Molecular structure of wlbb, a bacterial N -acetyltransferase involved in the biosynthesis of 2,3-diacetamido-2,3-dideoxy-D -mannuronic acid

Article abstract of DOI:10.1021/bi1005738

The pathogenic bacteria Pseudomonas aeruginosa and Bordetella pertussis contain in their outer membranes the rare sugar 2,3-diacetamido-2,3-dideoxy-d- mannuronic acid. Five enzymes are required for the biosynthesis of this sugar starting from UDP-N-acetylglucosamine. One of these, referred to as WlbB, is an N-acetyltransferase that converts UDP-2-acetamido-3-amino-2,3-dideoxy-d- glucuronic acid (UDP-GlcNAc3NA) to UDP-2,3-diacetamido-2,3-dideoxy-d-glucuronic acid (UDP-GlcNAc3NAcA). Here we report the three-dimensional structure of WlbB from Bordetella petrii. For this analysis, two ternary structures were determined to 1.43 resolution: one in which the protein was complexed with acetyl-CoA and UDP and the second in which the protein contained bound CoA and UDP-GlcNAc3NA. WlbB adopts a trimeric quaternary structure and belongs to the LβH superfamily of N-acyltransferases. Each subunit contains 27 β-strands, 23 of which form the canonical left-handed β-helix. There are only two hydrogen bonds that occur between the protein and the GlcNAc3NA moiety, one between O^?1 of Asn 84 and the sugar C-3? amino group and the second between the backbone amide group of Arg 94 and the sugar C-5? carboxylate. The sugar C-3? amino group is ideally positioned in the active site to attack the si face of acetyl-CoA. Given that there are no protein side chains that can function as general bases within the GlcNAc3NA binding pocket, a reaction mechanism is proposed for WlbB whereby the sulfur of CoA ultimately functions as the proton acceptor required for catalysis.

Full text of DOI:10.1021/bi1005738

4644 Biochemistry 2010, 49, 4644–4653
DOI: 10.1021/bi1005738
Molecular Structure of WlbB, a Bacterial N-Acetyltransferase Involved in the Biosynthesis
of 2,3-Diacetamido-2,3-dideoxy-
-mannuronic Acid†,‡
D
James B. Thoden and Hazel M. Holden*
Department of Biochemistry, University of Wisconsin, Madison, Wisconsin 53706
Received April 14, 2010; Revised Manuscript Received April 29, 2010
ABSTRACT: The pathogenic bacteria Pseudomonas aeruginosa and Bordetella pertussis contain in their outer
membranes the rare sugar 2,3-diacetamido-2,3-dideoxy-
the biosynthesis of this sugar starting from UDP-N-acetylglucosamine. One of these, referred to as WlbB, is
an N-acetyltransferase that converts UDP-2-acetamido-3-amino-2,3-dideoxy- -glucuronic acid (UDP-
GlcNAc3NA) to UDP-2,3-diacetamido-2,3-dideoxy- -glucuronic acid (UDP-GlcNAc3NAcA). Here we
D-mannuronic acid. Five enzymes are required for
D
D
report the three-dimensional structure of WlbB from Bordetella petrii. For this analysis, two ternary
˚
structures were determined to 1.43 A resolution: one in which the protein was complexed with acetyl-CoA
and UDP and the second in which the protein contained bound CoA and UDP-GlcNAc3NA. WlbB adopts a
trimeric quaternary structure and belongs to the LβH superfamily of N-acyltransferases. Each subunit
contains 27 β-strands, 23 of which form the canonical left-handed β-helix. There are only two hydrogen bonds
that occur between the protein and the GlcNAc3NA moiety, one between Oδ1 of Asn 84 and the sugar C-30
amino group and the second between the backbone amide group of Arg 94 and the sugar C-50 carboxylate.
The sugar C-30 amino group is ideally positioned in the active site to attack the si face of acetyl-CoA. Given
that there are no protein side chains that can function as general bases within the GlcNAc3NA binding
pocket, a reaction mechanism is proposed for WlbB whereby the sulfur of CoA ultimately functions as the
proton acceptor required for catalysis.
N-Acetyltransferases catalyze the transfer of acetyl groups
from acetyl-CoA1 to primary amine acceptors. They are dis-
tributed throughout nature where they play key roles in biolo-
gical processes such as the sleep-wake cycles of vertebrates, the
reversible modifications of histone proteins, and the inactivations
of aminoglycoside antibiotics (1, 2). Substrates for these enzymes
range from simple small molecules to large proteins. Thus far,
two major classes of N-acyltransferases have been identified
and are referred to as the GNAT and LβH superfamilies.
Members of the GNAT superfamily adopt an overall fold built
around a central mixed β-sheet, which is typically composed of
six β-strands (1, 2). As the name implies, proteins that belong to
the LβH superfamily have a structure dominated by a stunning
parallel β-helix with repeating isoleucine-rich hexapeptide motifs
and rare left-handed crossover connections (3).
of UDP-2-acetamido-4-amino-2,4,6-trideoxy-
D-glucose to yield
UDP-2,4-diacetamido-2,4,6- -trideoxyglucose or UDP-Qui-
D
NAc4NAc as indicated in Scheme 1 (4-6). C. jejuni, itself, is a
highly unusual Gram-negative bacterium that contains N-glyco-
sylated proteins, and QuiNAc4NAc serves as the bridge between
the asparagine residue of a given glycosylated protein and the
attached N-glycan moiety (4, 7). PglD functions as a trimer with
each subunit folding into two separate domains, an N-terminal
region containing a three-stranded parallel β-sheet flanked by
two R-helices and a C-terminal domain dominated by a left-
handed β-helix motif (5). From detailed structural and kinetic
studies, it has been proposed that His 125 functions as an active
site base to remove a proton from the amino group of the UDP-
linked sugar as it attacks the carbonyl carbon of acetyl-
CoA (5, 6). The actual role of His 125 is still open to debate,
however, given the recent biochemical data suggesting that while
it is important for catalysis, it is not absolutely essential (8).
The second N-acetyltransferase structure recently reported
was that of QdtC from Thermoanaerobacterium thermosacchar-
olyticum E207-71 (9). As indicated in Scheme 1, QdtC catalyzes
the last step in the biosynthesis of dTDP-3-acetamido-3,6-
Within the last two years, the molecular architectures of two
intriguing N-acetyltransferases that function on nucleotide-linked
sugars have been reported. The first of these was that of PglD, from
Campylobacter jejuni, which specifically catalyzes the N-acetylation
†This research was supported in part by National Institutes of Health
Grant DK47814 to H.M.H.
‡X-ray coordinates have been deposited in the Protein Data Bank of
the Research Collaboratory for Structural Bioinformatics, Rutgers
University, New Brunswick, NJ (entries 3MQG and 3MQH).
*To whom correspondence should be addressed. E-mail:
Hazel_Holden@biochem.wisc.edu. Fax: (608) 262-1319. Phone: (608)
262-4988.
dideoxy-D-glucose or Quip3NAc, an unusual dideoxysugar
found in the O-antigens of some Gram-negative bacteria (10)
and in the S-layer glycoprotein glycans of some Gram-positive
bacteria (11). QdtC, like PglD, functions as a trimer. Each
subunit of QdtC is dominated by 32 β-strands that form the
canonical LβH motif. QdtC lacks, however, the N-terminal
domain observed in PglD. Also, as opposed to PglD, there are
no potential catalytic bases located within the active site cleft of
QdtC. Indeed, PglD and QdtC accommodate their nucleotide-
linked sugars in completely different orientations as shown in
Figure 1. Given the lack of a potential catalytic base in QdtC and
1Abbreviations: CoA, coenzyme A; HEPES, 4-(2-hydroxyethyl)-1-
piperazineethanesulfonic acid; HEPPS, 3-[4-(2-hydroxyethyl)]-1-piper-
azinepropanesulfonic acid; IPTG, isopropyl β-D-thiogalactopyrano-
side; LB, Luria-Bertani; MOPS, 3-(N-morpholino)propanesulfonic
acid; NiNTA, nickel-nitrilotriacetic acid; PCR, polymerase chain reac-
tion; rms, root-mean-square; TB, Terrific broth; UDP, uridine dipho-
sphate; UMP, uridine monophosphate; Tris, tris(hydroxymethyl)-
aminomethane.
r
pubs.acs.org/Biochemistry
Published on Web 04/30/2010
2010 American Chemical Society

Article
Biochemistry, Vol. 49, No. 22, 2010 4645
Scheme 1
For the investigation described here, WlbB was crystallized in
the presence of either acetyl-CoA and UDP or CoA and its
substrate UDP-GlcNAc3NA. The structures were determined
˚
and refined to a nominal resolution of 1.43 A. The binding mode
for the UDP-GlcNAc3NA ligand is similar to that observed for
QdtC. WlbB is considerably smaller than QdtC, however, and
thus, its LβH motif is shorter by nine β-strands. The pyranosyl
moiety of UDP-GlcNAc3NA is accommodated within the active
site region of WlbB via only two specific interactions: one
between Oδ1 of Asn 84 and the sugar C-30 amino group and
the second between the backbone amide group of Arg 94 and the
sugar C-50 carboxylate. Importantly, the sugar C-30 amino
nitrogen is in the proper position to attack the si face of acetyl-
CoA. Details concerning the overall active site architecture of
WlbB are presented, and implications for its catalytic mechanism
are discussed.
MATERIALS AND METHODS
Cloning, Expression, and Purification. Genomic DNA
from B. petrii (ATCC BAA-461) was isolated by standard
procedures. The wlbB gene was PCR-amplified from genomic
DNA such that the forward primer 50-AAACATATGGCCAC-
TATCCATCCTACCGCCATCG and the reverse primer 50-
AAAACTCGAGTCAGGCCAGTCGGCATACGCCGTCAG
added NdeI and XhoI cloning sites, respectively. The purified
PCR product was A-tailed and ligated into a pGEM-T
(Promega) vector for screening and DNA sequencing. A
WlbB-pGEM-T vector construct of the correct sequence was
then appropriately digested and ligated into a pET28b(þ)
(Novagen) plasmid that had been previously modified for the
production of a protein with a TEV protease cleavable N-terminal
hexahistidine tag (17).
The WlbB-pET28jt plasmid was used to transform Rosetta-
(DE3) Escherichia coli cells (Novagen). The culture in LB
medium was grown at 37 °C with shaking until the absorbance
at 600 nm reached 0.7. The cultures were subsequently cooled in
an ice bath and induced with 1.0 mM IPTG, and the cells were
allowed to express protein at 16 °C for 24 h after induction. WlbB
was purified by a modification to the standard procedures for
Ni-NTA chromatography. Specifically, all buffers contained
500 mM NaCl; the lysis buffer contained 10% glycerol, and all
steps, other than the initial sonication of the cell pellet at 4 °C,
were performed at room temperature. Following purification via
Ni-NTA chromatography, TEV protease was added to the
pooled protein (at a 1:50 TEV protease:WlbB molar ratio), and
this mixture was dialyzed against 50 mM sodium phosphate,
500 mM NaCl, 40 mM imidazole, and 1 mM DTT (pH 8.0)
for 24 h. The cleaved and intact versions of WlbB, as well as
the TEV protease itself, were separated by passage through a
column of Ni-NTA resin. The cleaved protein was dialyzed
against 10 mM Tris and 400 mM NaCl at pH 8.0 and then
concentrated to 12.5 mg/mL using an extinction coefficient of
0.83 mL mg-1 cm-1 at 280 nm.
Production of UDP-2-acetamido-3-amino-2,3-dideoxy-
D-glucuronic Acid (UDP-GlcNAc3NA). UDP-GlcNAc3NA
was synthesized from UDP-GlcNAc. To aid in the purification
process, the synthesis was divided into two steps. The first
involved the oxidation of UDP-GlcNAc to UDP-GlcNAcA
(Scheme 2). A typical 10 mL reaction mixture contained 50 mM
HEPPS (pH 8.5), 100 mM (NH4)2SO4, 100 mg of UDP-GlcNAc
(0.154 mmol), 310 mg of NADþ (0.462 mmol), and 10 mg of
WpbO (from B. petrii). The reaction was allowed to proceed at
in light of subsequent site-directed mutagenesis experiments and
enzymatic activity assays, a novel catalytic mechanism for it was
proposed (9). Specifically, the sulfur of acetyl-CoA ultimately
serves as the catalytic base by accepting a proton from the sugar
amino group as it attacks the carbonyl carbon of acetyl-CoA.
Herein we report the molecular architecture of WlbB, an N-
acetyltransferase from Bordetella petrii. WlbB catalyzes the
penultimate step in the biosynthesis of UDP-2,3-diacetamido-
2,3-dideoxy-D-mannuronic acid or UDP-ManNAc3NAcA
(Scheme 2). Specifically, as shown in Schemes 1 and 2, WlbB
catalyzes the N-acetylation of UDP-2-acetamido-3-amino-
2,3-dideoxy-D-glucuronic acid or UDP-GlcNAc3NA to yield
UDP-GlcNAc3NAcA (12). Although a reasonably rare di-N-
acetylated sugar, ManNAc3NAcA is found not only in B.
petrii but also in the B-band O-antigen of the opportunistic
bacterium Pseudomonas aeruginosa, a major source of noso-
comial infections, and in the A-band trisaccharide of the
bacterium Bordetella pertussis, the causative agent of whop-
ping cough (13). Interestingly, mutant strains of B. pertussis
that lack the A-band trisaccharide have been shown to be
defective in the colonization of the respiratory tracts of
BALB/c mice (14). In addition, the O-antigen in P. aeruginosa
is thought to protect the bacterium from phagocytosis (15)
and from serum-mediated killing (16).

4646 Biochemistry, Vol. 49, No. 22, 2010
Thoden and Holden
FIGURE 1: Differences inthe orientationsofthe nucleotide-linkedsugar substrateswhen bound toPglDorQdtC. The ribbonrepresentationinthe
background corresponds to that for QdtC. The substrates for PglD and QdtC are highlighted with blue and black bonds, respectively. All figures
were prepared with PyMOL (31).
Scheme 2
glutamate, 50 mM HEPPS (pH 8), 7 μM WlbA (from Thermus
thermophilus), and 6 μM WlbC (from B. petrii). The reaction was
allowed to proceed for 12 h at 30 °C. The enzymes were removed
via filtration with a 10 kDa cutoff Centriprep concentrator, and
the enzyme-free reaction products were diluted with water in a
1:3 ratio. Purification was achieved by chromatography using a
6 mL Resource-Q column and a 150 mL gradient from 0 to
450 mM ammonium bicarbonate (pH 8.5). The desired product
was identified by mass spectrometry (m/z 619.0). Fractions con-
taining the oxidized sugar product were pooled and lyophilized
until all traces of buffer were removed.
The enzymatic activity of B. petrii WlbB was verified by its
incubation (10 μM) with 0.5 mM UDP-GlcNAc3NA and
0.5 mM acetyl-CoA at 30 °C for 2 h. Removal of the enzyme
and purification of the resulting reaction products on a 1 mL
Resource-Q column (20 mL gradient, 0 to 600 mM ammonium
bicarbonate, pH 8.5) showed the disappearance of the peaks
corresponding to UDP-GlcNAc3NA and acetyl-CoA and the
formation of peaks corresponding to CoA and a new uridine-
containing product. Mass spectrometry of the uridine-containing
product gave an ion at m/z 661.1, which corresponds to UDP-
GlcNAc3NAcA.
Structural Analysis of WlbB. Crystallization conditions
were initially surveyed via the hanging drop method of vapor
diffusion and using a sparse matrix screen developed in the
laboratory. Trials were conducted with both the apoprotein and
the protein incubated with 10 mM acetyl-CoA. Diffraction
quality crystals were subsequently grown via the hanging drop
method by mixing in a 1:1 ratio the protein incubated with acetyl-
CoA and a precipitant solution containing 15-20% poly-
(ethylene glycol) 8000 [100 mM MOPS (pH 7.5)]. The crystals
belonged to the space group C2221 with two trimers per asym-
˚
37 °C for 4 h. The enzyme was removed via filtration with a 10 kDa
cutoff Centriprep concentrator, and the enzyme-free reaction
products were diluted with water in a 1:4 ratio. Purification was
achieved by chromatography using a 6 mL Resource-Q column
and a 120 mL gradient from 0 to 500 mM ammonium bicarbonate
at pH 8.5. The desired product was identified by mass spectro-
metry (m/z 620.1). Fractions containing UDP-GlcNAcA were
pooled and lyophilized until all traces of buffer were removed. The
second step involved the oxidation and subsequent amination of
UDP-GlcNAcA to yield UDP-GlcNAc3NA. A typical 400 mL
reaction mixture contained 0.8 mM UDP-GlcNAcA, 50 mM
metric unit and the following unit cell dimensions: a = 85.8 A,
b = 158.4 A, and c = 118.4 A.
˚
˚
An initial X-ray data set was measured from this orthorhombic
crystal form at 4 °C using a Bruker AXS HiSTAR area detector.
The X-ray source was Cu KR radiation from a Rigaku RU200
generator equipped with Supper mirrors and operated at 50 kV
and 90 mA. These X-ray data were processed with SAINT
version 7.06A (Bruker AXS Inc.) and internally scaled with
SADABS version 2005/1 (Bruker AXS Inc.).
The structure was solved via single isomorphous replacement
using a crystal soaked in 1 mM methylmercury(I) chloride for

Article
Biochemistry, Vol. 49, No. 22, 2010 4647
Table 1: X-ray Data Collection Statistics
enzyme complexed with acetyl-CoA and UDP
enzyme complexed with CoA and UDP-GlcNAc3NA
resolution limits
no. of independent reflections
completeness (%)
redundancy
50.0-1.43 (1.48-1.43)b
226783 (20999)b
95.6 (88.7)b
50.0-1.43 (1.48-1.43)b
213775 (17996)b
90.0 (76.1)b
3.9 (2.7)b
2.9 (2.1)b
avg I/avg σ(I)
38.2 (8.9)b
7.0 (14.1)b
28.3 (6.6)b
7.7 (12.5)b
Rsym (%)a
P
P
aRsym = ( |I - I|/ I) ꢀ 100. bStatistics for the highest-resolution bin in parentheses.
Table 2: Model Refinement Statistics
enzyme complexed with acetyl-CoA
and UDP
enzyme complexed with CoA
and UDP-GlcNAc3NA
˚
resolution limits (A)
30.0-1.43
19.2/226763
19.1/215388
21.7/11375
8749b
30.0-1.43
17.6/213775
17.4/203089
20.6/10686
8796c
R-factora (overall) (%)/no. of independent reflections
R-factor (working) (%)/no. of independent reflections
R-factor (free) (%)/no. of independent reflections
no. of protein atoms
no. of heteroatoms
1945d
2310e
2
˚
average B value (A )
protein atoms
12.2
17.0
26.0
10.7
9.7
ligands
solvent
25.9
weighted rms deviation from ideality
˚
bond lengths (A)
0.012
2.18
0.012
2.12
bond angles (deg)
˚
general planes (A)
0.009
0.007
P
P
aR-factor = ( |Fo - Fc|/ |Fo|) ꢀ 100, where Fo is the observed structure factor amplitude and Fc is the calculated structure factor amplitude. bThese
include multiple conformations for Lys 57 and Arg 166 in subunit A, Glu 36, Lys 57, Glu 159, and Glu 170 in subunit B, Arg 21, Ile 121, and Glu 159 in subunit
C, Ile 16 in subunit D, and Lys 57 and Glu 159 in subunit E. cThese include multiple conformations for Arg 49 and Arg 166 in subunit A, Glu 33, Glu 36, Arg 55,
Glu 93, and Glu 159 in subunit B, Ile 22, Ile 121, Arg 149, and Glu 159 in subunit C, Ile 16 and Ile 22 in subunit D, Glu 33, Glu 93, and Glu 159 in subunit E, and
Glu 159 in subunit F. dHeteroatoms include six acetyl-CoA molecules, three UDP molecules, three UMP molecules, 1144 waters, two phosphate ions, four
ethylene glycol molecules, two sodium ions, and one 2-{2-[2-(2-{2-[2-(2-ethoxyethoxy)ethoxy]ethoxy}ethoxy)ethoxy]ethoxy}ethanol molecule. eHeteroatoms
include six CoA molecules, six UDP-GlcNAc3NA molecules, 1698 waters, two phosphate ions, 12 ethylene glycol molecules, two sodium ions, and one
2-{2-[2-(2-{2-[2-(2-ethoxyethoxy)ethoxy]ethoxy}ethoxy)ethoxy]ethoxy}ethanol molecule.
24 h. Six mercury binding sites were identified with SOLVE (18),
giving an overall figure of merit of 0.23 to 3.0 A resolution.
Solvent flattening and 6-fold averaging with RESOLVE (19, 20)
generated an interpretable electron density map, which allowed a
preliminary model to be constructed using COOT (21).
CoA was included in the soaking solution, only CoA was
observed in the electron density map. Most likely, the UDP-sugar
reacted with acetyl-CoA in the enzyme’s active site, and the UDP-
sugar product dissociated, leaving bound CoA. A second UDP-
sugar substrate entered the active site, resulting in the trapping of
an “abortive complex”. Relevant X-ray data collection statistics
are presented in Table 1.
The original structure solved from crystals belonging to the
space group C2221 served as the search model for the subsequent
three-dimensional analyses of the WlbB-acetyl-CoA-UDP and
WlbB-CoA-UDP-GlcNAc3NA ternary complexes via molec-
ular replacement with PHASER (23). Each model was refined
with Refmac using maximum likelihood (24). Relevant refine-
ment statistics are listed in Table 2.
Measurement of Enzymatic Activity. N-Acetyltransferase
activity was monitored spectrophotometrically by following the
increase in absorbance at 412 nm due to the reaction of the
sulfhydryl group of the CoASH product with 5,50-dithiobis-
(2-nitrobenzoic acid) resulting in a disulfide interchange. This
interchange leads to the formation of 5-thio-2-nitrobenzoic acid,
which has a characteristic absorbance at 412 nm and an extinc-
tion coefficient of 14150 M-1 cm-1. The use of this compound
for quantification of CoASH was first reported by Tomkins
et al. (25), and our assay method was similar to that described in
ref 26. Reactions were monitored continuously with a Beckman
DU 640B spectrophotometer, and enzyme activities were
˚
A second crystal form was obtained when 10 mM UDP was
included with the acetyl-CoA in the crystallization experiments.
These crystals were grown at pH 8.0 in the presence of 100 mM
HEPPS, 16-20% poly(ethylene glycol) 3400, and 210 mM
tetramethylammonium chloride. They belonged to the space
group P21 with two trimers per asymmetric unit and the following
˚
˚
˚
unit cell dimensions: a = 68.5 A, b = 107.9 A, c = 91.3 A, and
β = 102.6°. High-resolution X-ray data from these crystals were
collected at beamline 19-BM (Structural Biology Center, Argonne
National Laboratory, Argonne, IL), and the data were processed
and scaled with HKL-3000 (22). Prior to X-ray data collection,
the crystals were transferred to a stabilization solution containing
22% poly(ethylene glycol) 3400, 300 mM NaCl, 10 mM UDP,
210 mM tetramethylammonium chloride, 25 mM acetyl-CoA,
100 mM HEPPS (pH 8.0), and 18% ethylene glycol. For
preparation of the ternary complex of WlbB with CoA and
UDP-GlcNAc3NA, the crystals were soaked for 6 h in a solu-
tion containing 17% poly(ethylene glycol) 3400, 300 mM NaCl,
100 mM HEPPS (pH 8.0), 210 mM tetramethylammonium
chloride, 25 mM acetyl-CoA, and 25 mM UDP-GlcNAc3NA
prior to being transferred to the cryoprotectant. Although acetyl-

4648 Biochemistry, Vol. 49, No. 22, 2010
Thoden and Holden
FIGURE 2: The structure of WlbB complexed with acetyl-CoA and UDP. A ribbon representation of the WlbB trimer is shown in panel a with the
three subunits displayed in red, wheat, and light blue and the bound ligands shown as sticks. The overall three-dimensional fold of one subunit is
presented in stereo in panel b. The loop defined by Asn 84-Asp 100 interrupts the regularity of the LβH motif.
˚
calculated from the initial rates. Assay reaction mixtures were
100 μL in volume and contained, in addition to enzyme and
substrates, 100 mM HEPES (pH 7.5) and 5 mM 5,50-dithiobis-
(2-nitrobenzoic acid). The reactions were initiated by the addition
of enzyme and monitored at 25 °C. Kinetic parameters were
determined by having one substrate at a saturating concentration
(>10Km) while varying the concentration of the second. Speci-
fically, Km for acetyl-CoA was determined by varying its con-
centration from 0.01 to 5.0 mM using 5.0 mM UDP-GlcNAc3-
NA and the Km for UDP-GlcNAc3NA using 5.0 mM acetyl-CoA
while varying the UDP-GlcNAc3NA concentration from 0.01 to
5.0 mM. Individual substrate kinetic data were fitted to eq 1 using
Sigma Plot 8.
diffracted to 1.43 A resolution. These trimers were not related by
a local 2-fold axis, but rather by a translation. The quality of the
models for the six polypeptide chains in the asymmetric unit was
excellent, with 87, 12.4, and 0.5% of the φ and ψ values lying
within the core, allowed, and generously allowed regions of the
Ramachandran plot, respectively (27). All six subunits demon-
strated exceedingly similar architectures such that their R-car-
bons superimposed with root-mean-square deviations between
˚
0.08 and 0.19 A. In light of this, the following discussion refers
only to the first trimer in the X-ray coordinate file and specifically
to the subunits designated “A” and “B”.
The WlbB trimer, as displayed in Figure 2a, has dimensions of
˚
˚
˚
∼70 A ꢀ 66 A ꢀ 67 A, and each active site is wedged between two
2
˚
subunits. The surface area lost upon trimerization is ∼2200 A .
v ¼ VA=ðKa þ AÞ
ð1Þ
Each subunit contains all 190 amino acid residues of the crystal-
lized protein, and Pro 147 adopts a cis-peptide conformation. A
close-up view of one subunit is displayed in Figure 2b. There are
27 β-strands, 23 of which form the β-helix. The regularity of the
β-helix is broken between β-strands 14 and 15 by a loop formed
between Asn 84 and Asp 100. This loop reaches from one subunit
into the next of the trimer and provides major binding interac-
tions for both the acetyl-CoA and UDP-linked sugar ligands as
Calculated Km values were 83 ( 5 μM for UDP-GlcNAc3NA
and 175 ( 10 μM for acetyl-CoA.
RESULTS AND DISCUSSION
Structure of WlbB Complexed with Acetyl-CoA and
UDP. The crystals utilized in this investigation belonged to the
space group P21, contained two trimers per asymmetric unit, and

Article
Biochemistry, Vol. 49, No. 22, 2010 4649
F
IGURE 3: Active site architecture of the WlbB-acetyl-CoA-UDP complex model. Shown in panel a is the initial electron density corresponding
to the bound ligands (before they were included in the model). The map was contoured at ∼1.5σ and calculated with coefficients of the form 2Fo -
Fc, where Fo is the native structure factor amplitude and Fc the calculated structure factor amplitude. Those amino acid residues lying within
˚
∼3.2 A of acetyl-CoA are shown in panel b. The active site is formed by residues contributed from both subunits in the trimer as indicated by the
wheat and blue bonds and ribbon representations. Water molecules are depicted as red spheres, and potential hydrogen bonds are represented by
the dashed lines.
0
described below. Following the last β-strand of the LβH motif,
the polypeptide chain folds into a four-stranded antiparallel
β-barrel, which splays away from the main body of the trimer
(Figure 2a).
The ribose adopts the C2 -endo pucker. A salt bridge occurs
between the C-3 phosphoryl group on the ribose and the
guanidinium group of Arg 149 of subunit A. The pyrophosphoryl
group of the acetyl-CoA ligand interacts with seven waters, Oη of
Tyr 86 from subunit A, and Nε2 of Gln 160 from subunit B. Note
that Tyr 86 lies in the loop that interrupts the regularity of the
LβH motif. The pantothenate group adopts an extended struc-
ture much like a strand of β-sheet where it hydrogen bonds with
the backbone carbonyl groups of Val 85 and Tyr 86 from subunit
A and the backbone amide groups of Ala 111 and Ala 129 from
subunit B. Finally, the carbonyl oxygen of the cofactor’s acetyl
group interacts with the backbone amide of Asn 84 from subunit
A, which initiates the extended loop (Figure 2b).
For the initial structural analysis of WlbB, the protein was
crystallized in the presence of acetyl-CoA and UDP. The electron
densities corresponding to these bound ligands are shown in
Figure 3a. As can be seen, the electron density for acetyl-CoA is
extremely well-ordered whereas that for UDP is somewhat less
so. A close-up view of the binding pocket for acetyl-CoA is
displayed in Figure 3b. The CoA adopts a curved conformation
˚
such that N6 of the adenine ring lies within 3.1 A of one of the
carbonyl oxygens of the pantothenate unit. The adenine ring is
positioned within hydrogen bonding distance of the carbonyl
oxygen of Ala 129 from subunit B and two waters, whereas the
Structure of WlbB Complexed with CoA and UDP-
GlcNAc3NA. The binding of a nucleotide-linked sugar to WlbB
resulted in very little overall structural perturbations. Indeed, the
˚
ribose C-2 hydroxyl group is 2.9 A from Asn 134 in subunit A.

4650 Biochemistry, Vol. 49, No. 22, 2010
Thoden and Holden
F
IGURE 4: Active site architecture of the WlbB-CoA-UDP-GlcNAc3NA complex model. Shown in panel a is the initial electron density
corresponding to the bound ligands (before they were included in the model). The map was contoured at ∼1.5σ and calculated with coefficients of
the form 2Fo - Fc, where Fo is the native structure factor amplitude and Fc the calculated structure factor amplitude. Those amino acid residues
˚
lying within ∼3.2 A of UDP-GlcNAc3NA are shown in panel b. Water molecules are depicted as red spheres, and potential hydrogen bonds are
represented by the dashedlines. Notethatthe water moleculelocated withinhydrogen bonding distance of the sugar C-30 amino group isdisplaced
when acetyl-CoA is bound in the active site.
R-carbons for the structures, with or without the UDP-linked
surrounding the UDP-linked sugar is presented in Figure 4b.
˚
˚
sugar, superimpose with a rms deviation of ∼0.8 A, and the side
The uridine ring lies within 3.2 A of three water molecules. The
0
chain conformations within the active site regions of these two
complexes are virtually identical. The only notable difference is
that in the WlbB-acetyl-CoA-UDP complex, water molecules
occupy the position assumed by the sugar in the WlbB-CoA-
UDP-sugar complex.
ribose, which adopts the C3 -endo pucker, hydrogen bonds to
two waters and the carboxamide side chain of Asn 60 in subunit
B. The carboxamide side chain of Gln 59 in subunit B and
numerous solvent molecules surround the pyrophosphoryl group
of the UDP-linked sugar. The pyranose of UDP-GlcNAc3NA
4
For the structural analysis of this ternary complex, crystals
were prepared in the presence of acetyl-CoA and UDP-
GlcNAc3NA, but only CoA and UDP-GlcNAc3NA were visible
in the electron density map (Figure 4a). This also occurred in our
previous structural analysis of QdtC where crystals were grown in
the presence of acetyl-CoA and a nucleotide-linked sugar, but
only CoA was observed (9). As a consequence, the structure of
the WlbB ternary complex reported in this section represents that
of an abortive complex. A close-up view of the active site
assumes the C1 chair conformation. Only two specific interac-
tions occur between the protein (subunit A) and the GlcNAc3NA
moiety: the backbone amide group of Arg 94 interacts with
the sugar carboxylate group at C-50, and Oδ1 of Asn 84 lies
0
˚
within 2.8 A of the sugar C-3 amino group that is ultimately
acetylated during the reaction. As indicated by the red dashed
line in Figure 4b, the sugar C-30 amino group is positioned within
˚
3.2 A of the CoA sulfur atom. The lack of specific interactions
between the pyranosyl moiety and the protein suggests that WlbB

Article
Biochemistry, Vol. 49, No. 22, 2010 4651
FIGURE 5: Superposition of WlbB and QdtC. Ribbon representations for the WlbB and QdtC subunits are highlighted in light blue and white,
respectively. The CoA and nucleotide-linked sugars, when bound to WlbB and QdtC, are displayed with black and white bonds, respectively.
F
IGURE 6: Close-up of the WlbB active site. For this figure, the two structures described in this report were superimposed, and hydrogens were
added to the C-30 amino group of the sugar substrate. The green dashed line represents the hypothetical approach of the lone pair of electrons on
the amino nitrogen towardthesifaceofacetyl-CoA. The black dashedlines donot specificallyimplyhydrogen bonds butmerelyindicate distances
of 2.2-2.9 A between the hydrogens on the C-3 nitrogen and either Oδ1 of Asn 84 or the sulfur of CoA.
0
˚
may accept alternative substrates. Experiments to test this are
presently underway.
N159D, N159A, D160N, and D160A (9). All of these proteins
retained catalytic activity, albeit the activity was seriously
reduced for the D160A but not the D160N mutant enzyme. In
WlbB, these residues correspond to Asp 66, Asn 84, and Val 85.
The only conserved interaction between the nucleotide-linked
sugars and these two proteins is the hydrogen bond between the
side chain of Asn 84 in WlbB (Asn 159 in QdtC) and the C-30
amino group. As in the case of QdtC, there are no potential
catalytic bases within the active site of WlbB to deprotonate the
C-30 amino group for its attack at the carbonyl carbon of acetyl-
CoA.
Comparison of WlbB to QdtC. As discussed previously,
QdtC is an N-acetyltransferase that catalyzes the acetylation of
the C-30 amino group of dTDP-Quip3N (Scheme 1). The overall
level of amino acid sequence identity between QdtC and WlbB is
36%. A superposition of the two structures is presented in Figure 5.
Whereas WlbB is considerably smaller than QdtC (190 and 265
amino acid residues, respectively), both display nearly identical
binding orientations of the nucleotide-linked sugars. The two
proteins initially align at Ala 2 in WlbB and Ala 77 in QdtC. A
five-residue insertion occurs after Pro 88 in WlbB such that the
two proteins begin to align again at Glu 97 in WlbB and Glu 167
in QdtC. Their close structural correspondence continues until
Met 154 in WlbB and Ile 224 in QdtC. Indeed, the R-carbons for
123 target pairs between WlbB and QdtC superimpose with a rms
Implications for the Catalytic Mechanism of WlbB. The
two complex structures of WlbB described here show the binding
conformations for acetyl-CoA and CoA and thus represent the
“pre” and “post” reaction states of the cofactor, respectively. A
superposition of these two “states” is presented in Figure 6. Note
that the sulfur atom of the cofactor moves in the active site by
˚
deviation of 0.71 A. The specific interactions between WlbB or
˚
QdtC and their respective nucleotide-linked sugars are quite
different, however. In QdtC, three amino acid side chains are
located within hydrogen bonding distance of the sugar’s amino
and hydroxyl groups, namely, Glu 141, Asn 159, and Asp 160 (9).
These residues were tested for their roles in catalysis by preparing
the following site-directed mutant proteins: E141Q, E141A,
∼2 A upon departure of the acetyl group. In Figure 6, these two
conformations of the cofactor are displayed as well as the binding
position of the UDP-GlcNAc3NA substrate. Assuming that the
amino group of the UDP-GlcNAc3NA substrate enters the
WlbB active site in an unprotonated state, the hypothetical
positions for the two hydrogens attached to nitrogen are also

4652 Biochemistry, Vol. 49, No. 22, 2010
Thoden and Holden
included in Figure 6. A potential catalytic mechanism can thus be
envisioned as follows. The C-30 amino nitrogen of the sub-
strate attacks the si face of the acetyl moiety of acetyl-CoA to
produce a tetrahedral oxyanion intermediate. This intermedi-
ate is most likely stabilized by interaction of the oxyanion with
the backbone amide group of Asn 84 (Figure 3b). In the model
Dr. Norma E. C. Duke for assistance during the X-ray data
collection at Argonne and Professor W. W. Cleland for helpful
discussions.
REFERENCES
1. Dyda, F., Klein, D. C., and Hickman, A. B. (2000) GCN5-related
N-acetyltransferases: A structural overview. Annu. Rev. Biophys.
Biomol. Struct. 29, 81–103.
˚
shown in Figure 6, the amino nitrogen is located within 2.2 A
of the carbonyl carbon of acetyl-CoA and is oriented such
that its lone pair of electrons is in the proper location for
nucleophilic attack. The two hydrogens attached to the
amino nitrogen lie within hydrogen bonding distance of
Asn 84, which most likely plays a key role in proper substrate
positioning. As the oxyanion intermediate collapses, the
bond between the carbon and the sulfur of acetyl-CoA
breaks and the sulfur shifts its position in the active site as
indicated in Figure 6 and accepts a proton from the C-30
amino group.
2. Vetting, M. W., S de Carvalho, L. P., Yu, M., Hegde, S. S., Magnet, S.,
Roderick, S. L., and Blanchard, J. S. (2005) Structure and functions of
the GNAT superfamily of acetyltransferases. Arch. Biochem. Biophys.
433, 212–226.
3. Raetz, C. R., and Roderick, S. L. (1995) A left-handed parallel β helix
in the structure of UDP-N-acetylglucosamine acyltransferase. Science
270, 997–1000.
4. Szymanski, C. M., and Wren, B. W. (2005) Protein glycosylation in
bacterial mucosal pathogens. Nat. Rev. Microbiol. 3, 225–237.
5. Rangarajan, E. S., Ruane, K. M., Sulea, T., Watson, D. C., Proteau,
A., Leclerc, S., Cygler, M., Matte, A., and Young, N. M. (2008)
Structure and active site residues of PglD, an N-acetyltransferase from
the bacillosamine synthetic pathway required for N-glycan synthesis
in Campylobacter jejuni. Biochemistry 47, 1827–1836.
We previously suggested a similar reaction mechanism for
QdtC on the basis of X-ray crystallographic analyses, site-
directed mutagenesis, and kinetic experiments (9). At the time,
we assumed that the catalytic mechanism of QdtC might be an
“outlier” among sugar-modifying N-acetyltransferases in light of
the structure of PglD, which contains a putative catalytic base.
However, from this study, we now know that QdtC and WlbB
accommodate their sugar substrates in nearly identical fashions
and in marked contrast to that observed for PglD (Figure 1). In
addition, both QdtC and WlbB contain asparagine residues that
form hydrogen bonds to the substrate amino groups. Interest-
ingly, these enzymes operate on amino groups attached to the
C-30 atoms of the sugar substrates (Scheme 1). PglD, on the other
hand, acetylates an amino group attached to C-40. On the basis of
these observations, we suggest that there are two subfamilies of
LβH N-acetyltransferases that operate on nucleotide-linked
sugars: those that belong to the “PglD” group, which function
on amino groups attached to C-40 atoms, and those that belong to
the “QdtC” family, which operate on substrates containing C-30
amino groups.
As shown in Scheme 1, GDP-perosamine N-acetyltransferase
(PerB) catalyzes the acetylation of GDP-perosamine to yield
GDP-N-acetylperosamine, a 6-deoxyhexose found on the lipo-
polysaccharide of E. coli O157:H7, the causative agent of
enterohemorrhagic diarrhea first identified in contaminated
hamburgers and subsequently in other foods, including spin-
ach (28, 29). We suggest that its structure will belong to the
PglD subfamily. Another N-acetyltransferase, FdtC from Aneur-
inibacillus thermoaerophilus L420-91T, catalyzes the acetylation
of dTDP-3-amino-3,6-dideoxygalactose or dTDP-Fucp3N to
yield dTDP-Fucp3NAc (11). This unusual dideoxy sugar is found
in the S-layer of many Gram-positive and Gram-negative
bacteria (30) and in the O-antigens of some Gram-negative
bacteria (10). Given that FdtC functions on a C-30 amino group,
we would predict that it belongs to the QdtC subfamily. X-ray
crystallographic analyses of these two enzymes are presently
underway.
6. Olivier, N. B., and Imperiali, B. (2008) Crystal structure and catalytic
mechanism of PglD from Campylobacter jejuni. J. Biol. Chem. 283,
27937–27946.
7. Guerry, P., and Szymanski, C. M. (2008) Campylobacter sugars
sticking out. Trends Microbiol. 16, 428–435.
8. Demendi, M., and Creuzenet, C. (2009) Cj1123c (PglD), a multi-
faceted acetyltransferase from Campylobacter jejuni. Biochem. Cell
Biol. 87, 469–483.
9. Thoden, J. B., Cook, P. D., Schaffer, C., Messner, P., and Holden,
H. M. (2009) Structural and functional studies of QdtC: An N-
acetyltransferase required for the biosynthesis of dTDP-3-acetami-
do-3,6-dideoxy-R-D-glucose. Biochemistry 48, 2699–2709.
10. Feng, L., Wang, W., Tao, J., Guo, H., Krause, G., Beutin, L., and
Wang, L. (2004) Identification of Escherichia coli O114 O-antigen
gene cluster and development of an O114 serogroup-specific PCR
assay. J. Clin. Microbiol. 42, 3799–3804.
11. Pfoestl, A., Hofinger, A., Kosma, P., and Messner, P. (2003) Biosynthe-
sis of dTDP-3-acetamido-3,6-dideoxy-R-D-galactose in Aneurinibacil-
lus thermoaerophilus L420-91T. J. Biol. Chem. 278, 26410–26417.
12. Westman, E. L., Preston, A., Field, R. A., and Lam, J. S. (2008)
Biosynthesis of a rare di-N-acetylated sugar in the lipopolysaccharides
of both Pseudomonas aeruginosa and Bordetella pertussis occurs via an
identical scheme despite different gene clusters. J. Bacteriol. 190,
6060–6069.
13. Kochetkov, N. K., and Knirel, Y. A. (1994) Structure of lipopolysac-
charides from Gram-negative bacteria. III. Structure of O-specific
polysaccharides. Biochemistry (Moscow, Russ. Fed.) 59, 1325–1383.
14. Harvill, E. T., Preston, A., Cotter, P. A., Allen, A. G., Maskell, D. J.,
and Miller, J. F. (2000) Multiple roles for Bordetella lipopolysacchar-
ide molecules during respiratory tract infection. Infect. Immun. 68,
6720–6728.
15. Engels, W., Endert, J., Kamps, M. A., and van Boven, C. P. (1985)
Role of lipopolysaccharide in opsonization and phagocytosis of
Pseudomonas aeruginosa. Infect. Immun. 49, 182–189.
16. Dasgupta, T., de Kievit, T. R., Masoud, H., Altman, E., Richards,
J. C., Sadovskaya, I., Speert, D. P., and Lam, J. S. (1994) Characteriza-
tionof lipopolysaccharide-deficient mutants ofPseudomonasaeruginosa
derived from serotypes O3, O5, and O6. Infect. Immun. 62, 809–817.
17. Thoden, J. B., Timson, D. J., Reece, R. J., and Holden, H. M. (2005)
Molecular structure of human galactokinase: Implications for Type II
galactosemia. J. Biol. Chem. 280, 9662–9670.
18. Terwilliger, T. C., and Berendzen, J. (1999) Automated MAD and
MIR structure solution. Acta Crystallogr. D55 (Part 4), 849–861.
19. Terwilliger, T. C. (2000) Maximum-likelihood density modification.
Acta Crystallogr. D56 (Part 8), 965–972.
20. Terwilliger, T. C. (2003) Automated main-chain model building by
template matching and iterative fragment extension. Acta Crystallogr.
D59, 38–44.
21. Emsley, P., and Cowtan, K. (2004) Coot: Model-building tools for
molecular graphics. Acta Crystallogr. D60, 2126–2132.
ACKNOWLEDGMENT
22. Minor, W., Cymborowski, M., Otwinowski, Z., and Chruszcz, M.
(2006) HKL-3000: The integration of data reduction and structure
solution;from diffraction images to an initial model in minutes. Acta
Crystallogr. D62, 859–866.
23. McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M. D.,
Storoni, L. C., and Read, R. J. (2007) Phaser crystallographic soft-
ware. J. Appl. Crystallogr. 40, 658–674.
A portion of the research described in this paper was
performed at Argonne National Laboratory, Structural Biology
Center at the Advanced Photon Source (U.S. Department of
Energy, Office of Biological and Environmental Research, under
Contract DE-AC02-06CH11357). We gratefully acknowledge

Article
Biochemistry, Vol. 49, No. 22, 2010 4653
24. Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Refine-
ment of macromolecular structures by the maximum-likelihood
method. Acta Crystallogr. D53, 240–255.
25. Alpers, D. H., Appel, S. H., and Tomkins, G. M. (1965) A spectro-
photometric assay for thiogalactoside transacetylase. J. Biol. Chem.
240, 10–13.
26. Magalhaes, M. L., and Blanchard, J. S. (2005) The kinetic mechanism
of AAC3-IV aminoglycoside acetyltransferase from Escherichia coli.
Biochemistry 44, 16275–16283.
28. Riley, L. W., Remis, R. S., Helgerson, S. D., McGee, H. B., Wells, J. G.,
Davis, B. R., Hebert, R. J., Olcott, E. S., Johnson, L. M., Hargrett, N. T.,
Blake, P. A., and Cohen, M. L. (1983) Hemorrhagic colitis associated
with a rare Escherichia coli serotype. N. Engl. J. Med. 308, 681–685.
29. Albermann, C., and Beuttler, H. (2008) Identification of the GDP-N-
acetyl-D-perosamine producing enzymes from Escherichia coli O157:
H7. FEBS Lett. 582, 479–484.
30. Pfostl, A., Zayni, S., Hofinger, A., Kosma, P., Schaffer, C., and
Messner, P. (2008) Biosynthesis of dTDP-3-acetamido-3,6-dideoxy-
27. Laskowski, R. A., MacArthur, M. W., Moss, D. S., and Thornton,
J. M. (1993) PROCHECK: A program to check the stereochemical
quality of protein structures. J. Appl. Crystallogr. 26, 283–291.
R-D-glucose. Biochem. J. 410, 187–194.
31. DeLano, W. L. (2002) The PyMOL Molecular Graphics System,
DeLano Scientific, San Carlos, CA.