Tranylcypromine-Based LSD1 Inhibitors: Structure-Activity Relationships, Antiproliferative Effects in Leukemia, and Gene Target Modulation

Accepted Article

Title: Tranylcypromine-based LSD1 Inhibitors: Structure-Activity

Relationship, Antiproliferative Effect in Leukemias and Gene

Target Modulation

Authors: Antonello Mai, Rossella Fioravanti, Annalisa Romanelli,

Nicola Mautone, Elisabetta Di Bello, Annarita Rovere, Davide

Corinti, Clemens Zwergel, Sergio Valente, Dante Rotili,

Oronza A. Botrugno, Paola Dessanti, Stefania Vultaggio,

Paola Vianello, Anna Cappa, Claudia Binda, Andrea Mattevi,

Saverio Minucci, Ciro Mercurio, and Mario Varasi

This manuscript has been accepted after peer review and appears as an

Accepted Article online prior to editing, proofing, and formal publication

of the final Version of Record (VoR). This work is currently citable by

using the Digital Object Identifier (DOI) given below. The VoR will be

published online in Early View as soon as possible and may be different

to this Accepted Article as a result of editing. Readers should obtain

the VoR from the journal website shown below when it is published

to ensure accuracy of information. The authors are responsible for the

content of this Accepted Article.

To be cited as: ChemMedChem 10.1002/cmdc.201900730

Link to VoR: http://dx.doi.org/10.1002/cmdc.201900730

A Journal of

www.chemmedchem.org

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

Tranylcypromine-based LSD1 Inhibitors: Structure-Activity

Relationship, Antiproliferative Effect in Leukemias and Gene

Target Modulation

Rossella Fioravanti,^[a]+Annalisa Romanelli,^[a]+Nicola Mautone,^[a]Elisabetta Di Bello,^[a]Annarita

Rovere,^[a]Davide Corinti,^[a]Clemens Zwergel,^[a,b]Sergio Valente,*^[a]Dante Rotili,*^[a]Oronza A.

Botrugno,^[c,d]Paola Dessanti,^[c,e]Stefania Vultaggio,^[c]Paola Vianello,^[c]Anna Cappa,^[c,f]Claudia

Binda,^[g]Andrea Mattevi,^[g]Saverio Minucci,^[c,h]Ciro Mercurio,^[c,f]Mario Varasi,^[c,f]and Antonello Mai*^[a]

Dedicated to the memory of Prof. Maurizio Botta, outstanding scientist and unforgettable friend.

[a]

Dr. R. Fioravanti, Dr. A. Romanelli, Dr. N. Mautone, Dr. E. Di Bello, Dr. A. Rovere, Dr. D. Corinti, Dr. C. Zwergel, Dr. S. Valente, Dr. D. Rotili, Prof. A. Mai

Department of Drug Chemistry and Technologies

Sapienza University of Rome

P. le A. Moro 5, 00185 Rome, Italy

E-mail: sergio.valente@uniroma1.it , dante.rotili@uniroma1.it , antonello.mai@uniroma1.it

Dr. C. Zwergel

Department of Medicine of Precision

University of Studi della Campania Luigi Vanvitelli

Vico L. De Crecchio 7, 80138 Naples, Italy

Dr. O. A. Botrugno, Dr. P. Dessanti, Dr. S. Vultaggio, Dr. P. Vianello, Dr. A. Cappa, Prof. S. Minucci, Dr. C. Mercurio, Dr. M. Varasi

Department of Experimental Oncology

IEO, European Institute of Oncology IRCCS

via Adamello 16, 20139 Milan, Italy

[b]

[c]

[d]

[e]

[f]

Dr. O. A. Butrugno

IRCCS San Raffaele Scientific Institute, Milan, Italy

Dr. P. Dessanti

Oryzon Genomics S.A., Cornella de Llobregat, Barcelona, Spain

Dr. A. Cappa. Dr. C. Mercurio, Dr. M. Varasi

Experimental Therapeutics Program

IFOM-FIRC Institute of Molecular Oncology Foundation

via Adamello 16, 20139 Milan, Italy

[g]

[h]

Prof. C. Binda, Prof. A. Mattevi

Department of Biology and Biotechnology

University of Pavia

Via Ferrata 9, 27100 Pavia, Italy

Prof. S. Minucci

Department of Biosciences

University of Milan

Via Festa del Perdono 7, 20122 Milano, Italy

⁺These authors contributed equally

Supporting information for this article is given via a link at the end of the document.

Abstract: LSD1 is a lysine demethylase highly involved in initiation

and development of cancer. To design highly effective covalent

inhibitors, a strategy is to fill its large catalytic cleft by designing

tranylcypromine (TCP) analogs decorated with long, hindered

substituents. We prepared three series of TCP analogs, carrying

aroyl- and arylacetylamino (1a-h), Z-amino acylamino (2a-o), or

double-substituted benzamide (3a-n) residues at the C4 or C3

position of the phenyl ring. Further fragments obtained by chemical

manipulation applied on the TCP scaffold (compounds 4a-i) were

also prepared. When tested against LSD1, most of 1 and 3 exhibited

IC₅₀values in the low nanomolar range, with 1e and 3a,d,f,g being

also the most selective respect to monoamine oxidases. In MV4-11

AML and NB4 APL cells compounds 3 were the most potent,

displaying up to submicromolar cell growth inhibition against both

cell lines (3a) or against NB4 cells (3c). The most potent compounds

in cellular assays were also able to induce the expression of LSD1

target genes, such as GFI-1b, ITGAM, and KCTD12, as functional

read-out for LSD1 inhibition. Mouse and human intrinsic clearance

data highlighted the high metabolic stability of compounds 3a, 3d

and 3g. Further studies will be performed on the new compounds 3a

and 3c to assess their anticancer potential in different cancer

contexts.

Introduction

Epigenetic methylation of histone tails is regulated by the activity

of two families of enzymes: histone methyltransferases (HMTs),

that add methyl groups at either lysine or arginine residues

(lysine or protein arginine methyltransferases (KMTs or PRMTs),

respectively), and lysine demethylases (KDMs), that erase the

methyl marks from the ε-amino group of lysine residues using

either a flavin adenine dinucleotide (FAD)-dependent (KDM1A

and KDM1B) or a 2-oxoglutarate/Fe(II)-dependent (Jumonji-

1

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

containing enzymes, KDM2-7) mechanism.^[1]Lysine specific

demethylase 1 (LSD1 or KDM1A) removes the methyl group

from mono- and di-methylated lysine residues at the lysine 4 of

histone H3 (H3K4me1/2) and, in particular conditions, at

H3K9me1/2 (androgen-positive prostate cancer cells).^[2]The

H3K4me1/2 is an activation mark for transcription while the

H3K9me1/2 has a gene silencing role, thus LSD1 can act as

transcriptional repressor or activator depending on the substrate

used and the cellular context.^[3]LSD1 forms complexes with

other repressor proteins (CoREST),^[4]transcriptional silencers

(HDAC1/2), nuclear receptors, and other transcription factors to

epigenetically regulate the expression of genes involved in

various cellular events.^[5]LSD1 is an essential gene in

mammalian biology and is involved in many different cellular

events such as maintenance of pluripotency in embryonic stem

cells, embryonic development, hematopoiesis, neural stem cell

proliferation and neuronal development.^[6]Pathologically, LSD1

is implicated in tumorigenesis, metastasis, and poor prognosis of

cancer,^[7]and is overexpressed in several cancer cells, such as

breast cancer,^[8]neuroblastoma,^[9]and glioma^[10]cells.

regio/stereoisomers.^[13]Afterwards, to reduce the number of

chiral centers, we designed new analogues of 1a by inserting

two additional substituents at its benzamide portion (3a-n)

(Figure 2). Finally, we explored chemical variations of the TCP

motif to find new scaffolds for LSD1 inhibitor development (4a-h)

(Figure 2).

Several irreversible and reversible LSD1 inhibitors have

been developed so far and validated in various types of cancers

including leukemias, and some of them are in clinical trials

(tranylcypromine (TCP), IMG-7289, INCB059872, GSK2879552,

seclidemstat, and CC-90011) for the treatment of hematological

malignancies or solid tumors (Figure 1).^[11]

Figure 2. TCP-based LSD1 inhibitors described in this paper.

Here we report for all the derivatives 1-4 the LSD1 inhibitory

activities, the effects on cell proliferation in MV4-11 and NB4 cell

lines, two prototypes of acute myeloid leukemia (AML) and acute

promyelocytic leukemia (APL) cell lines, respectively. We further

report on the inhibitors’ ability to reactivate the expression of

genes related to silencing by LSD1, as functional read-out of

LSD1 inhibition in cells.

Results and Discussion

Figure 1. Structures of irreversible and reversible LSD1 inhibitors in clinical

trials for treatment of cancer.

Design, synthesis and enzyme inhibition data

The chemical syntheses of 1a-h and 2a,c-o were already

described by us.^[12-13]For the preparation of 2b, the meta isomer

We and others pioneered the studies on covalent LSD1

inhibitors starting from mechanistic and crystallographic

analyses on the stereoisomers of TCP and their 4-bromo

derivatives.^[12]Such crystal structures confirmed the covalent

bond between TCP and the FAD cofactor and highlighted the

presence of an open cleft in the enzyme active site, suggesting

the introduction of large substituents at the C4 position of the

TCP phenyl ring to design new molecules with improved

inhibitory activities.^[12]Thus, we prepared a first series of 4-

benzamide analogues of TCP, by inserting aroylamino and

arylacetylamino moieties with different sizes and shapes at the

C4 position of the TCP phenyl ring (1a-h), and a second series

of compounds in which we inserted at the same position a N-

benzyloxycarbonyl (Z) amino acid residue linked through an

amide bond (2a-o) (Figure 2).^[12]These more hindered,

branched derivatives were designed to gain more information on

steric requirements for the occupancy of the LSD1 open cleft

and to enhance selectivity towards LSD1 with respect to other

flavoenzymes such as monoamine oxidases (MAOs). From

these studies two prototypes emerged, 1a and 2a, which were

further characterized through chemical investigations of their

of

aminophenyl)cyclopropyl]carbamate 5^[13a]was coupled with Z-

phenylalanine in the presence of (benzotriazol-1-

2a,

the

known

tert-butyl

[2-(3-

yloxy)tripyrrolidinophosphonium hexafluorophosphate (PyBOP),

triethylamine, and dry N,N-dimethylformamide (DMF) in N₂

atmosphere to furnish the tert-butyl carbamate 6. Subsequent

acidic deprotection of 6 with 4M HCl in 1.4-dioxane afforded the

desired 2b (Scheme 1).

Scheme 1. a) PyBOP, triethylamine, dry DMF, N2; b) 4M HCl in 1,4-dioxane,

dry THF.

2

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

Since 2a-o contain three chiral centers, i.e. two on the

cyclopropyl ring and the third on the Z-amino acid chain, we

designed compounds 3a-n lacking the third stereogenic center

which, after coupling with 8^[12]and removal of the Boc protection

(4M HCl in 1,4-dioxane) from the obtained intermediates 26a,b

gave the desired compounds 3m,n (Scheme 2E).

and retaining

a branched structure. We decorated the

benzamide portion of 1a with two substituents, the N-

benzyloxycarbonylamino moiety present also in 2a-o, added to

the ortho, meta, or para position, and a second substituent,

represented by a cyclic amine as well as a phenyl, phenoxy, or

phenylthiol group (3a-l). Additionally, two further analogues were

prepared carrying a C2-oxyacetamide function and a C5-

benzamide moiety on the benzamide portion of 1a (3m,n).

Among compounds 3, the syntheses of 3b,d-g were

reported previously by us.^[14]The synthesis of 3a was

accomplished by coupling the commercially available 4-

{[(benzyloxy)carbonyl]amino}benzoic acid 7 with the tert-butyl [2-

(4-aminophenyl)cyclopropyl]carbamate 8^[12]in the presence of

N-ethyl-N'-(3-N,N-dimethylaminopropyl)carbodiimide

(EDC)

hydrochloride in dichloromethane (DCM), followed by cleavage

of the tert-butoxycarbonyl (Boc)-protected intermediate 9 with

4M HCl solution in 1,4-dioxane (Scheme 2A).

The synthesis of 3c was performed starting from tert-butyl 3-

fluoro-4-nitrobenzoate,

which

was

treated

with

N-

methylpiperazine to afford the nitro ester 10. Further palladium-

catalyzed reduction of the nitro group with hydrogen and

subsequent reaction of the primary amino group (compound 11)

with benzyl chloroformate in dry THF furnished the tert-butyl 4-Z-

aminobenzoate 12. Such intermediate, after transformation into

the corresponding carboxylic acid 13 with trifluoroacetic acid in

DCM, was coupled with 8^[12]in the presence of PyBOP and

triethylamine in dry DMF to give the tert-butyl carbamate 14

which was converted by acidic treatment into the hydrochloride

salt of the corresponding free amine 3c (Scheme 2B).

Scheme 2. Route A: a) EDC hydrochloride, triethylamine, dry DCM; b) 4M HCl

in dioxane, dry THF. Route B: c) N-methylpiperazine, dry potassium carbonate,

dry DMF, 100 °C; d) H₂, 10% Pd/C, MeOH; e) benzyl chloroformate,

triethylamine, dry THF, 0 °C; f) trifluoracetic acid, dry DCM; g) PyBOP,

triethylamine, dry DMF, N₂; b) 4M HCl in dioxane, dry THF. Route C: h) phenol

or thiophenol, dry potassium carbonate, dry DMF, 100 °C; i) H₂, 10% Pd/C,

EtOH; j) benzyl chloroformate, dry potassium carbonate, THF/H₂O = 1:1, 0 °C;

f) trifluoracetic acid, dry DCM; g) PyBOP, triethylamine, dry DMF, N₂; b) 4M

HCl in 1,4-dioxane, dry THF. Route D: j) benzyl chloroformate, dry potassium

carbonate, THF/H₂O = 1:1, 0 °C; a) EDC hydrochloride, triethylamine, dry

DCM; b) 4M HCl in 1,4-dioxane, dry THF. Route E: k) benzoyl chloride,

triethylamine, dry DCM; l) N-phenyl- or N-benzyl-2-bromoacetamide, dry

potassium carbonate, dry CH₃CN, 70 °C; m) 2N LiOH, dry THF, g) PyBOP,

triethylamine, dry DMF, N₂; b) 4M HCl in 1,4-dioxane, dry THF..

The reaction of the commercially available tert-butyl 4-

chloro-3-nitrobenzoate with phenol or thiophenol in the presence

of potassium carbonate in dry DMF at 100 °C furnished the nitro

intermediates 15a,b, then converted in the corresponding

amines

16a,b

by

palladium-catalyzed

hydrogenation.

Subsequent reaction of 16a,b with benzyl chloroformate in

presence of potassium carbonate in a mixture of THF/water 1:1

furnished

the

tert-butyl

3-{[(benzyloxy)carbonyl]amino-4-

phenoxy- and -phenylthiobenzoates 17a,b, which were

converted into the corresponding carboxylic acids 18a,b by

treatment with trifluoroacetic acid in dry DCM. The acidic

intermediates 18a,b were then coupled with the amine 8^[12]using

PyBOP as activating agent in presence of triethylamine in dry

DMF under nitrogen atmosphere. The obtained Boc-protected

derivatives 19a,b were finally treated with 4M HCl in 1,4-dioxane

and dry THF to give the desired compounds 3h,i (Scheme 2C).

The synthesis of 3j-l was undertaken by treating the

commercially available amino acids 20a-c with benzyl

chloroformate. The resulting 2-Z-aminobenzoic acids 21a-c were

then coupled with 8^[12]to furnish the Boc-protected derivatives

22a-c, which after acidic cleavage provided the desired 3j-l

(Scheme 2D).

Afterwards, we applied some chemical modifications to the

TCP structure by preparing compounds 4a-h, in which the

primary amine group of TCP has been changed into secondary

(N-methyl-TCP, 4a)^[15]or tertiary (N,N-dimethyl-TCP, 4b)^[16]

amine, or transformed into carboxamide (4c)^[15]or

carbohydrazide (4d). The isomeric 1-phenylcyclopropan-1-

amine

(4e)

and

the

{1-[(4-(1-

aminocyclopropyl)phenyl)amino]-1-oxo-3-phenylpropan-2-

yl}carbamate hydrochloride (4f, a 2a isomer) were also prepared,

together with the related 1-phenylcyclopropane-1-carboxamide

(4g),^[17](1-phenylcyclopropyl)methanamine (4h),^[17]and 2-

phenylaziridin-1-amine (4i).^[18]Compounds 4a,b,h,i were

prepared according to the reported procedures, while 4c,d were

obtained by treating the commercially available 2-

phenylcyclopropane-1-carboxylic acid with PyBOP, 33%

ammonia and triethylamine (for 4c), or its methyl ester with

hydrazine hydrate (for 4d) (Scheme 3A).

Reaction of methyl 2-hydroxy-5-aminobenzoate with benzoyl

chloride gave the intermediate 23, which was treated with N-

phenyl- or -benzyl-2-bromoacetamide to furnish the methyl

esters 24a,b. Such intermediates were hydrolyzed with lithium

hydroxide to afford the corresponding carboxylic acids 25a,b

3

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

Curtius reaction performed on 1-phenylcyclopropane-1-

carboxylic acid using diphenylphosphoryl azide, triethylamine,

and dry tert-butanol in dry benzene at 105 °C under N₂

atmosphere furnished 4e after acidic hydrolysis of the tert-butyl

carbamate 27, while treatment of the same carboxylic acid with

PyBOP, 33% ammonia and triethylamine afforded the 1-

phenylcyclopropane-1-carboxamide 4g (Scheme 3B). For the

synthesis of 4f, first the commercially available 4-

nitrophenylacetonitrile was converted into the corresponding

cyclopropane intermediate 28 using 1,2-dibromoethane,

tetrabutylammonium bromide and 50% sodium hydroxide, and

then hydrolyzed under strongly acidic conditions to afford the

carboxylic acid 29. Such intermediate was then converted

through Curtius reaction into the corresponding nitro carbamate

30, which was in turn reduced to the amino intermediate 31 by

palladium-catalyzed hydrogenation. Final coupling of 31 with Z-

phenylalanine in the presence of EDC hydrochloride,

triethylamine and hydroxybenzotriazole in dry DCM furnished

the protected tert-butyl carbamate 32, which after acidic

treatment provided 4f as a hydrochloride salt (Scheme 3C).

Scheme 3. Route A: a) PyBOP, 33% NH₃, triethylamine, dry DCM/DMF 4/1; b)

hydrazine hydrate, methanol. Route B: c) diphenylphosphoryl azide,

triethylamine, dry tert-butanol, dry benzene, 105 °C, N₂; d) 4M HCl in 1,4-

dioxane, dry THF; a) PyBOP, 33% NH₃, triethylamine, dry DCM/DMF 4/1.

Route C: e) 50 % sodium hydroxide, tetrabutylammonium bromide, dry CH₃CN,

40 °C; f) 96% sulfuric acid, reflux; c) diphenylphosphoryl azide, triethylamine,

dry tert-butanol, dry benzene, 105 °C, N₂; g) Pd/C, H₂30 psi, methanol; h) Z-

Phe-OH, EDC hydrochloride, triethylamine, hydroxybenzotriazole, dry DCM; d)

4M HCl in 1,4-dioxane, dry THF.

Compounds 1-4 were incubated with the human

recombinant LSD1/CoREST enzymatic complex as well as with

human MAO A and MAO B proteins to assess their potency and

selectivity, and the results are expressed as IC₅₀values (for

LSD1) or percentage of inhibition at 100 µM (for MAOs) and

summarized in Table 1.

Table 1. Biochemical profile of compounds 1-4^[a]

.

% inhibition at 100

Cpd

R

R₁

R₂

R₃

R₄

R₅

R₆

LSD1, IC₅₀(µM)

µM

MAO A

97%

MAO B

NI^[c]

1a^[b]

1b

0.019 ± 0.004

0.106 ± 0.020

96%

95%

37%

50%

NI

1c

1d

0.024 ± 0.004

0.029 ± 0.005

1e

1f

0.051 ± 0.008

0.054 ± 0.010

0.038 ± 0.009

2%

8%

33%

48%

96%

98%

1g

1h

0.043 ± 0.010

0.149 ± 0.028

89%

94%

17%

1%

2a^[d]

H

2b^[e]

18.1 ± 2.9

meta

4

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

2c

H

0.459 ± 0.090

2d

2e

2f

H

Br

H

0.230 ± 0.042

0.080 ± 0.026

0.236 ± 0.039

0.130 ± 0.025

71%

87%

29%

42%

2g

H

2h

H

0.280 ± 0.052

2i

2j

H

0.173 ± 0.028

0.767 ± 0.104

0.190 ± 0.030

2k

2l

H

0.083 ± 0.012

2m

2n

2o

H

0.400 ± 0.072

0.236 ± 0.040

0.581 ± 0.071

3a

3b^[f]

3c

H

0.090 ± 0.012

0.075 ± 0.011

0.089 ± 0.010

0.043 ± 0.010

0.307 ± 0.069

37%

76%

69%

46%

8%

78%

55%

NI

H

3d^[f]

3e^[f]

H

3f^[f]

H

0.061 ± 0.011

0.089 ± 0.020

21%

5%

17%

13%

3g^[f]

3h

3i

H

0.143 ± 0.028

0.073 ± 0.011

0.146 ± 0.022

0.159 ± 0.034

0.135 ± 0.029

3j

H

72%

94%

17%

NI

3k

3l

Br

3m

3n

H

3.9 ± 0.2

1.7 ± 0.05

4a

4b

4c

4d

4e

4f

10.8 ± 1.1

56.2 ± 7.8

NI

4g

4h

4i

NI

TCP

11.2 ± 1.8

79%

85%

[a] Data represent mean values of at least two separate experiments in duplicate. [b] Ref. ^[13a], added for comparison. [c] NI, no inhibition. [d] Reff. ^{[13b, 19]}, added

for comparison; compounds 2a,c-o have the Z-aminoacylamino substituent inserted at the C4 position of the TCP phenyl ring. [e] C3-substituted regioisomer of

2a. [f] Ref. ^[14], added for comparison.

phenyl ring furnished low nanomolar potency for LSD1 inhibition,

and the insertion at the amide function of longer substituents

such as 4-biphenyl, benzyl, 1- or 2-naphthylmethyl moieties led

As regards to compounds 1, we already reported the high

potency of 1a at LSD1 enzyme level.^[12-13]The introduction of 1-

or 2-naphthoylamine (1c,d) moiety at the C4-position of the TCP

5

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

to slightly less but still potent derivatives (1e-h) (Table 1). The

benzyl [4-(2-aminocyclopropyl)phenyl]carbamate 1b displayed

the lowest potency among the compounds of the series, with an

IC₅₀7-fold higher than 1a. About selectivity, only the 4-biphenyl

analogue 1e displayed no inhibition of both MAO-A and MAO-B

at 100 µM; all the other compounds strongly inhibited MAO-A,

while MAO-B was in general moderately or scarcely affected.

proliferation. The relative IC₅₀values for antiproliferative

activities by 1-3 are reported in Table 2.

Table 2. Antiproliferative activities of 1-3 on MV4-11 AML and NB4 APL cell

lines.

IC₅₀(µM)^[a]

Among the TCP analogues bearing a Z-amino acylamine

moiety in C4, we selected the Z-PheCONH derivative 2a (also

Compd

MV4-11

NB4

13b]

called MC2580) as a scaffold for further derivatization^[12,

1a

1b

1c

1d

1e

1f

>100

(Table 1). Similar to what previously observed with 1a and its

benzamide moiety, the shift of the 2a amino acylamine chain

from C4 to C3 (see the meta regioisomer 2b) decreased >120-

fold the anti-LSD1potency. Replacement of the 2a branched

benzyl group with phenyl (2c), 2-naphthylmethyl (2j), 2-propyl

(2m), or cyclohexylmethyl (2o) moiety furnished derivatives up

to 5-fold less potent than 2a, while 4-bromo- (2d) and 4-

methoxybenzyl (2f), 2-phenylethyl (2g), diphenylmethyl (2h), 1-

naphthylmethyl (2i), 1H-indol-3-yl (2k), or 2-methyl-1-propyl (2n)

substituent had only slight modulatory effects on the inhibitory

potency respect to the prototype. The chemical changes

affording about 2-fold increase of potency against LSD1 were

the introduction of the bromo atom at the C4 position of the

benzyl carbamate (2e) and the replacement of the benzyl at Cα

with the benzo[b]thiophen-3-yl group (2l). When some of

compounds 2 were tested against MAOs, in general appeared

more LSD1-selective than compounds 1, due to a slight drop of

inhibiting activity against MAO-A.

22.4 ± 3.8

8.7 ± 1.9

6.5 ± 0.7

2.3 ± 0.04

49.8 ± 7.7

21.8 ± 3.1

7.8 ± 1.0

10.2 ± 1.2

24.2 ± 3.1

52.3 ± 8.9

4.6 ± 0.5

5.3 ± 0.4

5.0 ± 0.7

8.7 ± 0.9

5.0 ± 0.8

7.6 ± 0.9

15.4 ± 2.7

16.0 ± 3.3

6.8 ± 0.8

>100

25 ± 3.2

14.4 ± 2.2

9.4 ± 0.9

7.5 ± 0.8

42.4 ± 6.2

17.8 ± 2.0

16.4 ± 3.3

17.4 ± 2.9

42.7 ± 5.8

62.2 ± 9.2

5.8 ± 0.8

7.3 ± 0.6

6.2 ± 0.5

16.5 ± 2.6

8.7 ± 1.0

7.8 ± 0.8

23.2 ± 4.2

24.4 ± 3.9

3.8 ± 0.04

70.4 ± 9.8

46.7 ± 6.2

30.3 ± 3.9

0.6 ± 0.02

7.4 ± 0.6

0.9 ± 0.06

1.3 ± 0.01

5.2 ± 0.4

1.5 ± 0.09

3.2 ± 0.2

5.4 ± 0.6

23.2 ± 3.8

8.1 ± 0.9

9.3 ± 1.0

7.6 ± 0.8

5.5 ± 1.4

3.8 ± 0.8

>100

1g

1h

2a^[b]

2b

2c

2d

2e

2f

2g

2h

2i

2j

The insertion of the Z-amino group to the benzamide portion

of 1a was devised to generate a sort of chimeras between 1 and

2 (compounds 3), without the disadvantage of the third chiral

center of 2. This modification led to highly active compounds,

with the meta substituted (3d,f,g) slightly more potent than the

corresponding para analogues (3a-c), and the ortho

regiosomers (3j-l) definitively less effective (Table 1). The

addition of a second substituent generally did not improve the

inhibitory potency of the derivatives, and the insertion of a

piperidine ring to the meta-substituted 3d (compound 3e)

caused a 10-fold drop of potency respect to 3d (Table 1).

Further design and synthesis of the related compounds 3m,n

furnished LSD1 inhibitors with low micromolar potency (Table 1).

When tested against MAOs, compounds 3 seemed to be in

general more selective towards LSD1 than 1 and 2, as they

mostly displayed scarce inhibition of both the amino oxidases

(Table 1).

2k

2l

2m

2n

2o

3a

3b

3c

3d

3e

3f

16.9 ± 2.5

13.2 ± 2.2

0.4 ± 0.01

4.4 ± 0.3

2.5 ± 0.1

1.7 ± 0.02

4.3 ± 0.3

1.9 ± 0.08

1.4 ± 0.06

3.3 ± 0.3

21.4 ± 3.3

8.2 ± 1.2

6.2 ± 0.7

8.1 ± 1.0

5.6 ± 1.1

3.3 ± 0.6

>100

3g

3h

3i

3j

3k

3l

Final exploration of chemical modifications applied on TCP

furnished fragments 4, totally devoid of LSD1/CoREST inhibitory

activity. The only exceptions are the N-methyl- and N,N-

dimethyl-TCP (4a and 4b, respectively), the first showing the

same potency of TCP, the latter being 5-fold less effective

(Table 1).

3m

3n

TCP

[a] Data represent mean values of at least two separate experiments in

duplicate. [b] Ref. ^[19], added for comparison.

Antiproliferative activities of 1-3 on MV4-11 AML and NB4

APL cell lines

Among 1a-h, all compounds displayed antiproliferative

activities against the two leukemia cell lines higher than the

prototype 1a. Derivatives bearing bulkier substituents such as 1-

and 2-naphthyl (1c and 1d, respectively), 2-naphthylmethyl (1h)

and mainly 4-biphenyl (1e) arrested MV4-11 cell growth at

single-digit micromolar concentration (in the range 2.3 to 8.7

µM), while only 1d and 1e displayed similar level of potency

Previous studies described LSD1 playing a relevant role in

human leukemias.^{[12-14, 20]}Thus, 1-3 were tested in MV4-11 AML

and in NB4 APL cell lines to determine their effects on cell

6

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

Figure 3. GFI-1b, ITGAM and KCTD12 gene expression induction in NB4 cells

by selected 1-3 derivatives. The inhibitors were tested at their biochemical

anti-LSD1 IC₅₀values (see Table 1). Fold-inductions were calculated with

respect to DMSO, which was used as a control. Data for GFI-1b and ITGAM

gene induction by 3b, 3f and 3g have been reported in ref. ^[14]and added here

for comparison.

against NB4 cells (Table 2). Among 2a-o, the shift of the Z-Phe

substituent from para to meta position (2b), or the shortening of

one of the two arms by replacing the Z-Phe with a Z-

phenylglycine (2c) reduced the antiproliferative effect. By

contrast, the insertion at the Cα of the Z-aminoacid unit of a 4-

substituted benzyl group (2d,f) or a bulkier diphenyl (2h), 1-

naphthylmethyl (2i) or benzo[b]thiophen-3-yl (2l) group, or

introduction of a bromine into the Z group of 2a (2e) increased

the inhibition of proliferation of the two tested leukemia cell lines

in the range 3.8 to 8.7 µM [IC₅₀values for 2a: 10.2 (MV4-11) and

17.4 (NB4) µM] (Table 2). As regards to 3a-n, the introduction of

substituent(s) at the C4-benzamide moiety of 1a afforded the

most potent antiproliferative agents against MV4-11 and NB4

cells. Indeed, all the compounds 3a-n except for the 3-Z-amino-

4-phenylthio derivative 3i exhibited IC₅₀values for both cell lines

in the single-digit micromolar range. The most effective of this

series were the 4- and 3-Z-amino substituted compounds 3a, 3c,

3d, 3f and 3g, with 3a and 3c being potent at submicromolar

level against MV4-11 (3a) and NB4 (3a and 3c) cells. This

generally agreed with their trend for LSD1 inhibition, with some

exceptions for 3b and 3i, which although showing potent

inhibition of LSD1 displayed less antiproliferative activity,

probably due to scarce cell penetration and/or distribution.

Preliminary metabolic stability evaluation of selected

compounds 3a, 3d and 3g

Finally, the metabolic stability of selected compounds 3a, 3d and

3g was assessed using both human and mouse liver

microsomes, to estimate their stability to phase I oxidative

metabolism.

As reported in Table 3, all the compounds, according to the

well stirred model,^[23]showed a low/medium intrinsic clearance,

both in mouse and human, suggestive of an high stability to

phase I oxidative metabolism.

Table 3. Antiproliferative activities of 1-3 on MV4-11 AML and NB4 APL cell

lines.

Metabolic stability data^[a]

Compd

LSD1 target modulation: effects of selected 1-3 derivatives

Mouse Cl_int(µL/min/mg protein) Human Cl_int(µL/min/mg protein)

on GFI-1b, ITGAM, and KCTD12 gene induction

3a

3d

3g

7.1 ± 2.2

4.3 ± 0.7

11.2 ± 1.8

6.7 ± 1.1

12.2 ± 1.7

lower than 3

To confirm that the most potent compounds in enzyme assay as

well as in leukemia cells were effectively working through LSD1

inhibition in cells, we detected the levels of transcripts of three

genes, GFI-1b, ITGAM/CD11b, and KCTD12, normally silenced

by LSD1, in NB4 cells after treatment with selected 1-3

compounds. In particular, GFI-1b physically interacts with LSD1

in a complex acting as a transcriptional repressor and critical

[a] Data are expressed as the mean of at least two determinations ± standard

deviation.

Conclusion

regulator of hematopoietic cell lineage development and

21]

differentiation,^[5a,

ITGAM is a differentiation marker in

LSD1 is a KDM epigenetic enzyme highly involved in initiation

and development of hematological malignancies as well as solid

tumor. In particular, AML cell lines harboring MLL and AML-ETO

translocations^{[20c, 24]}displayed high sensitivity to LSD1 inhibitors,

and their combination with all-trans retinoic acid (ATRA) was

proposed for the use in AML.^[25]The analysis of crystal

structures of the four stereoisomers of TCP and 4-bromo-TCP

complexed with the enzyme revealed that strong inhibitory

potency requires the large catalytic cleft of LSD1 to be filled

through insertion of long, hindered substituent(s) at the C4

position of the phenyl ring of TCP.^[12]Thus, we prepared three

different series of TCP derivatives, bearing aroyl- and

arylacetylamino (1a-h), Z-amino acylamino (2a-o), or double-

substituted benzamide (3a-n) residues at C4 or C3 position of

TCP as covalent LSD1 inhibitors. In addition, we applied some

chemical changes on the TCP scaffold (compounds 4a-i) to find

novel chemical entities suitable for designing novel LSD1

inhibitors. Compounds 1-4 were tested against LSD1, and some

of them against MAO-A and -B, to assess their potency and

selectivity. Most compounds 1 and 3 displayed IC₅₀values

against LSD1 in the low nanomolar range, while compounds 2

were in general less effective (IC₅₀values in the submicromolar

range) and compounds 4 were totally inactive. The different

substituents in 1, 2 and 3 had mostly modulatory effects on the

inhibitory potency of the compounds. Only compounds 1e, 3a,

leukemia and its gene target of LSD1,^{[13, 21b, 22]}and KCTD12 is

another gene reported to be under the control of LSD1.^{[20c, 22a]}

The inhibitors were added at a concentration equal to their

respective biochemical IC₅₀values, and after 24 h the GFI-1b,

ITGAM and KCTD12 mRNA expression levels were measured

by quantitative RT-PCR and graphed as fold-induction with

respect to the control (DMSO). Data depicted in Figure 3 show

that all the selected compounds 1d,e, 2d-f,h,i,l, and 3a-h,j-l

increased the expression of the three gene targets in NB4 cells,

demonstrating an inhibitory effect on LSD1 in cells.

7

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

3d, 3f and 3g displayed selectivity towards LSD1 with respect to

MAOs, the others exhibiting typically low inhibition for MAO-B

and high inhibition for MAO-A. Compounds 1-3 were tested in

MV4-11 AML and NB4 APL cells, to determine their effects on

cell proliferation. In general, MV4-11 cells were more sensitive

than NB4 cells to these inhibitors, and only two compounds of

the series 1 (1d,e) and six compounds of the series 2 (2d-f,h,i,l)

showed single digit micromolar IC₅₀values against both the cell

lines. Compounds 3, characterized by high potency and

selectivity against LSD1 at enzyme level, were also the most

potent in these assays: all these derivatives displayed single

digit micromolar cell growth inhibition against both the cell lines,

with the only exception of 3i, which was less effective. Among

General procedure for the synthesis of the tert-butyl

carbamates 6, 14, 19a,b, and 26a,b. Example: Tert-butyl (2-

(4-(4-benzamido-2-(2-oxo-2-

(phenylamino)ethoxy)benzamido)phenyl)

cyclopropyl)carbamate (26a). Triethylamine (0.06 mL, 0.52

mmol) and PyBop (0.08 g, 0.16 mmol) were added to a solution

of 25a (0.05 g, 0.13 mmol) in dry DMF under nitrogen

atmosphere. The resulting solution was stirred at room

temperature for 45 min, and then 8^[12](0.03 g, 0.13 mmol) was

added under nitrogen atmosphere. After 2 h, the reaction was

quenched with

a saturated sodium chloride solution and

extracted with ethyl acetate (3 × 10 mL). The combined organic

layers were dried over anhydrous sodium sulfate, filtered and

them, 3a exhibited submicromolar potency against both cell lines, concentrated in vacuo. The product was purified by silica gel

and 3c against NB4 cells. Target modulation experiments in

NB4 cells revealed that the most potent compounds at cellular

levels were also able to increase the expression of three genes

under the control of LSD1, thus demonstrating that the observed

effects were actually due to LSD1 inhibition. Selected

compounds 3a, 3d and 3g were profiled for mouse and human

microsomal stability, and all of them showed low/medium

intrinsic clearance, either in mouse or human microsomes,

highlighting their good metabolic stability. Further studies will be

performed on the new hit compounds 3a and 3c to assess their

anticancer potential in different cancer contexts including cancer

stem cells.^[26]

chromatography eluting with ethyl acetate/n-hexane 1.8/1 to

obtain the pure intermediate 26a. Yield = 40 %; mp = 220-

222 °C; recrystallization solvent = acetonitrile/methanol; H NMR

1

(400 MHz, CDCl₃) δ 1.42 (s, 9H, NHCOOC(CH₃)₃), 1.42-1.50 (m,

1H, cyclopropane CHH), 1.63-1.71 (m, 1H, cyclopropane CHH),

2.39-2.46 (m, 1H, cyclopropane CHNHBoc), 3.59-3.66 (m, 1H,

cyclopropane PhCH), 4.74 (s, 2H, CH₂CONHPh), 5.82-5.84 (d,

1H, NHCOOC(CH₃)₃), 7.04-7.10 (m, 1H, benzene proton), 7.15-

7.17 (d, 1H, benzene proton), 7.19-7.23 (m, 2H, benzene

protons), 7.32-7.38 (m, 2H, benzene protons), 7.42-7.59 (m, 7H,

benzene protons), 7.68-7.72 (dd, 1H, benzene proton), 7.93-

7.97 (m, 2H, benzene protons), 8.13-8.15 (d, 1H, aromatc

proton), 9.23 (s, 1H, CONHPh-cyclopropyl), 9.45 (s, 1H,

NHCOPh), 9.58 (s, 1H, CH₂CONHPh) ppm. MS (ESI) m/z: 621

[M + H]⁺.

Experimental Section

Benzyl

(1-((3-(2-((tert-

butoxycarbonyl)amino)cyclopropyl)phenyl)amino)-1-oxo-3-

phenylpropan-2-yl)carbamate (6): Synthesised as described

as for 26a. Yield = 66 %; mp = 151-153 °C; solvent =

recrystallization toluene; ¹H NMR (400 MHz, CDCl₃) δ 1.41 (s,

9H, NHCOOC(CH₃)₃), 1.46-1.53 (m, 1H, cyclopropane CHH),

1.66-1.73 (m, 1H, cyclopropane CHH), 2.42-2.48 (m, 1H,

cyclopropane CHNHBoc), 2.96-3.09 (m, 2H, CHCH₂Ph), 3.64-

3.71 (m, 1H, cyclopropane PhCH), 4.50-4.57 (m, 1H, CHCH₂Ph),

5.08 (s, 2H, NHCOOCH₂Ph), 5.82-5.84 (d, 1H, NHCOOC(CH₃)₃),

6.29-6.31 (d, 1H, NHCOOCH₂Ph), 7.12-7.16 (m, 1H, benzene

proton), 7.19-7.36 (m, 12H, benzene protons), 7.51-7.55 (m, 1H,

benzene proton), 9.56 (s, 1H, CONHPh) ppm. MS (ESI) m/z:

530 [M + H]⁺.

Chemistry

General: Melting points were determined on a Buchi 530

melting point apparatus and are uncorrected. 1H-NMR spectra

were recorded at 400 MHz on a Bruker AC 400 spectrometer;

chemical shifts are reported in δ (ppm) units relative to the

internal reference tetramethylsilane (Me₄Si). Microwave-assisted

reactions were performed with a Biotage Initiator (Uppsala,

Sweden) high frequency microwave synthesizer working at 2.45

GHz, fitted with magnetic stirrer and sample processor; reaction

vessels were Biotage microwave glass vials sealed with

applicable cap; temperature was controlled through the internal

IR sensor of the microwave apparatus. Low resolution mass

spectra of final and intermediate compounds were recorded on

an API-TOF Mariner by Perspective Biosystem (Stratford, Texas,

USA), samples were injected by a Harvard pump using a flow

rate of 5-10 µL/min, infused in the Electrospray system. All

compounds were routinely checked by TLC and ¹H-NMR. TLC

was performed on aluminum backed silica gel plates (Merck DC,

Alufolien Kieselgel 60 F254) with spots visualized by UV light. All

solvents were reagent grade and, when necessary, were puriﬁed

and dried by standard methods. Concentration of solutions after

reactions and extractions involved the use of a rotary evaporator

operating at reduced pressure of ca. 20 Torr. Organic solutions

were dried over anhydrous sodium sulfate. Elemental analysis

has been used to determine purity of the described unknown

final compounds, that is >95%. Analytical results are within

±0.40% of the theoretical values (Table S1 in Supporting

Information). All chemicals were purchased from Sigma Aldrich

s.r.l, Milan (Italy), or from TCI Europe N.V., Zwijndrecht

(Belgium), and were of the highest purity.

Benzyl

(4-((4-(2-((tert-

butoxycarbonyl)amino)cyclopropyl)phenyl)carbamoyl)-2-(4-

methylpiperazin-1-yl)phenyl)carbamate (14): Synthesised as

described as for 26a. Yield = 74 %; mp = 117-119 °C;

recrystallization solvent = cyclohexane; ¹H NMR (400 MHz,

CDCl₃): δ 1.14-1.18 (m, 1H, cyclopropane CHH), 1.34-1.37 (m,

1H, cyclopropane CHH), 1.5 (s, 9H, NHCOOC(CH₃)₃), 2.25-2.31

(m, 1H, CHNHBoc), 2.76-2.83 (m, 4H, CH₃N(CH₂)₂piperazine-

C3,C5), 3.12-3.17 (m, 4H, PhN(CH₂)₂piperazine-C2,C6), 3.32-

3.38 (m, 4H, NCH₃and PhCH), 4.89 (bs, 1H, NHCOOC(CH₃)₃),

5.23 (s, 2H, NHCOOCH₂Ph), 7.13-7.16 (m, 2H, benzene

protons), 7.34-7.48 (m, 5H, benzene protons), 7.70-7.72 (m, 2H,

benzene protons), 7.79-7.86 (m, 2H, benzene protons), 8.01-

8.03 (m, 1H, benzene proton), 8.74 (bs, 1H, NHCOOCH₂Ph),

10.27 (bs, 1H, PhCONH) ppm. MS (ESI) m/z: 600 [M + H]⁺.

8

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

Benzyl

(5-((4-(2-((tert-

5.15 (s, 2H, NHCOOCH₂Ph), 7.14-7.16 (d, 2H, benzene protons),

7.16-7.21 (t, 1H, benzene proton), 7.34-7.40 (m, 5H, benzene

protons), 7.54-7.58 (t, 1H, benzene proton), 7.63-7.65 (d, 2H,

benzene protons), 7.81-7.83 (d, 1H, benzene proton), 8.07-7.09

(d, 1H, benzene proton), 8.36 (bs, 3H, NH₃), 10.30 (s, 1H,

PhCONH), 10.44 (s, 1H, -NHCOOCH₂Ph) ppm. MS (ESI), m/z:

402 [M + H]⁺.

butoxycarbonyl)amino)cyclopropyl)phenyl)carbamoyl)-(2-

phenoxyphenyl)carbamate (19a): Synthesised from the

carboxylic acid 18a as described as for 26a. Yield = 73 %; mp =

203-205 °C; recrystallization solvent = acetonitrile/methanol; ¹H

NMR (400 MHz, CDCl₃) δ 1.42 (s, 9H, NHCOOC(CH₃)₃), 1.43-

1.50 (m, 1H, cyclopropane CHH), 1.63-1.71 (m, 1H,

+

cyclopropane CHH), 2.39-2.45 (m, 1H, cyclopropane CHNHBoc), Benzyl

(1-((3-(2-aminocyclopropyl)phenyl)amino)-1-oxo-3-

phenylpropan-2-yl)carbamate hydrochloride (2b):

Synthesised from the tert-butyl carbamate 6 as described as for

3.59-3.67 (m, 1H, cyclopropane PhCH), 5.18 (s, 2H,

NHCOOCH₂Ph), 5.82-5.84 (d, 1H, NHCOOC(CH₃)₃), 7.01-7.05

(m, 2H, benzene protons), 7.08-7.13 (m, 2H, benzene protons),

7.21-7.24 (m, 2H, benzene protons), 7.26-7.31 (m, 1H, benzene

proton), 7.32-7.38 (m, 7H, benzene protons, NHCOOCH₂Ph),

7.54-7.58 (m, 2H, benzene protons), 7.90-7.94 (dd, 1H, benzene

proton), 8.38-8.40 (d, 1H, benzene proton), 8.55 (s, 1H,

PhCONH) ppm. MS (ESI) m/z: 594 [M + H]⁺.

3j. Yield

=

74 %; mp

=

210-212 °C; solvent

=

acetonitrile/methanol; ¹H NMR (400 MHz, DMSO-d₆) δ 1.26-1.34

(m, 1H, cyclopropane CHH), 1.61-1.69 (m, 1H, cyclopropane

+

CHH), 2.09-2.20 (m, 1H, cyclopropane CHNH₃), 2.92-3.06 (m,

3H, cyclopropane PhCH, CHCH₂Ph), 4.41-4.48 (m, 1H,

CHCH₂Ph), 5.05 (s, 2H, NHCOOCH₂Ph), 7.02-7.08 (m, 1H,

benzene proton), 7.13-7.17 (m, 8H, benzene protons), 7.21-

.7.27 (m, 3H, benzene protons), 7.76-7.83 (m, 2H, benzene

Benzyl

(5-((4-(2-(tert-

butoxycarbonylamino)cyclopropylphenyl)carbamoyl)-2-

(phenylthio)phenyl)carbamate (19b): Synthesised from the

carboxylic acid 18b as described as for 26a. Yield = 77 %; mp =

189-191 °C; recrystallization solvent = acetonitrile/methanol; ¹H

NMR (400 MHz, CDCl₃) δ 1.41 (s, 9H, NHCOOC(CH₃)₃), 1.45-

1.52 (m, 1H, cyclopropane CHH), 1.65-1.72 (m, 1H,

+

protons), 8.57 (bs, 3H, NH₃), 9.86 (s, 1H, CONHPh), 10.07 (s,

1H, NHCOOCH₂Ph) ppm. MS (ESI), m/z: 430 [M + H]⁺.

Benzyl

(4-((4-(2-

aminocyclopropyl)phenyl)carbamoyl)phenyl)carbamate

hydrochloride (3a): Synthesised from the tert-butyl carbamate

cyclopropane CHH), 2.39-2.46 (m, 1H, cyclopropane CHNHBoc), 9 as described as for 3j. Yield = 68 %; mp = 238-240 °C;

3.59-3.68 (m, 1H, cyclopropane PhCH), 5.16 (s, 2H,

NHCOOCH₂Ph), 5.84-5.86 (d, 1H, NHCOOC(CH₃)₃), 7.20-7.26

(m, 3H, benzene protons), 7.28-7.32 (m, 3H, benzene protons),

7.33-7.36 (m, 7H, benzene protons, NHCOOCH₂Ph), 7.49-7.51

(d, 1H, benzene proton), 7.54-7.58 (m, 2H, benzene protons),

7.89-7.93 (dd, 1H, benzene proton), 8.07-8.09 (d, 1H, benzene

recrystallization solvent = acetonitrile/methanol; ¹H NMR (400

MHz, DMSO-d₆) δ 1.22-1.29 (m, 1H, cyclopropane CHH), 1.58-

1.65 (m, 1H, cyclopropane CHH), 2.11-2.20 (m, 1H,

cyclopropane CHNH₃), 2.90-2.98 (m, 1H, cyclopropane PhCH),

5.19 (s, 2H, NHCOOCH₂Ph), 7.12-7.14 (d, 2H, benzene protons),

+

7.35-7.46 (m, 5H, benzene protons), 7.59-7.61 (d, 2H, benzene

proton), 8.57 (s, 1H, PhCONH) ppm. MS (ESI) m/z: 610 [M + H]⁺. protons), 7.68-7.70 (d, 2H, benzene protons), 7.91 (d, 2H,

+

Tert-butyl

(2-(4-(5-benzamido-2-(2-(benzylamino)-2-

benzene protons), 8.24 (bs, 3H, NH₃), 10.07 (s, 1H, PhCONH),

10.11 (s, 1H, NHCOOCH₂Ph) ppm. MS (ESI), m/z: 402 [M + H]⁺.

oxoethoxy)benzamido)phenyl) cyclopropyl)carbamate (26b):

Synthesised from the carboxylic acid 25b as described as for

26a. Yield = 30 %; mp = 215-218 °C; recrystallization solvent =

Benzyl

4-(4-(2-aminocyclopropyl)phenylcarbamoyl)-2-(4-

methylpiperazin-1-yl)phenylcarbamate hydrochloride (3c):

Synthesised from the tert-butyl carbamate 14 as described as

for 3j. Yield = 60 %; mp = 190-192 °C; recrystallization solvent =

acetonitrile/methanol; ¹H NMR (400 MHz, DMSO-d₆) δ 1.21-1.29

(m, 1H, cyclopropane CHH), 1.58-1.65 (m, 1H, cyclopropane

1

acetonitrile/methanol; H NMR (400 MHz, CDCl₃) δ 1.40 (s, 9H,

NHCOOC(CH₃)₃), 1.44-1.52 (m, 1H, cyclopropane CHH), 1.64-

1.73 (m, 1H, cyclopropane CHH), 2.34-2.47 (m, 1H,

cyclopropane CHNHBoc), 3.58-3.67 (m, 1H, cyclopropane

PhCH), 4.38-4.41 (m, 2H, CH₂CONHCH₂Ph), 4.54 (s, 2H,

CH₂CONHCH₂Ph), 5.82-5.84 (d, 1H, NHCOOC(CH₃)₃), 7.14-

7.16 (d, 1H, benzene proton), 7.19-7.35 (m, 7H, benzene

protons), 7.42-7.59 (m, 6H, benzene protons, CH₂CONHCH₂Ph),

7.68-7.72 (dd, 1H, benzene proton), 7.93-7.97 (m, 2H, benzene

protons), 8.13-8.15 (d, 1H, benzene proton), 9.25 (s, 1H,

CONHPhcyclopropyl), 9.45 (s, 1H, NHCOPh), ppm. MS (ESI)

m/z: 635 [M + H]⁺.

+

CHH), 2.11-2.20 (m, 1H, cyclopropane CHNH₃), 2.31 (s, 3H,

NCH₃), 2.69-2.79 (m, 4H, CH₃N(CH₂)₂at piperazine-C3,C5),

2.91-2.97 (m, 1H, cyclopropane PhCH), 3.16-3.30 (m, 4H,

PhN(CH₂)₂at piperazine-C2,C6), 5.23 (s, 2H, NHCOOCH₂Ph),

7.13-7.16 (d, 2H, benzene protons), 7.34-7.48 (m, 5H, benzene

protons), 7.70-7.72 (d, 2H, benzene protons), 7.79-7.86 (m, 2H,

benzene protons), 8.01-8.03 (d, 1H, benzene proton), 8.56 (bs,

+

3H, NH₃), 8.74 (bs, 1H, PhCONH), 10.27 (bs, 1H,

General

cyclopropylamines hydrochlorides 2b, 3a,c,h-n, 4f.

Example: Benzyl (2-((4-(2-

procedure

for

the

synthesis

of

the

NHCOOCH₂Ph) ppm; MS (ESI) m/z: 500 [M + H]⁺.

Benzyl

(5-((4-(2-aminocyclopropyl)phenyl)carbamoyl)-2-

phenoxyphenyl)carbamate hydrochloride (3h): Synthesised

from the tert-butyl carbamate 19a as described as for 3j. Yield =

aminocyclopropyl)phenyl)carbamoyl)phenyl)carbamate

hydrochloride (3j). A 4M HCl solution in 1,4-dioxane (1.0 mL,

4.20 mmol) was added to a solution of 22a (0.06 g, 0.12 mmol)

in THF (2 mL). The reaction was stirred at room temperature for

5 h; then the solvent was removed in vacuo and the product was

triturated with a mixture of diethyl ether/petroleum ether and was

filtered to obtain 3j as a pure colourless solid. Yield = 75 %; mp

68 %; mp

=

198-200 °C; recrystallization solvent

=

acetonitrile/methanol; ¹H NMR (400 MHz, DMSO-d₆) δ 1.21-1.30

(m, 1H, cyclopropane CHH), 1.58-1.66 (m, 1H, cyclopropane

+

CHH), 2.10-2.20 (m, 1H, cyclopropane CHNH₃), 2.90-2.98 (m,

1H, cyclopropane PhCH), 5.13 (s, 2H, NHCOOCH₂Ph), 6.94-

6.96 (d, 2H, benzene protons), 7.03-7.05 (d, 2H, benzene

protons), 7.12-7.16 (m, 3H, benzene protons), 7.39 (m, 7H,

benzene protons), 7.70 (m, 3H, benzene protons), 8.30 (bs, 3H,

1

= 150-152 °C; recrystallization solvent = toluene; H NMR (400

MHz, DMSO-d₆) δ 1.21-1.30 (m, 1H, cyclopropane CHH), 1.57-

1.65 (m, 1H, cyclopropane CHH), 2.11-2.20 (m, 1H,

+

NH₃), 9.33 (s, 1H, PhCONH), 10.19 (s, 1H, NHCOOCH₂Ph)

+

cyclopropane CHNH₃), 2.90-2.98 (m, 1H, cyclopropane PhCH),

ppm. MS (ESI), m/z: 494 [M + H]⁺.

9

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

Benzyl

(5-((4-(2-aminocyclopropyl)phenyl)carbamoyl)-2-

acetonitrile/methanol; ¹H NMR (400 MHz, DMSO-d₆) δ 1.21-1.28

(m, 1H, cyclopropane CHH), 1.57-1.66 (m, 1H, cyclopropane

(phenylthio)phenyl)carbamate

hydrochloride

(3i):

+

Synthesised from the tert-butyl carbamate 19b as described as

for 3j. Yield = 68 %; mp = 227-229 °C; recrystallization solvent =

methanol; ¹H NMR (400 MHz, DMSO-d₆) δ 1.22-1.29 (m, 1H,

cyclopropane CHH), 1.57-1.66 (m, 1H, cyclopropane CHH),

CHH), 2.10-2.20 (m, 1H, cyclopropane CHNH₃), 2.90-2.99 (m,

1H, cyclopropane PhCH), 4.34-4.39 (m, 2H, CH₂CONHCH₂Ph),

4.75 (s, 2H, CH₂CONHCH₂Ph), 7.16-7.19 (m, 3H, benzene

protons), 7.25-7.31 (m, 5H, benzene protons), 7.51-7.63 (m, 5H,

benzene protons), 7.74-7.78 (dd, 1H, benzene proton), 7.92-

7.98 (m, 2H, benzene protons), 8.15-8.19 (m, 2H, benzene

+

2.11-2.20 (m, 1H, cyclopropane CHNH₃), 2.90-2.99 (m, 1H,

cyclopropane PhCH), 5.18 (s, 2H, NHCOOCH₂Ph), 6.94-6.96 (d,

2H, benzene protons), 7.03-7.05 (d, 2H, benzene protons), 7.12-

7.21 (m, 3H, benzene protons), 7.34-7.40 (m, 7H, benzene

protons), 7.64-7.72 (m, 3H, benzene protons), 8.30 (bs, 3H,

+

protons), 8.29 (m, 1H, CONHPh-cyclopropyl) 8.54 (bs, 3H, NH₃),

9.97 (s, 1H, CH₂CONHCH₂Ph), 10.18 (s, 1H, NHCOPh). ppm.

MS (ESI), m/z: 535 [M + H]⁺.

Benzyl (1-((4-(1-aminocyclopropyl)-phenyl)-amino)-1-oxo-3-

+

NH₃), 9.79 (s, 1H, PhCONH), 10.56 (s, 1H, NHCOOCH₂Ph)

ppm. MS (ESI), m/z: 510 [M + H]⁺.

phenylpropan-2-yl)-carbamate

hydrochloride

(4f):

Benzyl

(2-((4-(2-aminocyclopropyl)phenyl)carbamoyl)-5-

Synthesized from the tert-butyl carbamate 32 as described as

for 3j. Yield = 93 %, mp > 250 °C; recrystallization solvent =

methanol/THF; ¹H-NMR (400 MHz, DMSO-d₆): δ 1.16-1.18 (t, 2H,

CH₂CH₂cyclopropane), 1.32-1.35 (t, 2H, CH₂CH₂cyclopropane),

2.83-2.89 (m, 1H, PhCHHCH(NH)CO), 3.01-3.06 (m, 1H,

PhCHHCH(NH)CO), 4.40-4.45 (m, 1H, PhCH₂CH(NH)CO), 4.97

(s, 2H, PhCH₂O), 7.19-7.23 (t, 2H, benzene protons), 7.26-7.32

(t, 4H, benzene protons), 7.32-7.35 (t, 4H, benzene protons),

7.37-7.39 (d, 2H, benzene protons), 7.62-7.64 (d, 2H, benzene

protons), 7.73-7.75 (d, 1H, PhCH₂OCONH), 8.73 (br s, 3H,

bromophenyl)carbamate hydrochloridrate (3k): Synthesised

from the tert-butyl carbamate 22b as described as for 3j. Yield =

65 %; mp

=

206-208 °C; recrystallization solvent

=

acetonitrile/methanol; ¹H NMR (400 MHz, DMSO-d₆,) δ 1.22-

1.29 (m, 1H, cyclopropane CHH), 1.58-1.66 (m, 1H,

+

cyclopropane CHH), 2.11-2.20 (m, 1H, cyclopropane CHNH₃),

2.90-2.98 (m, 1H, cyclopropane PhCH), 5.23 (s, 2H,

NHCOOCH₂Ph), 7.16-7.24 (m, 1H, benzene proton), 7.33-7.42

(m, 4H, benzene protons), 7.45-7.49 (dd, 1H, benzene proton),

7.75-7.77 (d, 1H, benzene proton), 8.14-8.16 (d, 1H, benzene

+

NH₃), 10.31 (s, 1H, CONHPh) ppm. MS (ESI), m/z: 466 [M +

H]⁺.

+

proton), 8.22-8.24 (d, 1H, PhCONH), 8.77 (bs, 3H, NH₃), 10.30

(s, 1H, NHCOOCH₂Ph), ppm. MS (ESI), m/z: 480 [M + H]⁺.

Benzyl (4-((4-(2-aminocyclopropyl)phenyl)carbamoyl)-[1,1'-

biphenyl]-3-yl)carbamate hydrochloride (3l): Synthesised

from the tert-butyl carbamate 22c as described as for 3j. Yield =

General procedure for the synthesis of the tert-butyl

carbamates 9, 22a-c. Example: Benzyl (2-((4-(2-((tert-

butoxycarbonyl)amino)cyclopropyl)phenyl)carbamoyl)phen

yl)carbamate

(22a):

N-(3-Dimethylaminopropyl)-N′-

65 %; mp

=

200-202 °C; recrystallization solvent

=

ethylcarbodiimide hydrochloride (EDC × HCl) (0.06 g, 0.32

mmol) and triethylamine (0.05 mL, 0.80 mmol) were added to a

solution of 2-(((benzyloxy)carbonyl)amino)benzoic acid 21a

acetonitrile/methanol; ¹H NMR (400 MHz, DMSO-d₆,) δ 1.22-

1.30 (m, 1H, cyclopropane CHH), 1.57-1.63 (m, 1H,

+

cyclopropane CHH), 2.11-2.20 (m, 1H, cyclopropane CHNH₃),

(0.05

g,

0.20

mmol)

and

tert-butyl

(2-(4-

2.90-2.99 (m, 1H, cyclopropane PhCH), 5.15 (s, 2H,

NHCOOCH₂Ph), 7.16-2.21 (m, 2H, benzene protons), 7.23-2.28

(m, 1H, benzene proton), 7.32-7.39 (m, 4H, benzene protons),

7.41-7.43 (m, 1H, benzene proton), 7.46-7.51 (m, 2H, benzene

protons), 7.56-7.60 (m, 4H, benzene protons), 7.65-7.78 (m, 1H,

benzene proton), 7.98-8.00 (d, 1H, benzene proton), 8.21-8.23

(d, 1H, benzene proton), 8.59 (bs, 3H, NH₃), 9.91 (s, 1H,

PhCONH), 10.17 (s, 1H, NHCOOCH₂Ph) ppm. MS (ESI), m/z:

478 [M + H]⁺.

aminophenyl)cyclopropyl)carbamate 8^[12](0.07 g, 0.28 mmol) in

dry DCM (3 mL). After 1 h the reaction was quenched with water

and extracted with DCM (3 × 5 mL). Combined organic layers

were washed with saturated sodium chloride solution (3 × 5 mL),

dried over anhydrous sodium sulfate, filtered and concentrated

in vacuo. The product was purified by silica gel chromatography

eluting with ethyl acetate/n-hexane 1/3 to obtain the pure tert-

butyl carbamate 22a. Yield = 85 %; mp = 212-215 °C;

recrystallization solvent = acetonitrile/methanol; ¹H NMR (400

MHz, CDCl₃) δ 1.42 (s, 9H, NHCOOC(CH₃)₃), 1.44-1.51 (m, 1H,

cyclopropane CHH), 1.64-1.73 (m, 1H, cyclopropane CHH),

2.39-2.45 (m, 1H, cyclopropane CHNHCOOC(CH₃)₃), 3.58-3.67

(m, 1H, cyclopropane PhCH), 5.18 (s, 2H, NHCOOCH₂Ph),

5.81-5.83 (d, 1H, NHCOOC(CH₃)₃), 7.13-7.24 (m, 3H, benzene

protons), 7.26-7.31 (m, 1H, benzene proton), 7.32-7.36 (m, 4H,

benzene protons), 7.45-7.51 (m, 1H, benzene proton), 7.53-7.58

(m, 2H, benzene protons), 7.74-7.89 (m, 1H, benzene proton),

8.27-8.31 (dd, 1H, benzene proton), 8.82 (s, 1H, PhCONH), 9.35

(s, 1H, NHCOOCH₂Ph) ppm. MS (ESI) m/z: 502 [M + H]⁺.

+

N-(4-(2-aminocyclopropyl)phenyl)-5-benzamido-2-(2-oxo-2-

(phenylamino)ethoxy)benzamide

hydrochloride

(3m):

Synthesised from the tert-butyl carbamate 26a as described as

for 3j. Yield = 70 %; mp = 190-192 °C; recrystallization solvent =

acetonitrile/methanol; ¹H NMR (400 MHz, DMSO-d₆) δ 1.22-1.29

(m, 1H, cyclopropane CHH), 1.58-1.66 (m, 1H, cyclopropane

+

CHH), 2.11-2.20 (m, 1H, cyclopropane CHNH₃), 2.90-2.99 (m,

1H, cyclopropane PhCH), 4.74 (s, 2H, CH₂CONHPh), 7.03-7.09

(m, 1H, benzene proton), 7.16-7.22 (m, 3H, benzene protons),

7.31-7.37 (m, 2H, benzene protons), 7.52-7.63 (m, 7H, benzene

protons), 7.71-7.75 (dd, 1H, benzene proton), 7.93-7.99 (m, 2H,

benzene protons), 8.19-7.21 (d, 1H, benzene proton), 8.94 (bs,

Benzyl

(4-((4-(2-((tert-

butoxycarbonyl)amino)cyclopropyl)phenyl)carbamoyl)phen

yl) carbamate (9): Synthesised from the carboxylic acid 7 as

described as for 22a. Yield = 80 %; mp = 203-205 °C;

recrystallization solvent = acetonitrile/methanol; ¹H NMR (400

MHz, CDCl₃) δ 1.42 (s, 9H, NHCOOC(CH₃)₃), 1.45-1.52 (m, 1H,

cyclopropane CHH), 1.65-1.72 (m, 1H, cyclopropane CHH),

2.40-2.46 (m, 1H, cyclopropane CHNHCOOC(CH₃)₃), 3.49-3.66

(m, 1H, cyclopropane PhCH), 5.16 (s, 2H, NHCOOCH₂Ph),

+

3H, NH₃), 9.60 (s, 1H, CONHPh-cyclopropyl), 9.93 (s, 1H,

CH₂CONHPh), 10.11 (s, 1H, NHCOPh) ppm. MS (ESI), m/z: 521

[M + H]⁺.

N-(4-(2-aminocyclopropyl)phenyl)-5-benzamido-2-(2-

(benzylamino)-2-oxoethoxy)benzamide (3n): Synthesized

from the tert-butyl carbamate 26b as described as for 3j. Yield =

68%; mp

=

218-220 °C; recrystallization solvent

=

10

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

5.82-5.84 (d, 1H, NHCOOC(CH₃)₃), 7.20-7.24 (m, 2H, benzene

protons), 7.26-7.32 (m, 1H, benzene proton), 7.33-7.36 (m, 4H,

benzene protons), 7.55-7.58 (m, 2H, benzene protons); 7.61-

7.64 (m, 2H, benzene protons), 7.96-7.99 (m, 2H, benzene

protons), 8.70 (s, 1H, NHCOOCH₂Ph), 9.06 (s, 1H, PhCONH)

ppm. MS (ESI) m/z: 502 [M + H]⁺.

to afford an oily residue that was chromatographed over silica

gel by eluting with chloroform:methanol 10:1 to provide the

amine ester derivative 11 as a yellow solid. Yield = 77 %; mp =

128-130 °C; recrystallization solvent = cyclohexane; ¹H NMR

(400 MHz, CDCl₃): δ 1.58 (s, 9H, COOC(CH₃)₃), 2.39 (s, 3H,

NCH₃), 2.56-2.61 (t, 4H, CH₃N(CH₂)₂piperazine-C3,C5), 2.95-

2.99 (t, 4H, PhN(CH₂)₂piperazine C2,C6), 4.35 (bs, 2H, PhNH₂),

6.68-2.70 (d, 1H, benzene proton), 7.62-7.64 (d, 1H, benzene

proton), 7.71 (s, 1H, benzene proton) ppm. MS (ESI) m/z: 292

[M + H]⁺.

Benzyl

(5-bromo-2-((4-(2-((tert-

butoxycarbonyl)amino)cyclopropyl)phenyl)carbamoyl)phen

yl) carbamate (22b): Synthesised from the carboxylic acid 21b

as described as for 22a. Yield = 80 %; mp = 222-223 °C;

1

recrystallization solvent = methanol; H NMR (400 MHz, CDCl₃)

Tert-butyl

4-(benzyloxycarbonylamino)-3-(4-

δ

1.42 (s, 9H, -NHCOOC(CH₃)₃), 1.44-1.52 (m, 1H,

methylpiperazin-1-yl)benzoate (12): Benzyl chloroformate (2.1

mmol, 0.3 mL) was slowly added to a solution of tert-butyl 4-

amino-3-(4-methylpiperazin-1-yl)benzoate 11 (1.72 mmol; 0.50

g) in dry THF (10 mL) and triethylamine (2.1 mmol, 0.29 mL) at

0 °C. The resulting mixture was stirred at room temperature for

1.5 h, then was quenched with water (20 mL) and extracted with

DCM (3 × 20 mL). The organic phases were washed with brine

(2 × 50 mL), dried by sodium sulfate and concentrated to afford

a residue that was chromatographed on silica gel eluting with

ethyl acetate/chloroform 1/1 to provide pure 12 as an oil. Yield =

72 %; ¹H NMR (400 MHz, CDCl₃): δ 1.60 (s, 9H, COOC(CH₃)₃),

2.39 (s, 3H, NCH₃), 2.60-2.64 (t, 4H, CH₃N(CH₂)₂piperazine-

C3,C5), 2.89-2.93 (t, 4H, PhN(CH₂)₂piperazine C2,C6), 5.28 (s,

2H, NHCOOCH₂Ph), 7.15-7.17 (d, 1H, benzene proton), 7.37-

7.47 (m, 5H, benzene protons), 7.69-7.72 (m, 2H, benzene

protons), 8.69 (bs, 1H, NHCOOCH₂Ph) ppm. MS (ESI) m/z: 426

[M + H]⁺.

cyclopropane CHH), 1.65-1.73 (m, 1H, cyclopropane CHH),

2.39-2.46 (m, 1H, cyclopropane CHNHCOOC(CH₃)₃), 3.58-3.66

(m, 1H, cyclopropane PhCH), 5.16 (s, 2H, NHCOOCH₂Ph),

5.83-5.85 (d, 1H, NHCOOC(CH₃)₃), 7.19-7.24 (m, 2H, benzene

protons), 7.26-7.31 (m, 1H, benzene proton), 7.33-7.36 (m, 4H,

benzene protons), 7.46-7.50 (dd, 1H, benzene proton), 7.54-

7.58 (m, 2H, benzene protons), 7.84-7.86 (d, 1H, benzene

proton), 8.14-8.16 (d, 1H, benzene proton), 9.14 (s, 1H,

PhCONH), 9.44 (s, 1H, NHCOOCH₂Ph) ppm. MS (ESI) m/z: 580

[M + H]⁺.

Benzyl

(4-((4-(2-((tert-

butoxycarbonyl)amino)cyclopropyl)phenyl)carbamoyl)-[1,1'-

biphenyl]-3-yl)carbamate (22c): Synthesised from the

carboxylic acid 21c as described as for 22a. Yield = 82 %; mp =

217-219 °C; recrystallization solvent = acetonitrile/methanol; H

NMR (400 MHz, CDCl₃) δ 1.40 (s, 9H, NHCOOC(CH₃)₃), 1.44-

1.53 (m, 1H, cyclopropane CHH), 1.64-1.72 (m, 1H,

1

General procedure for the synthesis of the benzoic acids 13

cyclopropane CHH), 2.39-2.46 (m, 1H, cyclopropane CHNHBoc), and 18a,b. Example: 4-(Benzyloxycarbonylamino)-3-(4-

3.58-3.65 (m, 1H, cyclopropane PhCH), 5.18 (s, 2H,

NHCOOCH₂Ph), 5.84-5.86 (d, 1H, NHCOOC(CH₃)₃), 7.20-7.24

(m, 2H, benzene protons), 7.26-7.31 (m, 1H, benzene proton),

7.32-7.40 (m, 5H, benzene protons), 7.42-7.49 (m, 2H, benzene

protons), 7.53-7.59 (m, 4H, benzene protons), 7.61-7.65 (m, 1H,

benzene proton), 7.96-7.98 (d, 1H, benzene proton), 8.00-8.02

(d, 1H, benzene proton), 9.11 (s, 1H, -PhCONH), 9.36 (s, 1H,

NHCOOCH₂Ph) ppm. MS (ESI) m/z: 578 [M + H]⁺.

Tert-butyl 3-(4-methylpiperazin-1-yl)-4-nitrobenzoate (10): A

suspension of tert-butyl 3-fluoro-4-nitrobenzoate (7.76 mmol,

2.00 g), dry potassium carbonate (23.28 mmol, 3.22 g) and N-

methylpiperazine (23.28 mmol, 2.58 mL) was stirred in dry DMF

(10 mL) at 90 °C for 5 h in a sealed tube. After this time, the

reaction was quenched by water (50 mL) and extracted with

ethyl acetate (3 × 30 mL), washed with brined (2 × 50 mL) and

dried with sodium sulfate. The collected organic phases were

concentrated, and the residue was purified by chromatography

on silica gel 60 eluting with ethyl acetate to obtain pure 10 as a

yellow solid. Yield = 76 %; mp = 153-155 °C; recrystallization

solvent = toluene; ¹H NMR (400 MHz, CDCl₃) 1.60 (s, 9H,

COOC(CH₃)₃), 2.37 (s, 3H, NCH₃), 2.57-2.60 (t, 4H, CH₃N(CH₂)₂

piperazine-C3,C5), 3.18-8.21 (t, 4H, PhN(CH₂)₂piperazine-

C2,C6), 7.07-7.09 (d, 1H, benzene proton), 8.03-8.05 (d, 1H,

benzene proton), 8.37 (s, 1H, benzene proton) ppm. MS (ESI)

m/z: 322 [M + H]⁺.

methylpiperazin-1-yl)benzoic acid (13): A solution of tert-butyl

4-(benzyloxycarbonylamino)-3-(4-methylpiperazin-1-yl)benzoate

12 (0.47 mmol, 0.2 g) and trifluoroacetic acid (9.4 mmol, 0.72

mL) in dry DCM (5 mL) was stirred at room temperature

overnight. The solvent was removed, and the crude residue was

purified on silica gel chromatography eluting with ethyl

acetate/chloroform 1/1 to furnish the pure 13 as a colorless solid.

Yield = 83%; mp = 191-193 °C; recrystallization solvent =

1

acetonitrile/methanol; H NMR (400 MHz, DMSO-d₆) δ 2.87 (s,

3H, NCH₃), 2.99-3.12 (m, 4H, CH₃N(CH₂)₂piperazine-C3,C5),

3.44-3.48 (t, 4H, PhN(CH₂)₂piperazine-C2,C6), 5.23 (s, 2H,

NHCOOCH₂Ph), 7.36-7.47 (m, 5H, benzene protons), 7.70 (s,

1H, benzene proton), 7.75-7.77 (d, 1H, benzene proton), 8.04-

8.06 (d, 1H, benzene proton), 8.76 (bs, 1H, NHCOOCH₂Ph),

9.72 (bs, 1H, NH⁺), 12.88 (bs, 1H, COOH) ppm. MS (ESI) m/z:

368 [M - H]^-.

3-(((Benzyloxy)carbonyl)amino)-4-phenoxybenzoic

acid

(18a): Synthesized from 17a as described as for 13. Yield =

71 %; mp

=

235-237 °C; recrystallization solvent

=

1

acetonitrile/methanol; H NMR (400 MHz, DMSO-d₆): δ 5.15 (s,

2H, NHCOOCH₂Ph), 7.01-7.03 (d, 1H, benzene proton), 7.05-

7.13 (m, 3H, benzene protons), 7.25-7.31 (m, 1H, benzene

proton), 7.31-7.39 (m, 6H, benzene protons), 7.77-7.81 (dd, 1H,

benzene proton), 8.44 (s, 1H, NHCOOCH₂Ph), 8.44-8.46 (d, 1H,

benzene proton), 12.41 (bs, 1H, COOH) ppm. MS (ESI) m/z:

362 [M - H]^-.

Tert-butyl 4-amino-3-(4-methylpiperazin-1-yl)benzoate (11):

A

suspension of tert-butyl 3-(4-methylpiperazin-1-yl)-4-

3-(((benzyloxy)carbonyl)amino)-4-(phenylthio)benzoic acid

(18b): Synthesized from 17b as described as for 13. Yield =

nitrobenzoate 10 (2.49 mmol, 0.8 g) in methanol (30 mL) and

10% palladium on charcoal (0.12 mmol, 0.13 g) was placed in a

Parr apparatus and hydrogenated at 50 psi and 25 °C for 5 h.

Afterwards, palladium was filtered and methanol was evaporated

68 %; mp

=

221-223 °C; recrystallization solvent

=

1

acetonitrile/methanol; H NMR (400 MHz, DMSO-d₆): δ 5.14 (s,

2H, NHCOOCH₂Ph), 7.25-7.37 (m, 10H, benzene protons),

11

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

7.41-7.43 (d, 1H, benzene proton), 7.80-7.85 (dd, 1H, benzene

proton), 8.46-8.48 (d, 1H, aomatic proton), 9.44 (s, 1H,

NHCOOCH₂Ph), 12.65 (bs, 1H, COOH) ppm. MS (ESI) m/z: 378

[M - H]^-.

then benzyl chloroformate (0.08 mL, 0.60 mmol) was added

dropwise at 0 °C to the mixture. After 2 h, the reaction was

quenched with water and extracted with ethyl acetate (3 × 10

mL). Combined organic layers were washed with saturated

sodium chloride solution (3 × 20 mL), dried over anhydrous

sodium sulfate, filtered and concentrated in vacuo. The product

was triturated in petroleum ether and the colourless solid 17b

was filtered. Yield = 63 %; mp = 123-125 °C; recrystallization

solvent = cyclohexane; ¹H NMR (400 MHz, CDCl₃): δ 1.55 (s, 9H,

COOC(CH₃)₃), 5.16 (s, 2H, NHCOOCH₂Ph), 7.21-7.26 (m, 1H,

benzene proton), 7.27-7.30 (m, 1H, benzene proton), 7.30-7.32

(m, 2H, benzene protons), 7.33-7.36 (m, 6H, benzene protons),

7.47-7.49 (d, 1H, benzene proton), 7.85-7.89 (dd, 1H, benzene

proton), 8.33 (s, 1H, NHCOOCH₂Ph), 8.35-8.37 (d, 1H, benzene

proton) ppm. MS (ESI) m/z: 436 [M + H]⁺.

General procedure for the synthesis of tert-butyl 3-nitro-4-

phenoxybenzoate

(15a)

and

tert-butyl

3-nitro-4-

(phenylthio)benzoate (15b). Example: Tert-butyl 3-nitro-4-

(phenylthio)benzoate (15b): Benzenethiol (0.15 g, 1.40 mmol)

and anhydrous potassium carbonate (0.48 g, 3.49 mmol) were

added to a solution of tert-butyl 4-chloro-3-nitrobenzoate (0.30 g,

1.16 mmol) in dry DMF. The resulting mixture was stirred at

100 °C for 5 h, then the reaction was quenched with water and

extracted with ethyl acetate (3 × 10 mL). Combined organic

layers were washed with saturated solution of sodium chloride (2

× 10 mL), dried over anhydrous sodium sulfate, filtered and

concentrated in vacuo. The crude residue was purified on silica

gel chromatography eluting with ethyl acetate/n-hexane 1/3 to

furnish the product 15b. Yield = 70%; mp = 124-126 °C;

recrystallization solvent = cyclohexane; ¹H NMR (400 MHz,

CDCl₃): δ 1.57 (s, 9H, COOC(CH₃)₃), 7.20-7.26 (m, 1H, benzene

proton), 7.30-7.37 (m, 4H, benzene protons), 7.49-7.51 (d, 1H,

benzene proton), 8.17-8.21 (dd, 1H, benzene proton), 8.60-8.62

(d, 1H, benzene proton) ppm. MS (ESI) m/z: 332 [M + H]⁺.

Tert-butyl

3-(((benzyloxy)carbonyl)amino)-4-

phenoxybenzoate (17a): Synthesized from 16a as described as

for 17b. Yield = 67 %; mp = 132-134 °C; recrystallization solvent

= cyclohexane; ¹H NMR (400 MHz, CDCl₃): δ 1.54 (s, 9H,

COOC(CH₃)₃), 5.14 (s, 2H, NHCOOCH₂Ph), 7.00-7.04 (m, 2H,

benzene proton), 7.06-7.13 (m, 2H, benzene protons), 726-7.31

(m, 1H, benzene proton), 7.31-7.37 (m, 6H, benzene protons),

7.64-7.68 (dd, 1H, benzene proton), 8.35 (s, 1H,

NHCOOCH₂Ph), 8.44-8.46 (d, 1H, benzene proton) ppm. MS

(ESI) m/z: 420 [M + H]⁺.

Tert-butyl 3-nitro-4-phenoxybenzoate (15a): Synthesized as

described for 15b. Yield

= 72 %; mp = 135-137 °C;

recrystallization solvent = cyclohexane/toluene; ¹H NMR (400

MHz, CDCl₃): δ 1.55 (s, 9H, COOC(CH₃)₃), 6.99-7.03 (m, 2H,

benzene protons), 7.07-7.13 (m, 1H, benzene proton), 7.16-7.18

(d, 1H, benzene proton), 7.32-7.37 (m, 2H, benzene protons),

8.17-8.21 (dd, 1H, benzene proton), 8.50-8.52 (d, 1H, benzene

proton) ppm. MS (ESI) m/z: 316 [M + H]⁺.

2-(((benzyloxy)carbonyl)amino)benzoic

acid

(21a):

Synthesized from 20a as described as for 17b. Yield = 70 %; mp

= 205-208 °C; recrystallization solvent = acetonitile/methanol; ¹H

NMR (400 MHz, DMSO-d₆): δ 5.16 (s, 2H, NHCOOCH₂Ph),

7.14-7.20 (m, 1H, benzene proton), 7.25-7.31 (m, 1H, benzene

proton), 7.32-7.37 (m, 4H, benzene protons), 7.52-7.58 (m, 1H,

benzene proton), 7.98-8.03 (dd, 1H, benzene proton), 8.06-8.09

(dd, 1H, benzene proton), 10.27 (s, 1H, NHCOOCH₂Ph), 13.29

(bs, 1H, COOH) ppm. MS (ESI) m/z: 270 [M - H]^-.

2-(((Benzyloxy)carbonyl)amino)-4-bromobenzoic acid (21b):

Synthesized from 20b as described as for 17b. Yield = 60 %; mp

= >250 °C; recrystallization solvent = methanol; ¹H NMR (400

MHz, DMSO-d₆): δ 5.14 (s, 2H, NHCOOCH₂Ph), 7.25-7.31 (m,

1H, benzene proton), 7.32-7.36 (m, 4H, benzene protons), 7.39-

7.44 (dd, 1H, benzene proton), 7.91-7.93 (d, 1H, benzene

proton), 8.14-8.16 (d, 1H, aomatic proton), 10.37 (s, 1H,

NHCOOCH₂Ph), 13.22 (bs, 1H, COOH) ppm. MS (ESI) m/z: 348

[M - H]^-.

General procedure for the synthesis of tert-butyl 3-amino-4-

phenoxybenzoate

(16a)

and

tert-butyl

3-amino-4-

(phenylthio)benzoate (16b). Example: Tert-butyl 3-amino-4-

phenoxybenzoate (16a): 10% Palladium on charcoal (0.03 g,

0.03 mmol) was added under nitrogen atmosphere to a solution

of 15a (0.20 g, 0.63 mmol) in dry ethanol (50 mL). The resulting

mixture was degassed with nitrogen for 3 min, followed by

hydrogenation by using a Parr apparatus at 30 psi for 1 h. After

this time, the mixture was filtered and concentrated in vacuo to

obtain the pure colourless solid 16a. Yield = 95 %; mp = 122-

124 °C; recrystallization solvent = cyclohexane; ¹H NMR (400

MHz, DMSO-d₆): δ 1.56 (s, 9H, COOC(CH₃)₃), 4.49 (s, 2H, NH₂),

6.68-6.70 (d, 1H, benzene proton), 7.00-7,04 (m, 2H, benzene

protons), 7.08-7.13 (m, 1H, benzene proton), 7.32-7.38 (m, 2H,

benzene protons), 7.44-7.46 (d, 1H, benzene proton), 7.50-7.53

(m, 1H, benzene proton) ppm. MS (ESI) m/z: 286 [M + H]⁺.

3-(((benzyloxy)carbonyl)amino)-[1,1'-biphenyl]-4-carboxylic

acid (21c): Synthesized from 20c as described as for 17b. Yield

= 77 %; m.p. = >250 °C; recrystallization solvent = methanol; H

1

NMR (400 MHz, DMSO-d₆): δ 5.15 (s, 2H, NHCOOCH₂Ph),

7.25-7.31 (m, 1H, benzene proton), 7.32-7.42 (m, 5H, benzene

protons), 7.43-7.49 (m, 2H, benzene protons), 7.56-7.60 (m, 2H,

benzene protons), 7.63-7.67 (m, 1H, benzene protons), 7.79-

7.81 (d, 1H, benzene proton), 8.19-8.21 (d, 1H, benzene proton),

10.33 (s, 1H, NHCOOCH₂Ph), 13.25 (bs, 1H, COOH) ppm. MS

(ESI) m/z: 346 [M - H]^-.

Methyl 5-benzamido-2-hydroxybenzoate (23): A solution of

methyl 5-amino-2-hydroxybenzoate (0.20 g, 1.46 mmol) and

triethylamine (0.22 mL, 1.60 mmol) in dry DCM (4.0 mL) was

stirred at room temperature for 15 min, then the solution was

cooled to 0 °C and benzoyl chloride (0.17 mL, 1.46 mmol) was

added dropwise. After 2 h, the reaction was quenched with

water and extracted with DCM (3 × 10 mL). The combined

organic layers were washed with a saturated solution of sodium

Tert-butyl

3-amino-4-(phenylthio)benzoate

(16b):

Synthesized from 15b as described for 16a. Yield = 72 %; mp =

112-114 °C; recrystallization solvent = cyclohexane; ¹H NMR

(400 MHz, DMSO-d₆): δ 1.55 (s, 9H, COOC(CH₃)₃), 4.78 (s, 2H,

NH₂), 7.21-7.26 (m, 1H, benzene proton), 7.28-7.36 (m, 4H,

benzene protons), 7.38-7.40 (d, 1H, benzene proton), 7.46-7.48

(d, 1H, benzene proton), 7.78-7.82 (dd, 1H, benzene proton)

ppm. MS (ESI) m/z: 302 [M + H]⁺.

General procedure for the synthesis of benzyl carbamates

17a,b

and

21a-c.

Example:

Tert-butyl

3-

(((benzyloxy)carbonyl)amino)-4-(phenylthio)benzoate (17b):

Dry potassium carbonate (0.10 g, 0.70 mmol) was added to a

solution of 16b (0.15 g, 0.50 mmol) in dry THF (5 mL). The

resulted mixture was stirred at room temperature for 15 min,

12

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

chloride (2 × 20 mL), dried over anhydrous sodium sulfate,

filtered and concentrated in vacuo. The extract was triturated in

diethyl ether and the product 23, precipitated as colorless solid,

was filtered and rinsed with diethyl ether. Yield = 81 %; mp =

162-164 °C; recrystallization solvent = toluene; ¹H NMR (400

MHz, CDCl₃) δ 3.86 (s, 3H, COOCH₃), 7.01-7.03 (d, 1H,

benzene proton), 7.42-7.55 (m, 4H benzene protons), 7.93-7.97

(m, 2H, benzene portons), 8.11-8.13 (d, 1H, benzene proton),

9.76 (s, 1H, NHCOPh), 10.69 (s, 1H, OH) ppm. MS (ESI) m/z:

272 [M +H]⁺.

5-benzamido-2-(2-oxo-2-(phenylamino)ethoxy)benzoic acid

(25a): Synthesized from 24a as described as for 25b. Yield =

80 %; mp = > 250 °C; recrystallization solvent = methanol; ¹H

NMR (400 MHz, DMSO-d₆) δ 4.72 (s, 2H, CH₂CONHPh), 7.02-

7.06 (m, 1H, benzene proton), 7.09-7.11 (d, 1H, benzene

proton), 7.28-7.34 (m, 2H, benzene protons), 7.45-7.57 (m, 3H,

benzene protons), 7.58-7.63 (m, 2H, benzene protons), 7.76-

7.81 (dd, 1H, benzene proton), 7.93-7.98 (m, 2H, benzene

protons), 8.07-8.09 (d, 1H, benzene proton), 9.93 (s, 1H,

CH₂CONHPh), 10.13 (s, 1H, NHCOPh), 12.70 (bs, 1H, COOH)

ppm. MS (ESI) m/z: 389 [M - H]^-.

General procedure for the synthesis of methyl 5-benzamido-

2-(2-oxo-2-(phenylamino)ethoxy)benzoate (24a) and methyl

5-benzamido-2-(2-(benzylamino)-2-oxoethoxy)benzoate

General

procedure

for

the

synthesis

(4c)

of

and

2-

1-

phenylcyclopropane-1-carboxamide

(24b).

Example:

Methyl

5-benzamido-2-(2-oxo-2-

(24a): Dry potassium

phenylcyclopropane-1-carboxamide (4g). Example: 1-

Phenylcyclopropane-1-carboxamide (4g): To a solution of 1-

phenylcyclopropane-1-carboxylic acid (1.0 g, 6.17 mmol) in a

mixture of dry DCM/DMF 4/1 (20 mL + 5 mL) were added in

sequence triethylamine (3.44 mL, 24.66 mmol) and PyBOP

(4.01 g, 7.71 mmol), and the resulting mixture was left under

stirring at room temperature for 45 min. Afterwards, a 33%

ammonia aqueous solution (0.59 mL, 30.83 mmol) was added

and the final mixture was left under stirring at room temperature

for 24 h. At the end of the reaction, the reaction mixture was

concentrated and poured into water (50 mL) and then extracted

with ethyl acetate (4 × 50 mL). The organic layers were washed

in sequence with 2N HCl (2 × 20 mL), saturated sodium

bicarbonate solution (2 × 20 mL), and saturated sodium chloride

solution (1 × 20 mL), then were dried over anhydrous sodium

sulfate and concentrated under vacuum to furnish a crude

residue that was purified by silica gel column chromatography

eluting with a mixture ethyl acetate/n-hexane 1/1 to afford 4g as

a white powder. Yield = 84 %, mp = 98-100 °C, recrystallization

solvent: cyclohexane. ¹H-NMR (400 MHz, CDCl₃): δ 1.10-1.13 (q,

2H, CHH-CHH cyclopropane), 1.62-1.65 (q, 2H, CHH-CHH

cyclopropane), 5.33 (br s, 1H, CONHH), 5.72 (br s, 1H, CONHH),

7.33-7.35 (m, 1H, benzene proton), 7.37-7.41 (m, 2H, benzene

protons), 7.45-7.47 (m, 2H, benzene protons) ppm. MS (ESI),

m/z: 162 [M + H]⁺.

2-Phenylcyclopropane-1-carboxamide (4c): Synthesized from

2-phenylcyclopropane-1-carboxylic acid as described as for 4g.

Yield = 89.3 %, mp = 78-80 °C, recrystallization solvent:

cyclohexane. ¹H-NMR (400 MHz, CDCl₃): δ 1.31-1.35 (m, 1H,

PhCHCHHCH cyclopropane), 1.64-1.72 (m, 2H, CHCONH₂and

PhCHCHHCH cyclopropane), 2.52-2.57 (m, 1H, PhCHCH₂CH

cyclopropane), 5.36-5.39 (br s, 1H, CONHH), 5.60-5.63 (br s, 1H,

CONHH), 7.12-7.14 (m, 2H, benzene protons), 7.21-7.24 (m, 1H,

benzene proton), 7.31-7.33 (m, 2H, benzene protons) ppm. MS

(ESI), m/z: 162 [M + H]⁺.

Synthesis of 2-phenylcyclopropane-1-carbohydrazide (4d):

Hydrazine hydrate (0.07 mL, 1.42 mmol) was added to a

solution of methyl-2-phenylcyclopropane-1-carboxylate (0.05 g,

0.28 mmol) in methanol (10 mL), and the reaction was stirred at

room temperature overnight. After this time, the methanol was

removed in vacuo and the solid formed was triturated in diethyl

ether, filtered and washed with diethyl ether (3 × 5 mL) to afford

pure 4d. Yield: 78 %, mp 125-127 °C, recrystallization solvent:

(phenylamino)ethoxy)benzoate

carbonate (0.12 g, 0.88 mmol) and 2-bromo-N-phenylacetamide

(0.16 g, 0.74 mmol) were added to a solution of 23 (0.20 g, 0.74

mmol) in dry acetonitrile (5 mL). The reaction was stirred at

70 °C overnight then was quenched with water (30 mL), and the

precipitated product was filtered and dried. The solid was

purified on silica gel chromatography eluting with ethyl

acetate/n-hexane 1/2 to furnish pure 24a. Yield = 90 %; mp =

1

170-173 °C; recrystallization solvent = toluene/acetonitrile; H

NMR (400 MHz, CDCl₃) δ 3.83 (s, 3H, COOCH₃), 4.73 (s, 2H,

CH₂CONHPh), 7.04-7.10 (m, 1H, benzene proton), 7.15-7.17 (d,

1H, benzene proton), 7.32-7.38 (m, 2H, benzene protons), 7.42-

7.58 (m, 5H, benzene portons), 7.64-7.68 (dd, 1H, benzene

proton), 7.93-7.98 (m, 2H, benzene protons), 8.15-8.17 (d, 1H,

aromatc proton), 9.47 (s, 1H, NHCOPh), 9.57 (s, 1H,

CH₂CONHPh) ppm. MS (ESI) m/z: 405 [M + H]⁺.

Methyl

5-benzamido-2-(2-(benzylamino)-2-

oxoethoxy)benzoate (24b): Synthesized from 23 as described

as for 24a. Yield = 75 %; mp = 165-168 °C; recrystallization

solvent = toluene/acetonitrile; ¹H NMR (400 MHz, CDCl₃) δ 3.86

(s, 3H, COOCH₃), 4.38-4.41 (m, 2H, CH₂CONHCH₂Ph), 4.55 (s,

2H, CH₂CONHCH₂Ph), 7.15-7.17 (d, 1H, benzene proton), 7.22-

7.35 (m, 5H, benzene protons), 7.42-7.57 (m, 4H, benzene

protons), 7.93-7.98 (m, 2H, benzene protons), 8.15-8.17 (d, 1H,

benzene proton), 9.49 (s, 1H, NHCOPh) ppm. MS (ESI) m/z:

419 [M + H]⁺.

General procedure for the synthesis of 5-benzamido-2-(2-

oxo-2-(phenylamino)ethoxy)benzoic acid (25a) and 5-

benzamido-2-(2-(benzylamino)-2-oxoethoxy)benzoic

(25b). Example: Procedure for the synthesis of 5-

benzamido-2-(2-(benzylamino)-2-oxoethoxy)benzoic acid

(25b): A 2N aqueous solution of lithium hydroxide (0.02 g, 0.54

mmol) was added to a solution of 24b (0.15 g, 0.36 mmol) in

THF (5 mL), and the resulting mixture was stirred at room

temperature for 12 h. After this time, the THF was evaporated in

vacuo and the carboxylate product obtained was titrated with 2N

HCl aqueous solution, added at 0 °C dropwise until pH 1. The

colorless solid obtained 25b was filtered, washed with water and

dried in vacuo. Yield = 82 %; mp = 240-242 °C; recrystallization

acid

1

solvent = methanol; H NMR (400 MHz, DMSO-d₆) δ 4.35-4.39

(m, 2H, CH₂CONHCH₂Ph), 4.54 (s, 2H, CH₂CONHCH₂Ph), 7.08-

7.10 (d, 1H, benzene proton), 7.21-7.35 (m, 5H, benzene

protons), 7.45-7.57 (m, 2H, benzene protons), 7.76-7.80 (dd, 1H, ethanol; ¹H NMR (400 MHz, DMSO-d₆) δ 1.41 (m, 2H, CH₂

benzene proton), 7.93-7.98 (m, 2H, benzene protons), 8.07-8.09

(d, 1H, benzene proton), 8.27-8.30 (t, 1H, benzene proton),

10.13 (s, 1H, NHCOPh), 12.70 (bs, 1H, COOH) ppm. MS (ESI)

m/z: 403 [M - H]^-.

cyclopropane), 1.98 (m, 1H, CH cyclopropane), 2.40 (m, 1H, CH

cyclopropane), 4.08 (s, 2H, CONHNH₂), 7.23 (m, 5H, benzene

protons), 9.19 (s, 1H, CONHNH₂) ppm. MS (ESI), m/z: 176

[M+H]⁺

13

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

General procedure for the synthesis of tert-butyl (1-

phenylcyclopropyl)carbamates 27 and 30. Example: Tert-

1.52-1.55 (dd, 2H, CHH-CHH cyclopropane), 7.61-7.63 (d, 2H,

benzene protons), 8.15-8.17 (d, 2H, benzene protons), 12.48-

12.75 (br s, 1H, COOH). MS (ESI), m/z: 206 [M - H]^-.

butyl

(1-phenylcyclopropyl)carbamate

(27):

Diphenylphosphoryl azide (1.53 g, 5.55 mmol), triethylamine

(0.81 mL, 5.79 mmol) and tert-butanol (5.35 g, 6.92 mL, 72.4

mmol) were added to a solution of 1-phenylcyclopropane-1-

carboxylic acid (0.78 g, 4.83 mmol) in dry toluene (30 mL), and

the mixture was stirred at 105 °C under nitrogen atmosphere for

24 h. At the end of the reaction, the solvent was removed under

vacuum and the residue was purified by silica gel column

chromatography eluting with a mixture ethyl acetate/n-hexane

1/7 to give pure 27. Yield = 68.4 %, oil. ¹H-NMR (400 MHz,

CDCl₃): δ 1.25-1.30 (br d, 4H, CH₂CH₂cyclopropane), 1.47 (br s,

9H, COOC(CH₃)₃), 5.28 (br s, 1H, NHCOOC(CH₃)₃), 7.18-7.33

(m, 5H, benzene protons) ppm. MS (ESI), m/z: 234 [M + H]⁺.

Tert-butyl (1-(4-nitrophenyl)cyclopropyl)carbamate (30):

Yield = 68.3 %, mp = 122-124 °C, recrystallization solvent =

benzene. ¹H-NMR (400 MHz, CDCl₃): δ 1.37 (br m, 4H, CH₂CH₂

cyclopropane), 1.48 (s, 9H, COOC(CH₃)₃), 5.31 (br s, 1H,

NHCOOC(CH₃)₃), 7.32-7.34 (d, 2H, benzene protons), 8.16-8.18

(d, 2H, benzene protons) ppm. MS (ESI), m/z: 279 [M + H]⁺.

1-Phenylcyclopropan-1-amine hydrochloride (4e): A solution

of 27 (0.20 g, 0.86 mmol) in dry THF (5 mL) was treated with a

solution of 4N HCl in 1,4-dioxane (18.85 mL, 51.43 mmol) at

0 °C, and the resulting mixture was stirred at room temperature

for 24 h. At the end of the reaction, the solution was

concentrated under vacuum, and the resulting residue was

triturated with dry diethyl ether (10 mL), isolated by filtration and

washed over filter with dry diethyl ether to give 3 as a white

powder. Yield = 98 %, mp > 250 °C, recrystallization solvent:

methanol/THF. ¹H-NMR (400 MHz, DMSO-d₆): δ 1.19 (m, 2H,

Tert-butyl (1-(4-aminophenyl)-cyclopropyl)-carbamate (31):

10% Palladium on charcoal (0.017 g, 0.017 mmol) was added to

a solution of 30 (0.50 g, 1.82 mmol) in methanol (120 mL). The

system was degassed (N₂), then treated with H₂(30 psi) for 65

min. The mixture was filtered, washed over filter with methanol

and concentrated in vacuo. The resulting crude residue was

purified by silica gel column chromatography eluting with a

mixture ethyl acetate/n-hexane 3/1 to afford the pure 31. Yield =

77 %, oil. ¹H-NMR (400 MHz, CDCl₃): δ 1.12 (br s, 2H, CHH-

CHH cyclopropane), 1.18 (br s, 2H, CHH-CHH cyclopropane),

1.44 (s, 9H, COOC(CH₃)₃), 3.25-4.04 (br s, 2H, NH₂), 4.92-5.28

(br s, 1H, NHCOOC(CH₃)₃), 6.63-6.65 (d, 2H, benzene protons),

7.10-7.12 (d, 2H, benzene protons) ppm. MS (ESI), m/z: 249 [M

+ H]⁺.

Benzyl

(1-((4-(1-((tert-

butoxycarbonyl)amino)cyclopropyl)phenyl)amino)-1-oxo-3-

phenylpropan-2-yl)-carbamate (32): Triethylamine (0.17 mL,

1.21 mmol) and N-ethyl-N’-(3-dimethylaminopropyl)carbodiimide

hydrochloride (0.12 g, 0.60 mmol) were added to a mixture of N-

carbobenzyloxy-L-phenylalanine (0.18 g, 0.60 mmol), N-

hydroxybenzotriazole (0.09 g, 0.60 mmol) and 31 (0.10 g, 0.40

mmol) in dry DCM (6 mL), and the resulting mixture was stirred

for 24 h at room temperature. The reaction was poured into

water (50 mL) and extracted with DCM (3 × 10 mL). The organic

layers were washed with saturated sodium chloride solution (3 ×

10 mL), dried with anhydrous sodium sulfate and concentrated

under vacuum. The crude residue was purified by trituration with

a mixture of diethyl ether and petroleum ether to afford 32. Yield

1

CHH-CHH

cyclopropane),

1.39

(m,

2H,

CHH-CHH

= 70 %, mp = 116-118 °C, recrystallization solvent: toluene. H-

cyclopropane), 7.35-7.45 (m, 5H, benzene protons), 8.78 (br s,

NMR (400 MHz, CDCl₃): δ 1.18 (br s 2H, CHH-CHH

+

3H, NH₃). MS (ESI), m/z: 170 [M + H]⁺.

cyclopropane), 1.20 (br s 2H, CHH-CHH cyclopropane), 1.45 (s,

9H, COOC(CH₃)₃), 3.13-3.15 (m, 1H, Ph-CHH-CH(NH)CO),

3.20-3.22 (m, 1H, Ph-CHH-CH(NH)CO), 4.50 (m, 1H,

PhCH₂CH(NH)CO), 5.14 (s, 2H, PhCH₂OCO), 5.24 (br s, 1H,

PhCH₂OCONH), 5.40 (br s, 1H, NHCOOC(CH₃)₃), 7.07 (m, 1H,

benzene proton), 7.16-7.18 (m, 3H, benzene protons), 7.25-7.27

(m, 4H, benzene protons), 7.31-7.35 (m, 6H, benzene protons),

7.44 (br s, 1H, CONHPh) ppm. MS (ESI), m/z: 530 [M + H]⁺.

Biochemistry.

LSD1 enzyme inhibition assay. The complex of human

recombinant LSD1/CoREST protein was produced in E. coli as

separate proteins and co-purified following previously reported

procedures.^[27]The experiments were performed in 96 well half

area white plates (cat. 3693, Corning, Corning, NY) using a

mono-methylated H3-K4 peptide containing 21 amino acids

1-(4-Nitrophenyl)cyclopropane-1-carbonitrile

(28):

50%

Sodium hydroxide (7.9 mL, 197.6 mmol) was added dropwise at

room temperature to a mixture of 4-nitrophenylacetonitrile (4.0 g,

24.7 mmol), 1,2-dibromoethane (11.6 g, 5.32 mL, 61.7 mmol)

and tetrabutylammonium bromide (3.98 g, 12.4 mmol) in dry

acetonitrile (40 mL). Then, the resulting mixture was stirred at

40 °C for 8 h. Upon completion, the reaction mixture was poured

into water (50 mL) and extracted with ethyl acetate (3 × 30 mL).

The organic layers were washed with 2N potassium hydroxide (2

× 20 mL) and saturated sodium chloride solution (1 × 30 mL),

dried over anhydrous sodium sulfate and concentrated under

vacuum. The crude residue was purified by silica gel column

chromatography eluting with a mixture ethyl acetate/n-hexane

1:3 to afford 28. Yield = 85 %, mp = 113-115 °C, recrystallization

solvent: benzene.¹H-NMR (400 MHz, DMSO-d₆): δ 1.69-1.72 (dd, (custom synthesis done by Thermo Scientific) as substrate in 40

2H, CHH-CHH cyclopropane), 1.93-1.96 (dd, 2H, CHH-CHH

cyclopropane), 7.58-7.60 (d, 2H, benzene protons), 8.22-8.25 (d,

2H, benzene protons). MS (ESI), m/z: 189 [M + H]⁺.

µL volume of 50 mM Tris-HCl, pH 8.0 and 0.05 mg/ml BSA

buffer. The peptide purity was >95% as checked by analytical

high-pressure liquid chromatography and mass spectrometry.

The demethylase activity was estimated under aerobic

conditions and at room temperature by measuring the release of

H₂O₂produced during the catalytic process by the Amplex

UltraRed detection system coupled with horseradish peroxidase

(HRP). Briefly, 20 nM of LSD1/CoREST complex was incubated

at room temperature for 15 min in the absence and/or the

presence of various concentrations of the inhibitors, 50 µM

Amplex UltraRed (Life Technologies) and 0.023 µM HRP

(Sigma) in 50 mM Tris-HCl pH 8.0 and 0.05 mg/ml BSA. The

1-(4-Nitrophenyl)cyclopropane-1-carboxylic

acid

(29):

Compound 28 (2.6 g, 13.8 mmol) was suspended in water (16

mL), treated with 96% (w/w) sulfuric acid (11 mL) and stirred

under reflux overnight. Upon completion, the reaction mixture

was cooled and the resultant precipitate was filtered under

vacuum, washed over filter with water (30 mL), and dried

overnight under vacuum to give pure 29. Yield = 82 %, mp =

130-132 °C, recrystallization solvent: benzene. ¹H-NMR (400

MHz, DMSO-d₆): δ 1.23-1.26 (dd, 2H, CHH-CHH cyclopropane),

14

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

inhibitors were tested twice in duplicates at each concentration.

Tranylcypromine (Sigma) was used as control. After

preincubation of the enzyme with the inhibitor, the reaction was

initiated by addition of 4.5 μΜ of mono-methylated H3-K4

peptide. The conversion of the Amplex Ultra Red reagent to

Amplex UltroxRed was monitored by fluorescence (excitation at

510 nm, emission at 595 nm) for 12 min and by using a

microplate reader (Infinite 200, Tecan Group, Switzerland).

Arbitrary units were used to measure the level of H₂O₂produced

in the absence and/or in the presence of inhibition. The

maximum demethylase activity of LSD1/CoREST was obtained

in the absence of inhibitors and corrected for background

fluorescence in the absence of the substrate. The IC₅₀values

were calculated using GraphPad Prism version 4.0 (GraphPad

Software, San Diego, CA).

Glc6P, Glc6P-DH in 2% sodium bicarbonate); samples (25 µL)

were taken at time 0, 10, 20, 30 and 60 min added to 150 µL of

acetonitrile with verapamil 0.02 µM as Internal Standard (IS) to

stop the reaction. After centrifugation the supernatants were

analyzed by LC-MS/MS. A control sample without cofactors was

added in order to check the stability of test compounds in the

matrix after 60 min. Samples were analyzed on UFLC Shimadzu

AC20 coupled with a API 3200 Triple Quadrupole or on a 4500

Qtrap ABSciex. Compounds were analyzed either using acidic

or basic conditions. The percent of the area of test compound

remaining at the various incubation times were calculated in

respect to the area of compound at time 0 min.

Intrinsic Clearance: The rate constant, k (min^-1) derived for the

exponential decay equation (peak area/IS vs time) was used to

calculate the rate of intrinsic clearance (Cl_int) of the compound

using the following equation:

Cl_int(µL/min/mg) = k/microsomal conc. × 1000

where k = rate constant (min^-1)

Anti-MAO assays. Human recombinant MAO A and MAO B

were expressed in Pichia pastoris and purified as published.^[28]

Inhibition was measured by the horseradish peroxidase coupled-

assay using a Cary-Eclipse spectrofluorimeter. Assays were

performed using kynuramine (MAO A) and benzylamine (MAO

microsomal protein conc. = 0.5 mg protein/mL

B) as substrates in 50 mM Hepes/NaOH pH 7.5, 0.5% (v/v) Acknowledgements

reduced Triton X-100 after 15-min incubation of the enzyme with

the inhibitor.

This work was supported by PRIN 2016 (prot. 20152TE5PK)

Biology

(A.Mattevi, A.Mai), Ricerca Finalizzata 2013 PE-2013-02355271

(A.Mai), AIRC (IG-19162, PI: A.Mai; IG-11342, PI: A.Mattevi),

NIH (n. R01GM114306 - A.Mai), Fondazione Regionale Ricerca

Cell growth assays. The effect of 1-3 on cell proliferation were

evaluated against the AML MV4-11 and the APL NB4 cell lines

using the CellTiter-Fluor Cell Viability Assay (Promega, Madison, Bio-medica, Milan, Italy (n. 2015-0042 A. Mattevi) and Progetto

WI, USA) according to the manufacturer’s instructions. The cells

were incubated for 48 h with various inhibitor concentrations. An

equivalent of the CellTiter-Fluor reagent was then added, the

content was mixed and incubates for at least 90 min at 37 °C to

obtain a stable signal. The fluorescence was recorded using an

excitation wavelength of 360 nm and an emission at 535 nm.

IC₅₀values were calculated using GraphPad software.

di Ateneo “Sapienza” 2016 n. RG116154BED07FE9 (A.Mai) and

2017 n. RM11715C7CA6CE53 (D.R.) funds.

Conflict of interest

The authors declare no conflict of interest.

Keywords: histone demethylases • lysine specific demethylase

Gene modulation assays. Human APL NB4 cells were grown

in RPMI supplemented with 10% fetal bovine serum, 2 mM L-

glutamine, and antibiotics and maintained in a humidified tissue

1

•

drug discovery

•

structure–activity relationships

•

antiproliferative activity.

culture incubator at 37 °C in 5% CO₂. Cells were treated at the References

biochemical IC₅₀or with vehicle (DMSO). After 24 h the cells

[1]

aK. Helin, D. Dhanak, Nature 2013, 502, 480-488; bH. U.

Kaniskan, M. L. Martini, J. Jin, Chem Rev 2018, 118, 989-

1068.

D. Rotili, A. Mai, Genes Cancer 2011, 2, 663-679.

A. Maiques-Diaz, T. C. Somervaille, Epigenomics 2016, 8,

1103-1116.

were collected for RNA analysis. Total RNA was purified using

RNeasy Mini Kit (Qiagen, Valencia, CA), quantified and reverse

transcribed. mRNA levels were measured by quantitative RT-

PCR (Fast SYBR Green Master mix, Applied Biosystems Foster

City, CA) using specific primers and normalized against TBP

mRNA. Results are presented as fold induction relative to

vehicle treated cells (DMSO). Primers used in this study were:

[2]

[3]

[4]

[5]

M. G. Lee, C. Wynder, N. Cooch, R. Shiekhattar, Nature

2005, 437, 432-435.

aS. Saleque, J. Kim, H. M. Rooke, S. H. Orkin, Mol Cell

2007, 27, 562-572; bM. Wissmann, N. Yin, J. M. Muller, H.

Greschik, B. D. Fodor, T. Jenuwein, C. Vogler, R.

Schneider, T. Gunther, R. Buettner, E. Metzger, R.

Schule, Nat Cell Biol 2007, 9, 347-353.

J. Wang, K. Scully, X. Zhu, L. Cai, J. Zhang, G. G.

Prefontaine, A. Krones, K. A. Ohgi, P. Zhu, I. Garcia-

Bassets, F. Liu, H. Taylor, J. Lozach, F. L. Jayes, K. S.

Korach, C. K. Glass, X. D. Fu, M. G. Rosenfeld, Nature

2007, 446, 882-887.

K. Kosumi, Y. Baba, A. Sakamoto, T. Ishimoto, K. Harada,

K. Nakamura, J. Kurashige, Y. Hiyoshi, M. Iwatsuki, S.

Iwagami, Y. Sakamoto, Y. Miyamoto, N. Yoshida, E. Oki,

M. Watanabe, S. Hino, M. Nakao, H. Baba, Int J Cancer

2016, 138, 428-439.

S. Lim, A. Janzer, A. Becker, A. Zimmer, R. Schule, R.

Buettner, J. Kirfel, Carcinogenesis 2010, 31, 512-520.

J. H. Schulte, S. Lim, A. Schramm, N. Friedrichs, J.

Koster, R. Versteeg, I. Ora, K. Pajtler, L. Klein-Hitpass, S.

GFI-1b,

TCTGGCCTCATGCCCTTA;

ITGAM,

CATGACATAAGGTCAAGGCTGT;

KCTD12,

TACTGGAGGGGGAGAATGG

TBP,

TCTGGCCTCATGCCCTTA

-

AACCCCTGGTTCACCTCCT

[6]

[7]

CCTGCCCGAGAGATGATTAC

GCTGGCCCATAGTGATCTTT

CTTCACACGCCAAGAAACAGT.

Microsomal stability in liver microsomes. Test compounds

were dissolved in DMSO to obtain 0.2 mM solutions and pre-

incubated, at the final concentration of 1 µM, for 10 min at 37 °C

in potassium phosphate buffer 50 mM, pH 7.4, 3 mM MgCl₂, with

mouse and human liver microsomes (Sigma) at the final

concentration of 0.5 mg/mL. After the pre-incubation period,

reactions was started by adding the cofactors mixture (NADP⁺,

[8]

[9]

15

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

Kuhfittig-Kulle, E. Metzger, R. Schule, A. Eggert, R.

R. A. Casero, Jr., L. Marton, P. Woster, M. D. Minden, M.

Dugas, J. C. Wang, J. E. Dick, C. Muller-Tidow, K. Petrie,

A. Zelent, Nat Med 2012, 18, 605-611.

aJ. Wang, F. Lu, Q. Ren, H. Sun, Z. Xu, R. Lan, Y. Liu, D.

Ward, J. Quan, T. Ye, H. Zhang, Cancer Res 2011, 71,

7238-7249; bX. Zhang, F. Lu, J. Wang, F. Yin, Z. Xu, D.

Qi, X. Wu, Y. Cao, W. Liang, Y. Liu, H. Sun, T. Ye, H.

Zhang, Cell Rep 2013, 5, 445-457; cG. R. Sareddy, S.

Viswanadhapalli, P. Surapaneni, T. Suzuki, A. Brenner, R.

K. Vadlamudi, Oncogene 2017, 36, 2423-2434.

aF. Forneris, C. Binda, A. Adamo, E. Battaglioli, A.

Mattevi, J Biol Chem 2007, 282, 20070-20074; bF.

Forneris, C. Binda, E. Battaglioli, A. Mattevi, Trends

Biochem Sci 2008, 33, 181-189.

C. Binda, M. Li, F. Hubalek, N. Restelli, D. E. Edmondson,

A. Mattevi, Proc Natl Acad Sci U S A 2003, 100, 9750-

9755.

Buettner, J. Kirfel, Cancer Res 2009, 69, 2065-2071.

M. M. Singh, B. Johnson, A. Venkatarayan, E. R. Flores,

J. Zhang, X. Su, M. Barton, F. Lang, J. Chandra, Neuro

Oncol 2015, 17, 1463-1473.

D. P. Mould, A. E. McGonagle, D. H. Wiseman, E. L.

Williams, A. M. Jordan, Med Res Rev 2015, 35, 586-618.

C. Binda, S. Valente, M. Romanenghi, S. Pilotto, R. Cirilli,

A. Karytinos, G. Ciossani, O. A. Botrugno, F. Forneris, M.

Tardugno, D. E. Edmondson, S. Minucci, A. Mattevi, A.

Mai, J Am Chem Soc 2010, 132, 6827-6833.

aS. Valente, V. Rodriguez, C. Mercurio, P. Vianello, B.

Saponara, R. Cirilli, G. Ciossani, D. Labella, B. Marrocco,

D. Monaldi, G. Ruoppolo, M. Tilset, O. A. Botrugno, P.

Dessanti, S. Minucci, A. Mattevi, M. Varasi, A. Mai, Eur J

Med Chem 2015, 94, 163-174; bS. Valente, V. Rodriguez,

C. Mercurio, P. Vianello, B. Saponara, R. Cirilli, G.

Ciossani, D. Labella, B. Marrocco, G. Ruoppolo, O. A.

Botrugno, P. Dessanti, S. Minucci, A. Mattevi, M. Varasi,

A. Mai, ACS Med Chem Lett 2015, 6, 173-177.

[10]

[26]

[11]

[12]

[27]

[28]

[13]

[14]

[15]

P. Vianello, O. A. Botrugno, A. Cappa, R. Dal Zuffo, P.

Dessanti, A. Mai, B. Marrocco, A. Mattevi, G. Meroni, S.

Minucci, G. Stazi, F. Thaler, P. Trifiro, S. Valente, M. Villa,

M. Varasi, C. Mercurio, J Med Chem 2016, 59, 1501-1517.

S. J. Cho, N. H. Jensen, T. Kurome, S. Kadari, M. L.

Manzano, J. E. Malberg, B. Caldarone, B. L. Roth, A. P.

Kozikowski, J Med Chem 2009, 52, 1885-1902.

[16]

[17]

[18]

[19]

L. R. Mills, L. M. Barrera Arbelaez, S. A. L. Rousseaux, J

Am Chem Soc 2017, 139, 11357-11360.

K. S. Chan, H. Y. Fu, J. Q. Yu, J Am Chem Soc 2015,

137, 2042-2046.

R. K. Müller, R. Joos, D. Felix, J. Schreiber, C. Wintner, A.

Eschenmoser, Organic Syntheses 1976, 55, 114-114.

V. Rodriguez, S. Valente, S. Rovida, D. Rotili, G. Stazi, A.

Lucidi, G. Ciossani, A. Mattevi, O. A. Botrugno, P.

Dessanti, C. Mercurio, P. Vianello, S. Minucci, M. Varasi,

A. Mai, MedChemComm 2015, 6, 665-670.

[20]

aP. Vianello, O. A. Botrugno, A. Cappa, G. Ciossani, P.

Dessanti, A. Mai, A. Mattevi, G. Meroni, S. Minucci, F.

Thaler, M. Tortorici, P. Trifiro, S. Valente, M. Villa, M.

Varasi, C. Mercurio, Eur J Med Chem 2014, 86, 352-363;

bD. Niebel, J. Kirfel, V. Janzen, T. Holler, M. Majores, I.

Gutgemann, Blood 2014, 124, 151-152; cJ. P. McGrath, K.

E. Williamson, S. Balasubramanian, S. Odate, S. Arora, C.

Hatton, T. M. Edwards, T. O'Brien, S. Magnuson, D.

Stokoe, D. L. Daniels, B. M. Bryant, P. Trojer, Cancer Res

2016, 76, 1975-1988.

[21]

aL. T. van der Meer, J. H. Jansen, B. A. van der Reijden,

Leukemia 2010, 24, 1834-1843; bY. Ishikawa, K. Gamo,

M. Yabuki, S. Takagi, K. Toyoshima, K. Nakayama, A.

Nakayama, M. Morimoto, H. Miyashita, R. Dairiki, Y.

Hikichi, N. Tomita, D. Tomita, S. Imamura, M. Iwatani, Y.

Kamada, S. Matsumoto, R. Hara, T. Nomura, K. Tsuchida,

K. Nakamura, Mol Cancer Ther 2017, 16, 273-284; cN.

Sugino, M. Kawahara, G. Tatsumi, A. Kanai, H. Matsui, R.

Yamamoto, Y. Nagai, S. Fujii, Y. Shimazu, M. Hishizawa,

T. Inaba, A. Andoh, T. Suzuki, A. Takaori-Kondo,

Leukemia 2017, 31, 2303-2314.

[22]

aT. Maes, C. Mascaro, I. Tirapu, A. Estiarte, F. Ciceri, S.

Lunardi, N. Guibourt, A. Perdones, M. M. P. Lufino, T. C.

P. Somervaille, D. H. Wiseman, C. Duy, A. Melnick, C.

Willekens, A. Ortega, M. Martinell, N. Valls, G. Kurz, M.

Fyfe, J. C. Castro-Palomino, C. Buesa, Cancer Cell 2018,

33, 495-511 e412; bJ. Fang, H. Ying, T. Mao, Y. Fang, Y.

Lu, H. Wang, I. Zang, Z. Wang, Y. Lin, M. Zhao, X. Luo, Z.

Wang, Y. Zhang, C. Zhang, W. Xiao, Y. Wang, W. Tan, Z.

Chen, C. Lu, P. Atadja, E. Li, K. Zhao, J. Liu, J. Gu,

Oncotarget 2017, 8, 85085-85101.

[23]

[24]

J. B. Houston, Biochem Pharmacol 1994, 47, 1469-1479.

W. J. Harris, X. Huang, J. T. Lynch, G. J. Spencer, J. R.

Hitchin, Y. Li, F. Ciceri, J. G. Blaser, B. F. Greystoke, A.

M. Jordan, C. J. Miller, D. J. Ogilvie, T. C. Somervaille,

Cancer Cell 2012, 21, 473-487.

[25]

T. Schenk, W. C. Chen, S. Gollner, L. Howell, L. Jin, K.

Hebestreit, H. U. Klein, A. C. Popescu, A. Burnett, K. Mills,

16

10.1002/cmdc.201900730

ChemMedChem

FULL PAPER

Entry for the Table of Contents

Insert graphic for Table of Contents here.

Insert text for Table of Contents here.

LSD1 is a lysine demethylase highly involved in cancer initiation and progression. Through a X-ray-driven drug discovery process, we

identified some tranylcypromine-based compounds 1-4. Among them, 1-3 were active against LSD1 at the submicromolar/low

nanomolar range. When tested in MV4-11 AML and NB4 APL cells, 3a and 3c were the most potent to arrest proliferation and

induced target genes under the control of LSD1 in cells. These compounds will be further validated in different cancer contexts.

17

Article Doi

Tranylcypromine-Based LSD1 Inhibitors: Structure-Activity Relationships, Antiproliferative Effects in Leukemia, and Gene Target Modulation

DOI: 10.1002/cmdc.201900730

Source and publish data:

Authors:

Article abstract of DOI:10.1002/cmdc.201900730

Full text of DOI:10.1002/cmdc.201900730

Products guided by the article

R&D Labs maybe for 1105634-93-2

Relevant to this article

Hot Product