Synthesis and properties of a novel molecular beacon containing a benzene-phosphate backbone at its stem moiety

Article abstract of DOI:10.1039/b901631g

This paper describes the synthesis and properties of a novel molecular beacon (MB) containing a benzene-phosphate backbone at its stem moiety. The fluorescence intensity of MBs was found to stabilize by the introduction of the benzene-phosphate backbone at its stem moiety. Furthermore, an MB containing the benzene-phosphate backbone was more resistant to DNase I (endonuclease) than an MB comprising natural DNA and 2′-O-methyl-RNA. These results indicate that the MB with the benzene-phosphate backbone is superior as a molecular beacon as compared to the MB composed of natural DNA and 2′-O-methyl-RNA. The Royal Society of Chemistry 2009.

Full text of DOI:10.1039/b901631g

View Article Online / Journal Homepage / Table of Contents for this issue
PAPER
www.rsc.org/obc | Organic & Biomolecular Chemistry
Synthesis and properties of a novel molecular beacon containing a
benzene-phosphate backbone at its stem moiety
Yoshihito Ueno,*a,b,c,e Akihiro Kawamura,a Keiji Takasu,a Shinji Komatsuzaki,a Takumi Kato,a Satoru Kuboe,a
Yoshiaki Kitamuraa and Yukio Kitade*a,b,c,d
Received 26th January 2009, Accepted 6th April 2009
First published as an Advance Article on the web 12th May 2009
DOI: 10.1039/b901631g
This paper describes the synthesis and properties of a novel molecular beacon (MB) containing a
benzene-phosphate backbone at its stem moiety. The fluorescence intensity of MBs was found to
stabilize by the introduction of the benzene-phosphate backbone at its stem moiety. Furthermore, an
MB containing the benzene-phosphate backbone was more resistant to DNase I (endonuclease) than
an MB comprising natural DNA and 2¢-O-methyl-RNA. These results indicate that the MB with the
benzene-phosphate backbone is superior as a molecular beacon as compared to the MB composed of
natural DNA and 2¢-O-methyl-RNA.
backbone forms a thermally and thermodynamically stable duplex
Introduction
in itself, while it does not form a thermally stable duplex with
Nucleic acid probes modified with fluorescent dyes are widely used
complementary natural DNA or RNA. We thus envisioned that
to detect specific DNA or RNA molecules. Molecular beacons
if we could introduce the analog into the stem moieties of an MB,
(MBs) are dual-labeled nucleic acid probes that fluoresce upon hy-
the fluorescence intensity of the MB would stabilize because un-
bridization with a complementary target sequence.1–13 The nucleic
necessary interactions between the target RNA and stem moieties
acid is labeled at one end with a fluorescent reporter dye and at
would be avoided, allowing highly sensitive detection of the target
the opposite end with a fluorescence quencher. MBs are designed
RNA. In this paper, we report the synthesis and properties of
to form a stem–loop hairpin structure in the absence target DNA
novel MBs containing the benzene-phosphate backbone at their
or RNA, forcing the fluorescence reporter group in proximity
stem moieties (Fig. 1). A preliminary account of this work has
appeared.19
with the quencher group. In this conformation, fluorescence is
quenched. In the presence of a complementary target molecule,
the MB opens due to formation of the more stable probe–target
duplex, increasing the distance between the reporter and quencher,
and restoring fluorescence. The competing reaction between
hairpin formation and target hybridization improves specificity
of MBs compared with linear probes. However, designing MBs is
not as simple as attaching arbitrary arm sequences to previously
designed linear probes. The stem arms can also interact with the
flanking region of the target RNAs, changing the hybridization
specificity; adapting the arms to avoid such undesired interactions
increases design complexity.14–17
We have recently reported the synthesis and properties of a
nucleic acid analog consisting of a benzene-phosphate backbone.18
The building blocks of the nucleic acid analog are composed
of bis(hydroxymethyl)benzene residues connected to nucleobases
via a biaryl-like axis. A thermal denaturation study of duplexes
revealed that a nucleic acid analog with a benzene-phosphate
Results
Synthesis of amidite units
We have previously reported the synthesis of phospho-
ramidite units of nucleoside analogs 1, 2, 3, and 4 (Fig. 2) based
on heterocyclization (Fig. 3a).18 However, it was not an efficient
access because of the many tedious steps involved. Recently, it
has been reported that N1-arylpyrimidines or N9-arylpurines can
be efficiently synthesized from an arylboronic acid derivative and
nucleobases by the Chan–Lam–Evans reaction using Cu(II) as
a catalyst (Fig. 3b).20–26 Thus, we employed this reaction for the
synthesis of our compounds.
First, we synthesized an arylboronic acid derivative 9 for the
coupling reaction (Scheme 1). Dimethyl 5-aminoisophthalate (5)
was diazotized with NaNO2 in the presence of KI to give a 5-iodo
derivative 6 in 48% yield. After reducing the ester moieties of 6
with LiBH4, the resulting hydroxyl groups were protected with
a tert-butyldimethylsilyl (TBDMS) group to give a bis(TBDMS)
derivative 8 in 97% yield. The treatment of 8 with n-BuLi at -78 ◦C
in Et2O and then B(OCH3)3 afforded 9 in 60% yield.
aDepartment of Biomolecular Science, Faculty of Engineering, Gifu Univer-
sity, Japan. E-mail: uenoy@gifu-u.ac.jp, ykkitade@gifu-u.ac.jp; Fax: +81-
58-293-2794; Tel: +81-58-293-2639
bUnited Graduate School of Drug Discovery and Medical Information
Sciences, Gifu University, Japan
cCenter for Emerging Infectious Diseases, Gifu University, Japan
The arylboronic acid derivative 9 was coupled with ade-
nine (10) in the presence of Cu(OAc)2 and N,N,N¢,N¢-tetra-
methylethylenediamine (TMEDA) in aqueous MeOH solution to
give an N9-aryladenine derivative 11 in 61% yield (Scheme 2).
dCenter for Advanced Drug Research, Gifu University, 1-1 Yanagido, Gifu,
501-1193, Japan
ePRESTO, JST (Japan Science and Technology Agency), 4-1-8 Honcho
Kawaguchi, Saitama, 332-0012, Japan
This journal is
The Royal Society of Chemistry 2009
Org. Biomol. Chem., 2009, 7, 2761–2769 | 2761
©

View Article Online
Fig. 1 Structure of the molecular beacon.
Synthesis of MBs
We selected an mRNA of a human RNase H (position 140–156)
as a target sequence. The sequences of MBs and target RNAs
used in this study are shown in Table 1. Fluorescein was attached
to the 5¢-terminus of each probe, while dabcyl was attached to
the opposite terminus. MB1 comprised natural DNA and 2¢-O-
methyl-RNA, while MB2 comprised 2¢-O-methyl-RNA and the
nucleic acid analog with the benzene-phosphate backbone. RNA1
had a natural sequence, whereas RNA2 included a complementary
sequence to the stem moiety of the MBs. RNA3 contained 4
mismatched bases.
UV melting studies of MBs
The stability of hairpin conformations of the MBs was studied by
thermal denaturation (Fig. 4). Although the Tm value (51.6 ◦C in
1.0 M NaCl) of MB2 containing the benzene-phosphate backbone
was slightly lower than that of MB1 composed of natural DNA
and 2¢-O-methyl-RNA (56.3 ◦C in 1.0 M NaCl), the benzene-
phosphate moieties of MB2 could form a thermally stable hybrid
under test conditions.
Fig. 2 Structures of amidite units.
The reaction of
9 with 2-bis(tert-butoxycarbonyl)amino-6-
chloropurine (12) gave a 2-amino-N9-aryl-6-chloropurine deriva-
tive 13 in 33% yield (Scheme 3). The treatment of 13 with
aqueous TFA solution afforded an N9-arylguanine derivative
14 in 87% yield. Similarly, the reaction of 9 with cytosine (15)
gave an N1-arylcytosine derivative 16 in 91% yield (Scheme 4).
The treatment of 16 with 6 M HCl and then aqueous NaNO2
produced N4-aryluracil (17) in 85% yield. These compounds were
converted to the phosphoramidites 1, 2, 3, and 4 according to
the reported method. From these results, it was found that 11
and 13 were efficiently synthesized by the cross-coupling reaction
using Cu(OAc)2 as the catalyst although the yield of the coupling
reaction of 12 was lower than that of other compounds.
Detection of target RNAs by MBs
Each MB was allowed to anneal with the target RNAs. The
fluorescence intensity increased as a function of the target RNA
concentration (Figs. 5a and b). When RNA1 and RNA2 with
complementary sequences were used as targets, the fluorescence
intensity plateaued near 0.5 mM of target RNA. On the other
hand, when RNA3 containing 4 mismatched bases was used as the
target, the fluorescence intensity increased gradually and did not
reach a plateau even at 3.0 mM of target RNA. This indicates that
these MBs can distinguish the target RNAs from the 4-nucleotide
2762 | Org. Biomol. Chem., 2009, 7, 2761–2769
This journal is
The Royal Society of Chemistry 2009
©

View Article Online
Fig. 3 Synthetic routes.
Scheme 1 Reagents and conditions: (a) (1) NaNO2, 0.37 M HCl, 0 ◦C, 1 h, (2) KI, 0 ◦C, 1 h, 48%; (b) LiBH4, THF, rt, 24 h, 76%; (c) TBDMSCl,
imidazole, DMF, rt, 2 h, 97%; (d) (1) n-BuLi, THF, -78 ◦C, 1 h, (2) B(OMe)3, -78 ◦C, 1 h, and then rt, 12 h, 60%.
Nuclease resistant property of MBs
The stability of the MBs against nucleolytic degradation was
examined using DNase I (endonuclease). MB1 and MB2 were
incubated with DNase I at 37 ◦C, and the reactions were analyzed
by carrying out polyacrylamide gel electrophoresis (PAGE) under
denaturing conditions. As shown in Figs. 6a and b, MB1 compris-
ing natural DNA and 2¢-O-methyl-RNA was hydrolyzed randomly
after 1 min of incubation; MB2 comprising 2¢-O-methyl-RNA and
the nucleic acid analog with the benzene-phosphate backbone was
highly resistant to the enzyme. Therefore, it was apparent that MB2
containing the benzene-phosphate backbone was more resistant
to DNase I than MB1. Figs. 7a and b show the change in the
fluorescence intensities of the reaction mixtures containing MBs
and DNase I. The fluorescence intensity of the mixture containing
Scheme
2
Reagents and conditions: (a) adenine, Cu(OAc)2·H2O,
TMEDA, MeOH:H2O (4:1 v/v), rt, 2 h, 61%.
mismatched RNA. Furthermore, the difference in the fluorescence
intensities between MB2:RNA1 and MB2:RNA2 hybrids with
excess amounts of RNA targets turned out to be smaller than that
between MB1:RNA1 and MB1:RNA2 hybrids.
Scheme 3 Reagents and conditions: (a) 2-amino-N,N -bis(tert-butoxycarbonyl)-6-chloropurine, Cu(OAc)2·H2O, TMEDA, MeOH:H2O (4:1 v/v), rt, 2 h,
33%; (b) 50% TFA, H2O,rt, 48 h, 87%.
This journal is
The Royal Society of Chemistry 2009
Org. Biomol. Chem., 2009, 7, 2761–2769 | 2763
©

View Article Online
Table 1 Sequences of oligomers used in this study. Me, r, d, and b represent 2¢-O-methylribonucleoside, ribonucleoside, 2¢-deoxyribonucleoside, and
the benzene-type analog, respectively. The underlined letters indicate complementary sequences to the loop regions of MBs. The bold letters indicate a
complementary sequence to the stem region of MB. The italicized letters represent the mismatched bases. Flu and Dab indicate fluorescein and dabcyl,
respectively
No. of ON
sequence
MB1
Flu-5¢-d(GCAAGC)-2¢-O-Me(CCGGUCCACUUGUGCUC)-d(GCUUGC)-3¢-Dab
Flu-5¢-b(GCAAGC)-2¢-O-Me(CCGGUCCACUUGUGCUC)-b(GCUUGC)-3¢-Dab
3¢-r(GUCGUCCUUUGGCCAGGUGAACACGAGACGUGAGUAA)-5¢
MB2
RNA1
RNA2
RNA3
¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯
3¢-r(GUCGCGUUCGGGCCAGGUGAACACGAGACGUGAGUAA)-5¢
¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯
3¢-r(GUCGUCCUUUGGACAGCUGAUCACCAGACGUGAGUAA)-5¢
¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯ ¯
Scheme 4 Reagents and conditions: (a) cytosine, Cu(OAc)2·H2O, TMEDA, MeOH:H2O (4:1 v/v), rt, 2 h, 91% (b) (1) 0.16 M HCl, rt, 1 h; (2) aqueous
NaNO2, 0 ◦C, 3 h, and then 110 ◦C, 3 days, 85%.
Fig. 4 UV melting profiles. Solid line: MB2. Dashed line: MB1.
MB1 increased with time, whereas that of the mixture containing
Fig. 6 20% PAGE of MBs hydrolyzed by DNase I. (a) MB1. (b) MB2.
MB2 hardly changed.
efficient access because of the many tedious steps involved.18 Re-
cently, it was reported that N1-arylpyrimidines or N9-arylpurines
can be efficiently synthesized from an arylboronic acid derivative
and nucleobases by the Chan–Lam–Evans reaction using Cu(II)
Discussion
In a previous paper, we reported the synthesis of nucleoside
analogs based on heterocyclization. However, it was not an
Fig. 5 Fluorescence intensity measurement (1). (a) The profiles of MB1. (b) The profiles of MB2. Circle: RNA2. Square: RNA1. Triangle: RNA3.
2764 | Org. Biomol. Chem., 2009, 7, 2761–2769 This journal is The Royal Society of Chemistry 2009
©

View Article Online
Fig. 7 Fluorescence intensity measurement (2). (a) MB1. (b) MB2.
as a catalyst.20–26 Thus, we employed the reaction for the synthesis
of our compounds.
and MB1:RNA2 hybrids. The result indicates that the sequence
dependency of the fluorescence intensity of MBs can be reduced
by the introduction of the benzene-phosphate backbone at their
stem moieties.
The arylboronic acid derivative was coupled with cytosine
in the presence of Cu(OAc)2 and TMEDA in aqueous MeOH
solution to give an N1-arylcytosine derivative in a good yield.
The N1-arylcytosine derivative was efficiently converted to
N1-aryluracil. Similarly, the reaction of the arylboronic acid
derivative with adenine gave an N9-aryladenine derivative in a
moderate yield. The yield of the coupling reaction of a 2-amino-
6-chloropurine derivative with the arylboronic acid derivative was
lower than that of other compounds. However, the total synthetic
yield of the amidite unit was better than the previous one.
MBs are designed to form a stem–loop hairpin structure in
the absence of a target, quenching the fluorophore reporter.
However, designing MBs is not as simple as attaching arbitrary
arm sequences to previously designed linear probes. The stem
arms can also interact with the flanking regions of target RNAs,
changing the hybridization specificity; adapting the arms to avoid
such undesired interactions increases design complexity.14–17 In
our previous research, we found that the nucleic acid analog
with the benzene-phosphate backbone forms a thermally and
thermodynamically stable duplex in itself but does not form a
thermally stable duplex with complementary natural DNA or
RNA.18 Thus, we expected that the fluorescence intensity of the
MBs would stabilize by the introduction of the analog into their
stem moieties, as unnecessary interactions between the target
RNA and stem moieties would be avoided.
The resistance of MBs to nucleolytic hydrolysis by nucleases
is an important factor to be considered when they are used in
living cells.27–30 MBs form stem–loop hairpin structures in the
absence of target RNAs. Under these conditions, fluorescence is
not observed because the fluorescence of fluorophore is quenched
by the quencher. However, if MBs are the substrate of nucleases
in the cells, they are digested by the nucleases, and fluorophore
is spatially separated from the quencher so that fluorescence is
observed. This is one of the reasons for the high fluorescence
background observed when MBs are used in living cells.
Thus, the stability of MBs against nucleolytic degradation was
examined using DNase I (endonuclease). MB1 comprising natural
DNA and 2¢-methyl-RNA was hydrolyzed randomly after 1 min
of incubation; MB2 composed of 2¢-O-methyl-RNA and the
nucleic acid analog with the benzene-phosphate backbone was
highly resistant to the enzyme. Therefore, it was found that MB2
containing the benzene-phosphate backbone was more resistant
to DNase I than MB1. The fluorescence intensities of the reaction
mixtures were also measured. The fluorescence intensity of the
reaction mixture containing MB1 increased with time, whereas
that of the reaction mixture containing MB2 hardly changed.
Thus, from these results, it was found that MB2 has superior
properties as a molecular beacon as compared to MB1.
The fluorescence intensities of MBs increased as a function
of the target RNA concentrations. When excess amounts of
target RNAs were added to solutions containing MBs, the
fluorescence intensity of the solution containing the MB1:RNA2
hybrid was greater than that of the solution containing the
MB1:RNA1 hybrid. The target RNA2 includes a sequence, that is
complementary to the stem moiety of MB1, at the flanking region.
Thus, the difference in the fluorescence intensities of the hybrids
is considered to be a result of the interaction between the flanking
region of target RNA2 and the stem moiety of MB1. When MB2
containing the benzene-phosphate backbone at the stem moiety
was used, the fluorescence intensity of the solution containing the
MB2:RNA2 hybrid was slightly greater than that of the solution
containing the MB2:RNA1 hybrid. However, the difference in the
fluorescence intensities between the MB2:RNA1 and MB2:RNA2
hybrids was apparently smaller than that between the MB1:RNA1
In the present study, novel MBs containing a benzene-phosphate
backbone at the stem moiety were synthesized, and their properties
were studied. The sequence dependency of the fluorescence
intensity of MBs was found to reduce by the introduction of the
benzene-phosphate backbone at the stem moiety. Furthermore, it
was found that MB2 containing the benzene-phosphate backbone
was more resistant to DNase I (endonuclease) than MB1 com-
posed of natural DNA and 2¢-O-methyl-RNA. The use of these
MBs in living cells is now under investigation.
Experimental
General remarks
The NMR spectra were recorded at 400 MHz (1H) and 100 MHz
(13C) and were reported in ppm downfield from tetramethylsilane.
This journal is
The Royal Society of Chemistry 2009
Org. Biomol. Chem., 2009, 7, 2761–2769 | 2765
©

View Article Online
The coupling constants (J) are expressed in Hertz. The mass
spectra were obtained by the electron ionization (EI) or fast
atom bombardment (FAB) method. Thin-layer chromatography
was carried out on Merck coated plates 60F254. Silica gel column
chromatography was carried out on Wakogel C-300.
and 0.5 M HCl. The organic layer was washed with brine, dried
(Na2SO4), and concentrated. The residue was purified by column
chromatography (SiO2, 0–2% MeOH in CHCl3) to give 9 (0.69 g as
a white solid, 60%): 1H NMR (CDCl3) d 8.03 (s, 2H, H-2 and H-6),
7.61 (s, 1H, H-4), 4.87 (s, 4H, CH2), 0.10 (s, 18H, t-BuSi), 0.16 (s,
12H, CH3Si); 13C NMR (CDCl3) d 141.0, 131.7, 129.5, 128.0, 65.0,
26.0, 18.5, -5.2. Anal. Calcd for C20H39BO4Si2: C, 58.52; H, 9.58.
Found: C, 58.24; H, 9.34.
Dimethyl 5-iodoisophthalate (6)
To a solution of dimethyl 5-aminoisophthalate (1.00 g, 4.78 mmol)
and NaNO2 (0.66 g, 9.56 mmol) in H2O (5.7 mL) was added 2 M
HCl (1.3 mL) at 0 ◦C, and the whole was stirred at 0 ◦C for 1 h.
To the mixture was added a solution of KI (1.59 g, 9.56 mmol) in
H2O (23 mL), and the whole was stirred at room temperature for
1 h. The mixture was partitioned between CHCl3 and H2O. The
organic layer was washed with aqueous NaHCO3 (saturated) and
brine, dried (Na2SO4), and concentrated. The residue was purified
by column chromatography (SiO2, 2% MeOH in CHCl3) to give 6
(0.737 g as a pale yellow solid, 48%): LRMS (EI) m/z 320 (M+);
1H NMR (CDCl3) d 8.63 (t, 1H, J = 1.5, H-2), 8.55 (d, 2H, J =
1.5, H-4 and H-6), 3.95 (s, 6H, CH3); 13C NMR (CDCl3) d 164.8,
142.5, 132.2, 129.9, 93.4, 52.7; HRMS (EI) calcd for C10H9IO4
319.9553, found 319.9546.
9-[3,5-Bis(tert-butyldimethylsilyloxymethyl)phenyl]adenine (11)
A mixture of 9 (81 mg, 0.20 mmol), adenine (32 mg, 0.24 mmol),
TMEDA (30 mL, 0.20 mmol), Cu(OAc)2·H2O (20 mg, 0.10 mmol)
in MeOH (1.6 mL) and H2O (0.4 mL) was vigorously stirred under
an atmosphere of air at room temperature for 2 h. The mixture was
partitioned between CHCl3 and brine. The organic layer was dried
(Na2SO4), and concentrated. The residue was purified by column
chromatography (SiO2, 20–100% EtOAc in hexane) to give 11
(60 mg, 61%): LRMS (EI) m/z 499 (M+); 1H NMR (CDCl3) d 8.40
(s, 1H, adenine), 8.08 (s, 1H, adenine), 7.54 (s, 2H, aromatic H),
7.36 (s, 1H, aromatic H), 5.85 (s, 2H, NH2), 4.83 (s, 4H, CH2), 0.96
(s, 18H, t-BuSi), 0.13 (s, 12H, CH3Si); 13C NMR (CDCl3) d 155.6,
153.6, 150.0, 143.6, 139.7, 134.7, 122.9, 120.1, 119.3, 64.4, 25.9,
18.4, -5.3; HRMS (EI) calcd for C25H41N5O2Si2 499.2799, found:
499.2803. Anal. Calcd for C25H41N5O2Si2·1/2H2O: C, 59.01; H,
8.32; N, 13.76. Found: C, 59.19; H, 8.17; N, 13.76.
1,3-Bis(hydroxymethyl)-5-iodobenzene (7)
A mixture of 6 (0.46 g, 1.44 mmol) and LiBH4 (0.16 g, 7.35 mmol)
in THF (8 mL) was stirred at room temperature for 24 h. To
the mixture was added aqueous NaHCO3 (1 mL) at 0 ◦C, and
the whole was stirred at room temperature for 1 h. The solvent
was evaporated in vacuo, and the resulting residue was purified
by column chromatography (SiO2, 30–100% EtOAc in hexane) to
give 7 (0.29 g as a white solid, 76%): LRMS (EI) m/z 264 (M+); 1H
NMR (CDCl3) d 7.65 (m, 2H, H-4 and H-6), 7.33 (m, 1H, H-2),
4.66 (d, 4H, J = 5.2, CH2), 1.71 (t, 2H, J = 5.2, OH); 13C NMR
(DMSO-d6) d 145.0, 133.1, 123.8, 94.4, 62.1; HRMS (EI) calcd for
C8H9IO2 263.9647, found 263.9637.
2-Amino-N2-bis(tert-butoxycarbonyl)-9-[3,5-bis(tert-
butyldimethylsilyloxymethyl)phenyl]-6-chloropurine (13)
A mixture of 9 (0.58 g, 1.42 mmol), 2-amino-N,N -bis(tert-
butoxycarbonyl)-6-chloropurine (0.63 g, 1.70 mmol), TMEDA
(0.21 mL, 1.39 mmol), and Cu(OAc)2·H2O (0.14 g, 0.70 mmol)
in MeOH (4 mL) and H2O (1 mL) was vigorously stirred under
an atmosphere of air at room temperature for 2 h. The mixture
was partitioned between CHCl3 and brine. The organic layer was
dried (Na2SO4), and concentrated. The residue was purified by
column chromatography (SiO2, 25% EtOAc in hexane) to give 13
(0.34 g, 33%): LRMS (FAB) m/z 734 (MH+); 1H NMR (CDCl3)
d 8.43 (s, 1H, H-8), 7.53 (s, 2H, aromatic H), 7.43 (s, 1H, aromatic
H), 4.83 (s, 4H, CH2), 1.44 (s, 18H, t-BuO), 0.96 (s, 18H, t-BuSi),
0.13 (s, 12H, CH3Si); 13C NMR (DMSO-d6) d 152.5, 152.1, 151.7,
150.5, 144.9, 143.9, 133.7, 130.5, 123.6, 119.1, 83.6, 64.3, 27.9,
25.9, 18.4, -5.3; HRMS (FAB) calcd for C16H19N6O3 734.35360,
found 734.35432. Anal. Calcd for C35H57N5O6 Si2Cl: C, 57.23; H,
7.69; N, 9.54. Found: C, 57.48; H, 7.43; N, 9.19.
1,3-Bis(tert-butyldimethylsilyloxymethyl)-5-iodobenzene (8)
A mixture of 7 (0.27 g, 1.03 mmol), TBDMSCl (0.34 g, 2.27 mmol),
and imidazole (0.31 g, 4.53 mmol) in DMF (4 mL) was stirred
at room temperature for 2 h. EtOH (1 mL) was added to the
mixture, and the whole was stirred for 10 min. The mixture
was partitioned between EtOAc and H2O. The organic layer
was washed with aqueous NaHCO3 (saturated) and brine, dried
(Na2SO4), and concentrated. The residue was purified by column
chromatography (SiO2, 30–100% EtOAc in hexane) to give 8
(0.50 g as a pale oil, 97%): 1H NMR (CDCl3) d 7.48 (s, 2H, H-4 and
H-6), 7.20 (s, 1H, H-2), 4.62 (s, 4H, CH2), 0.89 (s, 18H, t-BuSi),
0.05 (s, 12H, CH3Si); 13C NMR (CDCl3) d 143.6, 133.5, 122.9,
94.1, 64.1, 25.9, 18.4, -5.3.
9-[3,5-Bis(hydroxymethyl)phenyl]guanine (14)
A mixture of 13 (0.50 g, 0.68 mmol), TFA (5.2 mL, 70 mmol),
and H2O (5.2 mL) was stirred at room temperature for 48 h. The
solvent was evaporated in vacuo. The resulting residue was filtered
and washed with H2O to give 14 (0.17 g, 87%): LRMS (FAB) m/z
288 (MH+); 1H NMR (DMSO-d6) d 10.67 (s, 1H, NH), 7.93 (s, 1H,
H-8), 7.42 (s, 2H, aromatic H), 7.35 (s, 1H, aromatic H), 6.48 (s,
2H, NH2), 5.31 (t, 2H, J = 5.4, OH), 4.55 (d, 4H, J = 5.4, CH2); 13C
NMR (DMSO-d6) d 157.5, 154.1, 151.5, 144.2, 137.4, 135.0, 124.2,
120.8, 117.3, 62.8; HRMS (FAB) calcd for C13H14N5O3 288.1097,
found 288.1101. Anal. Calcd for C13H13N5O3·1/7H2O: C, 53.87;
H, 4.62; N, 24.16. Found: C, 54.11; H, 4.64; N, 24.07.
3,5-Bis(tert-butyldimethylsilyloxymethyl)phenylboronic acid (9)
To a solution of 8 (1.40 g, 2.82 mmol) in Et2O (14 mL) was
slowly added n-BuLi (1.6 M in hexane, 3.52 mL, 5.64 mmol)
at -78 ◦C, and the whole was stirred at -78 ◦C for 1 h. To the
mixture was slowly added trimethyl borate (1.24 mL, 11.1 mmol)
at -78 ◦C, and the whole was slowly warmed to room temperature
and stirred for 12 h. The mixture was partitioned between EtOAc
2766 | Org. Biomol. Chem., 2009, 7, 2761–2769
This journal is
The Royal Society of Chemistry 2009
©

View Article Online
1-[3,5-Bis(tert-butyldimethylsilyloxymethyl)phenyl]cytosine (16)
4-N-Benzoyl-1-[3-(4,4¢-dimethoxytrityloxymethyl)-5-
(hydroxymethyl)phenyl]cytosine (20)
A mixture of 9 (0.40 g, 0.97 mmol), cytosine (0.13 g, 1.12 mmol),
TMEDA (0.15 mL, 0.97 mmol), and Cu(OAc)2·H2O (97 mg,
0.49 mmol) in MeOH (4 mL) and H2O (1 mL) was vigorously
stirred under an atmosphere of air at room temperature for 2 h.
The mixture was partitioned between CHCl3 and brine. The
organic layer was dried (Na2SO4), and concentrated. The residue
was purified by column chromatography (SiO2, 0–10% MeOH in
CHCl3) to give 16 (0.42 g, 91%): LRMS (FAB) m/z 475 (MH+);
1H NMR (CDCl3) d 7.56 (d, 1 H, J = 7.4, H-6), 7.32 (s, 1H,
aromatic H), 7.08 (s, 2H, aromatic H), 5.75 (d, 1 H, J = 7.4, H-5),
Compound 16 was converted to 20 according to the reported
method:18 1H NMR (DMSO-d6) d 11.35 (s, 1H), 8.17 (d, 1H,
J = 7.2), 8.02 (d, 2H, J = 7.6), 7.65–6.90 (m, 20H), 5.37 (t, 1H,
J = 6.0), 4.56 (d, 2H, J = 6.0), 4.12 (s, 2H), 3.73 (s, 6H); 13C
NMR (DMSO-d6) d 158.1, 144.8, 143.9, 139.6, 135.5, 132.8, 129.7,
128.5, 128.0, 127.6, 126.8, 124.4, 123.1, 122.9, 113.3, 86.1, 79.2,
64.6, 62.3, 55.0; LRMS (FAB) m/z 654 (MH+); HRMS (FAB)
calcd for C40H36N3O6 654.2604, found 654.2610. Anal. Calcd for
C40H35N3O6·5/4H2O: C, 70.81; H, 5.61; N, 6.19. Found: C, 71.19;
H, 5.67; N, 5.77.
4.72 (s, 4H, CH2), 0.90 (s, 18H, t-BuSi), 0.08 (s, 12H, CH3Si); 13
C
NMR (CDCl3) d 166.9, 156.7, 146.0, 143.5, 141.4, 123.8, 123.2,
95.5, 65.1, 26.6, 19.0, -4.6; HRMS (FAB) calcd for C24H42N3O3Si2
476.2778, found 476.2765.
1-[3-(4,4¢-Dimethoxytrityloxymethyl)-5-(hydroxymethyl)phenyl]-
uracil (21)
Compound 17 was converted to 21 according to the reported
method:18 1H NMR (DMSO-d6) d 11.41 (s, 1H), 7.67 (d, 1H, J =
8.0), 7.44–6.89 (m, 16H), 5.64 (d, 1H, J = 8.0), 5.32 (t, 1H, J = 5.4),
4.53 (d, 2H, J = 5.4), 4.09 (s, 2H), 3.72 (s, 6H); 13C NMR (DMSO-
d6) d 163.7, 158.1, 150.4, 145.5, 144.8, 144.0, 139.6, 138.8, 135.5,
129.7, 128.0, 127.6, 126.8, 124.3, 123.4, 123.3, 113.4, 101.6, 86.0,
79.2, 64.6, 62.3, 55.0; LRMS (FAB) m/z 551 (MH+); HRMS(FAB)
calcd for C33H31N2O6 551.2104, found 551.2176. Anal. Calcd for
C33H30N2O6·1/2H2O: C, 70.83; H, 5.58; N, 5.01. Found: C, 70.62;
H, 5.78; N, 4.74.
1-[3,5-Bis(hydroxymethyl)phenyl]uracil (17)
A mixture of 16 (500 mg, 105 mmol), 6 M HCl (28 mL) and H2O
(1 mL) was stirred at room temperature for 1 h. A solution of
NaNO2 (15 mg, 210 mmol) in H2O (130 mL) was added to the
mixture at 0 ◦C. The whole was stirred at 0 ◦C for 3 h, and then at
110 ◦C for 3 days. The solvent was evaporated in vacuo, and the
resulting residue was purified by column chromatography (SiO2,
10–20% MeOH in CHCl3) to give 17 (220 mg as a white solid,
85%): LRMS (EI) m/z 248 (M+); 1H NMR (DMSO-d6) d 11.42 (s,
1H, NH), 7.65 (d, 1H, J = 8.0, H-6), 7.32–7.17 (s, 3H, aromatic H),
5.65 (d, 1H, J = 8.0, H-5), 5.31 (t, 2H, J = 5.6, OH), 4.52 (d, 4H,
J = 5.6, CH2); 13C NMR (DMSO-d6) d 163.7, 150.4, 145.5, 143.7,
138.7, 124.0, 122.8, 101.6, 62.7; HRMS (EI) calcd for C12H12N2O4
248.0797, found 248.0790. Anal. Calcd for C12H12N2O4: C, 58.06;
H, 4.87; N, 11.29. Found: C, 58.00; H, 4.87; N, 11.24.
1-[3-[[(2-Cyanoethoxy)(N,N -diisopropylamino)phosphinyl]-
oxymethyl]-5-(4,4¢-dimethoxytrityloxymethyl)phenyl]uracil (1)
Compound 21 (0.80 g, 1.45 mmol) was dissolved in THF
(9.7 mL) containing N,N -diisopropylethylamine (1.46 mL,
8.72 mmol). Chloro(2-cyanoethoxy)(N,N -diisopropylamino)-
phosphine (0.65 mL, 2.9 mmol) was added to the solution, and
the mixture was stirred at room temperature for 1 h. Aqueous
NaHCO3 (saturated) and CHCl3 were added to the mixture, and
the separated organic layer was washed with aqueous NaHCO3
(saturated) and brine, dried (Na2SO4) and concentrated. The
residue was purified by column chromatography (a neutralized
SiO2, EtOAc) to give 1 (0.88 g, 81%): 31P NMR (CDCl3)
d 148.9.
6-N-Benzoyl-9-[3-(4,4¢-dimethoxytrityloxymethyl)-5-
(hydroxymethyl)phenyl]adenine (18)
Compound 11 was converted to 18 according to the reported
method:18 1H NMR (CDCl3) d 9.03 (s, 1H), 8.89 (s, 1H), 8.31 (s,
1H), 8.06 (d, 2H, J = 7.6), 7.69–6.82 (m, 19H), 4.84 (d, 2H, J =
5.6), 4.33 (s, 2H), 3.79 (s, 6H); 13C NMR (CDCl3) d 164.7, 158.6,
153.2, 151.8, 149.9, 149.5, 144.7, 143.3, 142.1, 142.0, 135.9, 134.4,
133.6, 132.8, 130.0, 128.9, 128.1, 128.0, 127.9, 126.9, 125.0, 123.3,
120.9, 120.3, 64.9, 64.4, 55.2, 53.6, 39.0, 20.7, 14.0; LRMS (FAB)
m/z 678 (MH+); HRMS (FAB) calcd for C41H36N5O5 678.2716,
found: 678.2711.
4-N-Benzoyl-1-[3-[[(2-cyanoethoxy)(N,N -diisopropylamino)-
phosphinyl]oxymethyl]-5-(4,4¢-dimethoxytrityloxymethyl)phenyl]-
cytosine (3)
9-[3-(4,4¢-Dimethoxytrityloxymethyl)-5-(hydroxymethyl)phenyl]-
2-N-[(dimethylamino)methylene]guanine (19)
Compound 20 (0.66 g, 1.01 mmol) was phosphitylated as described
in the preparation of 1 to give 3 (0.83 g, 96%): 31P NMR (CDCl3)
d 149.4.
Compound 14 was converted to 19 according to the reported
method:18 1H NMR (CDCl3) d 8.78 (s, 1H), 8.45 (s, 1H), 7.89–6.82
(m, 17H), 4.78 (s, 2H), 4.25 (s, 2H), 3.78 (s, 6H), 2.92 (s, 3H), 2.53 (s,
3H); 13C NMR (CDCl3) d 158.6, 158.1, 158.0, 156.8, 150.2, 144.9,
143.1, 141.2, 137.3, 136.0, 135.4, 129.9, 128.0, 126.9, 124.0, 121.0,
120.5, 120.1, 113.2, 86.5, 64.9, 64.4, 55.2, 40.7, 35.0; LRMS (FAB)
m/z 645 (MH+); HRMS (FAB) calcd for C37H37N6O5 645.2747,
found 645.2819. Anal. Calcd for C37H36N6O5 ·5/4H2O: C, 66.99;
H, 5.99; N, 12.34. Found: C, 66.83; H, 5.73; N, 12.09.
6-N-Benzoyl-9-[3-[[(2-cyanoethoxy)(N,N -diisopropylamino)-
phosphinyl]oxymethyl]-5-(4,4¢-dimethoxytrityloxymethyl)phenyl]-
adenine (2)
Compound 18 (0.45 g, 0.66 mmol) was phosphitylated as described
in the preparation of 1 to give 2 (0.51 g, 88%): 31P NMR (CDCl3)
d 149.4.
This journal is
The Royal Society of Chemistry 2009
Org. Biomol. Chem., 2009, 7, 2761–2769 | 2767
©

View Article Online
9-[3-[[(2-Cyanoethoxy)(N,N -diisopropylamino)phosphinyl]-
oxymethyl]-5-(4,4¢-dimethoxytrityloxymethyl)phenyl]-2-N-
[(dimethylamino)methylene]guanine (4)
periods, aliquots (5 mL) of the reaction mixture were separated
and added to a solution of 9 M urea (15 mL). The mixtures were
analyzed by electrophoresis on 20% polyacrylamide gel containing
7 M urea. The MB in the gel was visualized by a Typhoon system
(Amersham Biosciences).
Compound 19 (0.78 g, 1.21 mmol) was phosphitylated as described
in the preparation of 1 to give 4 (0.62 g, 60%): 31P NMR (CDCl3)
d 149.3.
Fluorometry of MBs treated with DNase I
Oligomer synthesis
Each solution containing each MB (60 pmol, final 0.3 mM) in a
buffer comprised of 10 mM Tris-HCl (pH 7.5), 100 mM NaCl,
2.5 mM MgCl2, and 0.5 mM CaCl2 was heated at 95 ◦C for
3 min, cooled gradually to an appropriate temperature. DNase
I (20 units) was added to the mixture, and the whole (total 200 mL)
was incubated at 37 ◦C. At appropriate periods, the fluorescence
in the mixture was read at 485 nm excitation and 535 nm emission
using a micro-plate reader, Wallac 1420 ARVOsx (Oarkin Elmer
Co. Ltd.).
The synthesis reagents, such as 3¢-dabcyl (quencher) CPG,
6-fluorescein phosphoramidite (fluorophore), and 2¢-O-Me-
modified RNA phosphoramidite, were purchased from Glen
Research Corporation (Sterling, VA). The synthesis was carried
out with a DNA/RNA synthesizer by the phosphoramidite
method. For the incorporation of the analogs into the oligomers,
a 0.15 M solution of each analog phosphoramidite in THF and
a coupling time of 20 min was used. Deprotection of the bases
and phosphates was performed in concentrated NH4OH at 55 ◦C
for 16 h. The oligomers were purified by 20% PAGE containing
7 M urea to give the highly purified oligomers, MB1 (20) and MB2
(12). The yields are indicated in parentheses as OD units at 260 nm
starting from 1.0 mmol scale. The extinction coefficients of the
oligomers were calculated from those of the mononucleotides and
dinucleotides according to the nearest-neighbor approximation
method.31 The extinction coefficient (at 260 nm) of the analogs
used for calculations are as follows: AB, 18500; CB, 9050; GB,
15300; UB, 13100.18
Acknowledgements
This study was supported by a Grant-in-Aid from PRESTO of JST
(Japan Science and Technology) and was also supported in part
by a Grant-in-Aid for Scientific Research (C) from JSPS (Japan
Society for the Promotion of Science).
References
1 S. Tyagi and F. R. Kramer, Nat. Biotechnol., 1996, 14, 303–
308.
2 S. Tyagi, D. P. Bratu and F. R. Kramer, Nat. Biotechnol., 1998, 16,
49–53.
3 S. Tyagi, S. A. E. Marras and F. R. Kramer, Nat. Biotechnol., 2000, 18,
1191–1196.
4 X. Fang, X. Liu, S. Schuster and W. Tan, J. Am. Chem. Soc., 1999, 121,
2921–2922.
MALDI-TOF/MS analyses of oligomers
Spectra were obtained with a time-of-flight mass spectrometer.
MB1: calculated mass, 10279; observed mass, 10272. MB2:
calculated mass, 10508; observed mass, 10507.
5 C. J. Yang, M. Pinto, K. Schanze and W. Tan, Angew. Chem., Int. Ed.,
2005, 44, 2572–2576.
Thermal denaturation study
6 P. Conlon, C. J. Yang, Y. Wu, Y. Chen, K. Martinez, Y. Kim, N. Stevens,
A. A. Marti, S. Jockusch, N. J. Turro and W. Tan, J. Am. Chem. Soc.,
2008, 130, 336–342.
A solution containing the MBs in a buffer comprised of 10 mM
sodium phosphate (pH 7.0) and 0.1 M NaCl was heated at
95 ◦C for 3 min, cooled gradually to an appropriate temperature,
and then used for the thermal denaturation study. The thermal-
induced transition of each mixture was monitored at 260 nm with
a spectrophotometer. The sample temperature was increased by
0.5 ◦C/min.
7 L. J. Brown, J. Cummins, A. Hamilton and T. Brown, Chem. Commun.,
2000, 621–622.
8 M. Rajendran and A. D. Ellington, Nucleic Acids Res., 2003, 31, 5700–
5713.
9 H. Du, M. D. Disney, B. L. Miller and T. D. Krauss, J. Am. Chem. Soc.,
2003, 125, 4012–4013.
10 H. Du, C. M. Strohsahl, J. Camera, B. L. Miller and T. D. Krauss,
J. Am. Chem. Soc., 2005, 127, 7932–7940.
11 K. Fujimoto, H. Shimizu and M. Inouye, J. Org. Chem., 2004, 69,
3271–3275.
Fluorescence measurement of MBs
Each solution containing each MB (0.3 mM) and the target RNA
(0, 0.1, 0.3, 0.6, 1.0, 1.5, 3.0, or 6.0 mM) in a buffer comprised of
10 mM sodium phosphate (pH 7.0) and 0.1 M NaCl was heated at
95 ◦C for 3 min, cooled gradually to an appropriate temperature,
and then used for the FRET analysis. Aliquots of the mixture
were transferred into 96-well plates. The fluorescence in the well
was read at 485 nm excitation and 535 nm emission using a micro-
plate reader, Wallac 1420 ARVOsx (Oarkin Elmer Co. Ltd.).
12 G. T. Hwang, Y. J. Seo and B. H. Kim, J. Am. Chem. Soc., 2004, 126,
6528–6529.
13 D. Horejsh, F. Martini, F. Poccia, G. Ippolito, A. D. Caro and M. R.
Capobianchi, Nucleic Acids Res., 2005, 33, e13.
14 A. Tsourkas, M. A. Behlke and G. Bao, Nucleic Acids Res., 2002, 30,
4208–4215.
15 K. A. Browne, J. Am. Chem. Soc., 2005, 127, 1989–1994.
16 L. Wang, C. J. Yang, C. D. Medley, S. A. Benner and W. Tan, J. Am.
Chem. Soc., 2005, 127, 15664–15665.
17 Y. Kim, C. J. Yang and W. Tan, Nucleic Acids Res., 2007, 35, 7279–
7287.
18 Y. Ueno, T. Kato, K. Sato, Y. Ito, M. Yoshida, T. Inoue, A. Shibata,
M. Ebihara and Y. Kitade, J. Org. Chem., 2005, 70, 7925–7935.
19 Y. Ueno, A. Kawamura, T. Kato and Y. Kitade, Nucleic Acids Symp.
Ser., 2007, 293–294.
20 D. M. T. Chan, K. L. Monaco, R.-P. Wang and M. P. Winters,
Tetrahedron Lett., 1998, 39, 2933–2936.
Partial hydrolysis of MBs with DNase I
Each MB (600 pmol, final 3.0 mM) was incubated with DNase I
(20 units) in a buffer containing 10 mM Tris-HCl (pH 7.5), 2.5 mM
MgCl2, and 0.5 mM CaCl2 (total 200 mL) at 37 ◦C. At appropriate
2768 | Org. Biomol. Chem., 2009, 7, 2761–2769
This journal is
The Royal Society of Chemistry 2009
©

View Article Online
21 P. Y. S. Lam, C. G. Clark, S. Saubern, J. Adams, M. P. Winters, D. M. T.
Chan and A. Combs, Tetrahedron Lett., 1998, 39, 2941–2944.
22 D. A. Evans, J. L. Katz and T. R. West, Tetrahedron Lett., 1998, 39,
2937–2940.
27 D. Sokol, X. Zhang, P. Lu and A. M. Gewirtz, Proc. Natl. Acad. Sci.
U. S. A., 1998, 95, 11538–11543.
28 D. P. Bratu, B.-J. Cha, M. M. Mhlanga, F. R. Kramer and
S. Tyagi, Proc. Natl. Acad. Sci. U. S. A., 2003, 100, 13308–
13313.
23 S. Ding, N. S. Gray, Q. Ding and P. G. Schultz, Tetrahedron Lett., 2001,
42, 8751–8755.
29 P. J. Santangelo, B. Nix, A. Tsourkas and G. Bao, Nucleic Acids Res.,
24 A. K. Bakkestuen and L.-L. Gundersen, Tetrahedron Lett., 2003, 44,
3359–3362.
2004, 32, e57.
30 N. Nitin, P. J. Santangelo, G. Kim, S. Nie and G. Bao, Nucleic Acids
Res., 2004, 32, e58.
25 Y. Yue, Z.-G. Zheng, B. Wu, C.-H. Xia and X.-Q. Yu, Eur. J. Org.
Chem., 2005, 5154–5157.
31 J. D. Puglisi and I. Tinoco, Jr., in Methods in Enzymology, ed.
J. E. Dahlberg, and J. N. Abelson, Academic Press, San Diego, 1989,
vol. 180, pp. 304–325.
26 M. F. Jacobsen, M. M. Knudsen and K. V. Gothelf, J. Org. Chem.,
2006, 71, 9183–9190.
This journal is
The Royal Society of Chemistry 2009
Org. Biomol. Chem., 2009, 7, 2761–2769 | 2769
©