR (300 MHz) d: 0.86 (3H, t,
J = 6.5 Hz), 1.01 (3H, s) 1.15 (3H, s), 1.17–2.52 (12H, m), 2.46
(1H); 13C NMR (75 MHz) d: 13.98, 21.55, 22.87, 25.12, 25.57,
29.08, 29.53, 34.51, 41.86, 45.37, 46.02, 217.08; HRMS (EI) m/z:
Calcd C12H22O (M+) 182.1670. Found: 182.1671.
4.2.2. 2,2-Dimethyl-6-(2-methylpropyl)cyclohexanone (4b)
The 3-isobutyl keto ester was prepared from keto ester (3, 5.0 g,
27.17 mmol) and isobutyl iodide (7.0 g, 38.04 mmol) in 68% yield
4.2. General procedure for the preparation of 6-substituted 2,2-
dimethylcyclohexanone (4a–d)
(4.43 g) as
a colorless liquid, and the keto ester (4.16 g,
17.33 mmol) was converted to the ketone (4b) in 68% yield
(2.15 g) as a colorless oil.
To a suspension of NaH (60% dispersion in oil, 3.4 g, 0.085 mol)
in THF (65 mL) and DMF (7 mL) was added a solution of b-keto es-
ter 315 (12.2 g, 0.066 mol) in THF (70 mL) at 0 °C. After stirring for
15 min at room temperature, a solution of alkyl halide (0.13 mmol)
in THF (70 mL) was added dropwise and the resulting mixture was
heated under reflux for 18 h. After cooling, the mixture was poured
into 10% HCl (100 mL), and the organics were extracted with ether
(2 ꢁ 100 mL), followed by standard workup. The residue was puri-
IR mmax cmꢀ1: 1701; 1H NMR (300 MHz) d: 0.81 (3H, d,
J = 6.3 Hz), 0.83 (3H, d, J = 6.3 Hz), 1.01 (3H, s), 1.16 (3H, s), 1.21
(2H, dd, J = 3.9, 12.9 Hz), 1.40–1.94 (6H, m), 1.99–2.09 (1H, m),
2.51–2.62 (1H, m); 13C NMR (75 MHz) d: 21.60, 22.20, 23.04,
25.06, 25.36, 25.60, 34.95, 38.40, 41.92, 43.71, 45.47, 217.17;
HRMS (EI) m/z: Calcd C12H22O (M+) 182.1670. Found: 182.1663.

A. Wada et al. / Bioorg. Med. Chem. 16 (2008) 8471–8481
8475
4.2.3. 6-Benzyl-2,2-dimethylcyclohexanone (4c)
4.3.3. 6-Benzyl-1-ethynyl-2,2-dimethylcyclohexanol (5c)
The 3-benzyl keto ester was prepared from keto ester (3, 2.0 g,
5.43 mmol) and benzyl bromide (1.3 g, 7.60 mmol) in 81% yield
(2.40 g) as a colorless liquid, and this keto ester (1.55 g, 5.66 mmol)
was converted to the ketone (4c) in83% yield(1.00 g)as a colorless oil.
IR mmax cmꢀ1: 1496, 1604, 3028, 1702; 1H NMR (300 MHz) d:
1.07 (3H, s), 1.19 (3H, s), 1.58–1.67 (2H, m, 3-CH2), 1.69–1.82
(2H, m), 1.22–3.25 (5H, m), 7.12–7.29 (5H, m); 13C NMR
(75 MHz) d: 21.38, 25.10, 25.60, 33.91, 35.71, 41.83, 45.49, 47.81,
125.80, 128.20 (2C), 129.05 (2C), 140.78, 216.25; HRMS (EI) m/z:
Calcd C15H20O (M+) 216.1513. Found: 216.1516.
This was prepared from ketone (4c, 1.70 g, 7.87 mmol), trimeth-
ylsilylacetylene (1.22 g, 12.43 mmol) and 1 M TBAF in THF
(7.87 mL, 7.87 mmol) in 97% yield (1.84 g) as a colorless liquid. IR
mmax cmꢀ1
:
1495, 1603, 2360, 3012, 3305, 3606; 1H NMR
(300 MHz) d: 1.00 (3H, s), 1.14 (3H, s), 1.15–3.26 (10H, m), 2.58
(1H, s), 7.18–7.28 (5H, m); 13C NMR (75 MHz) d: 19.73, 20.84,
26.56, 29.17, 37.37, 37.68, 39.02, 44.27, 75.51, 78.03, 84.33,
125.74, 128.23 (2C), 129.39 (2C), 141.40; HRMS (EI) m/z: Calcd
C
17H22O (M+) 242.1670. Found: 242.1675.
4.3.4. 1-Ethynyl-6-(2-naphthylmethyl)-2,2-
4.2.4. 2,2-Dimethyl-6-(2-naphthylmethyl)cyclohexanone (4d)
The 3-(2-naphtylmethyl) keto ester was prepared from keto es-
ter (3, 6.3 g, 34.24 mmol) and 2-naphtylmethyl bromide (10.6 g,
47.94 mmol) in 93% yield (10.27 g) as a colorless liquid, and this
keto ester (8.91 g, 27.50 mmol) was converted to the ketone (4d)
in 83% yield (6.01 g) as a colorless oil. IR mmax cmꢀ1: 1601, 1702;
1H NMR (300 MHz) d: 1.09 (3H, s), 1.21 (3H, s), 1.52–1.66 (2H,
m), 1.69–1.81 (2H, m), 1.26–3.40 (5H, m), 7.29 (1H, d, J = 8.4 Hz),
7.37–7.48 (2H, m), 7.59 (1H, s), 7.74–7.81 (3H, m); 13C NMR
(75 MHz) d: 21.38, 25.13, 25.62, 34.00, 35.89, 41.83, 45.55, 47.82,
125.11, 125.84, 127.31, 127.36, 127.54, 127.69, 127.75, 131.96,
133.48, 138.32, 216.23; HRMS (EI) m/z: Calcd C19H22O (M+)
266.1670. Found: 266.1674.
dimethylcyclohexanol (5d)
This was prepared from ketone (4d, 6.0 g, 22.64 mmol), tri-
methylsilylacetylene (3.51 g, 35.77 mmol) and 1 M TBAF in THF
(22.64 mL, 22.64 mmol) in quantitative yield (6.58 g) as a pale yel-
low solid. IR mmax cmꢀ1: 1508, 1601, 2107, 3057, 3305, 3608; 1H
NMR (300 MHz) d: 1.03 (3H, s), 1.16 (3H, s), 1.25–1.47 (2H, m),
1.57–1.71 (3H, m), 1.99–2.12 (1H, m), 2.55–2.63 (2H, m), 2.62
(1H, s), 3.40 (1H, dd, J = 2.9, 13.2 Hz), 3.51 (1H, dd, J = 2.9, 13.2
Hz), 7.36 (1H, d, J = 8.4 Hz), 7.38–7.48 (2H, m), 7.64 (1H, s), 7.75–
7.82 (3H, m); 13C NMR (75 MHz) d: 19.76, 20.84, 26.57, 29.25,
37.55, 37.68, 39.07, 44.24, 75.5, 78.09, 84.34, 125.08, 125.83,
127.35, 127.51, 127.56, 127.75, 128.04, 131.94, 133.51, 138.97;
HRMS (EI) m/z: Calcd C21H24O (M+) 292.1826. Found: 292.1830.
4.3. General procedure for the preparation of 6-substituted
acetylenic alcohol (5a–d)
4.4. General procedure for the preparation of aldehyde (6a–d)
A solution of acetylenic alcohol (5, 1.0 equiv), (Ph3SiO)3VO (0.02
equiv), and benzoic acid (0.02 equiv) in xylene (50 mL) was heated
under reflux for 2 days. After cooling, the solvent was removed in
vacuo and the residue was purified by CC [ether-hexane (1:19)] to
afford the aldehyde (6).
To a stirred suspension of the 6-substituted ketone (4, 0.8 g,
3.3 mmol) in THF (13 mL) was added dropwise at ꢀ70 °C a solution
of lithium trimethylsillylacetylene, prepared from trimethylsilylac-
ethylene (0.45 mL, 3.3 mmol) and n-BuLi (1.7 M hexane solution,
1.9 mL, 3.3 mmol) in THF (6 mL). After stirring for 1 h at ꢀ70 °C,
the reaction mixture was quenched with a saturated NH4Cl
(20 mL) and extracted with ether (3 ꢁ 20 mL), followed by stan-
dard workup to give the crude trimethylsilylated acetylene. To a
silylated acetylene in THF (6 mL) was added tetrabutyl ammonium
fluoride (1 mol solution in THF, 3.3 mL) at 0 °C. After stirring for an
additional 1 h, the reaction mixture was quenched with a saturated
NH4Cl (20 mL) and extracted with ether (3 ꢁ 20 mL), followed by
standard workup. The residue was purified by CC (etherꢀhexane,
1:19) to afford the acetylenic alcohol 5 as a colorless oil.
4.4.1. 2-(2-Butyl-6,6-dimethylcyclohexen-1-yl)ethanal (6a)
This was prepared from the alcohol (5a, 2.65 g, 12.75 mmol),
(Ph3SiO)3VO (239 mg, 0.26 mmol), and benzoic acid (31.7 mg,
0.26 mmol) in 81% yield (2.14 g) as a pale yellow oil. IR mmax
cmꢀ1: 1716; 1H NMR (300 MHz) d: 0.86 (3H, t, J = 6.9 Hz), 0.94
(6H, s), 1.22–1.32 (4H, m), 1.43–1.49 (2H, m), 1.53–1.62 (2H, m),
1.87 (2H, t, J = 7.5 Hz), 1.99 (2H, t, J = 6.0 Hz), 3.06 (2H, d,
J = 2.4 Hz), 9.50 (1H, t, J = 2.4 Hz); 13C NMR (75 MHz) d: 13.97,
19.36, 22.81, 27.48, 28.17 (2C), 30.28, 33.71, 34.69, 39.34, 43.37,
128.31, 137.00, 201.92; HRMS (EI) m/z: Calcd C14H24O (M+)
208.1826. Found: 208.1840.
4.3.1. 6-Butyl-1-ethynyl-2,2-dimethylcyclohexanol (5a)
This was prepared from ketone (4a, 2.41 g, 13.22 mmol), tri-
methylsilylacetylene (2.05 g, 20.89 mmol) and 1 M TBAF in THF
(13.22 mL, 13.22 mmol) in 96% yield (2.65 g) as a colorless liquid.
IR mmax cmꢀ1: 2358, 3305, 3608; 1H NMR (300 MHz) d: 0.88 (3H,
t, J = 7.2 Hz), 0.97 (3H, s), 1.09 (3H, s), 1.04–1.83 (13H, m), 1.88
(1H, s), 2.44 (1H, s); 13C NMR (75 MHz) d: 14.11, 19.70, 21.02,
23.10, 26.54, 29.35, 29.99, 30.08, 37.70, 38.79, 42.04, 74.93,
78.08, 84.60; HRMS (EI) m/z: Calcd C14H24O (M+) 208.1825. Found:
208.1825.
4.4.2. 2-[6,6-Dimethyl-2-(2-methylpropyl)cyclohexen-1-
yl]ethanal (6b)
This was prepared from the alcohol (5b, 4.22 g, 20.27 mmol),
(Ph3SiO)3VO (365.7 mg, 0.41 mmol), and benzoic acid (50.0 mg,
0.41 mmol) in 92% yield (3.87 g) as a pale yellow oil. IR mmax
cmꢀ1: 1715; 1H NMR (300 MHz) d: 0.84 (6H, d, J = 6.6 Hz), 0.97
(6H, s), 1.46–1.52 (2H, m), 1.56–1.66 (2H, m), 1.77–1.84 (1H, m),
1.81 (2H, d, J = 8.0 Hz), 1.99 (2H, t, J = 6.3 Hz), 3.10 (2H, d,
J = 2.3 Hz), 9.51 (1H, t, J = 2.3 Hz,); 13C NMR (75 MHz) d: 19.33,
22.29 (2C), 26.56, 28.26 (2C), 30.46, 34.92, 39.40, 42.66, 43.47,
129.58, 135.83, 202.07; HRMS (EI) m/z: Calcd C14H24O (M+)
208.1826. Found: 208.1846.
4.3.2. 1-Ethynyl-2,2-dimethyl-6-(2-methylpropyl)cyclohexanol
(5b)
This was prepared from ketone (4b, 3.86 g, 21.21 mmol), tri-
methylsilylacetylene (3.28 g, 33.51 mmol) and 1 M TBAF in THF
(21.21 mL, 21.21 mmol) in 96% yield (4.22 g) as a colorless liquid.
IR mmax cmꢀ1: 2361, 3306, 3609; 1H NMR (300 MHz) d: 0.84 (3H,
d, J = 6.5 Hz), 0.91 (3H, d, J = 6.5 Hz), 0.98 (3H, s), 1.09 (3H, s),
1.14–1.77 (10H, m), 1.85 (1H, s), 2.44 (1H, s); 13C NMR (75 MHz)
d: 19.74, 21.06, 21.64, 24.22, 25.44, 26.62, 29.61, 37.65, 38.84,
4.4.3. 2-(2-Benzyl-6,6-dimethylcyclohexen-1-yl)ethanal (6c)
This was prepared from the alcohol (5c, 1.20 g, 4.96 mmol),
(Ph3SiO)3VO (89.2 mg, 0.10 mmol), and benzoic acid (12.2 mg,
0.10 mmol) in 88% yield (1.05 g) as a pale yellow oil. IR mmax
cmꢀ1: 1494, 1602, 1716, 3012; 1H NMR (300 MHz) d: 1.04 (6H,
s), 1.50–1.56 (2H, m), 1.56–1.67 (2H, m), 1.96 (2H, t, J = 6.0 Hz),
3.19 (2H, d, J = 2.1 Hz), 3.31 (2H, s), 7.08–7.30 (5H, m), 9.59 (1H,
39.52, 39.69, 74.95, 77.96, 84.68; HRMS (EI) m/z: Calcd C14H24
O
(M+) 208.1826. Found: 208.1822.

8476
A. Wada et al. / Bioorg. Med. Chem. 16 (2008) 8471–8481
t, J = 2.1 Hz); 13C NMR (75 MHz) d: 19.26, 28.18 (2C), 30.69, 34.92,
39.16, 39.26, 43.76, 125.98, 128.16 (2C), 128.39 (2C), 131.06,
134.90, 139.47, 201.07; HRMS (EI) m/z: Calcd C17H22O (M+)
242.1669. Found: 242.1668.
108.20 (J = 37.5, 290.0 Hz), 109.72 (J = 33.8, 304.8 Hz), 114.57
(J = 34.3, 295.9 Hz), 117.02 (J = 32.8,287.0 Hz), 119.88, 126.00,
128.07 (2C), 128.46 (2C), 132.58, 135.28, 137.34, 140.10; 19F NMR
(470 MHz) d: ꢀ127.40, ꢀ122.75, ꢀ111.19, ꢀ82.21.; HRMS (EI) m/z:
Calcd C21H21F9O3S (M+) 524.1066. Found: 524.1082.
4.4.4. 2-[6,6-Dimethyl-2-(2-naphthylmethyl)cyclohexen-1-
yl]ethanal (6d)
4.5.4. (E)-2-[6,6-Dimethyl-2-(2-naphthylmethyl)cyclohexen-1-
yl]ethenyl Nonafluorobutanesulfonate (7d)
This was prepared from the alcohol (5d, 6.62 g, 22.74 mmol),
(Ph3SiO)3VO (401.4 mg, 0.45 mmol), and benzoic acid (54.9 mg,
0.45 mmol) in 83% yield (5.52 g) as a pale yellow oil. IR mmax
cmꢀ1: 1508, 1602, 1717, 3011; 1H NMR (300 MHz) d: 1.07 (6H,
s), 1.51–1.59 (2H, m), 1.59–1.67 (2H, m), 1.99 (2H, t, J = 5.9 Hz),
3.25 (2H, d, J = 2.0 Hz), 3.46 (2H, s), 7.24 (1H, d, J = 8.6 Hz), 7.39–
7.47 (2H, m), 7.52 (1H, s), 7.74–7.81 (3H, m), 9.63 (1H, t,
J = 2.0 Hz); 13C NMR (75 MHz) d: 19.29, 28.21 (2C), 30.75, 35.00,
39.17, 39.48, 43.83, 125.24, 125.92, 126.30, 126.98, 127.42,
127.56, 128.01, 131.25, 132.10, 133.52, 134.86, 137.04, 200.98;
HRMS (EI) m/z: Calcd C21H24O (M+) 292.1826. Found: 292.1821.
This was prepared from the aldehyde (6d, 4.57 g, 15.72 mmol),
n-C4F9SO2F (7.12 g, 23.58 mmol) in 56% yield (5.03 g) as a pale yel-
low oil. IR m
max cmꢀ1: 1202, 1426, 1508, 1601, 1643, 3065; 1H NMR
(300 MHz) d: 1.08 (6H, s), 1.501.57 (2H, m), 1.57–1.66 (2H, m), 2.00
(2H, t, J = 3.7 Hz), 3.59 (2H, s), 6.36 (1H, d, J = 12.0 Hz), 6.54 (1H, d,
J = 12.0 Hz), 7.21 (1H, d, J = 8.6 Hz), 7.42–7.48 (2H, m), 7.50 (1H, s),
7.75–7.82 (3H, m); 13C NMR (125 MHz) d: 18.95, 28.46 (2C), 29.23,
34.45, 38.88, 40.56, 108.40 (J = 34.0, 314.1 Hz), 109.69 (J = 31.0,
269.1 Hz), 114.58 (J = 35.6, 263.7 Hz), 116.99 (J = 33.9, 286.4 Hz),
120.00, 125.31, 126.00, 126.35, 126.82, 127.43, 127.59, 128.09,
132.09, 132.66, 133.55, 135.33, 137.47, 137.64; 19F NMR
(470 MHz) d: ꢀ127.38, ꢀ122.72, ꢀ111.16, ꢀ82.18; HRMS (EI) m/z:
Calcd C25H23F9O3S (M+) 574.1222. Found: 574.1225.
4.5. General procedure for the preparation enol nonaflate (7a–d)
A mixture of the aldehyde (1.0 equiv), t-BuOK (1.5 equiv) and
n-C4F9SO2F (1.5 equiv) in THF (40 mL) was heated under reflux
for 3–4 h. After cooling, the reaction mixture was quenched with
saturated aqueous NH4Cl (30 mL), the organics were extracted
with ether (3 ꢁ 70 mL), followed by standard workup. The residue
was purified by CC (etherꢀhexane, 1:9) to give the nonaflate 7.
4.6. General procedure for the preparation of b-
Ionylideneacetoaldehyde analogs (10a–d and 100a–d)
To a stirred solution of nonaflate (7, 200 mg, 0.67 mmol) in DMF
(2 mL) was added Pd(PPh3)4 (40 mg, 0.034 mmol, 0.05 equiv) at
room temperature under nitrogen. After 10 min, a solution of E- or
Z-3-tributylstannylbutenol (8 or 80, 300–400 mg, ca. 1 mmol, 1.5
equiv) in DMF (2 mL) was added and the resulting mixture was stir-
red for 2 h. The reaction mixture was quenched with saturated aque-
ous NaCl (5 mL) and extracted with Et2O (10 mL ꢁ 3), followed by
the standard work up. The residue was purified by CC (ether:hex-
ane = 1:4–3:7 as an eluent) to give the coupled alcohol (9 or 90).
The alcohol (9, 0.5 mmol) was dissolved in Et2O (20 mL), and MnO2
(10 equiv) was added. After stirring the mixture for 4–5 h min,
MnO2 was filtered withCelite. The filtrate was concentratedin vacuo
and the residue was purified by CC (ether:hexane = 3:7 as eluent) to
give the aldehyde (10 or 100) as a pale yellow oil.
4.5.1. (E)-2-(2-Butyl-6,6-dimethylcyclohexen-1-yl)ethenyl
Nonafluorobutanesulfonate (7a)
This was prepared from the aldehyde (6a, 1.58 g, 12.75 mmol),
n-C4F9SO2F (3.44 g, 11.4 mmol) in 59% yield (2.14 g) as a pale yel-
low oil. IR m
max cmꢀ1: 1210, 1424, 1649; 1H NMR (300 MHz) d: 0.86
(3H, t, J = 7.2 Hz), 0.95 (6H, s), 1.15–1.32 (4H, m), 1.40–1.64 (6H,
m), 1.98 (2H, t, J = 6.5 Hz), 6.20 (1H, d, J = 11.4 Hz), 6.43 (1H, d,
J = 11.4 Hz); 13C NMR (125 MHz) d: 13.90, 19.07, 22.68, 28.40
(2C), 30.13, 31.24, 34.04, 34.65, 39.05, 108.42 (J = 40.2, 271.2 Hz),
109.77 (J = 31.3, 270.6 Hz), 114.64 (J = 35.8, 301.6 Hz), 117.06
(J = 3.0, 288.6 Hz), 120.02, 130.04, 137.07, 137.69; 19F NMR
(470 MHz) d: ꢀ127.39, ꢀ122.74, ꢀ111.22, ꢀ82.20; HRMS (EI) m/z:
Calcd C18H23F9O3S (M+) 490.1223. Found: 490.1239.
4.6.1. (2E,4E)-5-(2-Butyl-6,6-dimethylcyclohexen-1-yl)-3-
methyl-2,4-pentadienal (10a)
4.5.2. (E)-2-[6,6-Dimethyl-2-(2-methylpropyl)cyclohexen-1-
yl]ethenyl nonafluorobutanesulfonate (7b)
This was prepared from the nonaflate (7a, 915 mg, 1.87 mmol)
and E-stannyl olefin (8, 1.02 g, 2.81 mmol) in 48% yield (231 mg,
2 steps) as a pale yellow oil. UV–vis kmax nm: 277.8, 328.6; IR mmax
cmꢀ1: 1657; 1H NMR (300 MHz) d: 0.87 (3 H, t, J = 7.2 Hz), 1.03 (6H,
s), 1.20–1.40 (6H, m), 1.40–1.70 (4H, m), 2.04 (2H, t, J = 7.4 Hz),
2.30 (3H, s), 5.92 (1H, d, J = 8.1 Hz), 6.20 (1H, d, J = 16.2 Hz), 6.74
(1H, d, J = 16.2 Hz), 10.12 (1H, d, J = 8.1 Hz); 13C NMR (75 MHz) d:
12.88, 13.96, 19.07, 22.69, 28.94 (2C), 30.66, 31.19, 34.27, 34.65,
39.72, 128.73, 134.69, 135.75, 137.04, 137.19, 155.03, 191.29;
HRMS (EI) m/z: Calcd C18H28O (M+) 260.2139. Found: 260.2147.
This was prepared from the aldehyde (6b, 1.43 g, 6.88 mmol),
n-C4F9SO2F (3.12 g, 10.32 mmol) in 60% yield (2.02 g) as a pale yel-
low oil. IR m
max cmꢀ1: 1208, 1424, 1649; 1H NMR (300 MHz) d: 0.81
(6H, d, J = 6.3 Hz), 0.98 (6H, s), 1.43–1.51 (2H, m), 1.53–1.66 (2H,
m), 1.67–1.89 (1H, m), 1.93 (2H, d, J = 7.8 Hz), 1.97 (2H, d,
J = 3.0 Hz), 6.19 (1H, d, J = 12.0 Hz), 6.42 (1H, d, J = 12.0 Hz); 13C
NMR (125 MHz) d: 19.05, 22.16 (2C), 26.79, 28.43 (2C), 30.32,
34.26, 39.12, 43.39, 108.42 (J = 39.7, 270.7 Hz), 109.78 (J = 32.3,
271.5 Hz), 114.61 (J = 36.3, 301.0 Hz), 117.06 (J = 34.6, 288.4 Hz),
120.34, 131.19, 136.48, 137.50; 19F NMR (470 MHz) d: ꢀ127.37,
ꢀ122.73, ꢀ111.17, ꢀ82.19; HRMS (EI) m/z: Calcd C18H23F9O3S
(M+) 490.1223. Found: 490.1217.
4.6.2. (2E,4E)-3-Methyl-5-[6,6-dimethyl-2-(2-
methylpropyl)cyclohexen-1-yl]-2,4-pentadienal (10b)
This was prepared from the nonaflate (7b, 1.0 g, 2.04 mmol) and
E-stannyl olefin (8, 1.11 g, 3.06 mmol) in 38% yield (203 mg, 2
steps) as a pale yellow oil. UV–vis kmax nm: 278.4, 326.2; IR mmax
cmꢀ1: 1657; 1H NMR (300 MHz) d: 0.82 (6H, d, J = 6.6 Hz), 1.05
(6H, s), 1.45–1.52 (2H, m, 2-CH2), 1.56–1.67 (2H, m), 1.70–1.84
(1H, m), 1.96 (2H, d, J = 7.5 Hz), 2.02 (2H, t, J = 5.4 Hz), 2.30 (3H,
s), 5.93 (1H, d, J = 8.4 Hz), 6.19 (1H, d, J = 16.2 Hz), 6.74 (1H, d,
J = 16.2 Hz), 10.12 (1H, d, J = 8.4 Hz); 13C NMR (75 MHz) d: 12.91,
19.06, 22.49 (2C), 27.27, 28.94 (2C), 30.94, 34.48, 39.86, 43.60,
128.70, 134.95, 135.98, 136.22, 138.17, 155.02, 191.29; HRMS
(EI) m/z: Calcd C18H28O (M+) 260.2139. Found: 260.2142.
4.5.3. (E)-2-(2-Benzyl-6,6-dimethylcyclohexen-1-yl)ethenyl
nonafluorobutanesulfonate (7c)
This was prepared from the aldehyde (6c, 200 mg, 0.83 mmol),
n-C4F9SO2F (377.6 mg, 1.25 mmol) in 75% yield (265.0 mg) as a pale
yellow oil. IR mmax cmꢀ1: 1206, 1425, 1494, 1602, 1647, 3064; 1H
NMR (300 MHz) d: 1.05 (6H, s), 1.48–1.55 (2H, m), 1.58–1.67 (2H,
m), 1.96 (2H, t, J = 6.0 Hz), 3.42 (2H, s), 6.29 (1H, d, J = 12.2 Hz),
6.47 (1H, d, J = 12.2 Hz), 7.05 (2H, d, J = 7.5 Hz), 7.14–7.31 (3H, m);
13C NMR (125 MHz) d: 18.94, 28.43 (2C), 30.33, 34.37, 38.88, 40.33,

A. Wada et al. / Bioorg. Med. Chem. 16 (2008) 8471–8481
8477
4.6.3. (2E,4E)-5-(2-Benzyl-6,6-dimethylcyclohexen-1-yl)-3-
methyl-2,4-pentadienal (10c)
J = 16.8 Hz), 7.10 (2H, d, J = 7.2 Hz), 7.15–7.32 (3H, m), 9.65 (1H, d,
J = 8.4 Hz); 13C NMR (75 MHz) d: 19.05, 20.94, 29.06 (2C), 30.98,
34.56, 39.37, 40.66, 125.95, 127.19, 128.03 (2C), 128.21, 128.48
(2C), 133.69, 135.92, 139.91, 140.67, 154.45, 190.20; HRMS (EI)
m/z: Calcd C21H26O (M+) 294.1982. Found: 294.1990.
This was prepared from the nonaflate (7c, 390 mg, 0.91 mmol)
and E-stannyl olefin (8, 495 mg, 1.37 mmol) in 49% yield
(131 mg, 2 steps) as a pale yellow oil. UV–vis kmax nm: 317.8; IR
mmax cmꢀ1: 1493, 1610, 1657; 1H NMR (300 MHz) d: 1.10 (6H, s),
1.48–1.57 (2H, m), 1.591.65 (2H, m), 1.96 (2H, t, J = 5.5 Hz), 2.27
(3H, s), 3.45 (2H, s), 5.87 (1H, d, J = 8.1 Hz), 6.25 (1H, d,
J = 16.0 Hz), 6.78 (1H, d, J = 16.0 Hz), 7.09 (2H, J = 7.5 Hz), 7.13–
7.21 (1H, m), 7.23–7.31 (2H, m), 10.09 (1H, d, J = 8.1 Hz,); 13C
NMR (75 MHz) d: 12.88, 18.98, 28.96 (2C), 30.64, 34.60, 39.42,
40.54, 100.22, 125.84, 128.20 (2C), 128.35 (2C), 129.11, 134.02,
135.31, 139.46, 140.58, 154.51, 191.26; HRMS (EI) m/z: Calcd
C21H26O (M+) 294.1983. Found: 294.1979.
4.6.8. (2Z,4E)-3-Methyl-5-[6,6-dimethyl-2-(2-
naphthylmethyl)cyclohexen-1-yl]-2,4-pentadienal (100d)
This was prepared from the nonaflate (7d, 1.55 g, 4.44 mmol)
and Z-stannyl olefin (80, 2.41 g, 6.66 mmol) in 70% yield (1.07 g, 2
steps) as a pale yellow solid. UV–vis kmax nm: 223.8, 274.8; IR mmax
cmꢀ1: 1508, 1616, 1661, 3013; 1H NMR (300 MHz) d: 1.15 (6H, s),
1.52–1.59 (2H, m), 1.60–1.69 (2H, m), 2.06 (2H, t, J = 8.6 Hz), 2.09
(3H, s), 3.64 (2H, s), 5.79 (1H, d, J = 8.6 Hz), 6.71 (1H, d,
J = 15.9 Hz), 6.83 (1H, d, J = 15.9 Hz), 7.24 (1H, d, J = 8.9 Hz), 7.39–
7.48 (2H, m), 7.53 (1H, s), 7.74–7.82 (3H, m), 9.80 (1H, d,
J = 8.6 Hz); 13C NMR (75 MHz) d: 19.03, 21.05, 29.05 (2C), 30.81,
34.63, 39.40, 40.83, 125.27, 126.01, 126.33, 126.80, 127.35,
127.45, 127.62, 128.06, 128.16, 131.99, 133.52, 133.81, 136.15,
4.6.4. (2E,4E)-3-Methyl-5-[6,6-dimethyl-2-(2-
naphthylmethyl)cyclohexen-1-yl]-2,4-pentadienal (10d)
This was prepared from the nonaflate (7d, 1.70 g, 2.96 mmol)
and E-stannyl olefin (8, 1.60 g, 4.44 mmol) in 65% yield (664 mg,
2 steps) as a pale yellow solid. UV–vis kmax nm: 224.0, 275.4; IR
mmax cmꢀ1: 1508, 1602, 1661, 3013; 1H NMR (300 MHz) d: 1.14
(6H, s), 1.51–1.57 (2H, m), 1.58–1.67 (2H, m), 2.03 (2H, t,
J = 5.4 Hz), 2.27 (3H, s), 3.62 (2H, s), 5.83 (1H, d, J = 8.3 Hz), 6.31
(1H, d, J = 16.2 Hz), 6.83 (1H, d, J = 16.2 Hz), 7.23 (1H, d,
J = 8.4 Hz), 7.39–7.49 (2H, m), 7.51 (1H, s), 7.75–7.82 (3H, m),
10.09 (1H, d, J = 8.3 Hz); 13C NMR (75 MHz) d: 12.93, 19.02, 29.00
(2C), 30.72, 34.69, 39.45, 40.75, 125.20, 125.93, 126.42, 126.95,
127.39, 127.59, 127.97, 129.14, 132.00, 133.52, 133.96, 135.33,
135.50, 138.12, 139.64, 154.47, 191.23; HRMS (EI) m/z: Calcd
C25H28O (M+) 344.2139. Found: 344.2143.
138.11, 139.90, 154.45, 190.00; HRMS (EI) m/z: Calcd C25H28
O
(M+) 344.2139. Found: 344.2145.
4.7. General procedure for the preparation of ethyl 5-
substituted retinoate (12a–d and 120a–d)
To a solution of diethyl 3-(methoxycarbonyl)-2-methyl-2-pro-
penyl-phosphonate (E:Z = 4:1) (11, 391 mg, 2 mmol) and DMPU
(4.0 equiv) in THF (5 mL) was added n-BuLi (1.6 M hexane solution,
1.25 mL, 2 mmol) at 0 °C. After stirring for 30 min, the solution was
cooled at ꢀ78 °C and to this mixture was added a solution of the
aldehyde (10 or 100, ca. 0.7 mmol) in THF (5 mL). The resulting
mixture was stirred for an additional 5 h and allowed to come to
the room temperature. The reaction mixture was quenched with
saturated NH4Cl (5 mL) and extracted with ether followed by stan-
dard workup. The residue was purified by column choromatogra-
phy on silica gel (ether:hexane = 1:9) to give the respective
pentaenyl esters (12 or 120) as a mixture of stereoisomers (12 for
all-E and 13Z-isomer, 120 for 9Z- and 9Z,13Z-isomer).
4.6.5. (2Z,4E)-5-(2-Butyl-6,6-dimethylcyclohexen-1-yl)-3-
methyl-2,4-pentadienal (100a)
This was prepared from the nonaflate (7a, 800 mg, 1.63 mmol)
and Z-stannyl olefin (80, 885 mg, 2.45 mmol) in 65% yield
(276 mg, 2 steps) as a pale yellow oil. UV–vis kmax nm: 276.4,
321.0; IR mmax cmꢀ1: 1615, 1660; 1H NMR (300 MHz) d: 0.85 (3H,
t, J = 7.1 Hz), 1.03 (6H, s), 1.18–2.08 (12H, m), 2.10 (3H, s), 5.84
(1H, d, J = 8.3 Hz), 6.62 (1H, d, J = 15.9 Hz), 7.50 (1H, d,
J = 15.9 Hz), 10.14 (1H, d, J = 8.3 Hz); 13C NMR (75 MHz) d: 13.96,
19.08, 21.12, 22.76, 28.97 (2C), 30.61, 31.29, 34.22, 34.76, 39.69,
126.69, 127.66, 136.83, 137.06, 137.23, 155.21, 190.06; HRMS
(EI) m/z: Calcd C18H28O (M+) 260.2138. Found: 260.2139.
4.7.1. Ethyl (2E,4E,6E,8E)-9-(2-Butyl-6,6-dimethylcyclohexen-1-
yl)-3,7-dimethyl-2,4,6,8-nonatetraenoate and Ethyl
(2Z,4E,6E,8E)-9-(2-butyl-6,6-dimethylcyclohexen-1-yl)-3,7-
dimethyl-2,4,6,8-nonatetraenoate (12a)
This was prepared from the aldehyde (10a, 231 mg, 0.89 mmol),
phosphonate (470.3 mg, 1.78 mmol), DMPU (776.7 mg, 3.56 mmol)
and n-BuLi (1.19 mL, 1.78 mmol) in 94% yield (310 mg, all-
E:13Z = 15:1) as a pale yellow oil.
4.6.6. (2Z,4E)-3-Methyl-5-[6,6-dimethyl-2-(2-
methylpropyl)cyclohexen-1-yl]-2,4-pentadienal (100b)
This was prepared from the nonaflate (7b, 800 mg, 1.63 mmol)
and Z-stannyl olefin (80, 885 mg, 2.45 mmol) in 57% yield (276 mg,
2 steps) as a pale yellow oil. UV–vis kmax nm: 276.8, 323.6; IR mmax
cmꢀ1: 1615, 1660; 1H NMR (300 MHz) d: 0.80 (6H, d, J = 6.3 Hz),
1.04 (6H, s), 1.43–1.51 (2H, m), 1.53–1.66 (2H, m), 1.69–1.87
(1H, m), 1.96 (2H, d, J = 7.5 Hz), 2.01 (2H, t, J = 3.0 Hz), 2.10 (3H,
s), 5.84 (1H, d, J = 8.3 Hz), 6.62 (1H, d, J = 16.2 Hz), 7.03 (1H, d,
J = 16.2 Hz), 10.15 (1H, d, J = 8.3 Hz); 13C NMR (75 MHz) d: 19.06,
21.14, 22.51 (2C), 27.26, 28.99 (2C), 30.92, 34.44, 39.84, 43.65,
126.97, 127.69, 135.88, 137.30, 138.30, 155.26, 190.14; HRMS
(EI) m/z: Calcd C18H28O (M+) 260.2139. Found: 260.2137.
all-E-Isomer: UV–vis kmax nm: 354.3; IR m
max cmꢀ1: 1584, 1698;
1H NMR (300 MHz) d: 0.87 (3H, t, J = 6.9 Hz), 1.02 (6H, s), 1.29 (3H,
t, J = 7.1 Hz), 1.23–1.66 (8H, m), 1.99 (3H, s), 2.00–2.08 (4H, m),
2.35 (3H, s), 3.47 (2H, q, J = 7.1 Hz), 5.77 (1H, s), 6.11 (1H, d,
J = 17.1 Hz), 6.12 (1H, d, J = 11.0 Hz), 6.27 (1H, d, J = 17.1 Hz), 6.28
(1H, d, J = 15.0 Hz), 6.99 (1H, dd, J = 11.0, 15.0 Hz); 13C NMR
(75 MHz) d: 12.87, 13.78, 14.00, 14.29, 19.26, 22.69, 28.97 (2C),
30.44, 31.11, 34.28, 34.56, 39.79, 59.59, 118.51, 128.89, 129.35,
130.88, 134.46, 135.04, 136.25, 137.74, 139.53, 152.65, 167.17;
HRMS (EI) m/z: Calcd C25H38O2 (M+) 370.2870. Found: 370.2866.
4.6.7. (2Z,4E)-5-(2-Benzyl-6,6-dimethylcyclohexen-1-yl)-3-
methyl-2,4-pentadienal (10’c)
4.7.2. Ethyl (2E,4E,6E,8E)-3,7-dimethyl-9-[6,6-dimethyl-2-(2-
methylpropyl)cyclohexen-1-yl]-2,4,6,8-nonatetraenoate and
Ethyl (2Z,4E,6E,8E)-3,7-dimethyl-9-[6,6-dimethyl-2-(2-
methylpropyl)cyclohexen-1-yl]-2,4,6,8-nonatetraenoate (12b)
This was prepared from the aldehyde (10b, 200 mg, 0.78 mmol),
This was prepared from the nonaflate (7c, 547 mg, 1.28 mmol)
and Z-stannyl olefin (80, 693 mg, 1.92 mmol) in 58% yield (218 mg,
2 steps) as a pale yellow oil. UV–vis kmax nm: 314.6; IR m :
max cmꢀ1
1494, 1615, 1659, 3012; 1H NMR (300 MHz) d: 1.12 (6H, s), 1.52–
1.58 (2H, m), 1.59–1.70 (2H, m), 2.04 (2H, t, J = 5.6 Hz), 3.49 (2H, s),
5.77 (1H, d, J = 8.4 Hz), 6.65 (1H, d, J = 16.8 Hz), 7.08 (1H, d,
phosphonate
(412.2 mg,
1.56 mmol),
DMPU
(680.7 mg,
3.12 mmol), and n-BuLi (1.04 mL, 1.56 mmol)in 92% yield
(267 mg, all-E:13Z = 14:1) as a pale yellow oil.

8478
A. Wada et al. / Bioorg. Med. Chem. 16 (2008) 8471–8481
all-E-Isomer: UV–vis kmax nm: 242.4, 352.8; IR
m
max cmꢀ1: 1584,
J = 7.1 Hz), 1.312.10 (12H, m), 1.97 (3H, s), 2.31 (3H, s), 4.15 (2H, q,
J = 7.1 Hz), 5.74 (1H, s), 6.02 (1H, d, J = 11.5 Hz), 6.20 (1H, d,
J = 15.2 Hz), 6.25 (1H, d, J = 15.6 Hz), 6.61 (1H, d, J = 15.6 Hz), 7.06
(1H, dd, J = 11.5, 15.2 Hz); 13C NMR (75 MHz) d: 13.73, 14.04,
14.29, 19.26, 20.82, 22.79, 29.06 (2C), 30.41, 31.52, 34.24, 34.82,
39.63, 59.59, 118.82, 127.82, 128.42, 129.65, 130.34, 134.36,
134.46, 138.03, 138.27, 152.65, 167.16; HRMS (EI) m/z: Calcd
1698; 1H NMR (300 MHz) d: 0.81 (6H, d, J = 6.6 Hz), 1.03 (6H, s),
1.28 (3H, t, J = 7.1H), 1.40–1.52 (2H, m), 1.55–1.63 (2H, m), 1.68–
1.85 (1H, m), 1.96 (2H, d, J = 8.4 Hz), 1.98 (3H, s), 2.00 (2H, t,
J = 6.6 Hz), 2.35 (3H, s), 4.17 (2H, q, J = 7.1 Hz), 5.76 (1H, s), 6.09
(1H, d, J = 16.2 Hz), 6.13 (1H, d, J = 10.7 Hz), 6.26 (1H, d,
J = 16.2 Hz), 6.28 (1H, d, J = 15.0 Hz), 6.99 (1H, dd, J = 10.7,
15.0 Hz); 13C NMR (75 MHz) d: 12.87, 13.78, 14.29, 19.26, 22.49
(2C), 27.12, 28.97 (2C), 30.76, 34.51, 39.86, 43.56, 59.59, 118.50,
129.29, 129.38, 130.88, 133.28, 135.04, 136.51, 138.87, 139.55,
152.66, 167.17; HRMS (EI) m/z: Calcd C25H38O2 (M+) 370.2870.
Found: 370.2871.
C
25H38O2 (M+) 370.2870. Found: 370.2872.
4.7.6. Ethyl (2E,4E,6Z,8E)-3,7-dimethyl-9-[6,6-dimethyl-2-(2-
methylpropyl)cyclohexen-1-yl]-2,4,6,8-Nonatetraenoate and
Ethyl (2Z,4E,6Z,8E)-3,7-Dimethyl-9-[6,6-dimethyl-2-(2-
methylpropyl)cyclohexen-1-yl]-2,4,6,8-nonatetraenoate (120b)
This was prepared from the aldehyde (100b, 230 mg,
0.89 mmol), phosphonate (470.3 mg, 1.78 mmol), DMPU
(776.7 mg, 3.56 mmol), and n-BuLi (1.19 mL, 1.78 mmol) in 93%
yield (307 mg, 9Z: 9Z,13Z = 12:1) as a pale yellow oil.
4.7.3. Ethyl (2E,4E,6E,8E)-9-(2-benzyl-6,6-dimethylcyclohexen-
1-yl)-3,-dimethyl-2,4,6,8-nonatetraenoate and Ethyl
(2Z,4E,6E,8E)-9-(2-benzyl-6,6-dimethylcyclohexen-1-yl)-3,7-
dimethyl-2,4,6,8-nonatetraenoate (12c)
This was prepared from the aldehyde (10c, 130 mg, 0.44 mmol),
phosphonate (232 mg, 0.88 mmol), DMPU (384.0 mg, 1.76 mmol),
and n-BuLi (0.59 ml, 0.88 mmol) in 95% yield (170 mg, all-
E:13Z = 41:1) as a pale yellow oil.
9Z-Isomer: UV–vis kmax nm: 348.4; IR m
max cmꢀ1: 1592, 1698; 1H
NMR (300 MHz) d: 0.82 (6H, d, J = 6.6 Hz), 1.03 (6H, s), 1.26 (3H, t,
J = 7.1 Hz), 1.43–1.52 (2H, m), 1.53–1.68 (2H, m), 1.71–1.86 (1H,
m), 1.97 (3H, s), 1.98 (2H, d, J = 8.4 Hz), 2.02 (2H, t, J = 7.5 Hz),
2.31 (3H, s), 4.15 (2H, q, J = 7.1 Hz), 5.74 (1H, s), 6.03 (1H, d,
J = 11.4 Hz), 6.20 (1H, d, J = 15.0 Hz), 6.23 (1H, d, J = 16.0 Hz), 6.59
(1H, d, J = 16.0 Hz), 7.06 (1H, dd, J = 11.4,15.0 Hz); 13C NMR
(75 MHz) d: 13.76, 14.28, 19.24, 20.84, 22.52 (2C), 27.04, 29.05
(2C), 30.64, 34.45, 39.75, 43.60, 59.57, 118.50, 127.77, 128.83,
129.76, 130.84, 13.22, 134.30, 138.30, 139.11, 152.69, 167.14;
HRMS (EI) m/z: Calcd C25H38O2 (M+) 370.2870. Found: 370.2876.
all-E-Isomer: UV–vis kmax nm: 350.8; IR mmax cmꢀ1: 1608, 1699,
3020; 1H NMR (500 MHz) d: 1.07 (6H, s), 1.26 (3H, t, J = 7.3 Hz),
1.471.50 (2H, m), 1.551.60 (2H, m), 1.92 (2H, t, J = 6.3 Hz), 1.95
(3H, s), 2.31 (3H, s), 3.45 (2H, s), 4.15 (2H, q, J = 7.3 Hz), 5.73 (1H,
s), 6.02 (1H, d, J = 11.5 Hz), 6.17 (1H, d, J = 16.0 Hz), 6.23 (1H, d,
J = 15.0 Hz), 6.31 (1H, d, J = 16.0 Hz), 6.93 (1H, dd,
J = 11.5,15.0 Hz), 7.10 (2H, d, J = 7.4 Hz), 7.16 (1H, t, J = 7.4 Hz),
7.25 (2H, t, J = 7.4 Hz); 13C NMR (125 MHz) d: 12.91, 13.80, 14.34,
19.19, 29.03 (2C), 30.41, 34.67, 39.56, 40.63, 59.64, 118.71,
125.62, 128.24 (2C), 128.41 (2C), 128.46, 129.94, 130.72, 131.78,
135.40, 136.82, 139.13, 140.21, 141.27, 152.59, 167.17; HRMS
(EI) m/z: Calcd C28H36O2 (M+) 404.2713. Found: 404.2721.
4.7.7. Ethyl (2E,4E,6Z,8E)-9-(2-Benzyl-6,6-dimethylcyclohexen-
1-yl)-3,7-dimethyl-2,4,6,8-nonatetraenoate and Ethyl
(2Z,4E,6Z,8E)-9-(2-Benzyl-6,6-dimethylcyclohexen-1-yl)-3,7-
dimethyl-2,4,6,8-nonatetraenoate (120c)
This was prepared from the aldehyde (10’c, 218 mg,
0.74 mmol), phosphonate (391.1 mg, 1.48 mmol), DMPU
(645.8 mg, 2.96 mmol), and n-BuLi (0.99 mL, 1.48 mmol) in 89%
yield (265 mg, 9Z: 9Z,13Z = 26:1) as a pale yellow oil.
4.7.4. Ethyl (2E,4E,6E,8E)-3,7-dimethyl-9-[6,6-dimethyl-2-(2-
naphthylmethyl)cyclohexen-1-yl]-2,4,6,8-nonatetraenoate and
Ethyl (2Z,4E,6E,8E)-3,7-dimethyl-9-[6,6-dimethyl-2-(2-
naphthylmethyl)cyclohexen-1-yl]-2,4,6,8-nonatetraenoate (12d)
This was prepared from the aldehyde (10d, 650 mg, 1.89 mmol) ,
phosphonate (998 mg, 3.78 mmol), DMPU (1.65 g, 7.56 mmol), and
n-BuLi (2.52 mL, 3.78 mmol) in 89% yield (760 mg, all-
E:13Z = 50>:1) as a pale yellow solid.
9Z-Isomer: UV–vis kmax nm: 350.8; IR mmax cmꢀ1: 1494, 1591,
1702, 3026; 1H NMR (300 MHz) d: 1.12 6H, s), 1.28 (3H, t,
J = 7.1 Hz), 1.50–1.57 (2H, m), 1.59–1.68 (2H, m), 1.97 (3H, s),
1.99 (2H, t, J = 5.5 Hz), 2.04 (3H, s), 3.52 (2H, s), 4.15 (2H, q,
J = 7.1 Hz), 5.68 (1H, s), 5.97 (1H, d, J = 11.5 Hz), 6.11 (1H, d,
J = 15.2 Hz), 6.32 (1H, d, J = 16.0 Hz), 6.65 (1H, dd,
J = 11.5,15.2 Hz), 6.72 (1H, d, J = 16.0 Hz), 7.127.33 (5H, m); 13C
NMR (75 MHz) d: 13.82, 14.31, 19.17, 20.75, 29.18 (2C), 30.61,
34.56, 39.42, 40.81, 59.54, 118.39, 125.87, 128.16 (2C), 128.24
(2C), 128.41, 128.48, 129.47, 129.52, 131.46, 134.65, 137.76,
140.66, 141.16, 152.85, 167.13; HRMS (EI) m/z: Calcd C28H36O2
(M+) 404.2713. Found: 404.2710.
all-E-Isomer: UV–vis kmax nm: 224.0, 353.0; IR m
max cmꢀ1: 1508,
1608, 1699, 3011; 1H NMR (300 MHz) d: 1.11 (6H, s), 1.28 (3H, t,
J = 7.0 Hz), 1.48–1.56 (2H, m), 1.57–1.63 (2H, m), 1.952.00 (2H,
m), 1.98 (3H, s), 2.32 (3H, s), 3.63 (2H, s), 4.16 (2H, q, J = 7.0 Hz),
5.73 (1H, s), 6.03 (1H, d, J = 11.5 Hz), 6.22 (1H, d, J = 15.1 Hz),
6.23 (1H, d, J = 16.2 Hz), 6.37 (1H, d, J = 16.2 Hz), 6.94 (1H, dd,
J = 11.5, 15.1 Hz), 7.27 (1H, d, J = 8.4 Hz), 7.39–7.47 (2H, m), 7.54
(1H, s), 7.74–7.82 (3H, m); 13C NMR (75 MHz) d: 12.88, 13.75,
14.29, 19.17, 29.02 (2C), 30.78, 34.69, 39.51, 40.81, 59.59, 118.69,
125.01, 125.77, 126.50, 127.22, 127.42 (2C), 127.54, 127.72,
128.39, 129.97, 130.64, 131.66, 131.94, 135.42, 136.94, 138.84,
139.03, 140.41, 152.51, 167.11; HRMS (EI) m/z: Calcd C32H38O2
(M+) 454.2870. Found: 454.2878.
4.7.8. Ethyl (2E,4E,6Z,8E)-3,7-dimethyl-9-[6,6-dimethyl-2-(2-
naphthylmethyl)cyclohexen-1-yl]-2,4,6,8-nonatetraenoate and
Ethyl (2Z,4E,6Z,8E)-3,7-dimethyl-9-[6,6-dimethyl-2-(2-
naphthylmethyl)cyclohexen-1-yl]-2,4,6,8-nonatetraenoate
(120d)
This was prepared from the aldehyde (100d, 650 mg,
1.89 mmol), phosphonate (998.8 mg, 3.78 mmol), DMPU (1.65 g,
7.56 mmol), and n-BuLi (2.52 mL, 3.78 mmol) in 89% yield
(762 mg, 9Z: 9Z,13Z = 50>:1) as a pale yellow solid.
4.7.5. Ethyl (2E,4E,6Z,8E)-9-(2-butyl-6,6-dimethylcyclohexen-1-
yl)-3,7-dimethyl-2,4,6,8-nonatetraenoateand ethyl
(2Z,4E,6Z,8E)-9-(2-butyl-6,6-dimethylcyclohexen-1-yl)-3,7-
dimethyl-2,4,6,8-nonatetraenoate (120a)
9Z-Isomer: UV–vis kmax nm: 223.6, 273.6, 350.2; IR mmax cmꢀ1
:
This was prepared from the aldehyde (10’a, 276 mg,
1.06 mmol), phosphonate (560.2 mg, 2.12 mmol), DMPU
(925.1 mg, 4.24 mmol), and n-BuLi (1.41 mL, 2.12 mmol) in 92%
yield (359 mg, 9Z: 9Z,13Z = 13:1) as a pale yellow oil.
1508, 1591, 1699, 3009; 1H NMR (300 MHz) d: 1.15 (6H, s), 1.25
(3H, t, J = 7.1 Hz), 1.53–1.59 (2H, m, 2-CH2), 1.59 (3H, s), 1.62–
1.69 (2H, m), 1.97 (3H, s), 2.04 (2H, t, J = 4.5 Hz), 3.68 (2H, s),
4.12 (2H, q, J = 7.1 Hz), 5.60 (1H, s), 5.94 (1H, d, J = 11.4 Hz), 6.04
(1H, d, J = 15.0 Hz), 6.36 (1H, d, J = 15.9 Hz), 6.53 (1H, dd, J = 11.4,
15.0 Hz), 6.78 (1H, d, J = 15.9 Hz), 7.31 (1H, d, J = 8.6 Hz), 7.37–
9Z-Isomer: UV–vis kmax nm: 349.4; IR
NMR (300 MHz) d: 0.85 (3H, t, J = 6.9 Hz), 1.01 (6H, s), 1.26 (3H, t,
m
max cmꢀ1: 1591, 1699; 1H

A. Wada et al. / Bioorg. Med. Chem. 16 (2008) 8471–8481
8479
7.47 (2H, m), 7.57 (1H, s), 7.73–7.81 (3H, m); 13C NMR (75 MHz) d:
12.88, 14.26, 19.18, 20.75, 29.22 (2C), 30.69, 34.62, 39.43, 41.02,
59.50, 118.45, 125.24, 125.95, 126.09, 127.13, 127.36, 127.62,
127.95, 128.24, 128.56, 129.30, 129.45, 131.34, 132.05, 133.61,
134.75, 137.64, 138.76, 140.90, 152.78, 167.02; HRMS (EI) m/z:
Calcd C32H38O2 (M+) 454.2870. Found: 4542871.
141.24, 155.19, 170.49; HRMS (EI) m/z: Calcd C26H32O2 (M+)
376.2400. Found: 376.2407.
4.8.4. (2E,4E,6E,8E)-3,7-Dimethyl-9-[6,6-dimethyl-2-(2-
naphthylmethyl)cyclohexen-1-yl]-2,4,6,8-nonatetraenoic acid
(1e)
This was prepared from the ester (12d, 390 mg, 0.86 mmol) in
79% yield (299 mg). mp: 169–171 °C (ether–hexane); UV–vis kmax
4.8. General procedure for the preparation of retinoic acid
analogs (1b–e and 2b–e)
nm (e
): 223.8, 340.0 (44300); IR mmax cmꢀ1: 1583, 1694, 2600–
3500; 1H NMR (500 MHz) d: 1.10 (6H, s), 1.49–1.52 (2H, m),
1.57–1.60 (2H, m), 1.94–1.99 (2H, m), 1.97 (3H, s), 2.31 (3H, s),
3.61 (2H, s), 5.74 (1H, s), 6.02 (1H, d, J = 11.5 Hz), 6.22 (1H, d,
J = 15.8 Hz), 6.23 (1H, d, J = 14.8 Hz), 6.37 (1H, d, J = 14.8 Hz), 6.97
(1H, dd, J = 11.5, 15.8 Hz), 7.25 (1H, d, J = 8.8 Hz), 7.38–7.45 (2H,
m), 7.52 (1H, s), 7.72–7.80 (3H, m), COOH signal was not observed;
13C NMR (125 MHz) d: 12.97, 13.98, 19.21, 29.08 (2C), 30.55, 34.75,
39.55, 40.86, 117.25, 125.07, 125.82, 126.53, 127.26, 127.47,
127.58, 127.79, 128.82, 129.91, 131.60, 131.82, 131.98, 133.58,
135.13, 136.91, 138.85, 139.79, 140.43, 155.11, 170.32; HRMS
(EI) m/z: Calcd C30H34O2 (M+) 426.2557. Found: 426.2557.
A mixture of the ester (12 or 120, ca.200 mg, 0.5 mmol) and 10%
KOH solution (3 mL) in methanol (6 mL) was heated at 50 °C for
2 h. After cooling, the reaction mixture was made acidic with 5%
HCl, and the organics were extracted with ethyl acetate followed
by standard workup. The residue was purified by CC (ethyl acetate:
hexane = 3:1) and recrystallization afforded the stereoisomeric
pure acid (1 or 2) as a yellow solid.
4.8.1. (2E,4E,6E,8E)-9-(2-Butyl-6,6-dimethylcyclohexen-1-yl)-
3,7-dimethyl-2,4,6,8-nonatetraenoic acid (1b)
This was prepared from the ester (12a, 246 mg, 0.66 mmol) in
82% yield (193 mg). mp: 83–86 °C (ether–hexane); UV–vis kmax
4.8.5. (2E,4E,6Z,8E)-9-(2-Butyl-6,6-dimethylcyclohexen-1-yl)-
3,7-dimethyl-2,4,6,8-nonatetraenoic acid (2b)
nm (e
): 200.6, 339.4 (36300); IR mmax cmꢀ1: 1583, 1689, 2600-
3500; 1H NMR (500 MHz) d: 0.86 (3H, t, J = 7.3 Hz), 1.01 (6H, s),
1.221.29 (2H, m), 1.301.37 (2H, m), 1.43–1.45 (2H, m), 1.56–1.62
(2H, m), 1.99 (3H, s), 2.01 (2H, t, J = 5.5 Hz), 2.04 (2H, t,
J = 7.8 Hz), 2.35 (3H, s), 5.78 (1H, s), 6.11 (1H, d, J = 16.3 Hz), 6.13
(1H, d, J = 16.0 Hz), 6.28 (1H, d, J = 16.3 Hz), 6.30 (1H, d,
J = 13.3 Hz), 7.03 (1H, dd, J = 13.3, 16.0 Hz), COOH signal was not
observed; 13C NMR (125 MHz) d: 12.96, 14.02, 14.06, 19.31,
22.75, 29.03 (2C), 30.53, 31.18, 34.35, 34.62, 39.85, 116.99,
129.29, 129.35, 131.89, 134.70, 134.75, 136.24, 137.76, 140.34,
155.33, 170.30; HRMS (EI) m/z: Calcd C23H34O2 (M+) 342.2557.
Found: 342.2555.
This was prepared from the ester (120a, 300 mg, 0.81 mmol) in
70% yield (202 mg). mp: 124–126 °C (ether–hexane); UV–vis kmax
nm (e
): 335.2 (35800); IR mmax cmꢀ1: 1589, 1682, 2600–3550; 1H
NMR (500 MHz) d: 0.86 (3H, t, J = 7.4 Hz), 1.02 (6H, s), 1.27 (2H,
sext, J = 7.4 Hz), 1.38 (2H, tt, J = 7.4, 8.0 Hz), 1.451.48 (2H, m),
1.58–1.64 (2H, m), 1.98 (3H, s), 2.03 (2H, t, J = 6.0 Hz), 2.06 (2H,
t, J = 8.0 Hz), 2.32 (3H, s), 5.78 (1H, s), 6.04 (1H, d, J = 11.3 Hz),
6.23 (1H, d, J = 15.3 Hz), 6.27 (1H, d, J = 16.0 Hz), 6.62 (1H, d,
J = 16.0 Hz), 7.11 (1H, dd, J = 11.3, 15.3 Hz), COOH signal was not
observed; 13C NMR (125 MHz) d: 14.20, 14.32, 19.52, 21.15,
23.08, 29.34 (2C), 30.71, 31.81, 34.53, 35.09, 39.90, 117.43,
128.00, 128.63, 130.84, 130.96, 134.34, 134.85, 138.29, 139.30,
155.48, 170.99; HRMS (EI) m/z: Calcd C23H34O2 (M+) 342.2557.
Found: 342.2552. Anal. Calcd for C23H34O21/2H2O: C, 78.59; H,
10.04. Found: C, 78.96; H, 9.81.
4.8.2. (2E,4E,6E,8E)-3,7-Dimethyl-9-[6,6-dimethyl-2-(2-
methylpropyl)cyclohexen-1-yl]-2,4,6,8-nonatetraenoic acid (1c)
This was prepared from the ester (12b, 265 mg, 0.72 mmol) in
75% yield (193 mg). mp: 105–108 °C (ether–hexane); UV–vis kmax
nm (
e
): 337.4 (44800); IR mmax cmꢀ1: 1582, 1681, 2600–3500; 1H
4.8.6. (2E,4E,6Z,8E)-3,7-Dimethyl-9-[6,6-dimethyl-2-(2-
NMR (500 MHz) d: 0.80 (6 H, d, J = 6.5 Hz), 1.01 (6H, s), 1.44–1.47
(2H, m), 1.56–1.62 (2H, m), 1.71–1.77 (1H, m), 1.95 (2H, d,
J = 7.5 Hz), 1.98 (2H, t, J = 3.7 Hz), 1.99 (3H, s), 2.35 (3H, s), 5.78
(1H, s), 6.09 (1H, d, J = 15.3 Hz), 6.13 (1H, d, J = 11.5 Hz), 6.27
(1H, d, J = 15.3 Hz), 6.30 (1H, d, J = 15.0 Hz), 7.03 (1H, dd, J = 11.5,
15.0 Hz), COOH signal was not observed; 13C NMR (125 MHz) d:
12.97, 14.03, 19.30, 22.55 (2C), 27.19, 29.04 (2C), 30.83, 34.57,
39.94, 43.62, 117.02, 129.22, 129.85, 131.90, 133.51, 134.74,
136.49, 138.88, 140.36, 155.37, 170.56; HRMS (EI) m/z: Calcd
methylpropyl)cyclohexen-1-yl]-2,4,6,8-nonatetraenoic acid (2c)
This was prepared from the ester (120b, 277 mg, 0.75 mmol) in
75% yield (200 mg). mp: 135–138 °C (ether–hexane); UV–vis kmax
nm (e
): 334.8 (35800); IR mmax cmꢀ1: 1589, 1682, 2600–3600; 1H
NMR (500 MHz) d: 0.83 (6H, d, J = 6.5 Hz), 1.03 (6H, s), 1.46–1.49
(2H, m), 1.59–1.64 (2H, m), 1.73–1.81 (1H, m), 1.98 (3H, s), 1.98
(2H, t, J = 3.5 Hz), 2.01 (2H, d, J = 4.0 Hz), 2.32 (3H, s), 5.78 (1H,
s), 6.04 (1H, d, J = 11.3 Hz), 6.23 (1H, d, J = 15.0 Hz), 6.26 (1H, d,
J = 15.8 Hz), 6.59 (1H, d, J = 15.8 Hz), 7.11 (1H, dd, J = 11.3,
15.0 Hz), COOH signal was not observed; 13C NMR (125 MHz) d:
14.03, 19.29, 20.94, 22.59 (2C), 27.11, 29.10 (2C), 30.69, 34.52,
39.79, 43.66, 117.20, 127.71, 128.80, 130.72, 131.24, 133.37,
134.06, 139.12, 139.15, 155.33, 170.87; HRMS (EI) m/z: Calcd
C
C
23H34O2 (M+) 342.2557. Found: 342.2557. Anal. Calcd for
23H34O2: C, 80.65; H, 10.01. Found: C, 80.37; H, 9.67.
4.8.3. (2E,4E,6E,8E)-9-(2-Benzyl-6,6-dimethylcyclohexen-1-yl)-
3,7-dimethyl-2,4,6,8-nona- tetraenoic acid (1d)
C
C
23H34O2 (M+) 342.2557. Found: 342.2544. Anal. Calcd for
23H34O2: C, 80.65; H, 10.01. Found: C, 80.27; H, 9.71.
This was prepared from the ester (12c, 157 mg, 0.39 mmol) in
69% yield (100 mg). mp: 147–149 °C (ether–hexane); UV–vis kmax
nm (
e
): 340.2 (38900); IR mmax cmꢀ1: 1582, 1682, 2600–3500; 1H
4.8.7. (2E,4E,6Z,8E)-9-(2-Benzyl-6,6-dimethylcyclohexen-1-yl)-
3,7-dimethyl-2,4,6,8-nonatetraenoic acid (2d)
NMR (500 MHz) d: 1.07 (6H, s), 1.46–1.50 (2H, m), 1.55–1.60
(2H, m), 1.92 (2H, t, J = 5.3 Hz), 1.96 (3H, s), 2.32 (3H, s), 3.45
(2H, s), 5.76 (1H, s), 6.03 (1H, d, J = 11.0 Hz), 6.18 (1H, d,
J = 16.0 Hz), 6.25 (1H, d, J = 15.0 Hz), 6.33 (1H, d, J = 16.0 Hz), 6.98
(1H, dd, J = 11.0, 15.0 Hz), 7.10 (2H, d, J = 7.2 Hz), 7.16 (1H, t,
J = 7.2 Hz), 7.25 (2H, t, J = 7.2 Hz), COOH signal was not observed;
13C NMR (125 MHz) d: 12.69, 14.00, 19.19, 29.04 (2 C), 30.44,
34.68, 39.56, 40.64, 117.24, 125.65, 128.26 (2C), 128.41(2C),
128.86, 129.83, 131.67, 131.97, 135.07, 136.75, 139.87, 140.18,
This was prepared from the ester (120c, 170 mg, 0.42 mmol) in
86% yield (136 mg). mp: 146–148 °C (ether-hexane); UV–vis kmax
nm (e
): 266.0, 377.6 (37200); IR mmax cmꢀ1: 1587, 1678, 2600–
3550; 1H NMR (500 MHz) d: 1.10 (6H, s), 1.51–1.55 (2H, m),
1.59–1.65 (2H, m), 1.96 (3H, s), 1.98 (2H, t, J = 5.5 Hz), 2.03 (3H,
s), 3.51 (2H, s), 5.69 (1H, s), 5.97 (1H, d, J = 11.5 Hz), 6.12 (1H, d,
J = 14.5 Hz), 6.32 (1H, d, J = 15.8 Hz), 6.68 (1H, dd, J = 11.5,14.5
Hz), 6.71 (1H, d, J = 15.8 Hz), 7.12–7.19 (3H, m), 7.23–7.29 (2H,

8480
A. Wada et al. / Bioorg. Med. Chem. 16 (2008) 8471–8481
m), COOH signal was not observed; 13C NMR (125 MHz) d: 14.06,
19.18, 20.82, 29.22 (2C), 30.67, 34.60, 39.44, 40.84, 117.11,
125.91, 128.13, 128.20 (2C), 128.39, 128.45 (2C), 129.86, 130.45,
131.59, 134.40, 138.56, 140.69, 141.20, 155.43, 170.83; HRMS
(EI) m/z: Calcd C26H32O2 (M+) 376.2400. Found: 376.2396.
albumin (BSA) and 1% sodium azide and incubated with 10 mL hu-
man monoclonal FITC conjugated CD 11 b antibody and CD14 anti-
body (Sigma) for 30 min at room temperature. The cells were
washed once with diluent solution and then fixed in 300 mL of
PBS(ꢀ) containing 2% paraformaldehyde. Fluorescence was de-
tected on a Becton Dickinson FACScanTM at excitation wavelength
of 490 nm and emission wavelength of 520 nm. Results were re-
corded as the mean fluorescence index, which is the product of
the% fluorescence and the mean fluorescence intensity, with 104
cells being counted per treatment.
4.8.8. (2E,4E,6Z,8E)-3,7-Dimethyl-9-[6,6-dimethyl-2-(2-
naphthylmethyl)cyclohexen-1-yl]-2,4,6,8- nonatetraenoic acid
(2e)
This was prepared from the ester (120d, 1.0 g, 2.20 mmol) in
quantitative yield (965 mg). mp: 162–164 °C (ether-hexane); UV–
vis kmax nm (
e
): 223.6, 268.6, 338.0 (35700); IR mmax cmꢀ1: 1589,
4.12. DNA fragmentation assay
1679, 2600–3500; 1H NMR (500 MHz) d: 1.14 (6H, s, gem -Me),
1.54-1.57 (2H, m), 1.62 (3H, s), 1.62-1.67 (2H, m), 1.97 (3H, s),
2.03 (2H, t, J = 5.5 Hz,), 3.66 (2H, s), 5.62 (1H, s), 5.95 (1H, d,
J = 6.8 Hz), 6.06 (1H, d, J = 8.9 Hz, 12-CH), 6.37 (1H, d, J = 9.6 Hz),
6.57 (1H, dd, J = 6.8, 8.9 Hz), 6.76 (1H, d, J = 9.6 Hz), 7.29 (1H, d,
J = 8.5 Hz), 7.39–7.45 (2H, m), 7.55 (1H, s), 7.74–7.80 (3H, m),
COOH signal was not observed; 13C NMR (125 MHz) d: 13.15,
19.22, 20.85, 29.25 (2C), 30.74, 34.68, 39.45, 41.07, 117.11,
125.30, 126.02, 126.16, 127.16, 127.40, 127.67, 127.99, 128.27,
128.50, 129.87, 130.23, 131.51, 132.08, 133.64, 134.51, 138.42,
138.79, 140.91, 155.32, 170.46; HRMS (EI) m/z: Calcd C30H34O2
(M+) 426.2557. Found: 426.2562.
For assessment of quantitative DNA fragmentation (laddering),
DNA was isolated from cells of each culture, and was examined
for fragmentation. DNA was subjected to electrophoresis in a 2%
agarose gel that was stained with ethidium bromide for observa-
tion under ultraviolet light.
4.13. Transfection and luciferase activity assay
Human osteosarcoma MG-63 cells, which are positive for RXR
gene expression, were maintained in Dulbecco’s modification Eagle
medium (Gibco BRL) supplemented with 1% penicillin, 1% strepto-
mycin, and 10% dextran-coated charcoal-treated FCS (Gibco BRL).
The day before transfection, cells were seeded on six-well culture
plates at a density of 2 ꢁ 105 cells per well so that they were con-
fluent the day of transfection. The retinoid-responsive luciferase
reporter constructs human RARb-RARE3-SV40-Luc and rat
CRBPII-RXRE-SV40- Luc were generated by cloning three copies
of the retinoic acid response element (RARE) from the RARbpro-
moter (59/33: GGGTAAAGTTCACCGAAAGTTCACTCG) or the RXRE
from the rat CRBPII promoter (639/605: GCTGTCACAGGTCA-
CAGGTCACAGGTCACAGTTCA) in the pGL3 vector.8,9). The pRL-
CMV vector was an internal control using the Tfx-50 reagent. After
4.9. Biological assay
4.9.1. HL-60. cells and synchronization of cell cycle at S phase
by excess amounts of thymidine
HL-60 cells were maintained in continuous culture in RPMI-
1640 medium (Nissui Seiyaku Co. Ltd, Tokyo, Japan) supplemented
with 10% dextran-coated charcoal-treated fetal calf serum (FCS)
(Gibco BRL, Grand Island, NY, USA), and kanamycin (0.06 mg/ml)
(Sigma, St. Louis, MO, USA) at 37 °C in a humidified atmosphere
of 5% CO2 in air. The doubling time of HL-60 cells was approxi-
mately 24 h. For synchronization at S phase, cells (4 ꢁ 105 cells/
ml) were cultured in 30 ml of RPMI-1640 medium supplemented
with 2.5 mM thymidine. After washing with Ca, Mg-free phos-
phate-buffered saline (PBS) [PBS(ꢀ)] twice, the synchronization
of cell cycle was repeated in the same manner, and the cells thus
obtained were used in the biological assays.
transfection, the cells were incubated with retinoids (10ꢀ6
lM) for
2 days. Luciferase activity of the cell lysates was measured with a
luciferase assay system (Toyo Ink Co. Ltd), according to the manu-
factures’ instructions. Transactivation determined from the lucifer-
ase activity was standardized with the luciferase activity of the
same cells measured with the Sea Pansy luciferase assay system
as a control (Toyo Ink Co. Ltd) Each set of experiments was re-
peated at least three times, and the results are presented in terms
of fold induction as means SE.
4.10. Analysis of cell cycle distribution by flow cytometry
Cells (105 cells/well) were placed in 24-well tissue culture
plates and cultured for 3 days with retinoids (10ꢀ10–10ꢀ6 M) in
RPMI-1640 medium at 37 °C in a humidified atmosphere of 5%
CO2 in air. To reduce the effects of contact inhibition, control cells
were adjusted to 60–70% confluency at the time of FACS analysis.
Each group of cells was collected in PBS(ꢀ). Then, the cells were
resuspended in PBS(ꢀ) containing 0.2% Triton-X and 1 mg/mL
RNase, and incubated at 37 °C for 1 h. Cells were washed with
PBS(ꢀ) and incubated with 0.5 mL of DNA-staining solution con-
taining propidium iodide (50 mg/mL) at 4 °C for 20 min. The cells
were analyzed with a flow cytometer euipped with an argon laser
(488 nm, Becton Dickinson FACScanTM) and cell cycle distribution
was analyzed by ModiFiT LT (Verity).
4.14. Statistical analysis
Statistical significances were determined using Dunnett’s test
and expressed as means SE. The data were compared to EtOH-
treated control cells, and levels of significance were determined
as, ***p < 0.001, **p < 0.01 and p < 0.05.
*
Acknowledgments
This work was supported in part by a grant of the second pro-
ject for Advanced Research and Technology by Kobe Pharmaceuti-
cal University, a Grant of Hoh-ansha Foundation, and Grant-in-Aid
for Scientific Research (C) from the Ministry of Education, Culture,
Sports, Science and Technology of Japan.
4.11. Cell surface antigen expression analysis
Cells (105 cells/well) were placed in 24-well tissue culture
plates, and cultured for 3 days in RPMI-1640 medium with reti-
noids (10-10-10-6 M) under the same conditions as described in
the flow cytometry. Each group of cells was then collected and
washed with PBS(-) once. Then, the cells (2 ꢁ 105 cells) were resus-
pended in 100 mL diluent solution containing 1% bovine serum
References and notes
1. Retinoids and related compounds. Part 30. See Part 29: Wada, A.; Wang, F.; Ito,
M. Chem. Pharm. Bull. 2008, 56, 112.
2. Vangelsdorf, D. J.; Umesono, K.; Evans, R. M. The Retinoids. In Sporn, M. B.,
Roberts, A. B., Goodman, D. S., Eds., second ed.; Raven Press: New York, 1994;
pp 319–350.

A. Wada et al. / Bioorg. Med. Chem. 16 (2008) 8471–8481
8481
3. (a) Heyman, R. A.; Vangelsdorf, D. J.; Dyck, J. A.; Stein, R. B.; Eichele, G.; Evans,
R. M.; Thaller, C. Cell 1992, 68, 397; (b) Hong, W. K.; Sporn, M. B. Science 1997,
278, 107.
7. (a) Wada, A.; Fukunaga, K.; Ito, M.; Mizuguchi, Y.; Nakagawa, K.; Okano, T.
Bioorg. Med. Chem. 2004, 12, 3931; (b) Wada, A.; Irki, Y.; Nakamura, S.; Ito, M.
Synthesis 2005, 1581.
4. For recent selected examples, see: (a) Sakaki, J.; Konishi, K.; Kishida, M.; Gunji,
H.; Kanazawa, T.; Uchiyama, H.; Fukuya, H.; Mitani, H.; Kimura, M. Bioorg. Med.
Chem. Lett. 2007, 17, 4808; (b) Sun, W.; Desai, S.; Piao, H.; Carroll, P.; Canney, D.
Heterocycles 2007, 71, 557; (c) Walker, J. R.; Alshafie, G.; Nieves, N.; Ahrens, J.;
Clagett-Dame, M.; Abou-Issa, H.; Curley, R. W. Bioorg. Med. Chem. 2006, 14,
3038; (d) Simoni, D.; Giannini, G.; Roberti, M.; Randanin, R.; Baruchello, R.;
Rossi, M.; Glisoria, G.; Invidiata, F. P.; Aiello, S.; Marino, S.; Cavallini, S.;
Siniscalchi, A.; Gebbia, N.; Crosta, L.; Grimaudo, S.; Abbedesssa, V.; Cristina, A.
D.; Tolemo, M. J. Med. Chem. 2005, 48, 4293; (e) Kagechika, H.; Shudo, K. J. Med.
Chem. 2005, 48, 5876; (f) Dawson, M. I. Curr. Med. Chem.-Anti-Cancer Agents
2004, 14, 199.
5. (a) Wada, A.; Hiraishi, S.; Ito, M. Chem. Pharm. Bull. 1994, 42, 757; (b) Wada, A.;
Tanaka, Y.; Fujioka, N.; Ito, M. Bioorg. Med. Chem. Lett. 1996, 6, 2049; (c) Wada,
A.; Hiraishi, S.; Takamura, N.; Date, T.; Aoe, K.; Ito, M. J. Org. Chem. 1997, 62,
4343; (d) Wada, A.; Fujioka, N.; Tanaka, Y.; Ito, M. J. Org. Chem. 2000, 65, 2438.
6. (a) Wada, A.; Nomoto, Y.; Tano, K.; Yamashita, E.; Ito, M. Chem. Pharm. Bull.
2000, 48, 1391; (b) Wada, A.; Gobindarajulu, B.; Shimomoto, S.; Ito, M. Synlett
2001, 1759; (c) Wada, A.; Fukunaga, K.; Ito, M. Synlett 2001, 800; (d) Wada, A.;
Mizuguchi, Y.; Shinmen, M.; Ito, M.; Nakagawa, K.; Okano, T. Lett. Drug Des.
Discov. 2006, 3, 118.
8. (a) Wada, A.; Ieki, Y.; Ito, M. Synlett 2004, 1061; (b) Ruttländer, M.; Knochel, P. J.
Org. Chem. 1998, 63, 203.
9. Tsuda, Y.; Sakai, Y. Synthesis 1981, 119.
10. (a) Narasakam, K.; Kusuma, H.; Hayashi, Y. Chem. Lett. 1991, 1413; (b) Pauling,
H.; Andrews, D. A.; Hindly, N. C. Helv. Chim. Acta 1976, 53, 1233; (c) Erman, M.
B.; Aulchenko, I. S.; Kheifits, L. A.; Dulova, V. G.; Novikov, J. N.; Voypin, M. E.
Tetrahedron Lett. 1976, 2981; (d) Chabardes, P. Tetrahedron Lett. 1988, 29, 6253.
11. Yamano, Y.; Todo, C.; Ito, M. J. Chem. Soc. Perkin Trans. I 1995, 1895.
12. Kagechika, H.; Kawachi, E.; Hashimoto, Y.; Himi, T.; Shudo, K. J. Med. Chem.
1988, 31, 2182.
13. (a) Petkiovich, M.; Brand, N. J.; Krust, A.; Chambon, P. Nature 1987, 330, 624; (b)
Giguere, V.; Ong, E. S.; Segui, P.; Evans, R. M. Nature 1987, 330, 624; (c) Krust,
A.; Kastner, P.; Petkiovich, M.; Zelent, A.; Chambon, P. Proc. Natl. Acad. U.S.A.
1989, 86, 5310.
14. (a) Heyman, R. A.; Mangelsdorf, D. J.; Dyck, J. A.; Stein, R. B.; Eichele, G.; Evans,
R. M.; Thaller, C. Cell 1992, 68, 397; (b) Levin, A. A.; Sturzenbecker, L. J.; Kazmer,
S.; Bosakowski, T.; Huselton, C.; Allenby, G.; Speck, J.; Kratzeisen, C.;
Rosenberger, M.; Lovey, A.; Grippo, J. F. Nature 1992, 355, 359.
15. Wada, A.; Sakai, H.; Kinumi, T.; Tsujimoto, K.; Yamauchi, M.; Ito, M. J. Org.
Chem. 1994, 59, 6922.