Intercalation-enhanced “Click” Crosslinking of DNA

Article abstract of DOI:10.1002/anie.201808054

DNA–DNA cross-linking agents constitute an important family of chemotherapeutics that non-specifically react with endogenous nucleophiles and therefore exhibit undesirable side effects. Here we report a cationic Sondheimer diyne derivative “DiMOC” that exhibits weak, reversible intercalation into duplex DNA (K_d=15 μm) where it undergoes tandem strain-promoted cross-linking of azide-containing DNA to give DNA-DNA interstrand crosslinks (ICLs) with an exceptionally high apparent rate constant k_app=2.1×10⁵ m^?1 s^?1. This represents a 21 000-fold rate enhancement as compared the reaction between DIMOC and 5-(azidomethyl)-2′-deoxyuridine (AmdU) nucleoside. As single agents, 5′-bispivaloyloxymethyl (POM)-AmdU and DiMOC exhibited low cytotoxicity, but highly toxic DNA-DNA ICLs were generated by metabolic incorporation of AmdU groups into cellular DNA, followed by treatment of the cells with DiMOC. These results provide the first examples of intercalation-enhanced bioorthogonal chemical reactions on DNA, and furthermore, the first strain-promoted double click (SPDC) reactions inside of living cells.

Full text of DOI:10.1002/anie.201808054

A Journal of the Gesellschaft Deutscher Chemiker
Angewandte
Chemie
International Edition
www.angewandte.org
Accepted Article
Title: Intercalation-enhanced "click" crosslinking of DNA
Authors: Masayuki Tera, Zahra Harati-Taji, and Nathan William
Luedtke
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: Angew. Chem. Int. Ed. 10.1002/anie.201808054
Angew. Chem. 10.1002/ange.201808054
Link to VoR: http://dx.doi.org/10.1002/anie.201808054
http://dx.doi.org/10.1002/ange.201808054

10.1002/anie.201808054
Angewandte Chemie International Edition
COMMUNICATION
Intercalation-enhanced “click” crosslinking of DNA
Masayuki Tera[a,b], Zahra Harati-Taji[a], Nathan W. Luedtke*[a]
Abstract: DNA-DNA cross-linking agents constitute an important
family of chemotherapeutics that non-specifically react with
endogenous nucleophiles and therefore exhibit undesirable side
effects. Here we report a cationic Sondheimer diyne derivative
“DiMOC” that exhibits weak, reversible intercalation into duplex DNA
(Kd = 15 M) where it undergoes tandem strain-promoted cross-
linking of azide-containing DNA to give DNA-DNA interstrand
crosslinks (ICLs) with an exceptionally high apparent rate constant
kapp = 2.1 x 105 M-1sec-1. This represents a 21’000-fold rate
enhancement as compared the reaction between DIMOC and 5-
(azidomethyl)-2′-deoxyuridine (AmdU) nucleoside. As single agents,
5'-bispivaloyloxymethyl (POM)-AmdU and DiMOC exhibited low
cytotoxicity, but highly toxic DNA-DNA ICLs were generated by
metabolic incorporation of AmdU groups into cellular DNA, followed
by treatment of the cells with DiMOC. These results provide the first
examples of intercalation-enhanced bioorthogonal chemical
reactions on DNA, and furthermore, the first strain-promoted double
click (SPDC) reactions inside of living cells.
and reacts to generate DNA-DNA interstrand cross links. To
utilize catalyst-free reactions,[11] azide groups were selected for
incorporation into DNA due to their compatibility with strain-
promoted azide-alkyne click (SPAAC) reactions.[12] For the
crosslinking agent, we envisioned that the integration of two
strained alkynes directly into a planar scaffold containing
cationic substituents could furnish
a novel “bioorthogonal
intercalating reagent” that reversibly intercalates into DNA and
rapidly crosslinks azide groups in opposite strands of the duplex.
Dibenzocycloocta-1,5-diyne (“CODY”), or “Sondheimer diyne”
(1)[13] has previously been used in strain-promoted double click
(SPDC) reactions of azide-modified carbohydrates on cell
surfaces,[14,15] but SPDC reactions have not been previously
demonstrated inside of whole cells or on nucleic acids. Previous
studies reported that three-component SPDC reactions between
CODY and the first azide is rate limiting, giving a highly reactive,
strained intermediate that reacts more rapidly with the second
azide group.[14,16] As such, the reaction of 1eq. of CODY with 1
eq. of AmdU (2)[17] in MeOH-chloroform (9:1) gave a 1:1 mixture
of cis/trans triazoles (3a/3b) and ~50% unreacted CODY as
products (Scheme 1, and Figure S1, SI). The apparent second-
order rate constant of this reaction was determined by
monitoring the loss in CODY absorbance ( = 351 nm) as a
function of time and AmdU concentration (Figure S2, SI) to give
an apparent second order rate constant (kapp) = 0.07 M-1s-1.
Bifunctional electrophiles such as phosphoramide mustard[1] and
cisplatin[2] react with nucleophiles in cellular DNA, RNA, and
proteins.[3] Among the wide variety of products formed, DNA–
DNA interstrand crosslinks (ICLs) are likely the most cytotoxic
because of their ability to directly block transcription and
replication.[4] Due to their extreme toxicity, bifunctional alkylating
agents were initially developed as chemical weapons and later,
certain derivatives were recognized as having important
chemotherapeutic activities.[5] Some of these agents are still
widely used in the first line therapies of various lymphomas,[6]
leukemias,[7] and solid tumors.[8] The low chemoselectivity of
these drugs contributes to their undesirable side effects,[9] and
their promiscuity makes it difficult to ascertain their exact mode
of action.[2,3]
N
O
N
dT
N
kapp
=
N3
NH
0.07 M-1s-1
+
+ 1
N
N
O
dT
N
dR
N
CODY (1)
AmdU (2)
cis/trans adduct (3a/3b)
O
To overcome the poor chemoselectivity of traditional cross-
linking agents, numerous methods have been established for the
synthesis of well-defined DNA-DNA ICLs in vitro,[10] but these
R
O
O
N3
NH
O
P
N
O
R
O
O
O
approaches represent
a large divergence from biological
O
O
O
pathways and are therefore not applicable in vivo. A new
method for chemoselective preparation of DNA-DNA ICLs in
cells would expand the scope of ICL applications in medicine
and bioanalytics. Here were report a two-step approach for ICL
formation where a non-native, non-toxic precursor of DNA
synthesis is applied to living cells such that bioorthogonal
functional groups are incorporated into opposing strands of
cellular DNA. A cell-permeable, small molecule containing
complimentary bioorthogonal functional groups is then added
Cl
R =
N
H
HO
POM-AmdU (5)
O
O
DiMOC (4)
Scheme 1. Reactions between 1 eq. CODY (1) and 1 eq. AmdU (2) in a 9:1
mixture of MeOH-chloroform gave a 1:1 mixture of cis/trans triazole products
(3a/3b) and 50% unreacted CODY (see Fig S1, SI), where “dR” = 2′-
deoxyribose and “dT” = 2'-deoxythymidine. See SI for the synthesis and
characterization of DiMOC (4), and reference 18 for POM-AmdU (5).
[a]
Dr. M. Tera, Z. Harati-Taji, Prof. Dr. N. W. Luedtke
Department of Chemistry, University of Zurich
Winterthurerstrasse 190, 8057 Zurich (Switzerland)
E-mail: nathan.luedtke@chem.uzh.ch
Dr. M. Tera
[b]
Bioorganic Research Institute, Suntory Foundation for Life Sciences
(SUNBOR)
8-1-1 Seikadai, Seika, Soraku, Kyoto 619-0284 (Japan)
Supporting information for this article is given via a link at the end of
the document.
This article is protected by copyright. All rights reserved.

10.1002/anie.201808054
Angewandte Chemie International Edition
COMMUNICATION
Figure 1. (a) Two-step process of non-covalent DIMOC intercalation followed by SPDC reaction to give ICL formation between opposing strands of azide-
containing DNA. (b) Estimated distances between (azido)methyl groups in duplexes 1 – 4 based on distances between thymidine methyl groups modeled by 3D-
DART.[19] Single-stranded DNA sequences for Duplex-1: TGCTGCGTTGTGTACAGACAAGAGAC; Duplex-2: TTCTGCGGTTGTGACAGACAAGAGAC; Duplex-3:
TGCTGCGTTGTTGCAAGACAAGAGAC; Duplex-4: TGCTGCGTCGTCGCAAGACACGAGAC (where “T” = AmdU residue). See Tables S1 – S3, SI for complete
DNA sequence information. (c) Denaturing PAGE analysis of 5′-fluorescein (FAM) labeled duplex DNA (2 nM) treated with DiMOC (12 nM) for 30 min at 25 ºC. (d)
Plots of initial ICL reaction rates versus DiMOC concentration (see Fig. S7, SI for raw data) yields an apparent second-order rate constant of 2.1 x 105 M-1 s-1.
Given the very poor water solubility of CODY, we
synthesized “DiMOC” (4) containing two morpholino sidechains
that are partially protonated under physiological conditions
(Scheme 1). The combination of the planar CODY scaffold with
cationic side chains enables reversible, low affinity intercalation
of DiMOC into unmodified duplex DNA. By monitoring changes
in the absorbance of DiMOC upon addition of calf thymus (CT)
DNA, direct binding experiments revealed the presence of a
weak binding interaction with an apparent dissociation constant
of Kd = 15 +/- 7M (Figure S3a-b, SI). To determine the binding
mode of DiMOC, viscosity titrations were conducted (Figure S3c,
SI). DiMOC caused increased viscosities of CT DNA solutions
that indicate an intercalation binding mode.[20] Consistent with
reversible, non-covalent binding of duplex DNA, DiMOC
exhibited no reactivity towards unmodified duplex DNA, yet CT
DNA did not inhibit the chemical reaction between DiMOC and
AmdU (Figure S4, SI).
DiMOC for 30 min at 25 °C and analyzed by denaturing PAGE
(Figure 1c). Duplex-1 reacted to give a 12 % yield of ICLs (likely
cis/trans isomers) having masses consistent with DNA-DiMOC-
DNA interstrand cross links (MALDI TOF MS = 17,625 m/z,
Figure S6, SI). In contrast, duplex-1′ containing only a single
AmdU unit did not react to give an ICL, rather only a DNA-
DiMOC “monoadduct” + H2O (MALDI TOF MS = 9,089 m/z).
Consistent with a close proximity of two azide groups (~7.0 Å),
duplex-2 reacted with DiMOC to give the highest yield (27%) of
a single DNA-DiMOC-DNA ICL product (MALDI TOF MS =
17,638 m/z). This compares very favorably with the use of
traditional bifunctional alkylating agents that react with duplex
DNA to give a complex mixture of products containing mostly
monoadducts and only 1 – 5 % of ICL DNA.[22]
To evaluate the apparent second-order rate constant (kapp) of
DNA-DiMOC-DNA ICL formation, the initial reaction rates of ICL
formation for duplex-2 were measured in the presence of
variable DiMOC concentrations (Figure 1d and Figure S7, SI).
This reaction proceeds exceptionally fast, even at nM
concentrations of reagents to give a kapp = 2.1 ± 0.2 x 105 M-1s-1.
This represents a 21’000-fold rate enhancement as compared to
the apparent second-order rate constant for the reaction
between the AmdU nucleoside (2) and DiMOC (kapp = 0.99 +/-
0.05 M-1s-1, Figure S2c-d, SI). Previous studies have also shown
how proximity effects resulting from non-covalent binding
interactions can accelerate reaction rates on nucleic acids.[23] To
the best of our knowledge, the ICL reaction between DiMOC and
duplex-2 represents the fastest DNA-small molecule covalent
To evaluate the ability of DiMOC to generate DNA-DNA ICLs
(Figure 1a), azide-containing duplex DNA was prepared using
enzymatic extension of a 5-fluorescein (FAM) modified primer in
the presence of 5-(azidomethyl)-2′-deoxyuridine (AmdU)
triphosphate (Figure S5, SI).[21] The templates were designed
and reactions conducted such that one or two AmdU units were
incorporated in the center of the duplex, with 0 – 3 base pairs
separating the azide groups, representing distances of
approximately 7.0 – 13.1 Å (Figure 1b). Aqueous solutions
containing each duplex (2 nM) were treated with 12 nM of
This article is protected by copyright. All rights reserved.

10.1002/anie.201808054
Angewandte Chemie International Edition
COMMUNICATION
modification reaction reported to date, with an apparent second-
order rate constant typical of many enzymatic transformations.[24]
To evaluate the possibility of DNA-DiMOC-DNA ICL
formation in living cells, we first evaluated the trends in toxicity of
DiMOC (4) and POM-AmdU (5) alone and in combination. POM-
AmdU is a relatively non-toxic nucleoside for the efficient
incorporation of azide groups into the genomes of replicating
cells and animals.[18] We used cell counting and Trypan blue
exclusion[25] to determine the impact of DiMOC (4) and POM-
AmdU (5) on viability and proliferation of HeLa (cervical
adenocarcinoma), as well as OCI-AML2 and OCI-AML3 (acute
myeloid leukemia) cells. When applied alone, these compounds
had little or no impact on HeLa cells at concentrations up to 30
μM of POM-AmdU and up to 30 μM of DiMOC for 72 h (Figure
S8, SI). The AML cell lines were somewhat more sensitive
towards the single agents, with maximal tolerated doses of 3 μM
of POM-AmdU and up to 10 μM of DiMOC (Figure S8, SI). When
applied in tandem, DiMOC and POM-AmdU exhibited highly
synergistic effects in all three cell lines. Cells were pretreated
with variable, sub-toxic doses of POM-AmdU (5) for 72 h,
followed by sub-toxic doses of DiMOC (4) for an additional 72 h
and analyzed for changes in cell number and viability (Figure 2a-
b). Interestingly, active and complete cell killing by the
combination of 4 + 5 was observed in HeLa cell cultures (Figure
2a), whereas OCI-AML2 (Figure 2b) and OCI-AML3 (Figure S8c,
SI) exhibited a maximal 50% reduction in the number viable cells,
indicative of cell cycle arrest. These results revealed cell-type
specific effects consistent with those previously reported for the
formation of DNA-DNA interstrand crosslinks in AML[26] and
HeLa[27] cell cultures.
compounds or DMSO alone (lanes 2, 4 and 6, Figure 2c). To
analyze this low mobility material for the presence of DNA-DNA
ICLs, 50 g of S1-resistant DNA from cells that had been treated
with POM-AmdU, DiMOC, or both compounds was subjected to
complete digestion with a mixture of enzymes (snake venom
phosphodiesterase I, exonuclease III, and shrimp alkaline
phosphatase), and the resulting nucleosides subjected to high
resolution LC-MS analysis. AmdU-DiMOC-AmdU ICL adducts
(Figures 2d,2e and Figure S10, SI) were observed in the
digested DNA from cells treated with both POM-AmdU and
DiMOC, but not the individual compounds alone. Taken together
with the rapid renaturation properties of the isolated DNA, these
results demonstrate the formation of DNA-DNA ICLs in the
genomes of cells treated with POM-AmdU and DiMOC.
To evaluate formation of cellular DNA-DNA ICLs, HeLa cells
were seeded at 500’000 cells per flask and treated with 100 μM
of POM-AmdU for 72 h. Since the population doubling time of
the HeLa cells was approximately 36 h under these conditions,
72 h allowed for two rounds of replication and therefore
incorporation of AmdU into opposing strands of DNA. The cells
were then washed and treated with 30 μM of DiMOC for 24 h.
Due to the shorter incubation time, the majority of HeLa cells
were still seemingly alive (69 +/- 7%) according to Trypan blue
exclusion.[25] The cells were washed, lysed, and the genomic
DNA was isolated. To evaluate the purified DNA for physical
properties consistent with DNA-DNA interstrand crosslinks,
denaturation–renaturation analyses were conducted.[28] This
assay is based on the fact that mixtures of genomic DNA lacking
ICLs are unable to “find” their complementary sequences
following denaturation and rapid renaturation, resulting in single-
stranded regions that are susceptible to S1 nuclease cleavage.
In contrast, complementary DNAs held together by ICLs quickly
rehybridize into long duplexes and therefore exhibit resistance
towards S1 nuclease degradation. The isolated genomic DNA
from treated HeLa cells was mechanically sheared by sonication
to obtain 100 – 300 bp DNA fragments, followed by denatured
with aqueous NaOH (pH 13.0), and rapid neutralization by
addition of HCl (Figure S9, SI). The samples were then treated
Figure 2. Number of living cells as compared to untreated controls according
to cell counting and Trypan blue staining of (a) HeLa cells or (b) OCI-AML2
cells following 72 h treatment with 0 – 30 M of POM-AmdU (5), washing, and
0 – 30 M of DiMOC (4) for 72 h. Toxicity values represent the mean and
standard error (SEM) of three independent biological replicates. (c) Analysis of
genomic DNA isolated from HeLa cells treated with 100 M of POM-AmdU for
72 h, followed by washing and treatment with 30 M of DiMOC for 24 h. The
treated cells were washed, lysed, and the isolated genomic DNA was
sonicated into 100 – 300 bp fragments. 14 g of each DNA sample was
denatured with aqueous NaOH, rapidly neutralized, digested with S1 nuclease.
Super denaturing PAGE (7M-urea, 40%-formamide, 8% polyacrylamide, 60
ºC) was used to resolve the samples, and the gel was stained with SYBR-gold
prior to imaging. (d) UHPLC-MS analysis of fully digested, S1-resistant
genomic DNA isolated from HeLa cells that had been treated with POM-AmdU
(100 M) for 72 h and DiMOC (30 M) for 24 h. Selected ion monitoring mode
for the chromatogram was m/z 513.20 – 513.21. (e) HRMS of AmdU-DiMOC-
with S1 nuclease and loaded onto
a super-denaturing
polyacrylamide gel (7M urea, 40% formamide, 8% crosslinked
polyacrylamide, 60 ºC). As a positive control, cisplatin (Cis-Pt)
was added to the live cells prior to harvesting of cellular DNA.
This caused the formation of S1-nuclease resistant ICL DNA
appearing as heterogeneous, low-mobility material on the gel
(lanes 8 and 10, Figure 2c). Similar low-mobility DNA was
apparent in cells treated with both POM-AmdU and DiMOC (lane
12, Figure 2c), but not from those treated with the individual
AmdU adduct isolated from HeLa cells. Mass calculated for C48H58N12O14
:
513.2092 (M + 2H)2+. The retention time and mass of this ICL product
matched those of a synthetic sample (Figure S10, SI).
This article is protected by copyright. All rights reserved.

10.1002/anie.201808054
Angewandte Chemie International Edition
COMMUNICATION
8846–8847. (b) Friscourt, F.; Fahrni, C. J.; Boons, G. J. A. J. Am. Chem.
Soc. 2012, 134, 18809–1881. (c) Wu, H.; Alexander, S. C.; Jin, S.; Devaraj,
N. K. J. Am. Chem. Soc. 2016, 138, 11429–11432. (d) Nainar, S.; Kubota,
M.; McNitt, C.; Tran, C.; Popik, V. V.; Spitale, R. C. J. Am. Chem. Soc.
2017, 139, 8090–8093.
[12] (a) Agard, N. J.; Prescher, J. A.; Bertozzi, C. R. J. Am. Chem. Soc. 2004,
126, 15046–15047. (b) van Delft, P.; van Schie, E.; Meeuwenoord, N.;
Overkleeft, H.; van der Marel, G.; Filippov, D. Synthesis (Stuttg). 2011,
2011, 2724–2732. (c) Marks, I. S.; Kang, J. S.; Jones, B. T.; Landmark, K.
J.; Cleland, A. J.; Taton, T. A. Bioconjug. Chem. 2011, 22, 1259–1263. (d)
Sharma, A. K.; Kent, A. D.; Heemstra, J. M. Anal. Chem. 2012, 84, 6104–
6109. (e) Holstein, J. M.; Schulz, D.; Rentmeister, A. Chem. Commun. 2014,
50, 4478–4481. (f) Merkel, M.; Peewasan, K.; Arndt, S.; Ploschik, D.;
Wagenknecht, H. A. ChemBioChem. 2015, 16, 1541–1553. (g) Zayas, J.;
Annoual, M.; Das, J. K.; Felty, Q.; Gonzalez, W. G.; Miksovska, J.; Sharifai,
N.; Chiba, A.; Wnuk, S. F. Bioconjug. Chem. 2015, 26, 1519–1532. (h)
Carell, T.; Vrabel, M. Top. Curr. Chem. 2016, 374, 9.
[13] (a) Wong, H. N. C.; Garratt, P. J.; Sondheimer, F. J. Am. Chem. Soc.
1974, 96, 5604–5605. (b) Xu, F.; Peng, L.; Shinohara, K.; Morita, T.;
Yoshida, S.; Hosoya, T.; Orita, A.; Otera, J. J. Org. Chem. 2014, 79,
11592–11608.
[14] Kii, I.; Shiraishi, A.; Hiramatsu, T.; Matsushita, T.; Uekusa, H.; Yoshida,
S.; Yamamoto, M.; Kudo, A.; Hagiwara, M.; Hosoya, T. Org. Biomol. Chem.
2010, 8, 4051–4055.
In summary, DiMOC is the first reported example of a
bioorthogonal “intercalating regent” that exhibits reversible
intercalation into duplex DNA (Kd = 15 M) where it undergoes
tandem, strain-promoted cross-linking of azide groups to give
DNA-DNA interstrand cross-links (ICLs). This reaction proceeds
with an exceptionally high apparent rate constant kapp = 2.1 x 105
M-1sec-1. This value is within the range of many enzymatic
transformations24 and is 21’100-fold faster than the non-
templated reaction between compounds 2 and 4 (Figure S2, SI).
DiMOC itself exhibited low cytotoxicity, but highly toxic DNA-
DNA interstrand crosslinks were generated in cells by metabolic
incorporation of azide groups, followed by treatment with DiMOC.
This type of approach for bioorthogonal crosslinking of cellular
DNA may enable future therapies and/or diagnostic techniques
that utilize two relatively non-toxic precursors. Intercalation-
enhanced bioorthogonal chemical reactions should be
applicable in other situations where enhanced reaction rates
between modified nucleic acids and bioorthogonal functional
groups are desired, such as the preparation of advanced
materials and nanodevices.[29]
[15] (a) Lau, Y. H.; Wu, Y.; Rossmann, M.; Tan, B. X.; de Andrade, P.; Tan, Y.
S.; Verma, C.; McKenzie, G. J.; Venkitaraman, A. R.; Hyvönen, M.; et al.
Angew. Chemie Int. Ed. 2015, 54, 15410–15413. (b) Sutton, D. A.; Yu, S.-
H.; Steet, R.; Popik, V. V. Chem. Commun. 2016, 52, 553–556.
[16] Sutton, D. A.; Popik, V. V. J. Org. Chem. 2016, 81, 8850–8857.
[17] Neef, A. B.; Luedtke, N. W. Chembiochem 2014, 15, 789–793.
[18] Tera, M.; Glasauer, S. M. K.; Luedtke, N. W. ChemBioChem 2018,
doi.org/10.1002/cbic.201800351.
Experimental Section
[19] van Dijk, M.; Bonvin, A. M. J. J. Nucleic Acids Res. 2009, 37 (SUPPL. 2),
235–239.
For experimental details see the electronic supporting information.
[20] Cohen, G.; Eisenberg, H. Biopolymers, 1969, 8, 45–55.
[21] Ren, X.; El-Sagheer, A. H.; Brown, T. Analyst 2015, 140, 2671–2678.
[22] Fischhaber, P. L.; Gall, A. S.; Duncan, J. A.; Hopkins, P. B. Cancer Res.
1999, 59, 4363–4368.
[23] (a) Minoshima, M.; Bando, T.; Sasaki, S.; Shinohara, K.; Shimizu, T.;
Fujimoto, J.; Sugiyama, H. J. Am. Chem. Soc. 2007, 129, 5384–5390. (b)
Shelbourne, M.; Chen, X.; Brown, T.; El-Sagheer, A. H. Chem. Commun.
2011, 47, 6257. (c) Wu, H.; Cisneros, B. T.; Cole, C. M.; Devaraj, N. K. J.
Am. Chem. Soc. 2014, 136, 17942–17945. (d) Di Antonio, M.; McLuckie, K.
I. E.; Balasubramanian, S. J. Am. Chem. Soc. 2014, 136, 5860–5863.
[24] Lang, K.; Chin, J. W. ACS Chem. Biol. 2014, 9, 16–20.
[25] Strober, W. T. Curr. Protoc. Immunol. 2015, 111, 1–3.
Acknowledgements
This work was supported by the Swiss National Science
Foundation grant #165949 (NWL) and by the Dr. Helmut
Legerlotz-Stiftung (MT). We thank Prof. Dr. J. Piel and Dr. R.
Ueoka for UHPLC-MS measurements.
[26] Xie, J.; Shults, K.; Flye, L.; Jiang, F.; Head, D. R.; Briggs, R. C. J. Cell.
Biochem. 2005, 95, 339–351.
[27] Osawa, T.; Davies, D.; Hartley, J. A. Cell Death Dis. 2011, 2, e187.
[28] (a) Kilbey, B. J.; Legator, M.; Nichols, W. HANDBOOK OF
MUTAGENICITY TEST PROCEDURES Library of Congress Cataloging in
Publication Data; Elsevier Science, 1984. (b) Dębiak, M.; Panas, A.;
Steinritz, D.; Kehe, K.; Bürkle, A. Toxicology 2011, 280, 53–60.
[29] Bujold, K. E.; Lacroix, A.; Sleiman, H. F. Chem, 2018, 4, 495–521.
Keywords: chemical biology; bioorthogonal chemistry; nucleic acids;
intercalating agent; strain-promoted azide-alkyne cycloaddition
[1] Dong, Q.; Barskt, D.; Colvin, M. E.; Melius, C. F.; Ludeman, S. M.;
Moravek, J. F.; Colvin, O. M.; Bigner, D. D.; Modrich, P.; Friedman, H. S.
Proc. Natl. Acad. Sci. U. S. A. 1995, 92, 12170–12174.
[2] Johnstone, T. C.; Suntharalingam, K.; Lippard, S. J. Chemical Reviews.
2016, 3436–3486.
[3] Melnikov, S. V; Oll, D.; Steitz, T. A.; Polikanov, Y. S. Nucleic Acids Res.
2016, 44, 4978–4987.
[4] Schärer, O. D. ChemBioChem 2005, 6, 27–32.
[5] Christakis, P. Yale J. Biol. Med. 2011, 84, 169–172.
[6] Gleeson, M.; Peckitt, C.; To, Y. M.; Edwards, L.; Oates, J.; Wotherspoon,
A.; Attygalle, A. D.; Zerizer, I.; Sharma, B.; Chua, S.; et al. Lancet Haematol.
2018, 5, e190–e200.
[7] Voorhies, B. N.; Stephens, D. M. Curr. Treat. Options Oncol. 2017, 18, 12.
[8] McCune, J. S.; Salinger, D. H.; Vicini, P.; Oglesby, C.; Blough, D. K.; Park,
J. R. J. Clin. Pharmacol. 2009, 49, 88–102.
[9] Sanderson, B. J. S.; Shield, A. J. Mutat. Res. Mol. Mech. Mutagen. 1996,
355, 41–57.
[10] (a) Cohen, S. B.; Cech, T. R. J. Am. Chem. Soc. 1997, 119, 6259–6268.
(b) Erlanson, D. A.; Glover, J. N. M.; Verdine, J. Am. Chem. Soc. 1997, 119,
6927–6928. (c) Kobertz, W. R.; Essigmann, J. M. J. Am. Chem. Soc. 1997,
119, 5960–5961. (d) Alefelder, S.; Sigurdsson, S. T. Bioorg. Med. Chem.
2000, 8, 269–273. (e) Nakane, M.; Ichikawa, S.; Matsuda, A. J. Org. Chem.
2008, 73, 1842–1851. (f) Peng, X.; In, S. H.; Li, H.; Seidman, M. M. J. Am.
Chem. Soc. 2008, 130, 10299–10306. (g) Qiu, Z.; Lu, L.; Jian, X.; He, C. A.
J. Am. Chem. Soc. 2008, 130, 14398–14399. (h) Hattori, K.; Hirohama, T.;
Imoto, S.; Kusano, S.; Nagatsugi, F. Chem. Commun. 2009, 42, 6463–6465.
(i) Pujari, S. S.; Xiong, H.; Seela, F. J. Org. Chem. 2010, 75, 8693–8696. (j)
Guainazzi, A.; Campbell, A. J.; Angelov, T.; Simmerling, C.; Schärer, O. D.
Chem. - A Eur. J. 2010, 16, 12100–12103. (k) De Beeck, M. O.; Madder, A.
J. Am. Chem. Soc. 2011, 133, 796–807. (l) Hentschel, S.; Alzeer, J.;
Angelov, T.; Schärer, O. D.; Luedtke, N. W. Angew. Chemie Int. Ed. 2012,
51, 3466–3469. (m) Shelbourne, M.; Brown Jr., T.; El-Sagheer, A. H.;
Brown, T. Chem. Commun. 2012, 48, 11184. (n) Haque, M. M.; Sun, H.; Liu,
S.; Wang, Y.; Peng, X. P. Angew. Chemie Int. Ed. 2014, 53, 7001–7005.
[11] (a) Schoch, J.; Wiessler, M.; Jäschke, A. J. Am. Chem. Soc. 2010, 132,
This article is protected by copyright. All rights reserved.

10.1002/anie.201808054
Angewandte Chemie International Edition
COMMUNICATION
COMMUNICATION
Click it together! An intercalating
agent based on the Sondheimer
diyne promoted very rapid, strain-
promoted double click (SPDC)
reactions between azide groups in
opposing strands of DNA to give
interstrand crosslinks. These results
provide the first examples of
intercalation-enhanced bioorthogonal
chemical reactions on DNA.
Masayuki Tera, Zahra Harati-Taji,
Nathan W. Luedtke*
Page No. – Page No.
Intercalation-enhanced “click”
crosslinking of DNA
This article is protected by copyright. All rights reserved.