Modeling, synthesis and biological evaluation of potential Retinoid X Receptor (RXR) selective agonists: Novel analogues of 4-[1-(3,5,5,8,8- pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)ethynyl]benzoic acid (bexarotene)

5950 J. Med. Chem. 2009, 52, 5950–5966

DOI: 10.1021/jm900496b

Modeling, Synthesis and Biological Evaluation of Potential Retinoid X Receptor (RXR) Selective

Agonists: Novel Analogues of 4-[1-(3,5,5,8,8-Pentamethyl-5,6,7,8-tetrahydro-2-

naphthyl)ethynyl]benzoic Acid (Bexarotene)

Carl E. Wagner,*^,†Peter W. Jurutka,^†Pamela A. Marshall,^†Thomas L. Groy,^‡Arjan van der Vaart,^§Joseph W. Ziller,

Julie K. Furmick,^†Mark E. Graeber,^†Erik Matro,^†Belinda V. Miguel,^†Ivy T. Tran,^†Jungeun Kwon,^†Jamie N. Tedeschi,^†

Shahram Moosavi, Amina Danishyar,^†Joshua S. Philp,^†Reina O. Khamees, Jevon N. Jackson,^†Darci K. Grupe,^†

Syed L. Badshah,^‡and Justin W. Hart^†

^†Division of Mathematical and Natural Sciences, New College of Interdisciplinary Arts and Sciences, Arizona State University, 4701 West

Thunderbird Road, Glendale, Arizona 85306, ^‡Department of Chemistry and Biochemistry, College of Liberal Arts and Sciences, Arizona State

University, Tempe, Arizona 85287, ^§Department of Chemistry, University of South Florida, 4202 East Fowler Avenue, CHE 205, Tampa, Florida

33620, and Department of Chemistry, University of California, Irvine, 576 Rowland Hall, Irvine, California 92697

Received April 20, 2009

This report describes the synthesis of analogues of 4-[1-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-

naphthyl)ethynyl]benzoic acid (1), commonly known as bexarotene, and their analysis in acting as

retinoid X receptor (RXR)-specific agonists. Compound 1 has FDA approval to treat cutaneous T-cell

lymphoma (CTCL); however, its use can cause side effects such as hypothyroidism and increased

triglyceride concentrations, presumably by disruption of RXR heterodimerization with other nuclear

receptors. The novel analogues in the present study have been evaluated for RXR activation in an RXR

mammalian-2-hybrid assay as well as an RXRE-mediated transcriptional assay and for their ability to

induce apoptosis as well as for their mutagenicity and cytotoxicity. Analysis of 11 novel compounds

revealed the discovery of three analogues that best induce RXR-mediated transcriptional activity,

stimulate apoptosis, have comparable K_iand EC₅₀values to 1, and are selective RXR agonists. Our

experimental approach suggests that rational drug design can develop new rexinoids with improved

biological properties.

Introduction

sequences that exist as half-sites separated by variable

length nucleotide spacers between direct, inverted, or

everted repeats²and are found within the promoter region

of target genes. To activate transcription, nuclear receptors

bind to the HREs as homodimers or heterodimers, with

each partner binding to a half-site of the element. The

association of the nuclear receptor protein with the DNA

results in regulation of target gene expression, ultimately

leading to a physiological effect or bioresponse.

Retinoids are a class of small molecule compounds that

play vital roles in the regulation of cellular processes,

including transcription of genes, differentiation, and pro-

liferation. Two classes of proteins that bind to retinoids,

retinoic acid receptors (RARs) and retinoid X receptors

(RXRs), have been studied in detail, and three subtypes,

R, β, and γ, have been identified for both RAR and RXR^a

proteins.¹The receptors for retinoids, as well as for other

small lipophilic hormonal ligands, belong to the larger

superfamily of receptors for steroids, as well as for thyroid

hormone receptor (TR) and vitamin D receptor (VDR),

which all function as transcription factors. All of the

receptor proteins have an “endogenous ligand” that binds

to a specific pocket within the protein, altering the protein’s

conformation and inducing the protein to bind to a specific

molecular scaffold on DNA. Most of these proteins, once

bound to a signaling lipophilic ligand, interact directly with

DNA sequences known as hormone response elements

(HREs). Most HREs consist of minimal core hexad

Although originally proposed to act as homodimers,³TR,

RAR, and VDR high affinity DNA binding is mediated via a

heterodimer of RXR and the appropriate receptor.⁴RXR

also binds to a natural endogenous ligand, 9-cis retinoic acid

(9-cis-RA; see below), and functions as a homodimer when

bound to its cognate ligand or can function as an unliganded

heterodimeric partner for other nuclear receptors including

VDR.⁵Thus, the RXR “master” partner is central to the

function of many nuclear receptors because the RXR protein

can form heterodimer complexes with many members of this

superfamily that result in specific physiological responses as a

result of modulation of gene expression.⁶

Interestingly, ligand-induced transcriptional activity for

the RXR homodimer is suppressed in most but not all cases

when RXR is complexed with a ligand-bound partner such

as VDR and TR, and these heterodimers prevent the

binding of RXR to its ligand, suggesting that TR and

VDR are “nonpermissive” heteropartners for RXR, in

*To whom correspondence should be addressed. Phone: (602) 543-

6937. Fax: (602) 543-6073. E-mail: Carl.Wagner@asu.edu.

^aAbbreviations: RXR, retinoid X receptor; RAR, retinoic acid receptor;

CTCL, cutaneous T-cell lymphoma; RXRE, retinoid X receptor element;

HRE, hormone response element; TR, thyroid receptor; VDR, vitamin D

receptor; SNuRMs, specific nuclear receptor modulators.

r

pubs.acs.org/jmc

Published on Web 09/16/2009

2009 American Chemical Society

Article

Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19 5951

Scheme 1

which the “primary” receptor (TR or VDR) and its ligand

play a dominant role over the “subordinate” RXR core-

ceptor.⁵However, in the case of RAR, which is a primary

partner activated by all-trans-retinoic acid (see structure

below), the RXR heteropartner is still able to bind 9-cis-RA

and the two retinoids synergistically enhance transactiva-

tion from retinoic acid response elements (RAREs).

Conversely, when 9-cis-RA or synthetic RXR ligands

(rexinoids) are present in excess in the case of VDR-RXR

or VDR-TR, these rexinoids divert RXR monomers away

from forming heterodimers, instead facilitating RXR

homodimers with a resulting attenuation of 1,25(OH)₂D₃

or thyroid hormone responsiveness. It is now genera-

lly recognized that by modifying the structure of nuclear

receptor (NR) ligands (and especially the RXR master

partner ligand), one can produce specific NR modulat-

ors (collectively termed the SNuRMs) with unique new

properties that can influence the activity of the NR in novel

ways.⁷

Scheme 2

SNuRMs such as RXR selective molecules (rexinoids) have

recently been targets of interest because the selective activat-

ion of RXR proteins versus RAR proteins might confer

cancer chemotherapeutic effects²¹without inciting concur-

rently negative side effects by interacting with the RAR

proteins.⁸The structure of the endogenous 9-cis retinoic

acid ligand for RAR and RXR is shown below. Ligand

Pharmacueticals, Inc., developed an RXR selective agonist,

4-[1-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)-

ethynyl]benzoic acid (1),⁹commonly known as bexarotene,

after lengthy SAR (structure-activity relationship) studies of

several analogous compounds.¹⁰Another analogue that was

later synthesized that had nearly identical response profiles to

1 was compound 2¹¹(disilabexarotene).

as well as amide retinoids²¹have been reported. The thiocar-

bamate analogue 6²²was shown to induce apoptosis in

leukemia HL-60 cells. Several pyridine containing analogues,

as in compound 7,²³and unsaturated analogues, such as

compound 8,²⁴were synthesized and shown to be potent

RXR selective agonists. Boehm and co-workers published a

series of papers that developed RXR selective agonists based

onaryl-trienoic acids lockedbynone,²⁵one,²⁶andtwo rings,²⁷

the last of which is demonstrated by compound 9.²⁷Notably,

addition of fluorine in proximity to the carboxylic acid of the

trienoic acids locked by no rings resulted in improved phar-

macological profiles²⁸and we hypothesize that analogues of 1

possessing a fluorine atom close to the carboxylic acid group

will possess similarly improved RXR agonist characteristics.

Compound 10²⁹and analogous compounds were identified

as potent RXR selective agonists. Finally, Gronemeyer and

co-workers used the RXR selective agonist 11⁶as well as a

model compound to design RXR modulating antagonists,

several of which were cocrystallized in the ligand binding

domain of hRXRR. However, despite the wealth of different

RXR agonist compounds that incorporate structural motifs

from 1, there are, as yet, no analogues of 1 that contain

additional functional moieties such as a nitro group or a

halogen atom substituted for hydrogen atoms on the aromatic

ring that bears the carboxylic acid.

Compound 1 is an FDA approved drug, effective in the

treatment of cutaneous T-cell lymphoma (CTCL), and it

is being explored for treatment of breast cancer,¹²lung

cancer,¹³colon cancer,¹⁴and other diseases of uncon-

trolled cellular proliferation because activation of RXR

and “up-regulation” (or expression) of the genes RXR

regulates seems to have a therapeutic effect by slowing or

arresting cellular proliferation in these conditions. Ana-

logues of 1 and compound 1 itself have also been

explored as possible treatments for noninsulin-depen-

dent diabetes mellitus (NIDDM) in mouse models.¹⁵

Despite specific activation of RXR by 1 versus RAR,

three drawbacks to the use of 1 include hypothyroid-

ism,¹⁶because there may be an unintentional antagon-

ism of the TR receptor with ligand activated RXR,¹⁷

hyperlipidemia, and cutaneous toxicity as a result of

residual RAR agonism at the dose concentration. Thus,

there is motivation to pursue novel RXR agonist mole-

cules that avoid these side effects.

There are several reports of compounds analogous to 1 in

the literature. In addition to the disilabexarotene, the triflu-

oromethylbexarotene (3),¹⁸thecyclopropyldienoicacid(4),¹⁹

and a host of novel aza-retinoids, including compound 5,²⁰

Therefore, studies in our laboratories have focused on

the synthesis, modeling, and biological evaluation of novel

5952 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19

Wagner et al.

Scheme 3

Scheme 4

compounds analogous to 1 such as compounds 12 and 14-21.

We have compared these novel analogues to 1 and its ketone

analogue (22).⁹

5-dimethyl-2,5-hexanediol was converted to 2,5-dichloro-

2,5-dimethylhexane (23)⁹in 73% recovered yield by treat-

ment with concentrated hydrochloric acid, and the dihalide

23 was reacted with toluene in the presence of aluminum

chloride to provide 1,2,3,4-tetrahydro-1,1,4,4,6-penta-

methylnaphthalene (24)⁹in 94% yield following the proce-

dure in literature (Scheme 1).

To make the Friedel-Crafts acylation coupling partners

for 24 en route to 1 and its structural isomer (12), commer-

cially available mono methyl terephthalate and mono methyl

isophthalate were converted to the corresponding acid chlor-

ides, 25 and 26, respectively, by reaction with thionyl chlor-

ide (Scheme 2).

Compound 1 was prepared according to the method of

Boehm and co-workers.⁹The Friedel-Crafts acylation of 24

with 25 provided ketone 27⁹in 82% yield. Ketone 27 was

converted to alkene-ester 28⁹in 66% yield by following the

Wittig reaction with triphenylphosphonium methylide, pre-

pared by the treatment of triphenylphosphonium methyl

bromide with sodium amide in THF. Alkene-ester 28 was

saponified by treatment with potassium hydroxide in metha-

nol, followed by acidification with hydrochloric acid to give

1 in 78% yield (Scheme 3).

In the present study, we have synthesized compounds 1 and

12-22 and evaluated these in mammalian 2-hybrid assays

and RXR- and RAR-response element (RXRE and RARE)

transcriptional activation systems using cultured human

cells, as well as in apoptosis, cytotoxicity, and mutagenicity

assays.

Results and Discussion

Analogue 12 was prepared by a slightly modified route as

reported for 1 (Scheme 4).

Chemistry. Synthesis of 1 and Isomer 12. To prepare

a standard sample of 1, as well as the novel isomer (2, 2,

Article

Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19 5953

Scheme 5

activates transcription better than 1 (for compound 20, using

a one-tailed heteroscadastic t test P=0.049, indicating that

compound 20 is significantly better than 1). Additionally,

ketones 21 and 22 also display a small degree of RXR

binding and homodimerization relative to 1. These results

imply that compounds modeled after 1 can be synthesized

successfully and can possess RXR binding properties, and

we are interested in elucidating the factors responsible for

eliciting the different response-ranges observed. Moreover,

these data suggest that construction of additional analogues

of 1 is warranted, especially those compounds that preserve

the carboxylic acid position but substitute non-hydrogen

atom groups on the aromatic ring that bears the carboxylic

acid.

Novel Analogues of 1 Bind to RXR and Mediate Transacti-

vation. It is important to point out that the use of the

mammalian two-hybrid assay as an initial screen for ago-

nist-induced homodimerization of RXR is useful because of

the speed, convenience, and sensitivity of the assay. How-

ever, an additional and vital question in testing RXR ago-

nists is the role of the correct biologically relevant DNA

platform, or retinoid X receptor response element (RXRE),

that specifically associates with the RXR homodimer in vivo.

The RXRE DNA sequence is present in the upstream

promoter region of genes controlled by the RXR homodimer

in response to the endogenous 9-cis RA ligand or when RXR

is bound to a synthetic rexinoid. It is possible that the RXRE

may influence the affinity and/or selectivity of the RXR

protein toward potential ligands. Thus, a second screening

protocol for our collection of possible RXR agonists

included transfection of Caco-2 cells with an expression

vector for wild-type human RXRR along with a reporter

construct that contains an RXRE driving the expression of

the luciferase reporter gene. The results in Figure 4 reveal

that of all the compounds tested (12-22), only analogue 16,

18, and 20 displayed transcriptional activity significantly

above the ethanol control levels (P values of <0.001 for

all, using a one-tailed heteroscedastic t test).

Scheme 6

Despite the report that ketone 13²³is an inactive RXR

agonist, we prepared isomer 12.

Synthesis of Analogues 14-21. To prepare analogues

14-21, the appropriate acid chloride Friedel-Crafts acyla-

tion coupling partners for 26 were synthesized. Thus, tri-

methyl-1,3,5-benzenetricarboxylate (31) was converted to

the monoacid diester (32)³⁰according to literature proce-

dures, and compound 32 was refluxed in excess thionyl

chloride to give acid chloride 33 (Scheme 5).

Dimethyl-nitro-terephthalate (34) was converted to the

monoacid ester (35),³¹and compound 35 was refluxed in

excess thionyl chloride to give acid chloride 36 (Scheme 6).

To prepare the analogues of 1 with fluorine, the method of

Kishida and co-workers was used.³²3-Fluoro-4-methylben-

zoic acid (37) was dibrominated with NBS and catalytic

benzoylperoxide to give compound 38,³²which was subseq-

uently treated with silver nitrate in ethanol and water to give

aldehyde 39.³²Aldehyde 39 was either converted to the

methyl-ester 40,³²followed by oxidation to the methyl-

fluoro-terephthalic acid 41³²and conversion to acid chloride

42, or 39³²was benzylated to give benzyl-ester 43.³²Benzyl-

ester 43 was oxidized with sodium hypochlorite to acid 44,³²

which was esterified to methyl-ester 45,³²debenzylated to

give acid 46,³²and converted to acid chloride 47³²

(Scheme 7).

The analogues 14-21 were synthesized according to a

route analogous to the one used to give analogues 13 and 14

(Scheme 8).

The X-ray crystal structures of ketones 49, 50, and 51 are

shown in Figure 1.

The X-ray crystal structures of fluorinated analogues 18

and 20 are shown in Figure 2.

These same 3 compounds were also active in the mammal-

ian two-hybrid assay described above (Figure 3).

Biological Assays and Rationale. A Mammalian Two-Hybrid

Assay Reveals that Several Novel Analogues Induce RXR

Homodimerization as Well as 1 Binds to RXR. Biological

assessment of a subset of analogues described above

(compounds 12-22) was first carried out by employing the

mammalian two-hybrid assay in human colon cancer (Caco-2)

cells (Figure 3). This assay tests for homodimerization and

ligand binding to a recombinant RXR. If the ligand-receptor

complex then homodimerizes with an RXR-Gal4 fusion pro-

tein, luciferase will be transcribed, as the luciferase gene is

downstream of Gal4p DNA binding elements.

This initial evaluation revealed that five compounds

exhibited at least some activity in the same order of magnit-

ude as 1. More importantly, the initial array of analogues

shows a range of receptor binding and RXR homodimerizat-

ion ability: 16 and 18 bind and mediate homodimerization

about half as well as 1, whereas compound 20 binds and

Determination of RXR Binding Affinity, EC₅₀Values, and

Quantitation of RAR Agonist Activity by the Most Active

Rexinoids. To better quantitate the affinity and efficacy of

the most active novel analogues for RXR binding, we

utilized both a ligand binding assay with overexpressed

human RXRR as well as the mammalian two-hybrid assay

in human colon cancer cells (Figure 3) to evaluate a much

larger array of 1 and analogue concentrations. The binding

affinities (K_ivalues) of the most active rexinoids were

determined by performing competition binding studies via

displacement of 10 nM [³H]-9-cis-retinoic acid essentially as

described previously.³³The transcriptional efficacy of these

same compounds was tested in mammalian two-hybrid

dose-response assays carried out with ligand concentrat-

ions ranging from 10ꢀ10^-10M up to 0.5ꢀ10^-5M. Utiliz-

ing this collection of binding affinity and dose-response

experiments, we were able to calculate K_iand EC₅₀values,

5954 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19

Wagner et al.

Scheme 7

Scheme 8

Figure 1. The X-ray crystal structures of ketone-esters 49, 50, and 51. Compound 50 displays twist isomerism in the aliphatic ring, hence, only

one of the two isomers in the crystal structure is shown.

which are listed in Table 1. The K_ivalue, which is an

estimate of ligand affinity for RXR, is similar to that

obtained previously for 1 by another group.⁹Moreover,

the data in Figures 3 and 4 suggest that compounds 16 and

18 possess slightly lower RXR binding activity while comp-

ound 20 is slightly more active, observations that are

entirely consistent with both the K_iand EC₅₀values in

Table 1.

We also performed an analysis of the “residual” retinoic

acid receptor (RAR) agonist activity of the parent compound

Article

Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19 5955

1, as well as analogues 16, 18, and 20 versus the authentic

RAR ligand (all-trans retinoic acid). The results of this assay,

which employed expression of the human RAR and a

retinoic acid responsive element (RARE)-luciferase reporter

system, revealed that compound 16 possess slightly greater

RAR agonist activity, analogue 20 is approximately equal to

1 in its activation of RAR, and compound 18 possesses

significantly lower RAR binding. Taken together, these

results suggest that modification of 1 with a halogen atom

on the aromatic ring that bears the carboxylic acid may

reduce the activation of RAR (compound 18) or increase its

ability to activate RXR (analogue 20).

Compound 1 and Novel Analogues Induce Apoptosis in a

CTCL System. It has been hypothesized that 1 treats

Table 1. Determination of Binding Affinity, EC₅₀Values, and Quanti-

tation of RAR Agonist Activity

% RAR

agonist

activity at

RXRR

% RAR agonist

activity^cat

binding affinity EC₅₀value^b

compd (K_i,^anM ((SD) nM ((SD) 100 nM ((SD) 1 μM ((SD)

compd 1

21(3)

81(12)

161 (28)

12 (2)

52 (6)

200 (28)

420 (63)

43 (5)

23 (5)

30 (4)

13 (2)

25 (6)

25 (4)

35 (6)

14 (1)

26 (2)

Figure 2. The X-ray crystal structures of fluorinated bexarotene

analogues 18 and 20. Compound 18 crystallized in such a way that a

channel whose boundaries were formed by the carboxylic acid

groups of 18 incorporated a solvent that could not be identified

by the model, although likely candidates such as ethyl acetate (the

crystallization solvent) were examined. Compound 20 displayed

twist-isomerism in the aliphatic ring, as well as partial-filled occu-

pancies of the fluorine atom at both ortho-positions to the car-

boxylic acid group due to carbon-carbon single bond rotation.

Additionally, the carbonyl carbonoxygen bond of the carboxylic

acid group of 20 could not be clearly resolved. Hence, one twist

isomer, as well a given rotational isomer for the fluorine and

carboxylic acid groups, has been displayed.

analogue 16

analogue 18

analogue 20

^aBinding affinities (K_i, values) were determined by competition of

10 nM [³H]-9-cis-retinoic acid (RA) with unlabeled test rexinoids as

described in Experimental Section. ^bEC₅₀values were determined from

full dose-response curves ranging from 10^-10to 10^-5M in transfected

Caco-2 cells using an RXR mammalian two-hybrid system. ^cRAR

agonist activity was derived from an PAR/RARE reporter system in

transfected Caco-2 cells treated with analogue or all-trans PA at 100 nM

or 1 μM. The activity with analogue (or compound 1) divided by the

activity with all-trans RA expressed as a percentage represents the PAR

agonist activity.

Figure 3. Identification of potential RXR agonists via a mammalian two-hybrid screening assay in human colon cancer cells. Caco-2 human

colon cancer cells were cotransfected using both a pCMVhRXR binding domain vector (BD) as well as an hRXR-activation domain (AD)

plasmid along with a pFR-Luc reporter gene containing BD-binding sites and renilla control plasmid. Cells were transfected for six hours

utilizing a liposome-mediated transfection protocol and then treated with ethanol vehicle or 10-7 M of the indicated compound. After a 24 h

incubation, cells were lysed and a luciferase assay was completed. Analogue-mediated RXR binding and homodimerization, as measured by

luciferase output, was compared to the RXR agonist parent compound 1 (value set to 1.0).

Figure 4. Identification of potential RXR agonists via an RXRE-luciferase reporter-based screening assay in human colon cancer cells. Caco-

2 cells were transfected with hRXRR, an RXREluciferase reporter gene, renilla control plasmid, and carrier DNA (pTZ18U). Cells were

transfected for six hours utilizing a liposome-mediated transfection protocol, and then treated with ethanol vehicle or 10-7 M compound 1 or

the indicated analogue (12-22). After a 24 h incubation, cells were lysed and a luciferase assay was completed. Analogue-stimulated, RXR-

mediated transcription, as measured by luciferase output, was compared to the RXR agonist parent compound 1 (value set to 1.0).

5956 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19

Wagner et al.

Figure 5. Evaluation of bexarotene (compound 1) and selected analogues for apoptotic activity utilizing a caspase 3/7 assay in CTCL cells.

Human T-cell lymphoma cells (CTCL) were plated and immediately dosed with the indicated treatments. Cells were allowed to incubate for

24 h, and the level of apoptosis was measured with a commercial kit (see Experimental Section). Sodium butyrate (Na Bu), a known inducer of

apoptosis, was used as a positive control.

Figure 6. Cytotoxocity Analysis of Select Compounds. Cytotoxi-

city was assayed by determining lactate dehydrogenase (LDH)

release. CTCL cells were left untreated or were treated for 48 h

with ethanol vehicle, 10-7 M of the indicated compounds, or

10 mM hydroxyurea (HU, positive control). After a 48 h incubation,

the supernatant from cells was removed and assayed for LDH

Figure 7. AutoDock binding free energies for compounds 12, 14,

16, 18, and 20. Shown are the 20 lowest energies for each compound.

The calculated binding free energy of 1 is shown by the dotted line.

activity (Promega CytoTox 96 nonradioactive cytotoxicity assay).

The total cell activity was determined by lysing untreated cells and

assaying the whole cell lysates. Cytotoxicity was determined as

percentage of LDH released, as compared to total activity (total

activity set to 1.0) after normalizing for background.

Compound 1 is statistically significantly more cytotoxic in

CTCL cells than ethanol vehicle alone (P=0.009, unpaired

t test, one tail, unequal variance); however, the level of

cytotoxicity is low (13.2% of total) compared to hydroxy-

urea (97% of total), a positive control. This is in line with

previously reported data for the cytotoxicity of 1.³⁶All of the

analogues are no more cytotoxic than 1 (P < 0.01, unpaired

t test, one tail, unequal variance), indicating that these

compounds are similar in biological activity to 1.

Compound 1 and the Novel Analogues are Not Mutagenic.

Mutagenicity of all compounds was tested in a Saccharo-

myces cerevisiae assay in order to determine if the com-

pounds are potentially suitable to administer in animal

models. This assay utilizes a strain of S. cerevisiae in which

three phenotypic readouts have been engineered^37,38in order

to determine if the compounds are potentially suitable to

administer in animal models. All compounds were tested for

mutagenicity compared to DMSO vehicle, and none were

mutagenic.

CTCL effectively because it induces apoptosis and/or

cytotoxicity in the T-lymphocyte.³⁴Thus, we next tested

CTCL cells treated with 1 and promising analogues

for their ability to induce classic apoptosis, using an

assay for caspases 3 and 7, two executioner caspases

in apoptosis.³⁵We included compounds 16, 18, and

20 because they possess the most potent RXR binding

and activation profile, as well as compound 19, which

does not bind to RXR and serves as a negative control.

Figure 5 illustrates the results of the apoptosis assay

and suggests that some of the analogues that bind and

activate RXR (compounds 16 and 20) also possess apop-

totic activity that is statistically significantly greater

than the ethanol vehicle control (using a one-tailed

heteroscedastic t test, P = 0.003 for compound 16, and

P=0.002 for compound 20), while compound 19, which

displays almost no apoptotic activity, also does not bind

to RXR. A potent known apoptotic inducer (sodium

butyrate, NaBu) serves as a positive control in this

system.

Molecular Modeling. Docking Studies of 1 and the Novel

Analogues Predict that Analogues 16, 18, and 19 Will Have the

Best Binding Aaffinities. We performed docking studies of 1

and compounds 12, 14, 16, 18, and 20 using the X-ray

structure of human RXRR in complex with 56³⁹(BMS 649)

as template. The molecular frameworks of 56, 1, and the

Compound 1 and the Active Analogues Display a Low Level

of Cytotoxicity. Cytotoxicity results for 1 and active analo-

gues are shown in Figure 6.

Article

Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19 5957

14 were obtained from better hydrogen bonding with

Arg316. Despite these rearrangements, the best docked

structures still had much larger binding free energies than 1

or compounds 16, 18, and 20. Therefore, our modeling

studies are predictive of the observation that compounds

16, 18, and 20 possessed the greatest RXR/RXRE-mediated

transcriptional activation of all novel analogues tested in the

RXRE assay, while analogues 12 and 14 did not display

significant RXR binding and activation.

Conclusions

We have modeled, synthesized and evaluated several novel

analogues of 1 with new functional groups substituting hydro-

gen atoms on the aromatic ring that bears the carboxylic acid.

Biological assays employing these compounds in human

Caco-2 and CTCL cells have identified compounds that bind

and activate RXR slightly below or near the levels of 1 (16, 18,

21 and 22) and we have also synthesized and identified a

compound (20) that possesses an apparent RXR binding

affinity that is 75% greater than 1 and that displays a 20%

increase inefficacy based on EC₅₀values(Table 1). Our results

suggest that additional novel analogues of 1 that substitute

non-hydrogen functional groups on the aromatic ring bearing

the carboxylic acid will likely serve as effective, and perhaps

more potent, ligands for RXR, which may also have reduced

RAR agonist activity (Table 1); thus, these compounds may

also possess less detrimental side-effects in cutaneous T-cell

lymphoma patients.

Figure 8. Docked structures of 1 and compound 20 to human

RXRR.

compounds are very similar, with 21 carbon atoms at identical

positions.

Docking predicted low binding energies for compounds

16, 18, and 20 (Figure 7). The calculated average binding free

energies were -14.9 and -14.8 kcal/mol for compound 18

and 20, respectively; this was identical to the calculated

binding energy of the docked 1 (-14.9 kcal/mol). Compound

16 was predicted to be the best binder, with an average

binding free energy of -16.0 kcal/mol. This lower energy was

mostly a result of a more favorable desolvation energy.

Overall, the binding of 1 and compounds 16, 18, and 20 were

very similar to the binding of 56, with C atom root-mean-

square deviations (rmsds) of 0.35 ( 0.08, 0.50 ( 0.10, 0.43 (

Experimental Section

Mammalian Two-Hybrid Assay. Mammalian two-hybrid

experiments were conducted using Caco-2 human colon cancer

cells. Cells were plated at 90000 cells/well in a 24 well plate and

maintained in minimum essential medium (MEM) (Invitrogen,

Carlsbad, CA), supplemented with 20% fetal bovine serum

(FBS) (Invitrogen), 1 mM sodium pyruvate (Invitrogen), 100 units/

mL penicillin, and 100 μg/mL streptomycin. The cells were

cotransfected utilizing RXR-bait (BD) and RXR-prey (AD)

fusion constructs, pFR-Luc reporter gene, and renilla control

plasmid via liposome-mediated transfection with Lipofectamine

LTX and PLUS reagent (Invitrogen). The cells were incubated

with the transfection mixture overnight and then treated with

ethanol vehicle, 1, or analogues at concentrations ranging from

10 ꢀ 10^-10M up to 0.5 ꢀ 10^-5M. After incubation with ligands,

cells were collected and the amount of reporter gene product

(luciferase) produced in the cells was measured using the Dual-

Luciferase reporter assay system according to the manufac-

turer’s protocol (Promega, Madison, WI) in a Sirus FB12

luminometer (Berthold Detection Systems). Independent experi-

ments were conducted with triplicate samples for each treatment

group.

RXRE-Mediated Transcription Assay. Caco-2 human colon

cancer cells were plated at 90000 cells/well in a 24-well plate and

maintained as described above. The transfection procedure was

adapted from the manufacturer’s protocol (Invitrogen). Briefly,

each well received 1 μL of Lipofectamine reagent, 2 μL of Plus

reagent, 500 ng of pTZ18U carrier DNA plasmid, and 20 ng of

pRL-null (constitutively expressing low levels of Renilla reni-

formis luciferase) to monitor transfection efficiency. Each well

also received 250 ng of pLuc-MCS plasmid (Stratagene, La

Jolla, CA) containing an oligonucleotide (cloned between the

HindIII and BglII sites) with two copies of the retinoid

X receptor response element (RXRE) upstream of the firefly

(Photinus pyralis) luciferase gene. The RXRE was based on a

naturally occurring double repeat responsive element from the

rat cellular retinol binding protein II gene. The sequence used

˚

0.10, and 0.33 ( 0.08 A for the 20 lowest energy structures,

respectively. The main deviations stemmed from the benzene

ring, which slightly rotated to best accommodate hydrogen

bonding between the carboxylate and Arg316. The ligands

bound in a large hydrophobic pocket (Figure 8), with the

fluoride atom of compounds 18 and 20, and the nitro group

of compound 16 pointing toward the C terminus of the H2

helix.

Compounds 12 and 14 were predicted to have significantly

higher binding energies than 1 (Figure 7). Structural analyses

of the docked structures showed that the increase in binding

energy was mainly due to the carboxylate at the ortho

position. To enable hydrogen bonding between the carbox-

ylate and Arg316, relatively large readjustments of the

ligands were needed, resulting in C atom rmsds of 0.95 (

˚

0.16 and 1.25 ( 0.15 A with 56 for compound 12 and 14,

respectively. The readjustments not only involved the ben-

zene ring but also shifted the rest of the ligand out of the

hydrophobic pocket. Such shifts were particularly pro-

nounced for the two lowest energy structures of compound

14 (with binding free energies of -13.7 and -13.2 kcal/mol,

see Figure 7). These structures have C atom rmsds of 1.63

˚

and 1.45 A. Although the hydrophobic contacts were less

optimal in these structures, overall decreases in binding

energy compared to the other docked structures of compound

5958 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19

Wagner et al.

was AAAATGAACTGTGACCTGTGACCTGTGACCTGT-

GAC, with the half elements underlined. The cells were incu-

bated with the transfection mixture overnight and then treated

with ethanol vehicle, 10^-7M 1, or analogues for 24 h. After

incubation with ligands, cells were collected and the amount of

reporter gene product (luciferase) produced in the cells was

measured using a luminometer.

LDH; this was used as the total cell LDH level. For the

remainder of the cells, the supernatant was removed and cen-

trifuged at 500g to remove residual cells; these supernatants

were then assayed for LDH activity. All assays were carried out

in a 96-well plate and included 25 μL of total cell lysate or

supernatant plus 25 μL of water and 50 μL of assay reagent. The

assay was incubated in the dark for 30 min, and then 50 μL of

stop solution was added. The assay was read in a Biotek

microtiter plate reader at 490 nm. Cytotoxicity was graphed in

Figure 6 for select analogues. The total cell LDH was set to

100%, and the no treatment control was used as 0%. All points

treatments were performed six times to generate the data set.

Mutagenicity. Mutagenicity of all compounds was tested in a

Saccharomyces cerevisiae assay in order to determine if the

compounds are potentially suitable to administer in animal

models. None were mutagenic in this assay. All compounds

were tested for mutagenicity with an incubation time of 3 h; the

highest concentration in the dose response curve was 0.15% w/v,

and compounds were dissolved in DMSO and compared to the

nonmutagenic DMSO control.

RXR Binding Assay. [³H]-9-cis-Retinoic acid (60 Ci/mmol)

was obtained from Perkin-Elmer (Waltham, MA). Assays were

carried out essentially as described previously.^9,33Briefly, Caco-

2 cells (500000 cells/60 mm plate) transfected with 50 ng human

wild-type RXRR expression plasmid were lysed in KETZD-0.3

buffer (0.3 M KCl, 10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 0.3 mM

ZnCl₂, 5 mM DTT) containing 0.5% Triton X-100 and supple-

mented with HALT protease inhibitors (Thermo Scientific,

Rockford, IL). Lysates were clarified by centrifugation for 15 min

at 16000ꢀg at 4 °C and then 40 μg of total protein lysate was

incubated with 10 nM [³H]-9-cis-retinoic acid and varying

concentrations of competing ligand for 16 h at 2 °C. Bound

and free hormone were separated with dextran-coated charcoal

for subsequent analysis of ligand binding.

RAR/RARE-Agonist Activity Assay. Caco-2 human colon

cancer cells were plated at 90000 cells/well in a 24-well plate and

maintained as described above. The transfection procedure

employed 1 μL of Lipofectamine reagent, 2 μL of Plus reagent,

50 ng of pTZ18U carrier DNA plasmid, 20 ng of pRL-null

(constitutively expressing low levels of Renilla reniformis

luciferase) to monitor transfection efficiency, and pCMX-hu-

man RARR expression vector. Each well also received 250 ng of

the pTK-DR5(X2)-Luc plasmid containing an oligonucleotide

with two copies of the retinoic acid response element (RARE)

upstream of the firefly (Photinus pyralis) luciferase gene. This

RARE is an optimized element that has been described

previously⁴⁰and is responsive to the RAR ligand, all-trans

retinoic acid. The sequence of the double RARE is (5⁰-AAAGG

TCACCGAAAGGTCACCATCCCGGGAAAAGGTCACC

GAAAGGTCACC-3⁰), with the half elements underlined. The

cells were incubated with the transfection mixture overnight and

then treated with ethanol vehicle, all-trans retinoic acid, or

analogues (retinoic acid or analogue concentrations ranged

from 1ꢀ10^-8M to 5ꢀ10^-6M) for 24 h. After incubation with

ligands, cells were collected and the amount of reporter gene

product (luciferase) produced in the cells was measured using a

luminometer.

Apoptosis Assay. Human T-cell lymphoma (CTCL) cells

(Hut78) were plated in a 24-well plate and immediately dosed

with the indicated treatments, including ethanol, compound 1,

analogue, water, or sodium butyrate. Cells were allowed to

incubate for 24 h, and then lysis was initiated by the addition

of a Caspase-Glo lysis/substrate mix. Upon programmed cell

death, caspases released by the lysed cells cleave the added

substrate and generate a measurable luminescent signal, assayed

in a luminometer. Analogue-induced apoptosis was compared

to the parent compound, 1. Sodium butyrate (Na Bu), a known

inducer of apoptosis, was used as a positive control.

Cytotoxicity Assay. Cytotoxicity was measured in the CTCL

cells (Hut78) by performing a lactate dehydrogenase (LDH)

assay (Cytotox 96 nonradioactive cytotoxicity assay, Promega,

Madison, WI), whereby induction of LDH leakage is an indica-

tion of cytotoxicity. LDH levels are indicated by a change in a

tetrazolium salt into a red formazan compound, read by a

microtiter plate reader (Bio-Tek Instruments, EL_X808), and

15000 CTCL cells in 50 μL were seeded into 96-well plates in

RPMI-1640 media supplemented with 10% FBS. Cells were

then treated with 0.5 mL of compound or ethanol vehicle alone

or were left untreated. Compound 1 or analogue final concen-

trations were 10^-7M. Hydroxurea, a known cytotoxic com-

pound, final concentration was 10 mM. Cells were incubated for

48 h. Untreated cells were incubated with a final concentration

0.8% Triton-X 100 for 1 h at 37 °C to lyse the cells and release all

Instrumentation. All ¹H NMR spectra were acquired at 400 or

500 MHz on Bruker or Varian spectrometers. Chemical shifts

(δ) are listed in ppm against deuterated solvent peaks as an

internal reference. Coupling constants (J) are reported in Hz,

and the abbreviations for splitting include: s, single; d, doublet; t,

triplet; q, quartet; p, pentet; m, multiplet; br, broad. All ¹³C

NMR spectra were acquired on Bruker instruments at 125.8 or

100.6 MHz. Chemical shifts (δ) are listed in ppm against solvent

carbon peaks as an internal reference. Infrared spectra (IR) were

assayed on a Perkin-Elmer 1600 series FTIR. High resolution

mass spectra were recorded using either a JEOL GCmate(2004),

a JEOL LCmate(2002) high resolution mass spectrometer, or an

ABI Mariner (1999) ESI-TOF mass spectrometer. Melting

points were assayed on a Thomas-Hoover capillary melting

point apparatus.

General Procedures. Tetrahydrofuran, methylene chloride,

diethyl ether, and benzene were dried by filtration through

alumina according to the procedure described by Grubbs.⁴¹

All other solvents were distilled from CaH₂prior to use.

Removal of volatile solvents transpired under reduced pressure

using a Buchi rotary evaporator and is referred to as removing

solvents in vacuo. Thin layer chromatography was conducted

on precoated (0.25 mm thickness) silica gel plates with 60F-254

indicator (Merck). Column chromatography was conducted

using 230-400 mesh silica gel (E. Merck reagent silica gel 60).

All tested compounds were analyzed for purity by combustion

analysis through Columbia Analytical Services (formerly Desert

Analytics in Tucson, AZ) and were found to be >95% pure.

2,5-Dichloro-2,5-dimethylhexane (23). A slightly modified

method of Boehm and co-workers⁹was followed to make 23.

To 2,5-dimethyl-2,5-hexanediol (5.0 g, 34 mmol) in a 100 mL

round-bottom flask was added concentrated hydrochloric acid

(40.0 mL), slowly with gentle swirling. The diol slowly dissolved

and a white precipitate formed simultaneously within 10 min.

After sitting 2 h, the heterogeneous mixture was filtered and

washed with copious amounts of water and a small amount of

methanol togive crude23 that was driedundervacuum for 30 min

to yield a white crystalline solid, mp 63-65.8 °C(lit.⁴²63-66.5 °C).

¹H NMR (400 MHz, CDCl₃) δ 1.94 (s, 4H), 1.59 (s, 12H). ¹³C

NMR (100.6 MHz, CDCl₃) δ 70.3, 41.1 32.5.

1,2,3,4-Tetrahydro-1,1,4,4,6-pentamethylnaphthalene (24). To a

three-neck, 500 mL round-bottom flask charged with 23 (10.0 g,

54.6 mmol) and dry DCM (50.0 mL), fitted with a spiral water

condenser, was added aluminum chloride (0.50 g, 3.7 mmol) in

small scoops. The colorless, homogeneous solution of 23 in DCM

turned canary yellow concurrent with gas evolution as the alumi-

num chloride was added. The reaction solution was stirred at room

temperature (30 min), and an additional amount of aluminum

chloride (100 mg) was added and the reaction solution was heated

to reflux and stirred for 15 min. TLC indicated that the reaction

Article

Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19 5959

was complete. The reaction solution was cooled in an ice bath and

quenched with a 20% HCl solution (50 mL). The reaction solution

was extracted with hexanes (200 mL, twice), dried over sodium

sulfate, concentrated in vacuo, and the crude oil was purified by

column chromatography (SiO₂, Hexanes) to give 24 (10.4 g, 94%)

as a white solid, mp 34-36 °C. ¹H NMR (500 MHz, CDCl₃) δ 7.22

(d, J=8.0, 1H), 7.13 (s, 1H), 6.97 (d, J=8.4, 1H), 2.31 (s, 3H), 1.68

(s, 4H), 1.29 (s, 6H), 1.28 (s, 6H); ¹³C NMR (100.6 MHz, CDCl₃)

δ 144.6, 141.8, 134.7, 126.9, 126.5, 126.4, 35.1, 35.1, 34. 1, 33.8,

31.9, 31.8, 21.1; GC-EI-MS (Mþ) calcd for C₁₅H₂₂202.1722,

found 202.1751.

4-[1-(3,5,5,8,8-Pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)-

ethynyl]benzoic Acid (1). Compound 1 was synthesized accord-

ing to the method of Boehm and co-workers.⁹To a 100 mL

round-bottom flask charged with 28 (1.48 g, 4.08 mmol) and

methanol (20 mL) was added a 5 M aqueous solution of

potassium hydroxide (2 mL, 10 mmol). A reflux condenser

was fitted to the round-bottom flask and the reaction solution

was refluxed and monitored by TLC. After 70 min at reflux, the

reaction solution was cooled to room temperature and

quenched with 20% HCl (250 mL). The aqueous solution was

extracted with ethyl acetate (200 mL, twice) and the organic

extracts were combined, washed with water and brine, dried

over sodium sulfate, and concentrated in vacuo to give crude 1.

Crude 1 was purified by dissolving the crude material in hot

ethyl acetate (19 mL), adding warm hexanes (19 mL), and

allowing the solution to cool to room temperature to give

Methyl-4-[(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-napht-

hyl)carbonyl]benzoate (27). Compound 27 was synthesized ac-

cording to the methods of Boehm and co-workers.⁹Mono-

methylterephthalic acid chloride (25) was synthesized by

refluxing monomethylterephthalic acid (10.1 g, 56.2 mmol) in

thionyl chloride (120 mL, 1.65 mol) in a 500 mL one-neck

round-bottom flask fitted with a water cooled reflux condenser.

Excess thionyl chloride was removed in vacuo to give crude 25 as

an off-white solid, and this solid was dissolved in dry benzene

(ca. 40 mL) and evaporated to dryness three times to remove

residual thionyl chloride. The acid chloride 25 was dried on high

vacuum to remove residual benzene. To a three-neck, 500 mL

round-bottom flask equipped with a reflux condenser and

magnetic stir-bar was added 24 (10.0 g, 49.4 mmol), followed

by a solution of crude acid chloride 25 (56.2 mmol) in DCM (50 mL).

Aluminum chloride (14.0 g, 105 mmol) was added to the reaction

solution at room temperature slowly, with stirring, and the reaction

solution turned from colorless to red accompanied by the evolution

of gas and heat. The reaction was stirred for 30 min and then heated

to reflux for 15 min. The reaction was judged to be complete by TLC,

and the solution was poured into an ice solution (200 mL) acidified

with a 20% HCl solution (50 mL) and ethyl acetate was added

(100 mL). The aqueous and organic layers were separated, and the

aqueous layer was extracted with ethyl acetate (100 mL, twice). The

combined organics were washed with water and brine, dried over

sodium sulfate, filtered, and rotevapped to give crude 27. Crude

27 was purified by dissolving the crude material in hot ethyl acetated

(53 mL), followed by the addition of methanol (100 mL) and slowly

cooling the solution to room temperature to yield square plate

crystals of 27 (12.86 g, 71%) that were filtered, mp 143-144 °C

1

crystals of 1 (1.12 g, 78%) mp 224-226 °C (lit.⁹234 °C). H

NMR (400 MHz, CDCl₃) δ 8.05 (d, J=8.2, 2H), 7.37 (d, J=8.2,

2H), 7.14 (s, 1H), 7.09 (s, 1H), 5.84 (s, 1H), 5.36 (s, 1H), 1.94

(s, 3H), 1.70 (s, 4H), 1.32 (s, 6H), 1.29 (s, 6H). ¹³C NMR

(100.6 MHz, CDCl₃) δ 172.2, 149.4, 146.7, 144.7, 142.6, 138.1,

132.9, 130.5, 128.3, 128.2, 126.9, 117.4, 105.0, 35.4, 35.4, 34.2,

34.1, 32.1, 32.1, 20.1. LC-APCI-MS (Mþ) calcd for C₂₄H₂₉O₂

349.2168, found 349.2161. Anal. Calcd for C₂₄H₂₉O₂: C 82.72;

H 8.10. Found: C 82.59; H 8.01.

4-[(3,5,5,8,8-Pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)car-

bonyl]benzoic acid (22). Compound 22 was synthesized accord-

ing to the method of Boehm and co-workers.⁹To a 100 mL

round-bottom flask charged with 27 (0.505 g, 1.39 mmol) and

methanol (6.8 mL) was added a 5 M aqueous solution of

potassium hydroxide (0.71 mL, 3.6 mmol). A reflux condenser

was fitted to the round-bottom flask, and the reaction solution

was refluxed and monitored by TLC. After 1 h at reflux, the

reaction solution was cooled to room temperature and

quenched with 20% HCl (20 mL). The aqueous solution was

extracted with ethyl acetate (25 mL, twice) and the organic

extracts were combined, washed with water and brine, dried

over sodium sulfate, and concentrated in vacuo to give crude 22.

Crude 22 was purified by column chromatography (25 mL SiO₂,

hexanes:ethyl acetate 9:1) to give 22 (0.429 g, 88%) as a white

crystalline solid, mp 198-199 °C (lit.⁹198-199 °C). ¹H NMR

(400 MHz, CDCl₃) δ 8.20 (dd, J=6.8, 1.8 Hz, 2H), 7.90 (d, J=

8.5, 1.8 Hz, 2H), 7.26 (s, 1H), 7.22 (s, 1H), 2.36 (s, 3H), 1.70

(s, 4H), 1.32 (s, 6H), 1.21 (s, 6H). ¹³C NMR (100.6 MHz, CDCl₃)

δ 197.7, 171.3, 148.5, 142.8, 141.9, 134.7, 134.6, 132.4, 130.1,

130.0, 129.5, 128.5, 34.9, 34.8, 34.4, 33.9, 31.7, 31.6, 20.0. Anal.

Calcd for C₂₃H₂₆O₃: C 78.83; H 7.48. Found: C 78.91; H 7.48.

Methyl 3-[(3,5,5,8,8-Pentamethyl-5,6,7,8-tetrahydronaphtha-

len-2-yl)carbonyl]benzoate (29). Compound 29²³was synthe-

sized according to a slightly modified method of Boehm and

co-workers.⁹Monomethylisophthalic acid chloride (26) was

synthesized by refluxing monomethylisophthalic acid (1.30 g,

7.24 mmol) in thionyl chloride (12.0 mL, 165 mmol) in a 100 mL

one-neck round-bottom flask fitted with a water cooled reflux

condenser. Excess thionyl chloride was removed in vacuo to give

crude 26 as an off-white solid, and this solid was dissolved in dry

benzene (ca. 20 mL) and evaporated to dryness three times to

remove residual thionyl chloride. The acid chloride 26 was dried

on high vacuum to remove residual benzene. To a two-neck,

50 mL round-bottom flask equipped with a reflux condenser

and magnetic stir-bar was added 24 (1.35 g, 6.67 mmol) followed

by a solution of crude acid chloride 26 (7.24 mmol) in DCM

(15 mL). Aluminum chloride (2.0 g, 15 mmol) was added to the

reaction solution at room temperature slowly, with stirring, and

the reaction solution turned from colorless to red accompanied

by the evolution of gas and heat. The reaction was stirred for

5 min then heated to reflux for 15 min. The reaction was judged

to be complete by TLC, and the solution was poured into an ice

solution (25 mL) acidified with a 20% HCl solution (8 mL) and

ethyl acetate was added (13 mL). The aqueous and organic

1

(lit.⁹142-143 °C). H NMR (400 MHz, CDCl₃) δ 8.15 (d, J=

6.8 Hz, 2H), 7.89 (d, J=6.8, 2H), 7.30 (s, 1H), 7.25 (s, 1H), 4.00 (s,

3H), 2.39 (s, 3H), 1.74 (s, 4H), 1.35 (s, 6H), 1.24 (s, 6H). ¹³C NMR

(100.6 MHz, CDCl₃) δ 197.7, 166.4, 148.4, 141.9, 141.8, 134.7, 134.5,

133.4, 129.9, 129.5, 129.4, 128.4, 52.4, 34.9, 34.8, 34.3, 33.8, 31.7, 31.6,

20.0.

Methyl 4-(1-(1,2,3,4-Tetrahydro-1,1,4,4,6-pentamethylnapht-

halen-7-yl)vinyl)benzoate (28). The method of Boehm and co-

workers⁹was followed to prepare compound 28. To a 100 mL

round-bottom flask charged with methyltriphenylphosphonium

bromide (4.72 g, 13.2 mmol) and dry THF (15 mL) under

nitrogen was slowly added sodium amide (0.72 g, 18.5 mmol).

The heterogeneous solution was allowed to stir for 46 h, and it

was slowly added to a solution of 27 (3.14 g, 8.62 mmol) in dry

THF (20 mL) over 15 min. The reaction solution was stirred for

45 min and then poured into water (200 mL). The aqueous

solution was extracted with ethyl acetate (200 mL, twice), and

the combined organic layers were washed with water and brine,

dried over sodium sulfate, and concentrated in vacuo to give a

rouge powder. Crude 28 was dissolved in hot ethyl acetate (10 mL),

hot methanol (40 mL) was added, and the solution was allowed to

cool to room temperature to give pure 28 as a white powder that

was filtered (2.06 g, 66%), mp 160-161 °C (lit.⁹160-161 °C). ¹H

NMR (400 MHz, CDCl₃) δ 7.96 (d, J=8.4, 2H), 7.34 (d, J=8.8,

2H), 7.13 (s, 1H), 7.08 (s, 1H), 5.81 (d, J=1.2, 1H), 5.33 (d, J=1.2,

1H), 3.91 (s, 3H), 1.94 (s, 3H), 1.71 (s, 4H), 1.31 (s, 6H), 1.27 (s,

6H). ¹³C NMR (100.6 MHz, CDCl₃) δ 166.9, 149.1, 145.5, 144.3,

142.3, 137.9, 132.7, 129.6, 128.9, 128.1, 128.0, 126.5, 116.8, 52.0,

35.1, 33.9, 33.8, 31.9, 31.8, 19.9.

5960 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19

Wagner et al.

layers were separated, and the aqueous layer was extracted with

ethyl acetate (15 mL, twice). The combined organics were

washed with water and brine, dried over sodium sulfate, filtered,

and rotevapped to give crude 29. Crude 29 was purified by

column chromatography (250 mL SiO₂, hexanes:ethyl acetate

95:5) to give 29 (2.21 g, 93%) as an oil that crystallized into a

solid 110-111 °C (lit.²³110-112 °C). ¹H NMR (400 MHz,

CDCl₃) δ 8.46 (s, 1H), 8.24 (d, J=8.0, 1H), 8.04 (d, J=7.6, 1H),

7.55 (t, J=7.6, 1H), 7.28 (s, 1H), 7.21 (s, 1H); 3.91 (s, 3H), 2.35 (s,

3H), 1.69 (s, 4H), 1.31(s, 6H), 1.21(s, 6H). ¹³C NMR (100.6 MHz,

CDCl₃) δ 197.5, 166.5, 148.4, 142.0, 138.8. 134.8, 134.5, 133.7,

131.6, 130.6, 129.7, 128.8, 128.7, 52.5, 35.1, 35.0, 34.5, 34.1, 31.8,

20.2. LC-APCI-MS (Mþ) calcd for C₂₄H₂₉O₃365.2117, found

365.2133.

Methyl 3-(1-(1,2,3,4-Tetrahydro-1,1,4,4,6-pentamethylnapht-

halen-7-yl)vinyl)benzoate (30). To a 100 mL round-bottom flask

charged with 29 (0.96 g, 2.63 mmol) and dry THF (5 mL) at

room temperature was slowly added by equal parts separated by

45 min a triphenylphosphonium methylide solution prepared as

follows: methyltriphenylphosphonium bromide (1.9 g, 5.32 mmol)

suspended in dry THF (16 mL) in a 100 mL round-bottom flask

equipped with a stir-bar was stirred for 30 min at room

temperature after the addition of a 2.5 M solution of n-butyl

lithium in hexanes (2.2 mL, 5.5 mmol), which provided a

homogeneous dark-yellow ylide solution. The reaction was

monitored by TLC, and when the reaction was judged to be

complete, the reaction solution was poured into water (70 mL)

and the aqueous solution was extracted with ethyl acetate

(70 mL, twice). The combined organic extracts were washed

with water and brine, dried over sodium sulfate, and concen-

trated in vacuo to give crude 30, which was purified by column

chromatography (25 mL SiO₂, hexanes:ethyl acetate 97.5:2.5) to

give 30 (0.26 g, 27%) as a white solid, mp 89-91 °C. ¹H NMR

(400 MHz, CDCl₃) δ 8.10 (s, 1H), 7.92 (d, J=6.8, 1H), 7.36 (m,

2H), 7.15 (s, 1H), 7.08 (s, 1H), 5.77 (d, J=1.2, 1H), 5.28 (d, J=

1.2, 1H), 3.91 (s, 3H), 1.96 (s, 3H), 1.71 (s, 4H), 1.31 (s, 6H), 1.28

(s, 6H). ¹³C NMR (100.6 MHz, CDCl₃) δ 167.4, 149.3, 144.4,

142.5, 142.4, 141.8, 138.3, 132.9, 131.6, 131.4, 130.5, 128.7,

128.5, 128.4, 128.3, 127.7, 116.2, 52.3, 35.5, 35.4, 34.2, 34.1,

32.2, 32.1, 30.9, 30.5, 20.2. LC-APCI-MS (Mþ) calcd for

C₂₅H₃₁O₂363.2329, found 363.2324.

3-(1-(1,2,3,4-Tetrahydro-1,1,4,4,6-pentamethylnaphthalen-7-

yl)vinyl)benzoic Acid (12). Compound 12 was synthesized from

30 according to the representative procedure for the synthesis of

1 from 28. To a 100 mL round-bottom flask charged with 30

(0.3278 g, 0.90 mmol) and methanol (5 mL) was added a 5 M

aqueous solution of potassium hydroxide (0.50 mL, 2.5 mmol).

A reflux condenser was fitted to the round-bottom flask, and the

reaction solution was refluxed and monitored by TLC. After 1 h

at reflux, the reaction solution was cooled to room temperature

and quenched with 20% HCl (55 mL). The aqueous solution was

extracted with ethyl acetate (50 mL, twice) and the organic

extracts were combined, washed with water and brine, dried

over sodium sulfate, and concentrated in vacuo to give crude 12.

Crude 12 was purified by column chromatography (25 mL SiO₂,

hexanes:ethyl acetate 9:1) to give 12 (0.2623 g, 83%) as a white

crystalline solid, mp 195-196 °C. ¹H NMR (400 MHz, CDCl₃)

δ 8.16 (s, 1H), 8.02 (m, 1H), 7.42 (m, 2H), 7.15 (s, 1H), 7.09

(s, 1H), 5.79 (s, 1H), 5.30 (s, 1H), 1.96 (s, 3H), 1.71 (s, 4H), 1.31

(s, 6H), 1.29 (s, 6H). ¹³C NMR (100.6 MHz, CDCl₃) δ 172.5,

149.2, 144.6, 142.5, 141.9, 138.2, 132.8, 132.5, 129.6, 129.3,

128.7, 128.4, 128.3, 116.4, 35.5, 34.3, 34.2, 32.2, 32.1, 20.2.

LC-APCI-MS (Mþ) calcd for C₂₄H₂₉O₂349.2168, found

349.2149. Anal. Calcd for C₂₄H₂₈O₂: C 82.72; H 8.10. Found:

C 82.26; H 7.84.

hydroxide (0.64 mL, 3.2 mmol). A reflux condenser was fitted to

the round-bottom flask, and the reaction solution was refluxed

and monitored by TLC. After 1 h at reflux, the reaction solution

was cooled to room temperature and quenched with 20% HCl

(20 mL). The aqueous solution was extracted with ethyl acetate

(25 mL, twice) and the organic extracts were combined, washed

with water and brine, dried over sodium sulfate, and concent-

rated in vacuo to give crude 13. Crude 13 was purified by column

chromatography (25 mL SiO₂, hexanes:ethyl acetate 9:1) to give

13 (0.2573 g, 99%) as a white crystalline solid, mp 192-195 °C

(lit.²³192-194 °C). ¹H NMR (400 MHz, CDCl₃)

δ 8.54 (s, 1H), 8.32 (d, J=7.5, 1H), 8.12 (d, J=8, 1H), 7.61 (t,

J=8, 1H), 7.30 (s, 1H), 7.24 (s, 1H), 2.37 (s, 3H), 1.71 (s, 4H),

1.34 (s, 6H), 1.22 (s, 6H). ¹³C NMR (100.6 MHz, CDCl₃)

δ 197.1, 171.4, 148.4, 141.9, 138.8, 135.1, 134.6, 134.4, 133.9,

132.0, 129.5, 129.4, 128.5, 34.9, 34.8, 34.3, 31.6, 20.0. Anal.

Calcd for C₂₃H₂₆O₃: C 78.83; H 7.48. Found: C 79.13; H 7.68.

3,5-Di(methoxycarbonyl)benzoic Acid (32). Compound 32

was synthesized by the method of Dimick and co-workers.³⁰

To a 250 mL round-bottom flask charged with trimethyl 1,3,5-

benzenetricarboxylate (31) (1.10 g, 4.36 mmol) and methanol

(100 mL) was added a 1 M aqueous solution of sodium hydro-

xide (3.95 mL, 3.95 mmol). The reaction solution was stirred for

18 h, the solvent was removed in vacuo, and the residual solid

material was dissolved in saturated NaHCO₃(150 mL) and

washed with DCM (75 mL). The aqueous layer was acidified

with conc HCl (18 mL) until the pH ∼ 2.0, and the hetero-

geneous solution was extracted with ethyl acetate (75 mL,

twice). The combined extracts were dried over sodium sulfate,

and the solvents were removed in vacuo to give crude 32. Crude

32 was purified by recrystallization from boiling water (500 mL/

5 g) to give pure 32 (0.817 g, 79%) as a white powder, mp 264 °C

1

(decomposition). H NMR (400 MHz, CDCl₃) δ 8.91 (s, 3H),

3.99 (s, 6H). ¹³C NMR (100.6 MHz, CDCl₃) δ 170.0, 165.3,

135.4, 135.1, 131.4, 130.3, 52.7.

4-(Methoxycarbonyl)-3-nitrobenzoic Acid (35). Compound 35

was synthesized and purified according to a slightly modified

method of Keenan and co-workers.³¹To a 250 mL round-

bottom flask charged with dimethylnitroterephthalate (12 g,

50.2 mmol) and dioxane (100 mL) was added 1 M sodium

hydroxide (50 mL, 50 mmol) dropwise over 30 min at room

temperature. The reaction solution was stirred overnight, water

was added (100 mL), and the solution was washed with diethyl

ether (100 mL, twice). The aqueous layer was acidified with 1 M

HCl (56 mL) to pH ∼1-2, then extracted with ethyl acetate (150 mL,

thrice). The combined organic extracts were dried over sodium

sulfate and removed in vacuo to give crude (35). Crude 35 was

recrystallized in water (600 mL/12 g) to give pure 35 as white

1

crystals (6.0 g, 53%), mp 177-179 °C. H NMR (400 MHz,

CDCl₃) δ 8.65 (s, 1H), 8.39 (d, J=8.0, 1H), 7.84 (d, J=8.0, 1H),

3.97 (s, 3H).

3-Fluoro-4-formylmethylbenzoate (40). Compound 40 was

synthesized according to the methods of Kishida and co-work-

ers.³²To a 500 mL round-bottom flask charged with 3-fluoro-4-

methylbenzoic acid (37) (9.0 g, 58.4 mmol) was added NBS (25.0 g,

140 mmol), benzoylperoxide (0.66 g, 2.73 mmol), and carbon

tetrachloride (112 mL). The reaction solution was heated to reflux

under magnetic stirring for 36 h, cooled to room temperature, and

solids were filtered and washed with carbon tetrachloride (∼20 mL).

The filtrate solvent was removed in vacuo and the crude

4-(dibromomethyl)-3-fluorobenzoic acid (38) was dried on high

vacuum and used without further purification. To a 500 mL round-

bottom flask charged with crude 38 (10.44 g, 58.4 mmol) was

added ethanol (148 mL), and a solution of silver nitrate (20.5 g,

120.7 mmol) in warm water (28 mL) was added dropwise while the

reaction solution was stirred in an oil bath preheated to 50-55 °C.

Upon addition of the silver nitrate solution, a green precipitate

formed. After stirring at 50 °C for 45 min, the reaction solution was

cooled to room temperature and filtered to remove the green

precipitate. The filtrate solvent was concentrated in vacuo, extracted

3-[(3,5,5,8,8-Pentamethyl-5,6,7,8-tetrahydronaphthalen-2-yl)-

carbonyl]benzoic Acid (13). Compound 13²³was synthesized

according to the method of Boehm and co-workers.⁹To a 100 mL

round-bottom flask charged with 29 (0.27 g, 0.74 mmol) and

methanol (5 mL) was added a 5 M aqueous solution of potassium

Article

Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19 5961

with ethyl acetate (130 mL), and the combined organic extracts

were washed with water and brine, dried over sodium sulfate, and

removed in vacuo to give crude 3-fluoro-4-formylbenzoic acid (39)

(8.68 g, 87%) that was used without further purification. To a

500 mL round-bottom flask charged with 39 (9.87 g, 58.7 mmol)

was added dry dimethylformamide (190 mL) and a 60 wt %

suspension of NaH in mineral oil (2.75 g, 68.8 mmol) in small

aliquots over 20 min. The reaction solution was stirred an addit-

ional 20 min, and methyliodide (4.32 mL, 69.4 mmol) was added to

the red heterogeneous solution. After stirring 5 h, the reaction

solution had become homogeneous, and it was poured into 1N

HCl (490 mL), extracted with ethyl acetate (150 mL, twice), and the

combined organic extracts were washed with saturated NaHCO₃

(75 mL) and brine, dried over sodium sulfate, and removed in

vacuo to give crude 40. Crude 40 was purified by column chroma-

tography (150 mL SiO₂, hexanes:ethyl acetate 4:1) to give 40 (10.24

g, 95%) as a colorless oil. ¹H NMR (400 MHz, CDCl₃) δ 10.41

(s, 1H), 7.94 (m, 2H), 7.85 (m, 1H), 3.95 (s, 3H). ¹³C NMR

(100.6 MHz, CDCl₃) δ 186.6, 165.2, 164.9, 163.1, 137.2, 132.1,

128.8, 126.8, 125.5, 124.8, 117.9, 117.7, 52.8; LC-APCI-MS (Mþ)

calcd for C₉H₇O₃F 182.0379, found 182.0336.

with ethyl acetate (50 mL, thrice). The combined organic

extracts were washed with brine, dried over sodium sulfate,

and removed in vacuo to give crude 44 (3.14 g, 90%) that was

used without further purification. A small sample was purified

by column chromatography (25 mL SiO₂, hexanes:ethyl acetate

1

1:1) to give pure 44 as a white powder, mp 127-128 °C: H

NMR (400 MHz, CDCl₃) δ 10.91 (br s, 1H), 8.09 (t, J=7.8, 1H),

7.93 (d, J=9.2, 1H), 7.85 (d, J=10.9, 1H), 7.39 (m, 5H), 5.40

(s, 2H); ¹³C NMR (100.6 MHz, CDCl₃) δ 168.8, 168.7, 164.4,

164.3, 163.4, 160.8, 136.8, 136.7, 135.2, 132.8, 128.7, 128.5,

128.3, 125.0, 124.9, 121.3, 121.2, 118.4, 118.2, 67.6.

4-Benzyl 1-Methyl 2-Fluorobenzene-1,4-dioate (45). Comp-

ound 45 was synthesized according to the method of Kishida

and co-workers.³²To a 100 mL round-bottom flask charged

with compound 44 (2.91 g, 10.6 mmol) was added SOCl₂(9.0 mL,

124 mmol) and the reaction solution was refluxed for 1 h. The

reaction solution was cooled to room temperature and the excess

thionyl chloride was removed in vacuo to give crude 4-chlorocar-

bonyl-2-fluorobenzoic acid benzyl ester. The crude 4-chlorocarbo-

nyl-2-fluorobenzoic acid in dry toluene (4.5 mL) was added

dropwise to a solution of triethylamine (2.9 mL, 20.9 mmol) in

methanol (29.8 mL, 736 mmol) over 10 min. The reaction solution

was stirred1 h and poured into 1N HCl (80 mL) and extractedwith

ethyl acetate (80 mL, thrice). The combined organic extracts were

washed with brine, dried over sodium sulfate, and removed in

vacuo to give crude 45. Crude 45 was purified by column chroma-

tography (150 mL SiO₂, hexanes:ethyl acetate 95:5) to give pure 45

as a colorless oil: ¹H NMR (400 MHz, CDCl₃) δ 7.99 (t, J=7.8,

1H), 7.88 (d, J=8.2, 1H), 7.81 (d, J=10.9, 1H), 7.41 (m, 5H), 5.37

(s, 2H), 3.95(s, 3H);¹³C NMR (100.6 MHz, CDCl₃) δ164.5, 164.4,

164.2, 164.1, 162.7, 160.1, 135.7, 135.6, 135.2, 132.2, 128.7, 128.5,

124.9, 124.8, 122.5, 122.4, 118.3, 118.0, 67.4, 52.6; LC-APCI-MS

(Mþ) calcd for C₁₆H₁₄O₄F 289.0876, found 289.0886.

4-(Methoxycarbonyl)-2-fluorobenzoic acid (41). Compound

41 was synthesized by the method of Kishida and co-workers.³²

To a 250 mL round-bottom flask charged with compound 40

(9.22 g, 50.5 mmol) and sulfamic acid (5.40 g, 55.6 mmol) in

water (21 mL) and ACN (42 mL) was added a solution of 80%

NaClO₂(4.92 g, 53.8 mmol) in water (21 mL) dropwise at room

temperature. After stirring for 1 h, the reaction solution was

poured into a saturated, aqueous solution of Na₂SO₃(75 mL)

and 1 N HCl (150 mL) and the resulting solution was extracted

with ethyl acetate (75 mL, thrice). The combined organic

extracts were washed with brine, dried over sodium sulfate,

and the solvents were removed in vacuo to give crude 41 (7.56 g,

75%) as a white solid. A small sample was recrystallized from

hot ethyl acetate togive pure41aswhite crystals, mp154-155 °C.

¹H NMR (400 MHz, CDCl₃) δ 10.5 (br s, 1H), 8.10 (t, J=7.8,

4-(Methoxycarbonyl)-3-fluorobenzoic Acid (46).³²A three-

neck 250 mL round-bottom flask charged with 45 (1.87 g,

6.49 mmol), 10% Pd/C (0.191 g), ethanol (11.0 mL), and ethyl

acetate (11.0 mL) was evacuated and backfilled with hydrogen

gas from a balloon three times, and the reaction solution was

allowed to stir under hydrogen at room temperature overnight.

The reaction solution was filtered through celite, and the

solvents were removed in vacuo to give crude 46 (1.23 g, 95%)

as a white crystalline solid that was used without further

purification. A small sample of crude 46 was purified by

recrystallization from hot ethyl acetate to give pure 46, mp

210-211 °C. ¹H NMR (400 MHz, DMSO-d₆) δ 13.61 (br s, 1H),

7.98 (t, J=7.8, 1H), 7.83 (d, J=8.2, 1H), 7.74 (d, J=11.2, 1H),

3.87 (s, 3H). ¹³C NMR (100.6 MHz, DMSO-d₆) δ 165.9, 165.8,

163.9, 163.8, 162.2, 159.6, 137.4, 137.3, 132.5, 125.6, 125.5,

122.1, 122.0, 117.9, 117.7, 53.0. LC-APCI-MS (Mþ) calcd for

C₉H₇O₄F 198.0328, found 198.0371.

Dimethyl 5-(2-(3,5,5,8,8-Pentamethyl-5,6,7,8-tetrahydronap-

hthalen-2-yl)carbonyl)benzene-1,3-dioate (48). Compound 48

was synthesized according to the representative procedure for

the synthesis of compound 29. Dimethyl 5-(chlorocarbo-

nyl)benzene-1,3-dioate (33) was synthesized by refluxing 3,5-

di(methoxycarbonyl)benzoic acid (32) (1.71 g, 7.17 mmol) in

thionyl chloride (12.0 mL, 165 mmol) in a 100 mL one-neck

round-bottom flask fitted with a water cooled reflux condenser.

Excess thionyl chloride was removed in vacuo to give crude 33 as

an off-white solid, and this solid was dissolved in dry benzene

(ca. 20 mL) and evaporated to dryness three times to remove

residual thionyl chloride. The acid chloride 33 was dried on high

vacuum to remove residual benzene. To a two-neck, 50 mL

round-bottom flask equipped with a reflux condenser and

magnetic stir-bar was added 24 (1.39 g, 6.86 mmol), followed

by a solution of crude acid chloride 33 (7.17 mmol) in DCM (15 mL).

Aluminum chloride (2.0 g, 15 mmol) was added to the reaction

solution at room temperature slowly, with stirring, and the reaction

solution turned from colorless to red accompanied by the evolution of

gas and heat. The reaction was stirred for 5 min then heated to reflux

1H), 7.89 (d, J=8.2, 1H), 7.82 (d, J=11.0, 1H), 3.97 (s, 3H). ¹³

C

NMR (100.6 MHz, CDCl₃) δ 168.6, 168.5, 165.0, 164.9, 163.4,

160.8, 136.7, 136.6, 132.8, 124.9, 124.8, 121.3, 121.2, 118,4, 118.1,

52.8. LC-APCI-MS (Mþ) calcd for C₉H₇O₄F 198.0328, found

198.0331.

Benzyl-3-fluoro-4-formylbenzoate (43).³²To a 100 mL round-

bottom flask charged with a crude sample of 3-fluoro-4-for-

mylbenzoic acid (39) (2.51 g, 14.9 mmol) and dry DMF (45 mL)

was slowly added with stirring 60 wt % NaH in mineral oil

(0.726 g, 18.2 mmol). The reaction solution was stirred for

45 min, benzyl bromide (2.2 mL, 18.4 mmol) was added drop-

wise, and the reaction solution was stirred for an additional 5 h.

TLC indicated the completion of the reaction, and the reaction

solution was poured into 1N HCl (80 mL) and extracted with

ethyl acetate (50 mL, twice). The combined organic extracts

were washed with saturated NaHCO₃and brine, dried over

sodium sulfate, and removed in vacuo to give crude 43 as a

yellow oil. Crude 43 was purified by column chromatography

(150 mL SiO₂, hexanes:ethyl acetate 4:1) to give 43 (3.84 g, 99%)

as a colorless oil: ¹H NMR (400 MHz, CDCl₃) δ 10.31 (s, 1H),

7.83 (m, 2H), 7.76 (m, 1H), 7.31 (m, 5H), 5.29 (s, 2H);¹³C NMR

(100.6 MHz, CDCl₃) δ 218.2, 186.6, 186.5, 165.2, 164.3, 164.2,

163.1, 137.3, 137.2, 135.2, 132.1, 128.9, 128.8, 128.7, 128.6,

128.5, 128.4, 128.3, 127.0, 126.9, 125.7, 125.6, 124.8, 118.2,

118.0, 117.8, 67.6, 67.4; LC-APCI-MS (Mþ) calcd for

C₁₅H₁₂O₃F 259.0771, found 259.0751.

4-((Benzyloxy)carbonyl)-2-fluorobenzoic Acid (44). Comp-

ound 44 was prepared according to the method of Kishida

and co-workers.³²To a 100 mL round-bottom flask charged

with 43 (3.29 g, 12.7 mmol), sulfamic acid (1.235 g, 12.7 mmol),

water (20 mL), and ACN (10 mL) was added a solution of 80%

NaClO₂(1.16 g, 12.8 mmol) in water (6.8 mL). After stirring for

1 h, the reaction solution was poured into saturated Na₂SO₃(25mL)

and 1N HCl (50 mL), and the resulting solution was extracted

5962 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19

Wagner et al.

for 15 min. The reaction was judged to be complete by TLC, and the

solution was poured into an ice solution (25 mL) acidified with a 20%

HCl solution (8 mL) and ethyl acetate was added (13 mL). The

aqueous and organic layers were separated, and the aqueous layer was

extracted with ethyl acetate (15 mL, twice). The combined organics

were washed with water and brine, dried over sodium sulfate, filtered,

and removed in vacuo to give crude 48. Crude 48 was purified by

column chromatography (250 mL SiO₂, hexanes:ethyl acetate 95:5 to

9:1) to give 48 (1.29 g, 44%) as a white powder, mp 143-145 °C. ¹H

NMR (400 MHz, CDCl₃) δ 8.89 (s, 1H), 8.65 (s, 1H), 7.27 (s, 1H),

7.22 (s, 1H), 3.95 (s, 6H), 2.37 (s, 3H), 1.68 (s, 4H), 1.31 (s, 6H), 1.19

(s, 6H). ¹³C NMR (100.6 MHz, CDCl₃) δ 196.2, 165.8, 149.0, 142.2,

139.4, 135.3, 131.2, 130.0, 129.1, 52.8, 35.0, 34.6, 34.1, 31.8, 20.3. LC-

APCI-MS (M þ H)þ calcd for C₂₆H₃₁O₅423.2171, found 423.2163.

Dimethyl 5-(1-(1,2,3,4-Tetrahydro-1,1,4,4,6-pentamethylnap-

hthalen-7-yl)vinyl)benzene-1,3-dioate (52). Compound 52 was

synthesized following the representative procedure to synthesize

compound 30. To a 100 mL round-bottom flask charged with 48

(0.92 g, 2.18 mmol) and dry THF (5 mL) at room temperature

was slowly added by equal parts separated by 45 min a triphe-

nylphosphonium methylide solution prepared as follows:

methyltriphenylphosphonium bromide (1.65 g, 4.62 mmol)

suspended in dry THF (10 mL) in a 100 mL round-bottom flask

equipped with a stir-bar was stirred for 30 min at room

temperature after the addition of a 2.5 M solution of n-butyl

lithium in hexanes (1.86 mL, 4.65 mmol), which provided a

homogeneous dark yellow ylide solution. The reaction was

monitored by TLC, and when the reaction was judged to be

complete, the reaction solution was poured into water (70 mL)

and the aqueous solution was extracted with ethyl acetate

(70 mL, twice). The combined organic extracts were washed

with water and brine, dried over sodium sulfate, and concen-

trated in vacuo to give crude 52, which was purified by column

chromatography (25 mL SiO₂, hexanes:ethyl acetate 97.5:2.5)

to give 52 (0.14 g, 16%) as a white solid, mp 138 °C. ¹H NMR

(400 MHz, CDCl₃) δ 8.58 (s, 1H), 8.16 (s, 2H), 7.15 (s, 1H), 7.09

(s, 1H), 5.81 (s, 1H), 5.35 (s, 1H), 3.93 (s, 6H), 1.95 (s, 3H), 1.73

(s, 4H), 1.31 (s, 6H), 1.29 (s, 6H). ¹³C NMR (100.6 MHz, CDCl₃)

δ 166.5, 148.6, 144.8, 142.6, 137.6, 132.7, 132.2, 130.9, 129.7,

128.5, 128.3, 117.5, 52.6, 35.5, 35.4, 34.2, 34.1, 32.1, 32.0, 20.3.

LC-APCI-MS (M þ H)þ calcd for C₂₇H₃₃O₄421.2379, found

421.2375.

was refluxed and monitored by TLC. After 1 h at reflux, the reaction

solution was cooled to room temperature and quenched with 20%

HCl (20 mL). The precipitate was filtered to give crude 15 (0.28 g,

97%) that appeared to be pure by TLC. A sample of 15 was purified

by recrystallization in hot ethyl acetate to give pure 15 as a white

crystalline solid, mp 301-303 °C. ¹H NMR (400 MHz, MeOH-d₄)

δ 8.85 (s, 1H), 8.57 (s, 2H), 7.33 (s, 1H), 7.31 (s, 1H), 2.34 (s, 3H),

1.73 (s, 4H), 1.34 (s, 6H), 1.22 (s, 6H). ¹³C NMR (100.6 MHz,

MeOH-d₄) δ 196.8, 166.6, 148.7, 142.1, 139.1, 134.7, 134.6, 134.2,

132.0, 129.6, 128.5, 106.4, 105.0, 34.8, 34.7, 34.2, 33.7, 30.8, 18.8.

Anal. Calcd for C₂₄H₂₆O₅: C 73.08; H 6.64. Found: C 72.95; H 6.75.

Methyl 4-(1-(3,5,5,8,8-Pentamethyl-5,6,7,8-tetrahydronapht-

halen-2-yl)carbonyl)-2-nitrobenzoate (49). Compound 49 was

synthesized following the representative procedure for the

synthesis of compound 29. Methyl 4-(chlorocarbonyl)-2-nitro-

benzoate (36) was synthesized by refluxing 4-(methoxycarbo-

nyl)-3-nitrobenzoic acid (35) (2.46 g, 10.9 mmol) in thionyl

chloride (22.0 mL, 302 mmol) in a 100 mL one-neck round-

bottom flask fitted with a water-cooled reflux condenser. Excess

thionyl chloride was removed in vacuo to give crude 36 as an off-

white solid, and this solid was dissolved in dry benzene (ca. 20 mL)

and evaporated to dryness three times to remove residual

thionyl chloride. The acid chloride 36 was dried on high vacuum

to remove residual benzene. To a two-neck, 50 mL round-

bottom flask equipped with a reflux condenser and magnetic

stir-bar was added 24 (2.55 g, 12.6 mmol), followed by a solution

of crude acid chloride 36 (10.9 mmol) in DCM (15 mL).

Aluminum chloride (4.0 g, 30 mmol) was added to the reaction

solution at room temperature slowly, with stirring, and the

reaction solution turned from colorless to red accompanied by

the evolution of gas and heat. The reaction was stirred for 5 min

then heated to reflux for 15 min. The reaction was judged to be

complete by TLC, and the solution was poured into an ice

solution (50 mL) acidified with a 20% HCl solution (16 mL) and

ethyl acetate was added (13 mL). The aqueous and organic

layers were separated, and the aqueous layer was extracted with

ethyl acetate (25 mL, twice). The combined organics were

washed with water and brine, dried over sodium sulfate, filtered,

and removed in vacuo to give crude 49. Crude 49 was purified by

column chromatography (250 mL SiO₂, hexanes:ethyl acetate

95:5 to 9:1) to give 49 (4.08 g, 91%) as a yellow, crystalline solid,

1

mp 115-116 °C. H NMR (400 MHz, CDCl₃) δ 8.32 (s, 1H),

5-(1-(1,2,3,4-Tetrahydro-1,1,4,4,6-pentamethylnaphthalen-7-

yl)vinyl)benzene-1,3-dioic Acid (14). Compound 14 was synthe-

sized following the representative procedure for the synthesis of

compound 12. To a 100 mL round-bottom flask charged with 52

(0.15 g, 0.36 mmol) and methanol (5 mL) was added a 5 M

aqueous solution of potassium hydroxide (0.43 mL, 2.15 mmol).

A reflux condenser was fitted to the round-bottom flask, and the

reaction solution was refluxed and monitored by TLC. After 1 h

at reflux, the reaction solution was cooled to room temperature

and quenched with 20% HCl (49 mL). The precipitate product

was filtered to give crude 14 that appeared to be pure by TLC. A

small sample of crude 14 was purified by recrystallization from

hot ethyl acetate to give pure 14 as a white crystalline solid, mp

258-260 °C. ¹H NMR (400 MHz, MeOH-d₄) δ 8.55 (s, 1H), 8.12

(s, 2H), 7.15 (s, 2H), 5.87 (s, 1H), 5.28 (s, 1H), 1.95 (s, 3H), 1.72

(s, 4H), 1.30 (s, 6H), 1.28 (s, 6H). ¹³C NMR (100.6 MHz,

MeOH-d₄) δ 167.5, 148.9, 144.5, 142.4, 142.1, 137.9, 132.5,

131.6, 131.5, 129.6, 128.2, 127.8, 116.0, 35.2, 35.1, 33.7, 33.6,

31.1, 31.0, 18.9. LC-APCI-MS (M - H)- calcd for C₂₅H₂₇O₄

391.1909, found 391.1942. Anal. Calcd for C₂₅H₂₈O₄: C 76.50;

H 7.19. Found: C 74.10; H 6.96.

8.09 (d, J=8, 1H), 7.82 (d, J=8, 1H), 7.25 (m, 1H), 3.95 (s, 3H),

2.36 (s, 3H), 1.69 (s, 4H), 1.31 (s, 6H), 1.20 (s, 3H). ¹³C NMR

(100.6 MHz, CDCl₃) δ 194.8, 165.5, 149.6, 148.2, 142.5, 141.7,

135.4, 134.2, 133.3, 130.7, 130.2, 128.9, 125.6, 53.7, 35.0, 34.9,

34.7, 34.1, 31.9, 31.7, 20.3; LC-APCI-MS (M þ H)þ calcd for

C₂₄H₂₈NO₅410.1967, found 410.1959.

Methyl 4-(1-(1,2,3,4-Tetrahydro-1,1,4,4,6-pentamethylnapht-

halen-7-yl)vinyl)-2-nitrobenzoate (53). Compound 53 was syn-

thesized following the representative procedure for the synthesis

of compound 30. To a 100 mL round-bottom flask charged with

52 (0.895 g, 2.19 mmol) and dry THF (5 mL) at room tempera-

ture was slowly added by equal parts separated by 45 min a

triphenylphosphonium methylide solution prepared as follows:

methyltriphenylphosphonium bromide (1.7 g, 4.76 mmol) sus-

pended in dry THF (16 mL) in a 100 mL round-bottom flask

equipped with a stir-bar was stirred for 30 min at room

temperature after the addition of a 2.5 M solution of n-butyl

lithium in hexanes (1.86 mL, 4.65 mmol), which provided a

homogeneous dark-yellow ylide solution. The reaction was

monitored by TLC, and when the reaction was judged to be

complete, the reaction solution was poured into water (70 mL)

and the aqueous solution was extracted with ethyl acetate (70

mL, twice). The combined organic extracts were washed with

water and brine, dried over sodium sulfate, and concentrated in

vacuo to give crude 53, which was purified by column chroma-

tography (25 mL SiO₂, hexanes:ethyl acetate 97.5:2.5) to give 53

(0.10 g, 11%) as an off-white solid.: ¹H NMR (400 MHz,

CDCl₃) δ 7.77 (s, 1H), 7.68 (d, J = 8, 1H), 7.50 (d, J = 7.6,

5-(1-(3,5,5,8,8-Pentamethylnaphthalen-2-yl)carbonyl)benz-

ene-1,3-dioic Acid (15). Compound 15 was synthesized following

the representative procedure for the synthesis of compound 13.

To a 100 mL round-bottom flask charged with 48 (0.31g, 0.74mmol

and methanol (5 mL) was added a 5 M aqueous solution of

potassium hydroxide (0.87 mL, 4.4 mmol). A reflux condenser

was fitted to the round-bottom flask, and the reaction solution

Article

Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19 5963

1H), 7.10 (m, 2H), 5.87 (s, 1H), 5.43 (s, 1H), 3.90 (s, 3H), 1.95

(s,3H),1.70(s,4H),1.30(s,6H),1.27(s,6H).¹³C NMR (100.6 MHz,

CDCl₃) δ 165.5, 149.0, 147.1, 145.4, 145.0, 142.7, 136.5, 132.4,

130.3, 130.1, 128.4, 128.0, 125.2, 121.5, 118.8, 104.7, 53.1, 35.1,

35.0, 34.0, 33.9, 31.9, 31.8, 19.9. LC-APCI-MS (M þ H)þ calcd

for C₂₅H₃₀NO₄408.2175, found 408.2169.

solution at room temperature slowly, with stirring, and the reaction

solution turned from colorless to red accompanied by the evolution of

gas and heat. The reaction was stirred for 5 min and then heated to

reflux for 15 min. The reaction was judged to be complete by TLC,

and the solution was poured into an ice solution (25 mL) acidified

with a 20% HCl solution (8 mL) and ethyl acetate was added

(13 mL). The aqueous and organic layers were separated, and the

aqueous layer was extracted with ethyl acetate (15 mL, twice). The

combined organics were washed with water and brine, dried over

sodium sulfate, filtered, and rotevapped to give crude 50. Crude 50

was purified by column chromatography (250 mL SiO₂, hexanes:

ethyl acetate 95:5 to 92.5:7.5) to give 50 (2.50 g, 97%) as a colorless

4-(1-(1,2,3,4-Tetrahydro-1,1,4,4,6-pentamethylnaphthalen-7-

yl)vinyl)-2-nitrobenzoic Acid (16). Compound 16 was synthe-

sized following the representative procedure for the synthesis of

compound 12. To a 100 mL round-bottom flask charged with 53

(0.099 g, 0.24 mmol) and methanol (5 mL) was added a 5 M

aqueous solution of potassium hydroxide (0.12 mL, 0.61 mmol).

A reflux condenser was fitted to the round-bottom flask, and the

reaction solution was refluxed and monitored by TLC. After 1 h

at reflux, the reaction solution was cooled to room temperature

and quenched with 20% HCl (15 mL). The aqueous solution was

extracted with ethyl acetate (50 mL, twice) and the organic

extracts were combined, washed with water and brine, dried

over sodium sulfate, and concentrated in vacuo to give crude 16.

Crude 16 was purified by column chromatography (25 mL SiO₂,

ethyl acetate) to give 16 (0.077 g, 80%) as an off-white crystalline

solid, mp 212-214 °C. ¹H NMR (400 MHz, CDCl₃) δ 8.60 (br s,

1H), 7.86 (d, J=8, 1H), 7.71 (s, 1H), 7.52 (d, J=8, 1H), 7.12

(s, 1H), 7.11 (s, 1H), 5.92 (s, 1H), 5.47 (s, 1H), 1.98 (s, 3H), 1.72

(s, 4H), 1.32 (s, 6H), 1.29 (s, 6H). ¹³C NMR (100.6 MHz, CDCl₃)

δ 169.9, 150.1, 147.3, 146.8, 145.4, 143.0, 136.7, 132.7, 131.2,

130.1, 128.7, 128.3, 123.6, 121.7, 119.4, 35.4, 35.3, 34.3, 34.2,

32.1, 32.0, 20.2. LC-APCI-MS (M - H)- calcd for C₂₄H₂₆NO₄

392.1862, found 392.1872. Anal. Calcd for C₂₄H₂₇O₄N: C 73.26;

H 6.92; N 3.56. Found: C 72.92; H 6.71; N 3.76.

1

crystalline solid, mp 114-117 °C. H NMR (400 MHz, CDCl₃)

δ 7.90 (d, J=8.0, 1H), 7.80 (d, J=10.1, 1H), 7.60 (t, J=7.4, 1H), 7.32

(s, 1H), 7.20 (s, 1H), 3.96 (s, 3H), 2.51 (s, 3H), 1.67 (s, 4H), 1.29

(s, 6H), 1.14 (s, 6H). ¹³C NMR (100.6 MHz, CDCl₃) δ193.9, 165.4,

165.3, 161.1, 158.6, 149.9, 142.2, 136.0, 134.4, 134.3, 134.0, 132.4,

132.3, 131.0, 130.9, 130.3, 129.9, 125.2, 125.1, 117.5, 117.3, 52.6, 34.8,

34.7, 34.4, 33.8, 31.5, 31.4, 20.9. LC-APCI-MS (M þ H)þ calcd for

C₂₄H₂₈O₃F 383.2023, found 383.2021.

Methyl 3-Fluoro-4-(1-(1,2,3,4-tetrahydro-1,1,4,4,6-pentamet-

hylnaphthalen-7-yl)vinyl)benzoate (54). Compound 54 was synt-

hesized following a slightly modified procedure for the synthesis

of compound 30. To a 20-dram vial containing 50 (0.79 g, 2.07 mmol)

and dry THF (3 mL) at room temperature was slowly added a

triphenylphosphonium methylide solution prepared as follows: to a

20-dram vial equipped with a Teflon magnetic stir-bar and contining

dry THF (2.0 mL) was added ⁱPr₂NH (0.66 mL, 4.67 mmol) and a

2.5 M solution of n-butyl lithium in hexanes (1.7 mL, 4.25 mmol),

and the solution was stirred for 30 min at room temperature, at which

point methyl triphenylphosphonium bromide (1.13 g, 3.19 mmol)

was added and the solution was stirred an additional 20 min to

provide a homogeneous dark-yellow ylide solution. The reaction was

monitored by TLC, and when the reaction was judged to be

complete, the reaction solution was poured into water (50 mL) and

the aqueous solution was extracted with ethyl acetate (50 mL, twice).

The combined organic extracts were washed with water and brine,

dried over sodium sulfate, and concentrated in vacuo to give crude 54

which was purified by column chromatography (25 mL SiO₂,

hexanes:ethyl acetate 97.5:2.5) to give 54 (0.254 g, 32%) as a white

solid, mp 107-109 °C. ¹H NMR (400 MHz, CDCl₃) δ 7.73 (d, J=

10.8, 1H), 7.70 (d, J=7.8, 1H), 7.15 (s, 1H), 7.10 (t, J=8.0, 1H), 7.05

(s, 1H), 5.86 (s, 1H), 5.56 (s, 1H), 3.91 (s, 3H), 1.98 (s, 3H), 1.69

(s, 4H), 1.29 (s, 6H), 1.28 (s, 6H). ¹³C NMR (100.6 MHz, CDCl₃)

δ 165.9, 165.8, 161.0, 158.5, 144.3, 143.5, 142.3, 138.3, 133.8, 133.7,

132.3, 130.7, 130.6, 130.5, 130.4, 128.0, 127.8, 125.0, 124.9, 121.3,

121.2, 117.2, 117.0, 52.2, 35.2, 35.1, 33.9, 33.8, 31.9, 31.8, 19.7. LC-

APCI-MS (M þ H)þ calcd for C₂₅H₃₀O₂F 381.2230, found

381.2220.

3-Fluoro-4-(1-(1,2,3,4-tetrahydro-1,1,4,4,6-pentamethylnaph-

thalen-7-yl)vinyl)benzoic Acid (18). Compound 18 was synthe-

sized following the representative procedure for the synthesis of

compound 12. To a 100 mL round-bottom flask charged with 54

(0.2541 g, 0.90 mmol) and methanol (5 mL) was added a 5 M

aqueous solution of potassium hydroxide (0.35 mL, 1.74 mmol).

A reflux condenser was fitted to the round-bottom flask and the

reaction solution was refluxed and monitored by TLC. After 1 h

at reflux, the reaction solution was cooled to room temperature

and quenched with 20% HCl (42 mL). The aqueous solution was

extracted with ethyl acetate (50 mL, twice), and the organic

extracts were combined, washed with water and brine, dried over

sodium sulfate, andconcentrated invacuotogive crude 18. Crude

18 was purified by column chromatography (25 mL SiO₂,

hexanes:ethyl acetate 9:1) to give 18 (0.24 g, 98%) as a white

crystalline solid, mp 188-189 °C. ¹H NMR (400 MHz, CDCl₃)

δ 10.80 (br s, 1H), 7.80 (d, J=9.9, 1H), 7.78 (d, J=7.0, 1H), 7.15

(s, 1H), 7.13 (t, J=8.1, 1H), 7.07 (s, 1H), 5.89 (s, 1H), 5.59 (s, 1H),

1.99 (s, 3H), 1.70 (s, 4H), 1.30 (s, 6H), 1.29 (s, 6H). ¹³C NMR

(100.6 MHz, CDCl₃) δ 171.0, 170.9, 161.0, 158.5, 144.4, 143.4,

142.4, 138.2, 134.8, 134.7, 132.3, 130.8, 130.7, 129.5, 129.4, 128.1,

4-(1-(3,5,5,8,8-Pentamethyl-5,6,7,8-tetrahydronaphthalen-2-

yl)carbonyl)-2-nitrobenzoic Acid (17). Compound 17 was synthe-

sized following the representative procedure for the synthesis of

compound 13. To a 100 mL round-bottom flask charged with 52

(0.30 g, 0.73 mmol) and methanol (5 mL) was added a 5 M

aqueous solution of potassium hydroxide (0.37 mL, 1.85 mmol).

A reflux condenser was fitted to the round-bottom flask, and the

reaction solution was refluxed and monitored by TLC. After 1 h

at reflux, the reaction solution was cooled to room temperature

and quenched with 20% HCl (20 mL). The aqueous solution was

extracted with ethyl acetate (25 mL, twice) and the organic

extracts were combined, washed with water and brine, dried

over sodium sulfate, and concentrated in vacuo to give crude 17.

Crude 17 was purified by column chromatography (25 mL SiO₂,

ethyl acetate) to give 17 (0.28 g, 97%) as a yellow crystalline

solid, mp 167-169 °C. ¹H NMR (400 MHz, CDCl₃) δ 9.00 (br s,

1H), 8.29 (s, 1H), 8.11 (d, J=7.5, 1H), 7.97 (d, J=7.5, 1H), 7.26

(m, 2H), 2.39 (s, 3H), 1.71 (s, 4H), 1.33 (s, 6H), 1.22 (s, 6H). ¹³

C

NMR (100.6 MHz, CDCl₃) δ 194.7, 169.2, 149.5, 148.5, 142.4,

142.0, 135.2, 133.7, 133.0, 130.4, 130.0, 129.2, 128.7, 125.2, 34.8,

34.7, 34.4, 33.9, 31.7, 31.5, 31.4, 20.1. Anal. Calcd for

C₂₃H₂₅O₅N: C 69.86; H 6.37; N 3.54. Found: C 68.35; H 6.75;

N 3.34.

Methyl 3-Fluoro-4-(1-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahy-

dronaphthalen-2-yl)carbonyl)benzoate (50). Compound 50 was

synthesized following the representative procedure for the

synthesis of compound 29. Methyl 4-(chlorocarbonyl)-3-fluor-

obenzoate (42) was synthesized by refluxing 4-(methoxy-

carbonyl)-2-fluorobenzoic acid (41) (1.34 g, 6.76 mmol) in

thionyl chloride (12.0 mL, 165 mmol) in a 100 mL one-neck

round-bottom flask fitted with a water-cooled reflux condenser.

Excess thionyl chloride was removed in vacuo to give crude 42 as

an off-white solid, and this solid was dissolved in dry benzene

(ca. 20 mL) and evaporated to dryness three times to remove

residual thionyl chloride. The acid chloride 42 was dried on high

vacuum to remove residual benzene. To a two-neck, 50 mL

round-bottom flask equipped with a reflux condenser and

magnetic stir-bar was added 24 (1.35 g, 6.67 mmol), followed

by a solution of crude acid chloride 42 (6.25 mmol) in DCM (15 mL).

Aluminum chloride (2.0 g, 15 mmol) was added to the reaction

5964 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19

Wagner et al.

127.8, 125.7, 125.6, 121.7, 121.6, 117.8, 117.6, 35.1, 33.9, 33.8,

31.9, 31.8, 19.7. LC-APCI-MS (M þ H)þ calcd for C₂₄H₂₈O₂F

367.2073, found 367.2032. Anal. Calcd for C₂₄H₂₇O₂F: C 78.66;

H 7.43; F 5.18. Found: C 78.34; H 7.52; F 4.8.

synthesized following a representative procedure for the synth-

esis of compound 54. To a 20 dram vial containing 51 (0.79 g,

2.07 mmol) and dry THF (3 mL) at room temperature was

slowly added a triphenylphosphonium methylide solution pre-

pared as follows: to a 20 dram vial equipped with a Teflon

magnetic stir-bar and contining dry THF (2.0 mL) was added

ⁱPr₂NH (0.66 mL, 4.67 mmol) and a 2.5 M solution of n-butyl

lithium in hexanes (1.7 mL, 4.25 mmol), and the solution was

stirred for 30 min at room temperature, at which point methyl

triphenylphosphonium bromide (1.13 g, 3.19 mmol) was added

and the solution was stirred an additional 20 min to provide a

homogeneous dark-yellow ylide solution. The reaction was

monitored by TLC, and when the reaction was judged to be

complete, the reaction solution was poured into water (50 mL)

and the aqueous solution was extracted with ethyl acetate (50 mL,

twice). The combined organic extracts were washed with water

and brine, dried over sodium sulfate, and concentrated in vacuo

to give crude 55 which was purified by column chromatography

(25 mL SiO₂, hexanes:ethyl acetate 97.5:2.5) to give 54 (0.301 g,

3-Fluoro-4-(1-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydronaph-

thalen-2-yl)carbonyl)benzoic Acid (19). Compound 19 was

synthesized following the representative procedure used to

synthesize compound 13. To a 100 mL round-bottom flask

charged with 50 (0.50 g, 1.31 mmol) and methanol (5 mL) was

added a 5 M aqueous solution of potassium hydroxide (0.74 mL,

3.71 mmol). A reflux condenser was fitted to the round-bottom

flask, and the reaction solution was refluxed and monitored by

TLC. After 1 h at reflux, the reaction solution was cooled to

room temperature and quenched with 20% HCl (20 mL). The

aqueous solution was extracted with ethyl acetate (25 mL,

twice), and the organic extracts were combined, washed with

water and brine, dried over sodium sulfate, and concentrated in

vacuo to give crude 19. Crude 19 was purified by column

chromatography (25 mL SiO₂, hexanes:ethyl acetate 4:1 to

3:2) to give 19 (0.409 g, 84%) as a white crystalline solid, mp

228-229 °C. ¹H NMR (400 MHz, DMSO-d₆) δ 13.58 (br s, 1H),

7.88 (d, J=8.0, 1H), 7.76 (d, J=10.4, 1H), 7.64 (t, J=7.4, 1H),

7.32 (s, 1H), 7.28 (s, 1H), 2.40 (s, 3H), 1.61 (s, 4H), 1.26 (s, 6H),

1.09 (s, 6H). ¹³C NMR (100.6 MHz, DMSO-d₆) δ 193.5, 165.6,

160.4, 157.9, 149.4, 141.9, 135.6, 135.5, 135.1, 133.9, 131.4,

131.3, 131.0, 129.7, 129.5, 125.3, 116.9, 116.6, 34.2, 34.1, 33.4,

31.2, 31.1, 20.3. LC-APCI-MS (M þ H)þ calcd for C₂₃H₂₆O₃F

369.1866, found 369.1877. Anal. Calcd for C₂₃H₂₅O₃F: C 74.98;

H 6.84; F 5.16. Found: C 74.92; H 7.21; F 4.9.

1

38%) as a white solid, mp 130-132 °C. H NMR (400 MHz,

CDCl₃) δ 7.86 (t, J=8.0, 1H), 7.14 (d, J=8.2, 1H), 7.12 (d, J=

6.0, 1H), 7.02 (d, J=12.4, 1H), 5.82 (s, 1H), 5.36 (s, 1H), 3.93 (s,

3H), 1.95 (s, 3H), 1.70 (s, 4H), 1.31 (s, 6H), 1.27 (s, 6H). ¹³C

NMR (100.6 MHz, CDCl₃) δ 164.8, 164.7, 163.3, 160.7, 148.1,

147.8, 147.7, 144.6, 142.4, 137.2, 132.6, 132.0, 128.1, 128.0,

122.0, 117.7, 117.1, 117.0, 115.0, 114.8, 52.2, 35.2, 35.1, 33.9,

33.8, 31.9, 31.8, 19.8. LC-APCI-MS (M þ H)þ calcd for

C₂₅H₃₀O₂F 381.2230, found 381.2254.

2-Fluoro-4-(1-(1,2,3,4-tetrahydro-1,1,4,4,6-pentamethylnaph-

thalen-7-yl)vinyl)benzoic Acid (20). Compound 20 was synthe-

sized following the representative procedure for the synthesis of

compound 12. To a 100 mL round-bottom flask charged with 55

(0.25 g, 0.66 mmol) and methanol (5 mL) was added a 5 M

aqueous solution of potassium hydroxide (0.35 mL, 1.76 mmol).

A reflux condenser was fitted to the round-bottom flask, and the

reaction solution was refluxed and monitored by TLC. After 1 h

at reflux, the reaction solution was cooled to room temperature

and quenched with 20% HCl (42 mL). The aqueous solution was

extracted with ethyl acetate (50 mL, twice), and the organic

extracts were combined, washed with water and brine, dried

over sodium sulfate, and concentrated in vacuo to give crude 20.

Crude 20 was purified by column chromatography (25 mL SiO₂,

hexanes:ethyl acetate 9:1) to give 12 (0.24 g, 99%) as a white

crystalline solid, mp 212-214 °C. ¹H NMR (400 MHz, CDCl₃)

δ 11.12 (br s, 1H), 7.97 (t, J=7.9, 1H), 7.18 (d, J=8.3, 1H), 7.11

(s, 1H), 7.10 (s, 1H), 7.06 (d, J=12.3, 1H), 5.86 (s, 1H), 5.39 (s,

1H), 1.96 (s, 3H), 1.71 (s, 4H), 1.31 (s, 6H), 1.28 (s, 6H). ¹³C

NMR (100.6 MHz, CDCl₃) δ 169.5, 169.4, 164.0, 161.4, 149.0,

148.9, 148.0, 144.7, 142.5, 137.1, 132.7, 132.6, 128.1, 128.0,

122.2, 122.1, 118.1, 115.9, 115.8, 115.1, 114.9, 35.2, 35.1, 34.0,

33.8, 31.9, 31.8, 19.8. LC-APCI-MS (M þ H)þ calcd for

C₂₄H₂₈O₂F 367.2073, found 367.2097. Anal. Calcd for

C₂₄H₂₇O₂F: C 78.66; H 7.43; F 5.18. Found: C 78.45; H 7.45;

F 5.0.

2-Fluoro-4-(1-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydronaph-

thalen-2-yl)carbonyl)benzoic Acid (21). Compound 21 was syn-

thesized following the representative procedure for the synthesis

of compound 13. To a 100 mL round-bottom flask charged with

51 (0.5065 g, 1.34 mmol) and methanol (5 mL) was added a 5 M

aqueous solution of potassium hydroxide (0.73 mL, 3.66 mmol).

A reflux condenser was fitted to the round-bottom flask and the

reaction solution was refluxed and monitored by TLC. After 1 h

at reflux, the reaction solution was cooled to room temperature

and quenched with 20% HCl (20 mL). The aqueous solution was

extracted with ethyl acetate (25 mL, twice) and the organic

extracts were combined, washed with water and brine, dried

over sodium sulfate, and concentrated in vacuo to give crude 21.

Crude 21 was purified by column chromatography (25 mL SiO₂,

hexanes:ethyl acetate 9:1) to give 21 (0.477 g, 97%) as a white

crystalline solid, mp 174-175 °C. ¹H NMR (400 MHz, CDCl₃) δ

Methyl 2-Fluoro-4-(1-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahy-

dronaphthalen-2-yl)carbonyl)benzoate (51). Compound 51 was

synthesized following the representative procedure for the

synthesis of compound 29. Methyl 4-(chlorocarbonyl)-2-fluor-

obenzoate (47) was synthesized by refluxing 4-(methoxy-

carbonyl)-3-fluorobenzoic acid (46) (1.21 g, 6.11 mmol) in

thionyl chloride (12.0 mL, 165 mmol) in a 100 mL one-neck

round-bottom flask fitted with a water-cooled reflux condenser.

Excess thionyl chloride was removed in vacuo to give crude 47 as

an off-white solid, and this solid was dissolved in dry benzene

(ca. 20 mL) and evaporated to dryness three times to remove

residual thionyl chloride. The acid chloride 47 was dried on high

vacuum to remove residual benzene. To a two-neck, 50 mL

round-bottom flask equipped with a reflux condenser and

magnetic stir-bar was added 24 (1.34 g, 6.61 mmol), followed

by a solution of crude acid chloride 47 (6.11 mmol) in DCM

(15 mL). Aluminum chloride (2.0 g, 15 mmol) was added to the

reaction solution at room temperature slowly, with stirring, and

the reaction solution turned from colorless to red accompanied

by the evolution of gas and heat. The reaction was stirred for

5 min and then heated to reflux for 15 min. The reaction was

judged to be complete by TLC, and the solution was poured into

an ice solution (25 mL) acidified with a 20% HCl solution

(8 mL) and ethyl acetate was added (13 mL). The aqueous and

organic layers were separated, and the aqueous layer was

extracted with ethyl acetate (15 mL, twice). The combined

organics were washed with water and brine, dried over sodium

sulfate, filtered, and concentrated to give crude 51. Crude 51 was

purified by column chromatography (250 mL SiO₂, hexanes:

ethyl acetate 95:5 to 92.5:7.5) to give 51 (1.76 g, 75%) as a white,

crystalline solid, mp 105-106 °C. ¹H NMR (400 MHz, CDCl₃)

δ 8.00 (t, J=7.4, 1H), 7.59 (d, J=8.4, 1H), 7.56 (d, J=11.6, 1H),

7.24 (s, 1H), 7.21 (s, 1H), 3.96 (s, 3H), 2.34 (s, 3H), 1.69 (s, 4H),

1.31 (s, 6H), 1.20 (s, 6H). ¹³C NMR (100.6 MHz, CDCl₃)

δ 196.1, 164.3, 164.2, 162.8, 160.2, 148.8, 143.9, 143.8, 142.0,

134.7, 134.0, 132.1, 129.5, 128.4, 125.3, 125.2, 121.9, 121.8,

118.3, 118.1, 52.6, 34.8, 34.7, 34.3, 33.8, 31.6, 31.5, 20.0. LC-

APCI-MS (M þ H)þ calcd for C₂₄H₂₈O₃F 383.2023, found

383.2036.

Methyl 2-Fluoro-4-(1-(1,2,3,4-tetrahydro-1,1,4,4,6-pentamet-

hylnaphthalen-7-yl)vinyl)benzoate (55). Compound 55 was

Article

Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19 5965

11.00 (br s, 1H), 8.14 (t, J=7.5, 1H), 7.63 (d, J=9.1, 1H), 7.60 (d,

J=12.3, 1H), 7.27 (s, 1H), 7.22 (s, 1H), 2.36 (s, 3H), 1.70 (s, 4H),

1.32 (s, 6H), 1.22 (s, 6H). ¹³C NMR (100.6 MHz, CDCl₃) δ 196.1,

168.3, 168.7, 163.5, 160.9, 148.9, 144.9, 144.8, 142.1, 134.8, 133.8,

132.7, 129.6, 128.5, 125.3, 125.2, 120.7, 120.6, 118.5, 118.3,

34.8, 34.7, 34.4, 33.9, 31.6, 31.5, 20.0. LC-APCI-MS (M þ H)þ

calcd for C₂₃H₂₆O₃F 369.1866, found 369.1867. Anal. Calcd

for C₂₃H₂₅O₃F: C 74.98; H 6.84; F 5.16. Found: C 74.95; H

6.98; F 5.0.

(b) Dawson, M. I.; Jong, L.; Hobbs, P. D.; Cameron, J. F.; Chao, W.-R.;

Pfahl, M.; Lee, M.-O.; Shroot, B.; Pfahl, M. Conformational Effects on

Retinoid Receptor Selectivity. 2. Effects of Retinoid Bridging Group on

Retinoid X Receptor Activity and Selectivity. J. Med. Chem. 1995, 38,

3368–3383.

(11) Daiss, J. O.; Burschka, C.; Mills, J. S.; Montana, J. G.; Showell,

G. A.; Fleming, I.; Gaudon, C.; Ivanova, D.; Gronemeyer, H.;

Tacke, R. Synthesis, Crystal Structure Analysis, and Pharmacolo-

gical Characterization of Disila-bexarotene, a Disila-Analogue of

the RXR-Selective Retinoid Agonist Bexarotene. Organometallics

2005, 24, 3192–3199.

(12) Yen, W. -C.; Prudente, R. Y.; Lamph, W. W. Synergistic effect of a

Acknowledgment. We thank the Chemistry Division of

the National Science Foundation for financial support of

this work (grant CHE-0741978). Thanks is also given to

Dr. Natalya Zolotova of the High-Resolution Mass Spectro-

metry Lab at ASU Tempe. Belinda V. Miguel was supported

inpart by the NIH, in the formof a MARC grant, Tempe, AZ.

Julie K. Furmick wishes to thank ASU Tempe for a School of

Life Sciences Undergraduate Research (SOLUR) fellowship.

We also thank Z. Nevin Gerek and J. Spiriti for technical

assistance and the Fulton High Performance Computing

Initiative at Arizona State University for computer time.

pCMX-hRARR and pTK-RARE(2)-Luc were generous gifts

from Dr. Paul Thompson, School of Biomedical Sciences,

University of Ulster, Coleraine, UK.

retinoid X receptor-selective ligand bexarotene (LGD1069,

Targretin) and paclitaxel (Taxol) in mammary carcinoma. Breast

Cancer Res. Treat. 2004, 88, 141–148.

(13) Yen, W.-C.; Corpuz, M. R.; Prudente, R. Y.; Cooke, T. A.;

Bissonnette, R. P.; Negro-Vilar, A.; Lamph, W. W. A Selective

Retinoid X Receptor Agonist Bexarotene (Targretin) Prevents and

Overcomes Acquired Paclitaxel (Taxol) Resistance in Human

Non-Small Cell Lung Cancer. Clin. Cancer Res. 2004, 10, 8656–

8664.

(14) Cesario, R. M.; Stone, J.; Yen, W.-C.; Bissonnette, R. P.; Lamph,

W. W. Differentiation and growth inhibition mediated via the

RXR:PPAR_γheterodimer in colon cancer. Cancer Lett. 2006,

240, 225–233.

(15) Mukherjee, R.; Davies, P. J. A.; Crombie, D. L.; Bischoff, E. D.;

Cesario, R. M.; Jow, L.; Hamanns, L. G.; Boehm, M. F.; Mondon,

C. E.; Nadzan, A. M.; Paterniti, J. R.; Heyman, R. A. Sensitization

of diabetic and obese mice to insulin by retinoid X receptor

agonists. Nature 1997, 386, 407–410.

(16) Sherman, S. I.; Gopal, J.; Haugen, B. R.; Chiu, A. C.; Whaley, K.;

Nowlakha, P.; Duvic, M. Central hypothyroidism associated with

retinoid X receptor-selective ligands. N. Engl. J. Med. 1999, 340,

1075–1079.

(17) Li, D.; Li, T.; Wang, F.; Tian, H.; Samuels, H. H. Functional

Evidence for Retinoid X Receptor (RXR) as a Nonsilent Partner in

the Thyroid Hormone Receptor/RXR Heterodimer. Mol. Cell.

Biol. 2002, 22, 5782–5792.

Supporting Information Available: ¹H NMR and ¹³C NMR

spectra of all compounds reported in the Experimental Section

as well as X-ray data for compounds 12, 18, 20, 49, 50, and 51.

The X-ray data can be found at the Cambridge Crystallographic

Data Centre under the identification numbers: 738925-73830.

This material is available free of charge via the Internet at http://

pubs.acs.org.

(18) Qing, F.-L.; Fan, J. A Suzuki coupling approach to the trifluoro-

methyl derivative of Targretin (LGD 1069). Bioorg. Med. Chem.

Lett. 1997, 7, 2117–2120.

(19) Vuligonda, V.; Thacher, S. M.; Chandraratna, R. A. S. Enantio-

selective Synthesis of Potent Retinoid X Receptor Ligands: Differ-

ential Biological Activities of Individual Antipodes. J. Med. Chem.

2001, 44, 2298–2303.

(20) Farmer, L. J.; Marron, K. S.; Canan Koch, S. S.; Hwang, C. K.;

Kallel, E. A.; Zhi, L.; Nadzan, A. M.; Robertson, D. W.; Bennani,

Y. L. Aza-retinoids as novel retinoid X receptor-specific agonists.

Bioorg. Med. Chem. Lett. 2006, 16, 2352–2356.

References

(1) (a) Mangelsdorf, D. J.; Umesono, K.; Evans, R. M. The Retinoid

Receptors. In The Retinoids; Academic Press: Orlando, FL, 1994;

pp. 319-349. (b) Leid, M.; Kastner, P.; Chambon, P. Multiplicity

Generates Diversity in the Retinoic Acid Signaling Pathways. Trends

Biochem. Sci. 1992, 17, 427–433.

(2) Olefsky, J. M. Nuclear Receptor Minireview Series. J. Biol. Chem.

2001, 276 (40), 36863–36864.

(3) Forman, B. M.; Yang, C.-R.; Au, M.; Casanova, J.; Ghysdael,

J.; Samuels, H. H. A domain containing leucin-zipper-like

(21) Kagechika, H.; Kawachi, E.; Hashimoto, Y.; Himi, T.; Shudo, K.

Retinobenzoic Acids. 1. Structure-Activitiy Relationships of Aro-

matic Amides with Retinoidal Activity. J. Med. Chem. 1988, 31,

2182–2192.

(22) Winum, J.-Y.; Baghdiguian, S.; Commes, T.; Leydet, A.; Montero,

J.-L. Synthesis of New Targretin Analogues that Induce Apoptosis

in Leukemia HL-60 Cells. Bioorg. Med. Chem. Lett. 2002, 12, 3529–

3532.

motifs mediates novel in vitro interactions between the thyroid

hormone and retinoic acid receptors. Mol. Endocrinol. 1989, 3,

1610–1626.

(4) Mangelsdorf, D. J.; Evans, R. M. The RXR heterodimers and

orphan receptors. Cell 1995, 83, 841–850.

(5) Thompson, P. D.; Remus, L. S.; Hsieh, J.-C.; Jurutka, P. W.;

Whitfield, G. K.; Galligan, M. A.; Encinas Dominguez, C.; Hauss-

ler, C. A.; Haussler, M. R. Distinct retinoid X receptor activation

dunction-2 residues mediate transactivation in homodimeric and

vitamin D receptor heterodimeric contexts. J. Mol. Endocrinol.

2001, 27 (2), 211–227.

(6) Nahoum, V.; Perez, E.; Germain, P.; Rodriquez-Barrios, F.;

Manzo, F.; Kammerer, S.; Lemaire, G.; Hirsch, O.; Royer, C. A.;

Gronemeyer, H.; de Lera, A. R.; Bourguet, W. Modulators of the

structural dynamics of the retinoid X receptor to reveal receptor

function. Proc. Natl. Acad. Sci. U.S.A. 2007, 104, 17323–17328.

(7) Altucci, L.; Leibowitz, M. D.; Ogilvie, K. M.; de Lera, A. R.;

Gronemeyer, H. RAR and RXR modulation in cancer and meta-

bolic disease. Nature Rev. Drug Discovery 2007, 6, 793–810.

(8) Lehmann, J. M.; Jong, L.; Fanjul, A.; Cameron, J. F.; Lu, X.-P.;

Haefner, P.; Dawson, M. I.; Pfahl, M. Retinoids selective for

retinoid X receptor pathways. Science 1992, 258, 1944–1946.

(9) Boehm, M. F.; Zhang, L.; Badea, B. A.; White, S. K.; Mais, D. E.;

Berger, E.; Suto, C. M.; Goldman, M. E.; Heyman, R. A. Synthesis

(23) Boehm, M. F.; Zhang, L.; Zhi, L.; McClurg, M. R.; Berger, E.;

Wagoner, M.; Mais, D. E.; Suto, C. M.; Davies, P. J. A.; Heyman,

R. A.; Nadzan, A. M. Design and Synthesis of Potent Retinoid X

Recptor Selective Ligands That Induce Apoptosis in Leukemia

Cells. J. Med. Chem. 1995, 38, 3146–3155.

(24) Faul, M. M.; Ratz, A. M.; Sullivan, K. A.; Trankle, W. G.;

Winneroski, L. L. Synthesis of Novel Retinoid X Receptor-Selec-

tive Retinoids. J. Org. Chem. 2001, 66, 5772–5782.

(25) Michellys, P. Y.; Ardecky, R. J.; Chen, J. H.; Crombie, D. L.;

Etgen, G. J.; Faul, M. M.; Faulkner, A. L.; Grese, T. A.; Heyman,

R. A.; Karanewsky, D. S.; Klausing, K.; Leibowitz, M. D.; Liu, S.;

Mais, D. A.; Mapes, C. M.; Marschke, K. B.; Reifel-Miller, A.;

Ogilvie, K. M.; Rungta, D.; Thompson, A. W.; Tyhonas, J. S.;

Boehm, M. F. Novel (2E,4E,6Z)-7-(2-Alkoxy-3,5-dialkylbenzene)-

3-methylocta-2,4,6-trienoic Acid Retinoid X Receptor Modulators

are Active in Models of Type 2 Diabetes. J. Med. Chem. 2003, 46,

2683–2696.

(26) Michellys, P.-Y.; Ardecky, R. J.; Chen, J.-H.; D’Arrigo, J.; Grese,

T. A.; Karanewsky, D. S.; Leibowitz, M. D.; Liu, S.; Mais, D. A.;

Mapes, C. M.; Montrose-Rafizadeh, C.; Ogilvie, K. M.; Reifel-

Miller, A.; Rungta, D.; Thompson, A. W.; Tyhonas, J. S.; Boehm,

M. F. Design, Synthesis, and Structure-Activity Relationship

Studies of Novel 6,7-Locked-[7-(2-alkoxy-3,5-dialkylbenzene)-3-

methylocta]-2,4,6-trienoic Acids. J. Med. Chem. 2003, 46, 4087–

4103.

and Structure-Activity Relationships of Novel Retinoid

X

Receptor-Selective Retinoids. J. Med. Chem. 1994, 37, 2930–2941.

(10) (a) Jong, L.; Lehmann, J. M.; Hobbs, P. D.; Harlev, E.; Huffman,

J. C.; Pfahl, M.; Dawson, M. I. Conformational effects on retinoid

receptor selectivity. 1. Effect of 9-double bond geometry on

retinoid X receptor activity. J. Med. Chem. 1993, 36, 2605–2613.

5966 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 19

Wagner et al.

(27) Michellys, P.-Y.; Darrigo, J.; Grese, T. A.; Karanewsky, D. S.;

Leibowitz, M. D.; Mais, D. A.; Mapes, C. M.; Reifel-Miller, A.;

Rungta, D.; Boehm, M. F. Design, synthesis and structure-activ-

ity relationship of novel RXR-selective modulators. Bioorg. Med.

Chem. Lett. 2004, 14, 1593–1598.

(28) (a) Gernert, D. L.; Ajamie, R.; Ardecky, R. A.; Bell, M. G.;

Leibowitz, M. D.; Mais, D. A.; Mapes, C. M.; Michellys, P. Y.;

Rungta, D.; Reifel-Miller, A.; Tyhonas, J. S.; Yumibe, N.; Grese,

T. A. Design and Synthesis of Fluorinated RXR Modulators.

Bioog. Med. Chem. Lett. 2003, 13, 3191–3195. (b) Michellys, P.-Y.;

Boehm, M. F.; Chen, J.-H.; Grese, T. A.; Karanewsky, D. S.; Leibowitz,

M. D.; Liu, S.; Mais, D. A.; Mapes, C. M.; Reifel-Miller, A.; Ogilvie, K.

M.; Rungta, D.; Thompson, A. W.; Tyhonas, J. S.; Yumbie, N.; Ardecky,

R. J. Design and Synthesis of Novel RXR-Selective Modulators with

Improved Pharmacological Profile. Biorg. Med. Chem. Lett. 2003, 13,

4070–4075.

and antiobesity agents. Bioorg. Med. Chem. Lett. 2007, 17, 4804–

4807.

(33) Koch, S. S. C.; Dardashti, L. J.; Hebert, J. J.; White, S. K.; Croston,

G. E.; Flatten, K. S.; Heyman, R. A.; Nadzan, A. M. Identification

of the First Retinoid X Receptor Homodimer Antagonist. J. Med.

Chem. 1996, 39, 3229–3234.

(34) Zhang, C.; Hazarika, P.; Ni, X.; Weidner, D. A.; Duvic, M.

Induction of Apoptosis by Bexarotene in Cutaneous T-Cell Lym-

phoma Cells. Clin. Cancer Res. 2002, 8, 1234–1240.

(35) Budihardjo, I.; Holt, O.; Lutter, M.; Luo, X.; Wang, X. Biochem-

ical Pathways of Caspase Activation During Apoptosis. Ann. Rev.

Cell Dev. Biol. 1999, 15, 269–290.

(36) Yen, W.-C.; Prudente, R. Y.; Corpuz, M. R.; Negro-Villar, A.;

Lamph, W. W. A selective retinoid X receptor agonist bexarotene

(LGD1069, targretin) inhibits angiogenesis and metastasis in solid

tumours. Br. J. Cancer 2006, 94, 654–660.

(29) Lehmann, J. M.; Jong, L.; Fanjul, A.; Cameron, J. F.; Lu, X. P.;

Haefner, P.; Dawson, M. I.; Pfahl, M. Retinoids Selective for

Retinoid X Receptor Response Pathways. Science 1992, 258,

1944–1946.

(30) Dimick, S. M.; Powell, S. C.; McMahon, S. A.; Moothoo, D. N.;

Naismith, J. H.; Toone, E. J. On the Meaning of Affinity: Cluster

Glycoside Effects and Concanavalin A. J. Am. Chem. Soc. 1999,

121, 10286–10296.

(31) Keenan, R. M.; Callahan, J. F.; Samanen, J. M.; Bondinell, W. E.;

Calvo, R. R.; Chen, L.; DeBrosse, C.; Egglesont, D. S.; Haltiwanger,

R. C.; Hwang, S. M.; Jakas, D. R.; Ku, T. W.; Miller, W. H.;

Newlander, K. A.; Nichols, A.; Parker, M. F.; Southhall, L. S.;

Uzinskas, I.; Vasko-Moser, J. A.; Venslavsky, J. W.; Wong, A. S.;

Huffman, W. F. Conformational Preferences in a Benzodiazepine

Series of Potent Nonpeptide Fibrogen Receptor Antagonists.

J. Med. Chem. 1999, 42, 545–559.

(32) Sakaki, J.; Kishida, M.; Konishi, K.; Gunji, H.; Toyao, A.;

Matsumoto, Y.; Kanazawa, T.; Uchiyama, H.; Fukaya, H.;

Mitani, H.; Arai, Y.; Kimura, M. Synthesis and structure-activity

relationship of novel RXR antagonists: orally active antidiabetic

(37) (a) Zimmerman, F. K. Procedures used in the induction of mitotic

recombination and mutation in the yeast Saccharomyces cerevisiae.

Mutat. Res. 1975, 31, 71–86. (b) Zimmermann, F. K.; Kern, R.;

Rasenberger, H. A yeast strain for simultaneous detection of mitotic

crossing over, mitotic gene conversion, and reverse mutation. Mutat.

Res. 1975, 28, 381–388.

(38) Marshall, P. A. Using Saccharomyces cerevisiae to Test the Muta-

genicity of Household Compounds: An Open Ended Hyothesis-

Driven Teaching Lab. CBE-LSE 2007, 6, 307–315.

(39) Egea, P. F.; Mitschler, A.; Moras, D. Molecular Recognition of

Agonist Ligands by RXRs. Mol. Endocrinol. 2002, 16, 987–997.

(40) Forman, B. M.; Umesono, K.; Chen, J.; Evans, R. M. Unique

response pathways are established by allosteric interactions among

nuclear hormone receptors. Cell 1995, 81, 541–550.

(41) Pangborn, A. B.; Giardello, M. A.; Grubbs, R. H.; Rosen, R. K.;

Timmers, F. J. Safe and Convenient Procedure for Solvent Puri-

fication. Organometallics 1996, 15, 1518–1520.

(42) Condon, F. E. Aluminum Chloride-Catalyzed Formation of 2,5-

Dichloro-2,5-dimethylhexane from tert-Butyl Chloride. J. Org.

Chem. 1956, 21, 761–763.

Article Doi

Modeling, synthesis and biological evaluation of potential Retinoid X Receptor (RXR) selective agonists: Novel analogues of 4-[1-(3,5,5,8,8- pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)ethynyl]benzoic acid (bexarotene)

DOI: 10.1021/jm900496b

Source and publish data:

Authors:

Article abstract of DOI:10.1021/jm900496b

Full text of DOI:10.1021/jm900496b

Products guided by the article

R&D Labs maybe for 1190848-42-0

Relevant to this article

Hot Product