Discovery of an l-fucono-1,5-lactonase from cog3618 of the amidohydrolase superfamily

Article

pubs.acs.org/biochemistry

Discovery of an L‑Fucono-1,5-lactonase from cog3618 of the

Amidohydrolase Superfamily

Merlin Eric Hobbs,^†Matthew Vetting,^§Howard J. Williams,^‡Tamari Narindoshvili,^‡

Devon M. Kebodeaux,^‡Brandan Hillerich,^§Ronald D. Seidel,^§Steven C. Almo,*^,§

and Frank M. Raushel*^,†,‡

^†Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas 77843, United States

^‡Department of Chemistry, Texas A&M University, College Station, Texas 77843, United States

^§Department of Biochemistry, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, New York 10461, United States

S

* Supporting Information

ABSTRACT: A member of the amidohydrolase superfamily,

BmulJ_04915 from Burkholderia multivorans, of unknown

function was determined to hydrolyze a series of sugar

lactones: ^L-fucono-1,4-lactone, D-arabino-1,4-lactone, L-xylono-

1,4-lactone, ^D-lyxono-1,4-lactone, and L-galactono-1,4-lactone.

The highest activity was shown for ^L-fucono-1,4-lactone with a

k

_catvalue of 140 s⁻¹and a k_cat/K_mvalue of 1.0 × 10⁵M⁻¹s⁻¹at

pH 8.3. The enzymatic product of an adjacent ^L-fucose

dehydrogenase, BmulJ_04919, was shown to be ^L-fucono-1,5-

lactone via nuclear magnetic resonance spectroscopy. ^L-

Fucono-1,5-lactone is unstable and rapidly converts non-

enzymatically to ^L-fucono-1,4-lactone. Because of the chemical

instability of ^L-fucono-1,5-lactone, 4-deoxy-L-fucono-1,5-lac-

tone was enzymatically synthesized from 4-deoxy-^L-fucose using L-fucose dehydrogenase. BmulJ_04915 hydrolyzed 4-deoxy-L-

fucono-1,5-lactone with a k_catvalue of 990 s⁻¹and a k_cat/K_mvalue of 8.0 × 10⁶M⁻¹s⁻¹at pH 7.1. The protein does not require

divalent cations in the active site for catalytic activity. BmulJ_04915 is the second enzyme from cog3618 of the amidohydrolase

superfamily that does not require a divalent metal for catalytic activity. BmulJ_04915 is the ﬁrst enzyme that has been shown to

catalyze the hydrolysis of either ^L-fucono-1,4-lactone or L-fucono-1,5-lactone. The structures of the fuconolactonase and the

fucose dehydrogenase were determined by X-ray diﬀraction methods.

Bamb_1224 from Burkholderia ambifaria AMMD and

Patl_0798 from Pseudoalteromonas atlantica T6c, were also

functionally annotated. These enzymes are members of the

amidohydrolase superfamily (AHS) of enzymes from cog3618.

Enzymes from this superfamily catalyze a diverse set of

reactions, including the hydrolysis of amide or ester bonds,

deamination, decarboxylation, isomerization, and hydration.⁵

The structural hallmark for members of this superfamily is a

distorted (β/α)₈barrel, which binds zero to three divalent

metal ions within the active site.⁵The AHS has been separated

into 24 clusters of orthologous groups (COG) by NCBI.⁶

The functionally characterized enzymes from cog3618

include 2-pyrone-4,6-dicarboxylate lactonase (LigI), 4-sulfomu-

L-Fucose is a widely distributed monosaccharide throughout the

biosphere having functions in both plant and mammalian

glycoconjugates.^1,2These glycoconjugates include the ABO

blood group antigens in mammals, ^L-fucose binding lectins,

glycolipids, and ^L-fucopyranosyl moieties in cell walls.¹L-Fucose

can function as the sole carbon source for many microbes and

has been shown to be metabolized via two separate pathways as

illustrated in Figure 1.²⁻⁴In the ﬁrst pathway, L-fucose is

isomerized to ^L-fuculose and then phosphorylated to L-fuculose

1-phosphate. It is subsequently cleaved to ^L-lactaldehyde and

dihydroxyacetone phosphate.³In an alternative pathway, L-

fucose is oxidized to ^L-fuconolactone and then hydrolyzed to L-

fuconate. This product is subsequently dehydrated to 2-keto-3-

deoxy-^L-fuconate and then oxidized to 2,4-diketo-3-deoxy-L-

fuconate. This compound is then hydrolyzed to pyruvate and ^L-

lactate.²In the latter pathway, the enzymes that hydrolyze L-

fuconolactone and 2,4-diketo-3-deoxy-^L-fuconate have not been

characterized.

conolactonase (4-SML), and ^L-rhamnono-1,4-lactonase.⁷⁻⁹

A

sequence similarity network for cog3618 at an E value cutoﬀ of

10⁻³⁰is presented in Figure 2A.¹⁰In this ﬁgure, each node in

the network represents a protein and is connected to other

We have determined the three-dimensional structure and

functionally annotated BmulJ_04915 from Burkholderia multi-

vorans ATCC 17616. Two homologues of this enzyme,

Received: November 19, 2012

Revised: December 6, 2012

Published: December 10, 2012

239

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

Figure 1. Metabolism of L-fucose. Pathway I produces dihydroxyacetone phosphate and L-lactaldehyde. Pathway II produces pyruvate and L-lactate

through the oxidation of ^L-fucose to L-fucono-1,5-lactone.

proteins by edges when the BLAST E values are smaller than

10⁻³⁰. At this stringency, the proteins within cog3618 split into

two large groups that are arbitrarily designated here as Class I

and Class II. When a more stringent E value of 10⁻⁷⁰is applied

to the sequence similarity network, the proteins organize into

smaller groups (Figure 2B), which, because of their higher level

of sequence similarity, may be isofunctional. In Figure 2, the

groups are assigned an arbitrary numerical identiﬁer (i.e., 1, 2,

3, etc.). ^L-Rhamnono-1,4-lactonase and BmulJ_04915 map to

Class I, while LigI and 4-SML map to Class II. Genomic

context analysis of the enzymes within Class I identiﬁes many

proteins of unknown function that are physically located near

other genes that have been previously annotated as ABC-type

carbohydrate transport systems, dehydrogenases, dehydratases,

and hydrolases. Therefore, many of the proteins of unknown

function within Class I are likely involved in carbohydrate

metabolism and are thus predicted to hydrolyze sugar lactones.

BmulJ_04915 is predicted to hydrolyze sugar lactones based

on genomic context (Figure 3). The protein, BmulJ_04922,

from cog1028 is 64% similar in amino acid sequence to 2-keto-

3-deoxy-^L-fuconate dehydrogenase (XCC4067) from Xantho-

monas campestris. BmulJ_04920 is 60% similar in protein

sequence to the known ^L-fuconate dehydratase from cog4948

(XCC4069).^11,33However, BmulJ_04919 from cog1028 is not

related to XCC4067, an enzyme that is known to catalyze the

oxidation of ^L-fucose. The closest experimentally annotated

homologue to BmulJ_04919 is ^L-rhamnose dehydrogenase

(SKA58_03570) from Sphingomonas sp. SKA58.⁹In this paper,

we have determined the three-dimensional structures of

BmulJ_04915 and BmulJ_04919 and have shown that

BmulJ_04919 catalyzes the oxidation of ^L-fucose to L-fucono-

1,5-lactone and that BmulJ_04915 and two homologues

(Bamb_1224 and Patl_0789) catalyze the hydrolysis of this

product to ^L-fuconate.

published procedures with the exception of 4-deoxy-^L-fucono-

1,5-lactone, which was enzymatically synthesized.¹²The

noncommercial lactones included the following: ^L-fucono-1,4-

lactone (1), ^D-altrono-1,4-lactone (3), D-arabinono-1,4-lactone

(6), ^L-xylono-1,4-lactone (7), L-mannono-1,4-lactone (11), D-

talono-1,4-lactone (12), ^D-allono-1,4-lactone (13), L-rhamno-

no-1,4-lactone (14), ^D-lyxono-1,4-lactone (15), L-lyxono-1,4-

lactone (16), ^L-arabinono-1,4-lactone (17), D-xylono-1,4-

lactone (19), ^L-mannono-1,5-lactone (22), L-rhamnono-1,5-

lactone (23), and 4-deoxy-^L-fucono-1,5-lactone (24). Those

sugar lactones that were available commercially included the

following: ^L-galactono-1,4-lactone (2), L-glucono-1,4-lactone

(4), ^D-idono-1,4-lactone (5), D-mannono-1,4-lactone (8), D-

glucono-1,4-lactone (9), ^D-galactono-1,4-lactone (10), D-

ribono-1,4-lactone (18), ^D-glucurono-6,3-lactone (20), and D-

erythronolactone (21). These compounds were obtained from

CarboSynth or ChromaDex. The structures of these lactones

are presented in Scheme 1. The aldose sugars were obtained

from either from Sigma Aldrich or Carbosynth, and the

structures are presented in Scheme 2. These sugars included ^L-

fucose (25), ^L-galactose (26), L-glucose (27), D-altrose (28), D-

arabinose (29), ^L-xylose (30), L-rhamnose (31), D-mannose

(32), ^L-allose (33), D-talose (34), L-talose (35), D-allose (36),

D-galactose (37), L-mannose (38), D-gulose (39), D-glucose

(40), ^L-arabinose (41), L-ribose (42), D-lyxose (43), L-lyxose

(44), ^D-xylose (45), D-ribose (46), and 4-deoxy-L-fucose (47).

Cloning, Expression, and Puriﬁcation of BmulJ_04915

from B. multivorans ATCC 17616 and Patl_0798 from P.

atlantica T6c. The gene for BmulJ_04915 (gi|161520151) was

ampliﬁed from B. multivorans ATCC 17616 genomic DNA

using 5′-TTAAGAAGGAGATATACCATGGGTGCCCTGC-

GTATTGACTCAC-3′ as the forward primer and 5′-GATT-

GGAAGTAGAGGTTCTCTGCCAGACGAGCATCAGCCG-

GTTC-3′ as the reverse primer. The gene Patl_0798 (gi|

109897125) was ampliﬁed from P. atlantica strain T6c genomic

DNA using 5′-TTAAGAAGGAGATATACCATGGTGATGA-

GAATTGATGCACACCAACATT-3′ as the forward primer

and 5′-GATTGGAAGTAGAGGTTCTCTGCCAATCGGTA-

GAATCGTTCGGC-3′ as the reverse primer. Polymerase

MATERIALS AND METHODS

■

Materials. All chemicals and buﬀers were purchased from

Sigma Aldrich unless otherwise speciﬁed. Sugar lactones that

were not commercially available were synthesized according to

240

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

Figure 2. (A) cog3618 sequence similarity networks at an E value of 10⁻³⁰where each node represents a protein and an edge represents an E value

between two proteins of ≤10⁻³⁰. (B) cog3618 sequence similarity networks at an E value of 10⁻⁷⁰where each node represents a protein and an edge

represents an E value between two proteins of ≤10⁻⁷⁰. The nodes are color-coded as follows: yellow nodes for predicted L-fucono-1,5-lactonase, blue

square for BmulJ_04915, blue circle for Bamb_1224, blue triangle for Patl_0798, orange node for ^L-rhamnono-1,4-lactonase, red node for LigI, and

green node for Protein Data Bank entry 4SML.

chain reaction (PCR) was performed using KOD Hot Start

DNA Polymerase (Novagen). The conditions were as follows:

2 min at 95 °C, followed by 40 cycles of 30 s at 95 °C, 30 s at

66 °C, and 30 s at 72 °C. The ampliﬁed fragments were cloned

into the C-terminal TEV cleavable StrepII-6x-His-tag contain-

ing vector, CHS30, by ligation-independent cloning.¹³

All puriﬁcation steps were performed at 4 °C, and all growth

media contained 100 μg/mL kanamycin and 35 μg/mL

chloramphenicol. The plasmid was transformed into Rosetta2-

(DE3)pLysS cells (Novagen) and plated on LB agar plates.

Five to ten colonies were used to inoculate 100 mL of LB

medium and allowed to grow overnight at 37 °C (250 rpm

agitation). The overnight cultures were used to inoculate 4 L of

autoinduction medium in ten 2 L ﬂasks and incubated (250

rpm agitation) at 25 °C for 24 h until the OD₆₀₀reached 20−

25.^14,15Cells were harvested by centrifugation and stored at

−80 °C. Cells were resuspended (4:1, v/w) in buﬀer A [50 mM

HEPES (pH 7.8), 150 mM NaCl, 10% glycerol, and 20 mM

imidazole] with 0.1% Tween 20 and then disrupted by

sonication. The cellular extract was clariﬁed by centrifugation

at 4 °C and applied to a 10 mL Ni-Sepharose HP (GE

Healthcare) column. The column was washed with 10 column

241

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

Figure 3. Genomic neighborhood of BmulJ_04915. Genes are color-coded as follows: red for those cloned and puriﬁed for this study, blue for those

predicted from strong sequence similarity to genes encoding proteins of known function, yellow for those predicted genes based on genomic context,

and gray for those predicted to function in carbohydrate transport.

Scheme 1

volumes of buﬀer A, and proteins were step eluted with 300

mM imidazole in buﬀer A. TEV protease¹⁶was added at a ratio

of 1:50 (w/w) to the pooled fractions that were subsequently

dialyzed overnight against buﬀer A with 300 mM imidazole.

The pooled eluate was then concentrated to 15−30 mg/mL

and applied to a 16/60 Superdex 200 column (GE Healthcare)

equilibrated against buﬀer B [20 mM HEPES (pH 7.8), 150

mM NaCl, and 5% glycerol]. Fractions that were >95% pure as

determined by sodium dodecyl sulfate−polyacrylamide gel

electrophoresis were passed through a 5 mL Ni-Sepharose HP

(GE Healthcare) column to remove uncut protein and TEV

protease. Protein not retained by the column was concentrated

to 15−30 mg/mL by centrifugal ultraﬁltration. Aliquots were

snap-frozen in liquid nitrogen and stored at −80 °C.

Cloning, Expression, and Puriﬁcation of Bamb_1224

from B. ambifaria AMMD. The gene for Bamb_1224 was

cloned from B. ambifaria AMMD (gi|115351277) with the

primer pair of 5′-GCAGGACCATATGACGTTCCGCATCG-

ACGCTCATCAA-3′ and 5′-GCAGGACAAGCTTTTGAGC-

GTGTTGATCGCCGGACGGCCGA-3′. Restriction sites for

NdeI and HindIII were inserted into the forward and reverse

primers, respectively. The PCR product was puriﬁed with a

242

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

Scheme 2

PCR cleanup system (Promega), doubly digested with NdeI

and HindIII, and then ligated into a pET-30a(+) vector

(Novagen) previously digested with NdeI and HindIII. The

recombinant plasmid harboring this gene was transformed into

BL21(DE3) cells (Novagen) via electroporation.

HEPES (pH 7.4), 0.5 M NaCl, and 500 mM imidazole over a

gradient of 25 column volumes.

Cloning, Expression, and Puriﬁcation of BmulJ_04919

from B. multivorans ATCC 17616. The gene for

BmulJ_04919 was cloned from B. multivorans ATCC 17616

(gi|189353674) with the primer pair of 5′-GCAGGAGCCAT-

ATGGATCTGAATCTGCAGGACAAGGTCGT3′ and 5′-

GCAGGAGCAAGCTTTCAGACGAGCGCACGATCGAGA-

TGCGTAT-3′. Restriction sites for NdeI and HindIII were

inserted into the forward and reverse primers, respectively. The

PCR product was puriﬁed with a PCR cleanup system

(Promega), doubly digested with NdeI and HindIII, and then

ligated into a pET-30a(+) vector (Novagen) previously

digested with NdeI and HindIII. The recombinant plasmid

harboring this gene was transformed into BL21(DE3) cells

(Novagen) via electroporation.

A single colony was used to inoculate 5 mL cultures

containing LB and 50 μg/mL kanamycin, and the cultures were

allowed to grow overnight at 37 °C. The overnight cultures

were used to inoculate 1 L of LB medium supplemented with

50 μg/mL kanamycin. These cultures were incubated until the

OD₆₀₀reached 0.4−0.6, and then 1.0 mM IPTG was added to

induce gene expression at ambient temperature (25 °C) for an

additional 18 h. Cells were harvested by centrifugation at 4 °C

and then resuspended in 20 mM HEPES (pH 7.5).

A single colony was used to inoculate 5 mL cultures

containing LB and 50 μg/mL kanamycin and allowed to grow

overnight at 37 °C. The overnight cultures were used to

inoculate 1 L of LB medium supplemented with 50 μg/mL

kanamycin. These cultures were incubated until the OD₆₀₀

reached 0.4−0.6, and then 1.0 mM isopropyl β-thiogalactoside

(IPTG) was added to induce gene expression at ambient

temperature (25 °C) for an additional 18 h. Cells were

harvested by centrifugation at 4 °C and then resuspended in 20

mM HEPES (pH 7.5). Approximately 0.1 mg/mL phenyl-

methanesulfonyl ﬂuoride (PMSF) was added to the cell

suspension, and then the cells were lysed via multiple rounds

of sonication in 50 mM HEPES (pH 7.4), 0.5 M NaCl, and 40

mM imidazole. Nucleic acids were removed from the

supernatant solution by the addition of a 2% (w/v) protamine

sulfate solution over the course of 30 min at 4 °C. The

protamine sulfate-bound DNA was removed by centrifugation

at 4 °C, and the supernatant was collected and applied to a 5

mL HisTrap HP (GE Healthcare) nickel aﬃnity column.

Protein was eluted from the nickel aﬃnity column with 50 mM

243

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

Approximately 0.1 mg/mL PMSF was added to the cell

suspension, and then the cells were lysed via multiple rounds of

sonication. Nucleic acids were removed from the supernatant

solution by the addition of a 2% (w/v) protamine sulfate

solution over the course of 30 min at 0 °C. The protamine

sulfate-bound DNA was removed by centrifugation at 4 °C.

Solid ammonium sulfate was added to 50% of saturation and

the precipitated protein isolated by centrifugation. The protein

was resuspended in a minimal amount of 20 mM HEPES (pH

7.5) and then applied to a High Load 26/60 Superdex 200 gel

ﬁlitration column (GE Healthcare). Fractions containing the

protein of expected size were pooled and puriﬁed further by ion

exchange chromatography with a ResourceQ column (6 mL) at

pH 7.5.

Initial phases for unliganded BmulJ_04919 were determined by

MR using MOLREP and a tetrameric search model (PDB entry

3FTP).²²A BmulJ_04919 homology model, constructed

utilizing the SWISSPDB homology modeling server, was

subsequently placed according to the MOLREP MR solution.²³

This model was subjected to simulated annealing using torsion

angle dynamics within PHENIX, generating an initial model

with R and R_freevalues of 39.2 and 42.5%, respectively. The

structure of the NADP−^L-fucose−BmulJ_04919 ternary

complex was determined using a single subunit of the

unliganded complex. Iterative cycles of reﬁnement in PHENIX

and model building in COOT were utilized to obtain the ﬁnal

crystallographic structures.²⁴Ligand geometry restraints were

built using ELBOW within PHENIX.

Measurement of Enzyme Activity. The enzymatic

hydrolysis of lactones was monitored with a SpectraMax340

UV−visible spectrophotometer using a colorimetric pH

indicator assay at 30 °C. Protons released from the carboxylate

product during lactone hydrolysis were measured using the pH

indicator cresol purple or bromothymol blue.²⁵Reaction

mixtures measured with cresol purple contained 2.5 mM

BICINE buﬀer (pH 8.3), 0.2 M NaCl, 0−1.0 mM lactone, 0.1

mM cresol purple, and the lactonase. Reaction mixtures

measured with bromothymol blue contained 2.5 mM MOPS

buﬀer (pH 7.1), 0.2 M NaCl, 0−0.5 mM lactone, and 0.1 mM

bromothymol blue. The ﬁnal concentration of DMSO was 1%.

Changes in absorbance at 577 nm (ε = 1764 M⁻¹cm⁻¹) and

616 nm (ε = 1135 M⁻¹cm⁻¹) were monitored in 96-well plates

for cresol purple and bromothymol blue, respectively. Back-

ground rates arising from acidiﬁcation by atmospheric CO₂

were observed and subtracted from the initial rates. The

dehydrogenase activity catalyzed was monitored with a

SpectraMax340 UV−visible spectrophotometer by measuring

the reduction of NADP⁺or NAD⁺at 340 nm (ε = 6220 M⁻¹

cm⁻¹) at 30 °C. The assays were performed in 50 mM BICINE

buﬀer (pH 8.0), varying concentrations of sugar substrates, and

0.5 mM NADP⁺. Kinetic constants for NADP⁺and NAD⁺were

determined in the same manner as described above except that

the assay conditions were as follows: 50 mM BICINE buﬀer

(pH 8.0), varying concentrations of nucleotide, and 200 μM ^L-

fucose.

Crystallization and Data Collection for BmulJ_04915

and BmulJ_04919. All crystallization experiments were

conducted by the sitting drop vapor diﬀusion method at 18

°C in 96-well Intelliplates (Art Robbins Instruments). Equal

volumes of crystallization reagent and protein (0.5 μL each)

were mixed and equilibrated against 70 μL of the crystallization

agent in the reservoir. Crystals of BmulJ_04915 [30 mg/mL in

20 mM HEPES (pH 7.8), 150 mM NaCl, 5% glycerol, 0.5 mM

ZnCl₂, and 9 mM TCEP] were obtained with 20% (w/v) PEG

3350 and 100 mM HEPES (pH 7.5). Hexagonal rods (0.2 mm

× 0.05 mm × 0.05 mm) grew sporadically over 1−2 months.

Crystals were soaked in mother liquor supplemented with 20%

(v/v) glycerol for 10 s prior to being ﬂash-cooled in liquid

nitrogen. Crystals of unliganded BmulJ_04919 [14.5 mg/mL in

50 mM Tris (pH 7.5)] were obtained with 0.2 M calcium

acetate, 10% (w/v) PEG 8000, and 0.1 M HEPES (pH 7.5).

Triganol bipyramids appeared in 1−2 days and grew to the

maximal size in a week (0.2 mm × 0.1 mm × 0.1 mm). Crystals

were soaked in mother liquor supplemented with 20% ethylene

glycol for 10 s prior to being ﬂash-cooled in liquid nitrogen.

Crystals of the BmulJ_04919 [14.5 mg/mL in 50 mM Tris (pH

7.5), 5 mM NADP⁺, and 25 mM L-fucose] ternary complex

were obtained in 0.2 M MgCl₂, 20% (w/v) PEG 8000, and 0.1

M Tris (pH 8.5). Crystals of the ternary complex formed as

small (0.05 mm × 0.025 mm × 0.025 mm) misshapen plates

that grew at the periphery of the drop over 1−2 weeks. Crystals

were soaked in mother liquor supplemented with 5 mM

NADP⁺, 25 mM L-fucose, and 20% (v/v) ethylene glycol for 2

min prior to being ﬂash-cooled in liquid nitrogen. All X-ray

diﬀraction data were collected at 100 K using synchrotron

radiation (λ = 0.98), and intensities were integrated with

MOSFLM and scaled with SCALA [Protein Data Bank (PDB)

entries 4DNM and 4GKB] or HKL3000 (PDB entry

4GVX).¹⁷⁻¹⁹Data for BmulJ_04915 were collected on a

Quantum 315 CCD detector (Area Detector Systems Corp.) at

NSLS beamline X29A (National Synchrotron Light Source,

Brookhaven National Laboratory, Upton, NY). Data for

BmulJ_04919 were collected on a Rayonix 225-HE detector

(Rayonix) at APS beamline 31-ID (Advanced Photon Source,

Argonne National Laboratory, Argonne, IL).

Data Analysis. The kinetic constants were determined from

a ﬁt of the initial velocity data to eq 1 using the nonlinear least-

squares ﬁtting program in SigmaPlot 9.0

ν/E_t= (k_cat[A])/(K_m+ [A])

(1)

where v is the initial velocity, E_tis the total enzyme

concentration, k_catis the turnover number, [A] is the substrate

concentration, and K_mis the Michaelis constant.

Metal Analysis. The metal content of BmulJ_04915 was

determined with an Elan DRC II ICP-MS instrument as

previously described.²⁶Protein samples for ICP-MS analysis

were digested with HNO₃and then reﬂuxed for 30 min.²⁷All

buﬀers were passed through a column of Chelex 100 (Bio-Rad)

to remove trace metal contamination. EDTA and 1,10-

phenanthroline (1.0 mM) were incubated with 1.0 μM

BmulJ_04915 in 50 mM buﬀer at pH values ranging from 6

to 10 to remove divalent metal ions. The buﬀers for these

experiments included CHES (pH 6.0), HEPES (pH 7.0),

BICINE (pH 8.0), and CHES (pH 9.0 and 10.0). The eﬀect of

added divalent cations on the catalytic activity of BmulJ_04915

was determined by adding Mn²⁺, Zn²⁺, Co²⁺, Cu²⁺, or Ni²⁺(0−

500 μM) directly to the assay mixtures. The puriﬁed enzyme

Determination of the Structure of BmulJ_04915 and

BmulJ_04919. Initial phases for BmulJ_04915 were deter-

mined by molecular replacement (MR) using PHENIX/

PHASER and a monomeric ensemble model generated by an

overlay of the structures represented by PDB entries 2QAH,

2FFI, and 3CJP, all homologues with sequences that are <20%

identical.^20,21Starting with the MR phases, we were able with

the autobuild wizard of PHENIX to build a majority of the

structure with R and R_freevalues of 26.9 and 30.8%, respectively.

244

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

Table 1. Catalytic Constants for BmulJ_04915, Bamb_1224, and Patl_0798

BmulJ_04915

Bamb_1224

Patl_0798

k_cat/K_m

(M⁻¹s⁻¹

)

compound

k_cat(s⁻¹

)

K_m(mM)

(M⁻¹s⁻¹

)

k_cat(s⁻¹

)

K_m(mM)

(M⁻¹s⁻¹

)

k_cat(s⁻¹

)

K_m(mM)

At pH 8.3

0.9 0.1

L-fucono-1,4-

lactone (1)

140

32

8

1.4 0.2

1.1 0.2

0.7 0.05

1.5 0.3

1.0 (0.1) × 10⁵

3.0 (0.3) × 10⁴

8.4 (0.5) × 10⁴

1.0 (0.1) × 10⁴

89

4

2

1

1.0 (0.1) × 10⁵

4.0 (0.3) × 10⁴

2.4 (0.2) × 10⁴

5.0 (0.5) × 10³

139

6

7

1.2 0.1

1.5 0.2

0.75 0.02

1.5 0.4

1.2 (0.2) × 10⁵

8.0 (0.5) × 10⁴

3.3 (0.2) × 10⁴

6.6 (0.2) × 10⁴

L-galactono-1,4-

lactone (2)

2

1

55

19

1.3 0.1

0.8 0.1

1.3 0.3

119

25

D-arabinono-1,4-

lactone (6)

59

3

L-xylono-1,4-

lactone (7)

14

6.0 0.5

10 0.3

a

4-deoxy-L-fucono-

ND

1,5-lactone (24)

At pH 7.1

L-fucono-1,4-

lactone (1)

4.0 0.1

6.0 0.5

2.0 0.2

0.6 0.1

1.3 0.2

1.0 0.3

7 (0.1) × 10⁴

4.1 0.3

6.2 2.0

2.2 0.2

0.9 0.1

0.5 0.1

0.7 0.1

5.0 (0.1) × 10³

4.0 (0.5) × 10³

3.2 (0.2) × 10³

7.0 (0.3) × 10²

7.2 (0.6) × 10⁶

3.0 0.2

5.7 0.3

1.8 0.2

0.6 0.1

2.6 0.3

1.6 0.3

4.5 (0.5) × 10³

2.2 (0.1) × 10³

1.0 (0.1) × 10³

1.0 (0.2) × 10³

2.6 (0.2) × 10⁶

L-galactono-1,4-

lactone (2)

5.0 (0.5) × 10³

1.6 (0.3) × 10³

1.0 (0.1) × 10³

8.0 (1.0) × 10⁶

D-arabinono-1,4-

lactone (6)

a

L-xylono-1,4-

ND

lactone (7)

4-deoxy-L-fucono-

994 64

0.13 0.03

1530 47

0.21 0.02

1320 80

0.45 0.02

1,5-lactone (24)

a

Kinetic constants were not determined for this substrate.

was also incubated with 50−500 molar equiv of these divalent

cations for 24 h at 4 °C in 50 mM HEPES (pH 7.5) and

subsequently assayed for catalytic activity.

copy with a Bruker Avance III 500 MHz spectrometer with an

H, C, N cryoprobe using WATERGATE solvent suppression

Sequence Similarity Network for cog3618. Proteins

belonging to cog3618 were identiﬁed from the NCBI protein

database using the query “cog3618”. The proteins within

cog3618 were subjected to an all-by-all BLAST at a speciﬁed E

value (10⁻⁵⁰, 10⁻⁶⁰, etc.) using the NCBI standalone BLAST

program. The BLAST ﬁles were opened and visualized in the

similarity network program Cytoscape.²⁸

Reaction Product of BmulJ_04919 with ^L-Fucose. The

product of the reaction catalyzed by BmulJ_04919 was

determined through ¹H, ¹³C heteronuclear multiple-bond

correlation (HMBC) and correlation nuclear magnetic

resonance (NMR) spectroscopy using a Bruker Avance III

500 MHz spectrometer with an H, C, N cryoprobe.

WATERGATE solvent suppression was performed on reaction

samples in 500−1000 μL of D₂O with 100 mM acetate buﬀer

(pH 5.5), 25 mM NAD⁺, 25 mM L-fucose, and 100 μM

BmulJ_04919. After being incubated for 10 min, the enzyme

was removed from the reaction mixture using a 3 kDa cutoﬀ

VWR centrifugal ﬁlter. NAD⁺and NADH were removed by the

addition of Dowex-1 X2 anion exchange resin that was

previously equilibrated with 50 mM acetate buﬀer (pH 5.5).

The pH of the sample was then adjusted to pH 4.2 with 1 M

acetate buﬀer (pH 4.2).

RESULTS

■

Puriﬁcation of BmulJ_04915. The gene for BmulJ_04915

was cloned and expressed in Escherichia coli, and the protein

was puriﬁed to homogeneity. The puriﬁed enzyme contained

∼0.7 molar equiv of Zn²⁺. The addition of chelating agents or

divalent metal ions (Mn²⁺, Zn²⁺, Co²⁺, Cu²⁺, or Ni²) directly to

the assay mixture did not aﬀect the rate of enzyme-catalyzed

hydrolysis of ^L-fucono-1,4-lactone (1). The puriﬁed enzyme

was incubated with EDTA or 1,10-phenanthroline at pH values

ranging from 6 to 10 to chelate the metal ions bound to the

protein. The addition of chelators did not diminish the catalytic

activity of this enzyme, and ICP-MS analysis demonstrated that

the addition of 1,10-phenanthroline removed >95% of the Zn²⁺

that was initially bound to the protein. The apoenzyme had the

same catalytic activity as the as-puriﬁed enzyme. Therefore,

BmulJ_04915 does not require a divalent cation for substrate

turnover.

L-Fucono-1,5-lactone was identiﬁed as a substrate for

BmulJ_04915 using ¹H NMR spectroscopy. The reactions

were conducted with 50 mM phosphate buﬀer (pH 6.5), 15

mM ^L-fucose, 15 mM NAD⁺, 10 μM BmulJ_04919, and 10 μM

1

BmulJ_04915 in a ﬁnal reaction volume of 200 μL. H NMR

spectra were recorded over 1 min intervals with WATERGATE

solvent suppression.

Enzymatic Synthesis of 4-Deoxy-^L-fucono-1,5-lactone.

4-Deoxy-^L-fucono-1,5-lactone (24) was synthesized enzymati-

cally from 4-deoxy-^L-fucose (47) using BmulJ_04919 as the

catalyst. The reaction was conducted in 50 mM phosphate

buﬀer (pH 7.0), 15 mM 4-deoxy-^L-fucose, and 15 mM NAD⁺in

a ﬁnal volume of 1 mL for 20 min. The enzyme was removed

from the reaction mixture using a 3 kDa cutoﬀ VWR centrifugal

ﬁlter. NAD⁺and NADH were removed by the addition of

Dowex-1 X2 anion exchange resin. The structure of the lactone

was determined using HMBC and correlation NMR spectros-

Substrate Speciﬁcity. BmulJ_04915 is a member of

cog3618 from the amidohydrolase superfamily. Other enzymes

from cog3618 have been shown to catalyze the hydrolysis of

lactones.⁷⁻⁹The genomic context is indicative of an enzyme

that participates in the metabolism of carbohydrates, and thus,

this enzyme was predicted to catalyze the hydrolysis of sugar

lactones. The enzyme was screened against a small and focused

library of 23 lactones as potential substrates for this enzyme

(see Scheme 1). BmulJ_04915 exhibited catalytic activity for

the hydrolysis of ^L-fucono-1,4-lactone (1), D-arabino-1,4-

245

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

Table 2. Data Collection and Reﬁnement Statistics for the BmulJ_04915 and BmulJ_04919 Crystal Structures

BmulJ_04915

apo-BmulJ_04919

BmulJ_04919 Ternary complex

a

Data Collection

space group

unit cell

P3₂21

P6₁

C2

a = 75.1 Å, c = 142.3 Å

a = 100.0 Å, c = 205.8 Å

a = 68.4 Å, b = 118.5 Å, c = 118.2 Å,

β = 92.9°

resolution (Å)

completeness (%)

redundancy

mean(I)/sd(I)

R_sym

40−2.15 (2.27−2.15)

99.9 (99.8)

40−1.5 (1.52−1.50)

100.0 (100.0)

8.9 (9.3)

40−1.5 (1.52−1.5)

96.7 (98.7)

11.4 (11.7)

2.8 (2.7)

17.3 (3.5)

10.8 (2.8)

10.0 (1.8)

0.094 (0.777)

0.110 (0.836)

0.103 (0.494)

Structure

resolution (Å)

40−2.15 (2.23−2.15)

40−1.5 (1.52−1.50)

185136 (6256)

15.1 (23.4)

40−1.5 (1.52−1.50)

145306 (4808)

15.2 (20.3)

no. of unique reﬂections 25899 (2790)

R_cryst(%)

19.0 (25.3)

22.8 (28.9)

1−296

R_free(%, 5% of data)

17.2 (24.9)

17.9 (22.7)

contents of model

1−258

b

(native range)

observed

residues

3−289

A1−191, A203−258, B1−258, C1−258, D1−194, D203−258

A1−258, B1−258, C1−258, D1−258

waters

194

1098

8876

1045

9232

all atoms

average B factor (Å²)

2526

Wilson B Factor 25.6

13.8

8.9

(Å²)

TLS groups

11.0

14.0

25.0

protein/water/

NADP/fucose

30.6/39.8/−/−

14.1/29.1/−/−

9.4/23.9/7.7/6.8

rmsd for bond lengths

(Å)

0.01

1.11

0.008

1.12

0.006

1.17

rmsd for bond angles

(deg)

MOLPROBITY

statistics

Ramachandran

favored/outliers

(%)

98.6 (0.35)

1.4

96.9 (0.0)

1.4

96.9 (0.0)

1.4

Ramachandran

rotamer outliers

(%)

c

Clashscore

8.38 (91st percentile)

1.56 (97th percentile)

4DNM

5.37 (91st percentile)

1.59 (78th percentile)

3.81 (95th percentile)

1.47 (87th percentile)

4GVX

c

overall score

PDB entry

4GKB

a

b

Statistics in parentheses are for the highest-resolution bin. Numbers outside of the listed native range are polyhistidine tags or cloning artifacts.

c

Scores are ranked according to structures of similar resolution as formulated in MOLPROBITY.

lactone (6), L-xylono-1,4-lactone (7), and L-galactono-1,4-

lactone (2). The best substrate from this initial set of

compounds is ^L-fucono-1,4-lactone. The kinetic constants are

listed in Table 1.

other members of the amidohydrolase family (Figure 4A).

There are few inserted secondary structural elements, with

most of the deﬁning structural features being extended loops

connecting the (β/α)₈TIM barrel elements. Residual density

within the active site was modeled as a bound HEPES molecule

derived from crystallization buﬀer. The piperazine ring lies

against the face of Trp-22 (loop between β-strand 1 and α-helix

1), while the sulfonate is interacting with Arg-106 and the three

active site histidine residues (His-9, His-11, and His-166)

(Figure 4B). A search using the SSM server returns a number of

amidohydrolases at >2.0 Å root-mean-square deviation (rmsd)

and <20% sequence identity, demonstrating that the structure

of BmulJ_04915 is signiﬁcantly diﬀerent from those previously

determined.²⁹The closest structure is that of the 2-pyrone-4,6-

dicarboxylic acid hydrolase (LigI) from Sphingomonas paucimo-

bilis (rmsd of 2.2 Å over 229 Cα atoms, 20% sequence

identity), which also catalyzes the hydrolysis of a lactone.⁷

Puriﬁcation and Properties of BmulJ_04919. A gene for

a protein currently annotated as a short chain dehydrogenase of

Structure of BmulJ_04915. The structure of

BmulJ_04915 was determined by molecular replacement to

2.15 Å resolution (Table 2). There is a monomer in the

asymmetric unit that is consistent with the protein being a

monomer in solution. The ﬁnal model contains residues 3−

289, all of which are well-deﬁned in electron density. The

crystal from which BmulJ_04915 was determined requires

TCEP and Zn²⁺(added prior to the knowledge that

BmulJ_04915 was not a metalloenzyme) to form and was

only sporadically reproducible. A well-deﬁned Zn²⁺ion,

coordinated by Asp-176 and His-222 of one molecule and

Cys-71 and Asp-72 of a crystallographically related molecule,

speciﬁes how Zn²⁺was critical to the crystallization.

BmulJ_04915 forms a distorted (β/α)₈TIM barrel with an

active site at the C-terminal end of the β-barrel consistent with

246

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

a

Table 3. Catalytic Constants for BmulJ_04919 at pH 8.0

substrate

k_cat(s⁻¹

)

K_m(μM)

k_cat/K_m(M⁻¹s⁻¹

)

L-fucose (25)

D-arabinose (29)

L-galactose (26)

4-deoxy-L-fucose (47)

NADP⁺

10 0.3

21.0 0.1

11 0.5

6.2 0.8

1.5 (0.2) × 10⁶

2.3 (0.1) × 10⁵

3.7 (0.3) × 10⁴

4.0 (0.1) × 10⁴

3.0 (0.4) × 10⁶

5.3 (0.1) × 10⁵

94

3

285 36

786 92

4.0 0.5

26

11 0.2

15

1

NAD⁺

1

28

4

a

When NADP⁺or NAD⁺was varied, the L-fucose concentration was

ﬁxed at 200 μM. When the sugar substrates were varied, the NADP⁺

concentration was ﬁxed at 500 μM.

Identiﬁcation of the Initial Reaction Product of

BmulJ_04919. The only product of an ^L-fucose dehydrogen-

ase that has ever been structurally characterized is ^L-fucono-1,4-

lactone (1).³⁵However, it has been proposed that L-fucono-1,5-

lactone is the true product of the reaction, but this compound

has never been observed because of the rapid nonenzymatic

conversion to ^L-fucono-1,4-lactone (1) or hydrolysis to L-

fuconate.^34,35To help stabilize product formation, the reaction

was conducted at pH 5.5 and then quenched at pH 4.2. The

initial product was structurally characterized by NMR spec-

troscopy and shown to be ^L-fucono-1,5-lactone with the

resonance for the methyl group at 1.32 ppm, which quickly

rearranges to the 1,4-lactone (1.24 ppm) at pH >5.0. For

further characterization, the reaction was quenched at pH 4.2,

which greatly slowed the intermolecular rearrangement.

The enzymatically produced ^L-fucono-1,5-lactone is rapidly

converted to ^L-fucono-1,4-lactone (1). Enzyme, NAD⁺, and L-

fucose were added together at pH 5.5, and the reaction was

monitored by ¹H NMR spectroscopy until L-fucono-1,5-lactone

was the predominate product. The enzyme was removed from

the reaction mixture and the pH adjusted to 6.5. The time

course for the subsequent change in the ¹H NMR spectrum for

the C-6 methyl groups of ^L-fucose (25) and the reaction

products is presented in Figure 5. At 1.1 and 1.2 ppm, there is a

pair of doublets for the α- and β-anomers of ^L-fucose (25). At

1.24 and 1.32 ppm are the two doublets for ^L-fucono-1,4-

lactone (1) and ^L-fucono-1,5-lactone, respectively (Figure 5A).

At the earliest time points, ^L-fucono-1,5-lactone is clearly

dominant versus ^L-fucono-1,4-lactone (1). However, after 5

min, approximately half of the ^L-fucono-1,5-lactone has been

converted to the ^L-fucono-1,4-lactone (Figure 5B). After 1 h,

nearly all of the ^L-fucono-1,5-lactone was converted to L-

fucono-1,4-lactone (1) (Figure 5C). The nonenzymatic

transformation of ^L-fucono-1,5-lactone to L-fucono-1,4-lactone

(1) does not utilize the hydrolyzed product, ^L-fuconate, as a

reactive intermediate. The rate constant is approximately 0.12

min⁻¹at pH 6.5.

Figure 4. Structure of BmulJ_04915. (A) Ribbon diagram of

BmulJ_04915. The HEPES molecule is shown as spheres. (B)

Residues directly adjacent to bound HEPES in the active site of

BmulJ_04915. Numbers in parentheses designate the approximate

location in the secondary structure from which the residue originates.

unknown speciﬁcity (BmulJ_04919) is positioned in the same

putative operon as BmulJ_04915. This gene was cloned and

overexpressed and the protein puriﬁed to homogeneity.

BmulJ_04919 is a member of cog1028, which includes other

enzymes with the following experimentally veriﬁed functions: 2-

dehydro-3-deoxy-^L-fuconate dehydrogenase,¹¹2-dehydro-3-

deoxy-^L-rhamnonate dehydrogenase,⁹L-rhamnose dehydrogen-

ase,⁹2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase,³⁰D-

gluconate dehydrogenase,³¹and sorbitol-6-phosphate dehydro-

genase.³²The closest homologue to BmulJ_04919 with a

veriﬁed catalytic activity in cog1028 appears to be ^L-rhamnose

dehydrogenase from Sphingomonas sp. SKA58. BmulJ_04919 is

unrelated to the putative ^L-fucose dehydrogenase (XCC4065

from X. campestris) from cog0667.^11,33The oxidized product of

the reaction catalyzed by BmulJ_04919 is likely to be the

physiological substrate for BmulJ_04915.

Substrate Speciﬁcity of BmulJ_04919. It was anticipated

that BmulJ_04919 would catalyze the formation of ^L-fucose-

1,5-lactone from ^L-fucose and NADP⁺because the pyranose

form of ^L-fucose is predominant in solution (Figure 6A). To

determine the substrate speciﬁcity of this enzyme, a small

library of pentose and hexose sugars was tested as potential

substrates by monitoring the reduction of NADP⁺at 340 nm

(Scheme 2). ^L-Fucose (25), L-galactose (26), and D-arabinose

(29) were the only sugars oxidized by this enzyme. The

dehydrogenase has the highest activity with ^L-fucose, and the

kinetic constants are listed in Table 3.

Identiﬁcation of the Physiological Substrate for

BmulJ_04915. To determine whether BmulJ_04915 prefer-

entially hydrolyzes the 1,4- or 1,5-lactone of ^L-fuconate,

BmulJ_04919 was incubated with ^L-fucose (25) and NAD⁺.

1

Shown in Figure 6A is the H NMR spectrum of the methyl

carbon for the α- and β-anomers of ^L-fucose (25) before the

addition of BmulJ_04919. After ∼5 min, the concentrations of

the two lactones were approximately equal as shown in Figure

6B. The lactonase (BmulJ_04915) was added, and the

spectrum of the reaction product was monitored as a function

of time. The resonances for the ^L-fucono-1,5-lactone dis-

appeared at a signiﬁcantly higher rate than those for ^L-fucono-

247

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

using 4-deoxy-^L-fucose (47) as a substrate for BmulJ_04919.

This compound is missing the hydroxyl group at C-4 and thus

cannot form a 1,4-lactone. The product of this reaction was

shown to be 4-deoxy-^L-fucono-1,5-lactone (24) by NMR

spectroscopy (Figure 7A). As no 4-hydroxyl group is available,

Figure 5. ¹H NMR time course for the nonenzymatic conversion of L-

fucono-1,5-lactone to ^L-fucono-1,4-lactone. The resonances corre-

sponding to the C-6 methyl groups of both α-^L-fucose (1.12 ppm) and

β-^L-fucose (1.15 ppm), L-fucono-1,5-lactone (1.32 ppm), and L-

fucono-1,4-lactone (1.24 ppm) are presented. (A) The major reaction

product of BmulJ_04915 at pH 4.2 is shown to be ^L-fucono-1,5-

lactone. (B) Five minutes after the reaction mixture had been adjusted

to pH 6.5, the ^L-fucono-1,4-lactone is at a concentration equal to that

of the original enzymatic product. (C) Sixty minutes after the pH of

the reaction mixture had been adjusted to pH 6.5, the major peak is ^L-

fucono-1,4-lactone.

1

Figure 7. H NMR time course of the enzymatic conversion of 4-

deoxy-^L-fucose to 4-deoxy-L-fucono-1,5-lactone and 4-deoxy-L-fuco-

nate. The resonances corresponding to the C-6 methyl groups of both

α-4-deoxy-^L-fucose (1.02 ppm) and β-4-deoxy-L-fucose (1.06 ppm), 4-

deoxy-^L-fucono-1,5-lactone (1.25 ppm), and 4-deoxy-L-fuconate (1.07

ppm) are provided. (A) 4-Deoxy-^L-fucose, prior to addition of

enzymes at pH 6.5. (B) One minute after the addition of

BmulJ_04919 to 4-deoxy-^L-fucose, the enzymatic product is 4-deoxy-

L-fucono-1,5-lactone. (C) One minute after the addition of

BmulJ_04915 to the reaction mixture, 4-deoxy-^L-fucono-1,5-lactone

is no longer present in the reaction mixture and 4-deoxy-^L-fuconate

(1.07 ppm) appears to be the major product.

the six-member lactone is relatively stable and undergoes slow

nonenzymatic hydrolysis. A new methyl doublet appears at 1.25

ppm when 4-deoxy-^L-fucose is oxidized to 4-deoxy-L-fucono-

1,5-lactone by BmulJ_04919 (Figure 7B). After hydrolysis with

BmulJ_04915, this resonance disappears and the methyl

resonance for 4-deoxy-^L-fuconate appears at 1.07 ppm (Figure

7C). The 4-deoxy-^L-fucono-1,5-lactone (24) was isolated, and

the kinetic constants for the hydrolysis of this compound by

BmulJ_04915, Bamb_1224, and Patl_0798 were determined at

pH 7.1. The values of k_catand k_cat/K_mfor the hydrolysis of 4-

deoxy-^L-fucono-1,5-lactone are approximately 250- and 115-

fold greater, respectively, than those for ^L-fucono-1,4-latone

assayed at pH 7.1 (Table 1).

Structure of BmulJ_04919. Unliganded BmulJ_04919

crystallized in space group P6₁with a tetramer per asymmetric

unit and was phased by molecular replacement using a

tetrameric model [PDB entry 3FTP, 3-ketoacyl(acyl carrier

protein) reductase] and reﬁned to a resolution of 1.5 Å (Table

2). The NADP−^L-fucose−BmulJ_04919 ternary complex

crystallized in space group C2 with two dimers per asymmetric

unit and was phased by molecular replacement using a single

subunit of the unliganded structure and reﬁned to a resolution

of 1.5 Å. The density was suﬃcient to build the entire structure,

excluding a portion of a helix−turn−helix motif (residues

∼192−202) in two subunits of the unliganded structure. The

subunit structure of BmulJ_04919 consists mainly of a

Rossmann fold dinucleotide cofactor binding motif in which

a central, twisted β-sheet consisting of seven parallel β-strands

(3-2-1-4-5-6-7 strand topology) is ﬂanked by ﬁve helices

(α1−α3, α7, and α9) on one side and four helices (α3−α6) on

the other (Figures 8). A structure similarity search utilizing the

1

Figure 6. H NMR time course of the enzymatic conversion of L-

fucose to ^L-fucono-1,5-lactone and L-fucono-1,5-lactone to L-fuconate.

The resonances corresponding to the C-6 methyl groups of both α-^L-

fucose (1.125 ppm) and β-^L-fucose (1.15 ppm), L-fucono-1,5-lactone

(1.295 ppm), ^L-fucono-1,4-lactone (1.225 ppm), and L-fuconate (1.182

ppm) are provided. (A) ^L-Fucose, the substrate for BmulJ_04919,

prior to addition of the enzyme at pH 6.5. (B) Five minutes after the

addition of BmulJ_04919 to ^L-fucose, the enzymatic product, L-

fucono-1,5-lactone, and the nonenzymatic product, ^L-fucono-1,4-

lactone, are at equal concentrations. (C) Five minutes after the

addition of BmulJ_04915 to the reaction mixture, the ^L-fucono-1,5-

lactone is no longer present in the reaction mixture and the ^L-fucono-

1,4-lactone appears to be unchanged. ^L-Fuconate (1.182 ppm) appears

to be the major product. The α-anomer of ^L-fucose appears to be

unchanged; however, the concentration of the β-anomer has been

reduced to at least half of the original value.

1,4-lactone (1) (Figure 6C). The formation of L-fuconate was

conﬁrmed by the new resonance at approximately 1.18 ppm.

To further demonstrate that BmulJ_04915 catalyzes the

hydrolysis of the 1,5-lactone faster than the 1,4-lactone, 4-

deoxy-^L-fucono-1,5-lactone (24) was synthesized enzymatically

248

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

to stabilize the active site conformation and promote the

catalytic reaction, with possibly enhanced dissociation at

thermophilic temperatures.³⁶In contrast, the C-terminus of

BmulJ_04919 remains 6−7 Å from the sugar binding pocket

and appears to be well-anchored, suggesting it does not move

during the reaction.

NADP⁺Binding Site of BmulJ_04919. Clear and

continuous electron density for NADP⁺was visualized in the

BmulJ_04919 ternary complex (Figure 9A). As is common in

SDR enzymes, the NAD(P)⁺is bound at the C-terminal edge of

the seven-stranded β-sheet in an extended conformation

(Figure 9B).³⁷In addition to the general topology, the

Rossman fold also includes a highly variable Gly-rich sequence

essential for coordination of the cofactor pyrophosphate. In

BmulJ_04919, this sequence lies between the end of β-strand 1

and the start of α-helix 1 with the sequence G₁₄GASGIGG₂₁.

Clear binding determinants that support the preference of

BmulJ_04919 for NADP⁺over NAD⁺can be identiﬁed. The 2′-

phosphate of NADP⁺forms a salt bridge with the guanidinium

group of Arg-39 and a hydrogen bond with the side chain of

His-40, both originating from the loop between β2 and α2

(Figure 9C). Utilization of this loop for cofactor discrimination

is typical for SDR enzymes.³⁷Arg-39 is positioned by a

hydrogen bond to Glu-63, originating from the loop between β-

strand 3 and α-helix 3. The side chain of Arg-39 additionally

stacks against the face of the adenosine moiety, which in

combination with van der Walls contacts with Leu-64 and a

hydrogen bond from Glu-63 to the adenosine amino group

completes the binding pocket for the adenosine moiety.

L-Fucose Binding Site of BmulJ_04919. Clear and

continuous electron density was observed for ^L-fucose (Figure

9D). The unliganded structure superimposes well with the

ternary complex with an rmsd of 0.22 Å for 247 common Cα

atoms excluding residues 192−202, which are either missing or

more distant from the active site in the unliganded structure

(see below). The binding site for ^L-fucose utilizes structural

elements from the C-terminal region. ^L-Fucose binds in a C3-

endo conformation and is highly coordinated, with each

hydroxyl forming at least two hydrogen bonds to protein

atoms (Figure 9E). ^L-Fucose is bound with C-3 positioned

directly against the nicotinamide (3.3 Å) for the 4-pro-S hydride

transfer typical of “classical” SDR enzymes.³⁷In addition, the

protein relay connecting the acid/base hydroxyl-tyrosinate

(Tyr-163) to a lysine (Lys-157) to a conserved water molecule

stabilized by Asn-113, again typical of classical SDR enzymes, is

observed.³⁷Determinants that are unique to L-fucose binding

include Asn-94 from the β4−α4 loop coordinating the hydroxyl

at C-4, Gln-147 from the α5−α6 loop coordinating the

hydroxyl groups at positions C-3 and C-4, the backbone

carbonyl of Ala-184 and the side chain of Glu-185 (β6−α7

loop) coordinating the hydroxyl groups at positions C-2 and C-

3, respectively, and Lys-141 from the N-terminal end of α5

coordinating both hydroxyl groups at C-2 and C-3. In addition,

the side chains of Asn-94, Leu-190, Tyr-191, and Trp-194 form

a hydrophobic pocket that interacts with the methylene group

of ^L-fucose. Indeed, the largest structural change from the apo

structure to the ternary complex is the movement of the α7−α8

loop to optimize these interactions. In the apo structure, this

region either is disordered or is some 3−4 Å more distant from

the L-fucose binding site. As α7 also interacts with the NADP⁺

and most SDR reaction mechanisms proceed through an

ordered “bi-bi” mechanism [NAD(P)⁺binding ﬁrst and leaving

last], one can envision NADP⁺binding initiating the

Figure 8. Ribbon diagram of BmulJ_04919 with bound NADP

(magenta sticks) and ^L-fucose (green sticks).

SSM server indicates a similarity to a number of short chain

dehydrogenase/reductase (SDR) family enzymes with an rmsd

of <1.5.²⁹The highest scores were for human retinal short

chain dehydrogenase/reductase (PDB entry 1YDE, rmsd of

1.15 Å, sequence identity of 35%, Z score of 16.2) and

Thermoplasma acidophilum ^D-aldohexose dehydrogenase, AldT

(PDB entry 2DTE, rmsd of 1.31 Å, sequence identity of 32%, Z

score of 15.3). Structurally, the largest diﬀerences between

these enzymes are modest deviations in the positions of the

β4−α4 loop, α4, the α7/α8 helix−turn−helix motif, and α2.

For example, in AldT, α2 is converted to a loop and 10 residues

are deleted compared to the same region in BmulJ_04919.³⁶

Examination of the intermolecular interactions of BmulJ_04919

within the two crystal forms is consistent with BmulJ_04919

existing as a tetramer in solution (Figure S1 of the Supporting

Information). In addition, the top structural homologues as

indicated by the SSM search also exist as similar tetramers in

their crystal structures. The tetramer is composed of a dimer of

dimers with 222 point group symmetry where the majority of

interactions are between the A and B subunits and the A and D

subunits. There are only minor interactions between the A and

C subunits, where the C-terminus of the A subunit interacts

with the C-terminus of the C subunit and α5 forming one wall

of the ^L-fucose binding pocket (Figure S1 of the Supporting

Information). Interestingly, the C-terminus of AldT was found

to cover the sugar binding pocket entirely and was postulated

249

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

Figure 9. Interactions of BmulJ_04919 with ligands. (A) The 2.5σ F_o− F_ckick map for NADP⁺bound to the NADP⁺−L-fucose−BmulJ_04919

ternary complex. (B) Interactions of NADP⁺with the secondary structure elements of BmulJ_04919. (C) 2′-Adenosine phosphate binding site of

BmulJ_04919. NADP⁺is shown as sticks with orange carbons, and residues of BmulJ_04919 adjacent to the 2′-adenosine phosphate are shown as

sticks with green carbons. (D) The 2.5σ F_o− F_ckick map for L-fucose bound to the NADP⁺−L-fucose−BmulJ_04919 ternary complex. L-Fucose is

shown as sticks with yellow, numbered carbons. (E) Stereoview of the interactions of ^L-fucose with BmulJ_04919. Protein atoms, L-fucose, and

NADP⁺are shown as sticks with green, yellow, and white carbons, respectively.

stabilization of the α7−α8 loop in a conformation competent

for binding ^L-fucose, followed by active site closure upon the

formation of the numerous interactions with the substrate. On

the basis of the number and speciﬁcity of the interactions, the

structure of the ternary complex suggests that BmulJ_04919

would be fairly speciﬁc for ^L-fucose and that these binding

determinants could be utilized to model the substrate speciﬁcity

of homologues of BmulJ_04919.

terminal end of β-strand 8.⁵In BmulJ_04915, three of the four

histidine residues are conserved (His-9, His-11, and His-166)

from the C-terminal ends of β-strands 1 and 6, in addition to

the aspartate (Asp-244) from the end of β-strand 8. The

histidine from the end of β-strand 5 is absent and replaced with

Leu-141 (Figures 4B and 10A). In the absence of a metal ion

bound in the active site, these four residues must now acquire

new functional roles.

A structural alignment of the LigI and BmulJ_04915 active

sites reveals relatively little conservation between the two

binding pockets, aside from the residues predicted to confer

catalytic activity (Figure 10A). A low level of conservation of

the active site can be explained by analysis of the two

signiﬁcantly diﬀerent substrates utilized by these enzymes. LigI

catalyzes the hydrolysis of a planar dicarboxylated six-

membered lactone, while BmulJ_04915 catalyzes the hydrolysis

of a nonplanar six-membered lactone. The structure of

BmulJ_04915 could not be obtained with bound substrate or

product, but it is possible to manually dock the ^L-fucono-1,5-

lactone substrate in the active site to obtain a view of the

structural determinants for substrate binding (Figure 10B).

Modeling ^L-fucono-1,5-lactone into the active site of

BmulJ_04915 was based on the structural alignment with

LigI (with bound product) and the general path of the bound

HEPES molecule (Figures 4B and 10A). The sulfonate of the

HEPES molecule bound to BmulJ_04915 is positioned like the

newly formed carboxylate of the product of the reaction

catalyzed by LigI (4-carboxy-2-hydroxymuconate) interacting

with three histidine residues (His-9, His-11, and His-166), Arg-

DISCUSSION

■

Metal Content. LigI from S. paucimobilis was the ﬁrst

enzyme from cog3618 to be mechanistically and structurally

characterized, and this enzyme does not require the binding of

a divalent metal ion in the active site for catalytic activity.⁷

BmulJ_04915, also a member of cog3618, shares ∼20%

identical sequence with LigI, and it is the second example of

an enzyme within the AHS that does not require metal for

catalytic function. We were unable to detect the binding of

metals via ICP-MS in the samples of BmulJ_04915 puriﬁed in

the absence of added metal, and thus, this protein does not

require the metal for catalytic activity.

Active Site of BmulJ_04915. Nearly all members of the

AHS are recognized by the conservation of ﬁve amino acid

residues that form the active site and are utilized for metal

binding and/or proton transfers. These residues include two

histidine residues from the C-terminal end of β-strand 1, two

additional histidine residues from the C-terminal ends of β-

strands 5 and 6, and a conserved aspartate residue from the C-

250

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

carbonyl group of the sugar lactone substrate via electrostatic

interactions.⁷The aspartate residue from β-strand 8 (Asp-244)

is positioned to deprotonate an active site water molecule for

nucleophilic attack on the C-1 carbonyl group of the lactone

substrate. A ﬁfth active site residue conserved within many

members of cog3618 is an arginine from β-strand 4 (Arg-106).

This arginine is proposed to assist in the cleavage of the lactone

functional group through electrostatic interactions with the

hydroxyl leaving group of the product. The proposed

mechanism is presented in Scheme 3.

Natural Substrate of BmulJ_04915. BmulJ_04915

exhibits signiﬁcant catalytic activity for a series of ﬁve-

membered sugar lactones (Table 1) that share the same

stereochemistry at C-2 and C-3 and has the highest activity for

the ^L-fucono-1,4-lactone. The best substrate for BmulJ_04919

is β-^L-fucose, which undergoes oxidation to L-fucono-1,5-

lactone and subsequent nonenzymatic transformation to ^L-

fucono-1,4-lactone. It has been postulated that the instability of

D-galactono-1,5-lactone is due to an intermolecular rearrange-

ment that occurs in a distorted chair conformation. The

rearrangement is thought to arise from the axial hydroxyl group

in C-4, which is positioned for nucleophilic attack on C-1.³⁸

A

similar rearrangement is assumed for ^L-fucono-1,5-lactone and

is fully consistent with the NMR data reported in this paper.

The ¹H NMR spectra show a direct conversion of L-fucono-1,5-

lactone to ^L-fucono-1,4-lactone without transformation to L-

fuconate as an intermediate. The NMR spectra clearly show

that BmulJ_04915 hydrolyzes ^L-fucono-1,5-lactone at a rate

faster than that with ^L-fucono-1,4-lactone (Figure 6).

It was not possible to determine the kinetic constants for the

hydrolysis of ^L-fucono-1,5-lactone because of chemical

instability, and thus, a stable mimic was utilized. 4-Deoxy-^L-

fucono-1,5-lactone was synthesized enzymatically and provided

a pyranosyl analogue that was more stable because of the

absence of the axial hydroxyl group on C-4, which allowed the

kinetic constants to be determined at pH 7.1. 4-Deoxy-^L-

fucono-1,5-lactone was shown to be hydrolyzed by

BmulJ_04915 approximately 2 orders of magnitude faster

than the corresponding ^L-fucono-1,4-lactone. Thus, even

though ^L-fucono-1,5-lactone is kinetically unstable, it appears

to be the natural substrate of BmulJ_04915.

The closest homologue (∼27% identical sequence) of known

function to BmulJ_04915 is SKA58_03595 from Sphingomonas

sp. SKA58, which has been experimentally annotated as an ^L-

rhamnono-1,4-lactonase.⁹Kinetic constants for L-rhamnono-

1,4-lactonase have not apparently been reported, nor has a

complete substrate proﬁle been established. ^L-Rhamnono-1,4-

Figure 10. (A) Active site of BmulJ_04915 structurally aligned with

that of 2-pyrone-4,6-dicarboxylic acid lactonase (LigI). The active site

is color-coded as follows: green for LigI (PDB entry 4d8l) and white

for BmulJ_04915. Numbers in parentheses designate the approximate

locations in the secondary structure from which the residue originates.

(B) ^L-Fucono-1,5-lactone modeled into the active site of

BmulJ_04915.

106, and Asp-244 (Figure 4B). In this model, Gln-110 and Lys-

169 are positioned to interact with hydroxyl groups at C-3 and

C-4 of ^L-fucono-1,5-lactone. On either face of the lactone, Leu-

141 and Leu-247 constrict the active site. Finally, Trp-22 lies

against the aliphatic face of the lactone (C-3−C-4−C-5) near

the entrance to the active site.

Proposed Mechanism of Action. The four AHS

conserved residues (His-9, His-11, His-166, and Asp-244)

align with their counterparts in LigI and assume similar roles in

catalysis. The three conserved histidine residues polarize the

Scheme 3

251

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

lactonase is adjacent to an L-rhamnose dehydrogenase from

cog1028 that shares 30% sequence identity with BmulJ_04919.

Given the sequence similarities, it is predicted that these

homologues of BmulJ_04915 and BmulJ_04919 will act in a

similar manner to produce a 1,5-lactone, which is subsequently

hydrolyzed to the acid sugar.

Oﬃce of Basic Energy Sciences, under Contract DE-AC02-

06CH11357. Use of the Lilly Research Laboratory Collabo-

rative Access Team (LRL-CAT) beamline at Sector 31 of the

Advanced Photon Source was provided by Eli Lilly Co., which

operates the facility.

Additional ^L-Fucono-1,5-lactonases. L-Fucono-1,5-lacto-

nase activity was demonstrated in groups 1, 9, and 14 of

cog3618 with enzymes Bamb_1224, Patl_0798, and

BmulJ_04915, respectively (Figure 3 and Table 1). Groups 1,

9, and 14 are grouped together as part of Class I enzymes at a

low-stringency E value of 10⁻³⁰and only begin to separate into

more distinct groups at E values of >10⁻⁷⁰(Figure 2B). A list of

candidate ^L-fucono-1,5-lactonase sequences has been estab-

lished. These proteins shared at least 30% sequence identity

and map to the Class I enzymes in the sequence similarity

network. All candidate sequences were aligned with the

experimentally veriﬁed ^L-fucono-1,5-lactonase, BmulJ_04915.

Sequences were considered to be ^L-fucono-1,5-lactonase if the

following active site residues were conserved: His-9, His-11,

Trp-22, Arg-106, Gln-110, His-166, Thr-207, Glu-208, and Asp-

244. The 174 sequences that conform to the speciﬁc active site

residues are now postulated to be ^L-fucono-1,5-lactonase

proteins and are represented as yellow nodes in Figure 2 and

are listed in Table S1 of the Supporting Information.

REFERENCES

■

(1) Becker, D. J., and Lowe, J. B. (2003) Fucose: Biosynthesis and

biological function in mammals. Glycobiology 13, 41R−53R.

(2) Chan, J. Y., Nwokoro, N. A., and Schachter, H. (1979) ^L-Fucose

metabolism in mammals. The conversion of ^L-fucose to two moles of

L-lactate, of L-galactose to L-lactate and glycerate, and of D-arabinose to

L-lactate and glycollate. J. Biol. Chem. 254, 7060−7068.

(3) Ghalambor, M. A., and Heath, E. C. (1962) The metabolism of ^L-

Fucose. II. The enzymatic cleavage of ^L-fuculose 1-phosphate. J. Biol.

Chem. 237, 2427−2433.

(4) Heath, E. C., and Ghalambor, M. A. (1962) The Metabolism of ^L-

Fucose. I. The Purification and Properties of ^L-Fuculose Kinase. J. Biol.

Chem. 237, 2423−2426.

(5) Seibert, C. M., and Raushel, F. M. (2005) Structural and Catalytic

Diversity within the Amidohydrolase Superfamily. Biochemistry 44,

6383−6391.

(6) Tatusov, R. L., Natale, D. A., Garkavtsev, I. V., Tatusova, T. A.,

Shankavaram, U. T., Rao, B. S., Kiryutin, B., Galperin, M. Y., Fedorova,

N. D., and Koonin, E. V. (2001) The COG Database: New

Developments in Phylogenetic Classification of Proteins from

Complete Genomes. Nucleic Acids Res. 29, 22−28.

(7) Hobbs, M. E., Malashkevich, V., Williams, H. J., Xu, C., Sauder, J.

M., Burley, S. K., Almo, S. C., and Raushel, F. M. (2012) Structure and

Catalytic Mechanism of LigI: Insight into the Amidohydrolase

Enzymes of cog3618 and Lignin Degradation. Biochemistry 51,

3497−3507.

(8) Halak, S., Basta, T., Buerger, S., Contzen, M., Wray, V., Pieper, D.

H., and Stolz, A. (2007) 4-Sulfomuconolactone hydrolases from

Hydrogenophaga intermedia S1 and Agrobacterium radiobacter S2. J.

Bacteriol. 189, 6998−7006.

(9) Watanabe, S., Saimura, M., and Makino, K. (2008) Eukaryotic

and bacterial gene clusters related to an alternative pathway of non-

phosphorylated ^L-rhamnose metabolism. J. Biol. Chem. 283, 20372−

20382.

(10) Atkinson, H. J., Morris, J. H., Ferrin, T. E., and Babbitt, P. C.

(2009) Using sequence similarity networks for visualization of

relationships across diverse protein superfamilies. PLoS One 4, e4345.

(11) Yew, W. S., Fedorov, A. A., Fedorov, E. V., Rakus, J. F., Pierce,

R. W., Almo, S. C., and Gerlt, J. A. (2006) Evolution of enzymatic

activities in the enolase superfamily: ^L-Fuconate dehydratase from

Xanthomonas campestris. Biochemistry 45, 14582−14597.

(12) Xiang, D. F., Kolb, P., Fedorov, A. A., Xu, C., Fedorov, E. V.,

Narindoshvili, T., Williams, H. J., Shoichet, B. K., Almo, S. C., and

Raushel, F. M. (2012) Structure-based function discovery of an

enzyme for the hydrolysis of phosphorylated sugar lactones.

Biochemistry 51, 1762−1773.

(13) Aslanidis, C., and de Jong, P. J. (1990) Ligation-independent

Cloning of PCR Products (LIC-PCR). Nucleic Acids Res. 18, 6069−

6074.

(14) Studier, F. W. (2005) Protein production by auto-induction in

high density shaking cultures. Protein Expression Purif. 41, 207−234.

(15) Fox, B. G., and Blommel, P. G. (2009) Autoinduction of protein

expression. Current Protocols in Protein Science, Chapter 5, Unit 5, p 23,

Wiley, New York.

ASSOCIATED CONTENT

* Supporting Information

Table S1 and Figure S1. This material is available free of charge

via the Internet at http://pubs.acs.org.

■

S

Accession Codes

The X-ray coordinates of L-fucono-1,5-lactonase

(BmulJ_04915) have been deposited in the Protein Data

Bank as entries 4DLF, 4DLM, 4DO7, and 4DNM. X-ray

coordinates for ^L-fucose dehydrogenase (BmulJ_04919) have

been deposited as PDB entries 4GKB, 4GLO, and 4GVX.

AUTHOR INFORMATION

Corresponding Author

■

*F.M.R.: telephone, (979) 845-3373; fax, (979) 845-9452; e-

mail, raushel@tamu.edu. S.C.A.: telephone, (718) 430-2746;

fax, (718) 430-8565; e-mail, almo@aecom.yu.edu.

Funding

This work was supported in part by the Robert A. Welch

Foundation (A-840) and the National Institutes of Health (GM

71790 and GM 93342).

Notes

The authors declare no competing ﬁnancial interest.

ACKNOWLEDGMENTS

■

X-ray diﬀraction data for this study were measured at beamlines

X29 of the National Synchrotron Light Source (NSLS),

Brookhaven National Laboratory, and Lilly Research Labo-

ratory Collaborative Access Team (LRL-CAT) at the Advanced

Photon Source, Argonne National Laboratory. Use of the NSLS

beamline is supported by Center for Synchrotron Biosciences

Grant P30-EB-009998 from the National Institute of

Biomedical Imaging and Bioengineering and by the U.S.

Department of Energy, Oﬃce of Science, Oﬃce of Basic Energy

Sciences, under Contract DE-AC02-98CH10886. Use of the

Advanced Photon Source at Argonne National Laboratory was

supported by the U.S. Department of Energy, Oﬃce of Science,

(16) Tropea, J. E., Cherry, S., and Waugh, D. S. (2009) Expression

and purification of soluble His(6)-tagged TEV protease. Methods Mol.

Biol. 498, 297−307.

(17) Minor, W., Cymborowski, M., Otwinowski, Z., and Chruszcz, M.

(2006) HKL-3000: The integration of data reduction and structure

solutionfrom diffraction images to an initial model in minutes. Acta

Crystallogr. 62, 859−866.

252

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Biochemistry

Article

(18) Battye, T. G., Kontogiannis, L., Johnson, O., Powell, H. R., and

Leslie, A. G. (2011) iMOSFLM: A new graphical interface for

diffraction-image processing with MOSFLM. Acta Crystallogr. 67,

271−281.

(19) Evans, P. (2006) Scaling and assessment of data quality. Acta

Crystallogr. 62, 72−82.

(37) Lesk, A. M. (1995) NAD-binding domains of dehydrogenases.

Curr. Opin. Struct. Biol. 5, 775−783.

(38) Ueberschar, K. H., Blachnitzky, E. O., and Kurz, G. (1974)

Reaction Mechanism of ^D-Galactose Dehydrogenases from Pseudomo-

nas saccharophila and Pseudomonas fluorescens. Eur. J. Biochem. 48,

389−405.

(20) Zwart, P. H., Afonine, P. V., Grosse-Kunstleve, R. W., Hung, L.

W., Ioerger, T. R., McCoy, A. J., McKee, E., Moriarty, N. W., Read, R.

J., Sacchettini, J. C., Sauter, N. K., Storoni, L. C., Terwilliger, T. C., and

Adams, P. D. (2008) Automated structure solution with the PHENIX

suite. Methods Mol. Biol. 426, 419−435.

(21) McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M.

D., Storoni, L. C., and Read, R. J. (2007) Phaser crystallographic

software. J. Appl. Crystallogr. 40, 658−674.

(22) Lebedev, A. A., Vagin, A. A., and Murshudov, G. N. (2008)

Model preparation in MOLREP and examples of model improvement

using X-ray data. Acta Crystallogr. 64, 33−39.

(23) Arnold, K., Bordoli, L., Kopp, J., and Schwede, T. (2006) The

SWISS-MODEL workspace: A web-based environment for protein

structure homology modelling. Bioinformatics 22, 195−201.

(24) Koehn, R. K., Diehl, W. J., and Scott, T. M. (1988) The

differential contribution by individual enzymes of glycolysis and

protein catabolism to the relationship between heterozygosity and

growth rate in the coot clam, Mulinia lateralis. Genetics 118, 121−130.

(25) Chapman, E., and Wong, C. H. (2002) A pH sensitive

colorimetric assay for the high throughput screening of enzyme

inhibitors and substrates: A case study using kinases. Bioorg. Med.

Chem. 10, 551−555.

(26) Hall, R. S., Xiang, D. F., Xu, C., and Raushel, F. M. (2007) N-

Acetyl-^D-glucosamine-6-phosphate deacetylase: Substrate activation via

a single divalent metal ion. Biochemistry 46, 7942−7952.

(27) Kamat, S. S., Bagaria, A., Kumaran, D., Hampton, G. P., Fan, H.,

Sali, A., Sauder, J. M., Burley, S. K., Lindahl, P. A., Swaminathan, S.,

and Raushel, F. M. (2011) Catalytic mechanism and three-dimensional

structure of adenine deaminase. Biochemistry 50, 1917−1927.

(28) Smoot, M. E., Ono, K., Ruscheinski, J., Wang, P. L., and Ideker,

T. (2011) Cytoscape 2.8: New features for data integration and

network visualization. Bioinformatics 27, 431−432.

(29) Krissinel, E., and Henrick, K. (2004) Secondary-structure

matching (SSM), a new tool for fast protein structure alignment in

three dimensions. Acta Crystallogr. 60, 2256−2268.

(30) Sundlov, J. A., Garringer, J. A., Carney, J. M., Reger, A. S., Drake,

E. J., Duax, W. L., and Gulick, A. M. (2006) Determination of the

crystal structure of EntA, a 2,3-dihydro-2,3-dihydroxybenzoic acid

dehydrogenase from Escherichia coli. Acta Crystallogr. D62, 734−740.

(31) Klasen, R., Bringer-Meyer, S., and Sahm, H. (1995) Biochemical

characterization and sequence analysis of the gluconate:NADP 5-

oxidoreductase gene from Gluconobacter oxydans. J. Bacteriol. 177,

2637−2643.

(32) Novotny, M. J., Reizer, J., Esch, F., and Saier, M. H., Jr. (1984)

Purification and properties of ^D-mannitol-1-phosphate dehydrogenase

and ^D-glucitol-6-phosphate dehydrogenase from Escherichia coli. J.

Bacteriol. 159, 986−990.

(33) Yokochi, N., Nishimura, S., Yoshikane, Y., Ohnishi, K., and Yagi,

T. (2006) Identification of a new tetrameric pyridoxal 4-dehydrogen-

ase as the second enzyme in the degradation pathway for pyridoxine in

a nitrogen-fixing symbiotic bacterium, Mesorhizobium loti. Arch.

Biochem. Biophys. 452, 1−8.

(34) Schachter, H., Sarney, J., McGuire, E. J., and Roseman, S.

(1969) Isolation of diphosphopyridine nucleotide-dependent ^L-fucose

dehydrogenase from pork liver. J. Biol. Chem. 244, 4785−4792.

(35) Tsuji, Y., Koike, A., Yamamoto, K., and Tochikura, T. (1992)

Purification and some properties of ^L-fucose dehydrogenase from

Agrobacterium radiobacter and its application to the assay of bound-

fucose in glycoconjugates. Biochim. Biophys. Acta 1117, 167−173.

(36) Yasutake, Y., Nishiya, Y., Tamura, N., and Tamura, T. (2007)

Structural insights into unique substrate selectivity of Thermoplasma

acidophilum ^D-aldohexose dehydrogenase. J. Mol. Biol. 367, 1034−

1046.

253

dx.doi.org/10.1021/bi3015554 | Biochemistry 2013, 52, 239−253

Article Doi

Discovery of an l-fucono-1,5-lactonase from cog3618 of the amidohydrolase superfamily

DOI: 10.1021/bi3015554

Source and publish data:

Authors:

Article abstract of DOI:10.1021/bi3015554

Full text of DOI:10.1021/bi3015554

Products guided by the article

R&D Labs maybe for 124819-01-8

Relevant to this article

Hot Product