Solution structure, mechanism of replication, and optimization of an unnatural base pair

Article abstract of DOI:10.1002/chem.201000959

As part of an ongoing effort to expand the genetic alphabet for in vitro and eventual in vivo applications, we have synthesized a wide variety of predominantly hydrophobic unnatural base pairs and evaluated their replication in DNA. Collectively, the resu

Full text of DOI:10.1002/chem.201000959

DOI: 10.1002/chem.201000959
Solution Structure, Mechanism of Replication, and Optimization of an
Unnatural Base Pair
Denis A. Malyshev,[a] Danielle A. Pfaff,[b] Shannon I. Ippoliti,[b] Gil Tae Hwang,[a, c]
Tammy J. Dwyer,*[b] and Floyd E. Romesberg*[a]
Abstract: As part of an ongoing effort
to expand the genetic alphabet for in
vitro and eventual in vivo applications,
we have synthesized a wide variety of
predominantly hydrophobic unnatural
base pairs and evaluated their replica-
tion in DNA. Collectively, the results
have led us to propose that these base
pairs, which lack stabilizing edge-on in-
teractions, are replicated by means of a
unique intercalative mechanism. Here,
we report the synthesis and characteri-
zation of three novel derivatives of the
nucleotide analogue dMMO2, which
forms an unnatural base pair with the
nucleotide analogue d5SICS. Replacing
the para-methyl substituent of dMMO2
with an annulated furan ring (yielding
dFMO) has a dramatically negative
effect on replication, while replacing it
with a methoxy (dDMO) or with a
thioACTHNUTRGNEUGmN ethyl group (dTMO) improves
replication in both steady-state assays
and during PCR amplification. Thus,
genetic alphabet. To elucidate the
structure–activity relationships govern-
ing unnatural base pair replication, we
determined the solution structure of
duplex DNA containing the parental
dMMO2–d5SICS pair, and also used
this structure to generate models of the
derivative base pairs. The results
strongly support the intercalative
mechanism of replication, reveal a sur-
prisingly high level of specificity that
may be achieved by optimizing packing
interactions, and should prove invalu-
dTMO–d5SICS,
and
especially
dDMO–d5SICS, represent significant
progress toward the expansion of the
Keywords: DNA replication · ge-
AHCTUNGTRENNUNG
netic alphabet
· intercalations ·
polymerase · unnatural base pairs
Introduction
bination of hydrogen-bonding[1] and shape complementari-
ty.[2–4] However, a priori there is no reason that these forces
should be unique in their ability to mediate base pairing.
With the long-term goal of expanding the genetic code,
we[5–15] and others[3,16–22] have explored the development of
unnatural nucleotides bearing nucleobase analogues that
pair through hydrophobic and packing forces. Among the
most promising predominantly hydrophobic base pairs that
we have identified is that formed between dMMO2 and
d5SICS (dMMO2–d5SICS, Figure 1a).[8] The dMMO2–
d5SICS pair is synthesized (by insertion of each unnatural
triphosphate opposite the other in the template)[23] and then
extended (by insertion of the next correct dNTP) with rela-
tively high efficiency and fidelity by diverse polymerases,[13]
including the exonuclease deficient Klenow fragment (Kf)
of E. coli DNA polymerase I.
The natural genetic alphabet relies on the selective pairing
of the four natural nucleotides, which is governed by a com-
[a] D. A. Malyshev, Dr. G. T. Hwang, Prof. F. E. Romesberg
Department of Chemistry
The Scripps Research Institute
10550 North Torrey Pines Road
La Jolla, CA 92037 (USA)
Fax : (+1)858-784-7472
E-mail: floyd@scripps.edu
[b] D. A. Pfaff, S. I. Ippoliti, Prof. T. J. Dwyer
Department of Chemistry and Biochemistry
University of San Diego, 5998 Alcala Park
San Diego, CA 92110 (USA)
Fax : (+1)619-260-2211
E-mail: tdwyer@sandiego.edu
The step that most limits the replication of DNA contain-
ing dMMO2–d5SICS is the insertion of dMMO2TP opposite
d5SICS in the template. In general, we have found that the
rates of insertion are most sensitive to triphosphate derivati-
zation; thus our efforts to optimize dMMO2–d5SICS have
focused on modification of dMMO2 (with the goal of opti-
[c] Dr. G. T. Hwang
Department of Chemistry
Kyungpook National University
Daegu 702-701 (Korea)
Supporting information for this article is available on the WWW
under http://dx.doi.org/10.1002/chem.201000959.
12650
ꢀ 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2010, 16, 12650 – 12659

FULL PAPER
Figure 2. Intercalative model for unnatural base pair replication.[9] The
unnatural nucleobase in the template is shown in white and the natural
or unnatural nucleobase of the incoming dNTP is shown in black.
tercalation is required to position the primer terminus ap-
propriately for continued extension, which is also favored by
Figure 1. Unnatural nucleotides used in the current study. Only nucleo-
bases are shown; sugars and phosphates have been omitted for clarity.
hydrogen-bond formation between
a polymerase-based
donor and the ortho substituents of d5SICS and
dMMO2,[6–8] explaining why they are essential for extension.
Thus, a subtle balance between intercalation and deinterca-
lation is required for the unnatural base pair to be synthe-
sized and extended efficiently. (Despite the requirement of
both intercalation and deintercalation, for simplicity, we
refer to this mechanism as the “intercalative mechanism.”).
To test the intercalative mechanism of replication and to
continue our efforts to optimize the dMMO2–d5SICS un-
natural base pair, we now report the kinetic and structural
characterization of base pairs formed between d5SICS and
three dMMO2 derivatives that have been modified at the
meta and/or para positions: dDMO, dTMO, and dFMO (Fig-
ure 1c). Complete steady-state kinetic analysis, as well as
the efficiency and fidelity of PCR amplification show that
derivatization with a thiomethyl, or especially with a meth-
mizing the insertion of dMMO2TP opposite d5SICS). Be-
cause previous studies showed that the methoxy and sulfur
substituents at the position ortho to the glycosidic linkage
are essential for efficient extension of the nascent unnatural
base pair,[6–8] our efforts focused specifically on meta and
para derivatizations of dMMO2.[9,10] Indeed, we already
demonstrated that both dNaMTP and d5FMTP (Figure 1b)
are inserted opposite d5SICS with higher efficiency and fi-
delity than dMMO2TP, and that dNaM–d5SICS is sufficient-
ly well recognized for expansion of the genetic alphabet in
vitro.[9] However, we anticipate that one of the most inter-
esting in vitro applications of an expanded genetic alphabet
will be the use of an unnatural base pair to site specifically
modify DNA or RNA in a format consistent with enzymatic
synthesis, and one limitation of dNaM is that the second ar-
omatic ring precludes derivatization at the position most
commonly used to attach linkers (i.e., the C5 position of
natural pyrimidines[24]). While other positions might be
found to derivatize dNaM with linkers, modifications of
dMMO2 that improve replication without blocking the C5
position are desirable.
AHCTUNGTREGoNNUN xy substituent, significantly improves replication: dTMO–
d5SICS and dDMO–d5SICS are replicated more efficiently
than dMMO2–d5SICS. Unlike dNaM, the C5 position of
dTMO and dDMO is available for derivatization, making
them amenable for uses involving the site-specific modifica-
tion of DNA. Surprisingly, the furan substituent of dFMO
dramatically reduces the efficiency of each step of replica-
tion. To help understand these trends in replication, we also
report the solution structure of dMMO2–d5SICS in duplex
DNA, along with models of the derivative base pairs. The
data strongly supports the intercalative model of replication
and provides a rationale for the observed variations in the
recognition of the dMMO2 derivatives.
Previous kinetic[5–11] and structural[12] studies have prompt-
ed us to propose that the predominantly hydrophobic un-
natural base pairs are replicated via a unique mechanism in-
volving partial interstrand intercalation (Figure 2). In this
mechanism, the unnatural triphosphates are recognized by
at least partial intercalation of their nucleobases into the
polymerase-bound template strand between the nucleobase
of their cognate unnatural nucleotide and a flanking nucleo-
base. This mode of insertion likely results from the high hy-
drophobic packing and stacking potential of the unnatural
nucleobases and the absence of interactions that favor edge-
to-edge pairing, and also suggests that increased packing
within the major groove underlies the more efficient inser-
tion of dNaMTP and d5FMTP opposite d5SICS, relative to
dMMO2TP. Importantly, the model also suggests that dein-
Results
Unnatural base pair design and evaluation: The dDMO and
dTMO nucleotides were designed to probe the effects of
heteroatom substitution in the developing major groove at
the primer terminus while leaving the C5 position unsubsti-
Chem. Eur. J. 2010, 16, 12650 – 12659
ꢀ 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
12651

F. E. Romesberg, T. J. Dwyer et al.
Table 1. Second-order rate constants (kcat/KM) for Kf-mediated synthesis and extension of dMMO2 or an analogue paired opposite d5SICS in the tem-
plate.[a]
Sequence Context I
Sequence Context II
5’-dTAATACGACTCACTATAGGGAGAY
3’-dATTATGCTGAGTGATATCCCTCTXGCTAGGTTACGGCAGGATCGC
5’-dTAATACGACTCACTATAGGGAGCY
3’-dATTATGCTGAGTGATATCCCTCGXTCTAGGTTACGGCAGGATCGC
X
Y
Synthesis
Extension
X
Y
Synthesis
Extension
[mÀ1 minÀ1
]
[mÀ1 minÀ1
]
[mÀ1 minÀ1
]
[mÀ1 minÀ1
]
dT
dA
3.2ꢁ108
3.6ꢁ105
1.7ꢁ106
1.6ꢁ106
2.5ꢁ104
2.7ꢁ104
2.2ꢁ104
<1.0ꢁ103[d]
1.3ꢁ105
1.3ꢁ104
1.7ꢁ108
1.9ꢁ106
7.8ꢁ106
9.8ꢁ105
5.4ꢁ104
<1.0ꢁ103[d]
1.0ꢁ104
4.2ꢁ103
4.9ꢁ103
4.0ꢁ105
dT
dA
3.3ꢁ108
4.8ꢁ105
3.1ꢁ108
3.2ꢁ105
d5SICS
d5SICS
d5SICS
d5SICS
d5SICS
d5SICS
d5SICS
d5SICS
d5SICS
dMMO2[b]
dDMO
dTMO
dFMO
d5SICS[b]
dA[b]
d5SICS
d5SICS
d5SICS
d5SICS
d5SICS
d5SICS
d5SICS
d5SICS
d5SICS
dMMO2[c]
dDMO
dTMO
dFMO
d5SICS[c]
dA[c]
5.0ꢁ105
1.6ꢁ106
not measured
not measured
2.4ꢁ105
not measured
not measured
<1.0ꢁ103[d]
3.6ꢁ103
5.9ꢁ104
dC[b]
dC[c]
<1.0ꢁ103[d]
1.9ꢁ105
<1.0ꢁ103[d]
6.5ꢁ102
dG[b]
dG[c]
dT[b]
dT[c]
8.5ꢁ103
3.3ꢁ105
[a] In all cases “X” is the nucleotide in the template. For synthesis, “Y” corresponds to the triphosphate inserted, and for extension, it corresponds to the
nucleotide at the nascent primer terminus. [b] Taken from reference [8]. [c] Taken from reference [9]. [d] Below the limit of detection.
tuted. In contrast, like dNaM, the C5 position of dFMO is
substituted, and this analogue was designed to introduce a
more rigidly positioned heteroatom, while simultaneously
increasing the potential for nucleobase packing. Oligonucle-
otides containing the unnatural nucleotides were synthesized
to act as templates or primers so that both synthesis and ex-
tension of each unnatural base pair could be evaluated inde-
pendently. Kinetic analyses were performed under steady-
state conditions using Kf, and second-order rate constants
(efficiency, kcat/KM) were determined (individual kcat and KM
values are reported in Supporting Information). PCR am-
plification was also performed to further evaluate the un-
natural base pair and to gauge the potential practical utility.
The unnatural base pairs are generally referred to as dY–
dX, when no strand context is implied, while dY:dX is used
to refer specifically to the strand context with dY in the
primer strand and dX in the template strand.
efficiency of 4.7ꢁ107 mÀ1 minÀ1, and it is inserted opposite
itself in the template with an efficiency of 1.2ꢁ105 mÀ1 minÀ1.
Insertion of natural dNTPs opposite dMMO2 in the tem-
plate is not detectable (kcat/KM <1.0ꢁ103 mÀ1 minÀ1), except
in the case of dATP, which is inserted with moderate effi-
ciency (kcat/KM =1.0ꢁ105 mÀ1 minÀ1).[8] We found that inser-
tion of d5SICS opposite dDMO is threefold less efficient
than opposite dMMO2. However, dDMO also directs the
synthesis of the mispair with itself or that with dA less effi-
ciently than does dMMO2, without significantly increasing
the synthesis efficiencies of any of the other mispairs.
We found that insertion of d5SICSTP opposite dTMO is
twofold less efficient than opposite dMMO2. Interestingly,
the thiomethyl substituent significantly increases the rate at
which dATP is inserted, while only slightly increasing the
rates at which the other mispairs are synthesized. Surprising-
ly, incorporating the major groove oxygen atom as a re-
strained furan (i.e., dFMO), as opposed to a free methyl
ether (i.e., dDMO), dramatically reduces the efficiency of
d5SICSTP insertion (by 100-fold). While dFMO does not
direct Kf to synthesize the self-pair (kcat/KM <1.0ꢁ
103 mÀ1 minÀ1), it does direct the relatively more efficient in-
sertion of each natural triphosphate.
Unnatural base pair synthesis—insertion of dMMO2TP ana-
logues opposite d5SICS: To characterize the effects of major
groove substitution, we first characterized the rate at which
the dMMO2TP analogues are inserted opposite d5SICS in
the template (Table 1). For comparison, dMMO2TP itself is
inserted with
a second-order rate constant of 3.6ꢁ
105 mÀ1 minÀ1.[8] We found that dDMOTP and dTMOTP are
inserted fivefold more efficiently, resulting entirely from a
decreased apparent KM for unnatural triphosphate binding.
However, insertion of dFMOTP opposite d5SICS is more
than tenfold less efficient than insertion of dMMO2TP, due
to changes in both the apparent kcat and KM. A complete
characterization of mispair synthesis with d5SICS in the
template was reported previously.[8]
Unnatural base pair extension—extension of dMMO2 ana-
logues paired opposite d5SICS: Efficient and high-fidelity
replication of DNA containing the unnatural base pair also
requires efficient continued primer elongation after incorpo-
ration of the unnatural nucleotide, and inefficient primer ex-
tension after incorporation of an incorrect nucleotide. We
first examined the efficiencies with which Kf extends pri-
mers terminating with a dMMO2 analogue paired opposite
d5SICS or a natural nucleotide by insertion of dCTP oppo-
site dG (Table 1). For comparison, Kf extends dMMO2:
d5SICS (primer:template) with a second-order rate constant
of 1.9ꢁ106 mÀ1 minÀ1. Changing the major groove substituent
from the methyl group of dMMO2 to the methoxy group of
dDMO results in a fourfold increase in extension efficiency.
Unnatural base pair synthesis—insertion of d5SICSTP oppo-
site dMMO2 analogues: To characterize the recognition of
the unnatural nucleotides in the template, we examined the
efficiencies with which Kf inserts d5SICSTP (Table 2). For
reference, d5SICSTP is inserted opposite dMMO2 with an
12652
www.chemeurj.org
ꢀ 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2010, 16, 12650 – 12659

Unnatural Base Pairs
FULL PAPER
Table 2. Second-order rate constants (kcat/KM) for Kf-mediated synthesis and extension of d5SICS paired op-
posite dMMO2 or an analogue in the template.[a]
d5SICS:dTMO is threefold
faster
than
extension
of
Sequence Context I[b]
Sequence Context II[b]
d5SICS:dMMO2. Again, pri-
mers terminating with dG
paired opposite dTMO are not
extended, while the dA:dTMO
and dA:dMMO2 mispairs are
extended with similar efficien-
cies, and the mispairs with dT
or dC paired opposite dTMO
are extended an order of mag-
nitude slower than when paired
opposite dMMO2. Surprisingly,
the d5SICS:dFMO pair is ex-
tended 70-fold less efficiently
than d5SICS:dMMO2. More-
over, all of the mispairs be-
tween a natural nucleotide and
dFMO are extended with rates
slower than 7.8ꢁ103 mÀ1 minÀ1,
revealing that both correct
pairs and mispairs with dFMO
in the template are extended
only poorly by Kf.
X
Y
Synthesis
Extension
X
Y
Synthesis
Extension
[mÀ1 minÀ1
]
[mÀ1 minÀ1
]
[mÀ1 minÀ1
]
[mÀ1 minÀ1
]
dMMO2 d5SICS[c]
dMMO2 dMMO2[c]
dMMO2 dA[c]
dMMO2 dC[c]
4.7ꢁ107
1.2ꢁ105
6.7ꢁ105
5.3ꢁ103
4.6ꢁ104
1.2ꢁ106
dMMO2 d5SICS[d]
dMMO2 dMMO2[d]
dMMO2 dA[d]
6.6ꢁ107
1.8ꢁ106
1.7ꢁ106
<1.0ꢁ103[e]
1.1ꢁ104
1.0ꢁ105
1.7ꢁ106
<1.0ꢁ103[e]
<1.0ꢁ103[e]
<1.0ꢁ103[e]
1.5ꢁ107
dMMO2 dC[d]
3.0ꢁ103
4.4ꢁ105
dMMO2 dG[c]
dMMO2 dT[c]
<1.0ꢁ103[f] dMMO2 dG[d]
7.9ꢁ103
<1.0ꢁ103[e]
2.0ꢁ106
6.6ꢁ105
2.6ꢁ106
dMMO2 dT[d]
dDMO d5SICS
5.2ꢁ103
dDMO
dDMO
dDMO
dDMO
dDMO
dDMO
dTMO
dTMO
dTMO
dTMO
dTMO
dTMO
dFMO
dFMO
dFMO
dFMO
dFMO
dFMO
d5SICS
dDMO
dA
dC
dG
9.7ꢁ107
1.3ꢁ106
7.1ꢁ104
<1.0ꢁ103[f] dDMO
dDMO
dA
dC
dG
dT
1.6ꢁ105
<1.0ꢁ103[e]
6.9ꢁ103
8.3ꢁ104
1.1ꢁ105
1.3ꢁ106
dDMO
dDMO
8.4ꢁ105
<1.0ꢁ103[e]
<1.0ꢁ103[e]
2.5ꢁ103
<1.0ꢁ103[e]
<1.0ꢁ103[e]
1.8ꢁ103
1.1ꢁ106
<1.0ꢁ103[e] dDMO
<1.0ꢁ103[e]
9.7ꢁ104
dT
2.4ꢁ105
1.9ꢁ106
dDMO
d5SICS
dTMO
dA
dC
dG
2.7ꢁ107
not measured
8.3ꢁ103
8.5ꢁ105
5.3ꢁ104
2.5ꢁ103[f]
3.0ꢁ103
2.2ꢁ105
<1.0ꢁ103[e]
3.6ꢁ104
dT
1.5ꢁ103
d5SICS
dFMO
dA
dC
dG
4.9ꢁ105
9.1ꢁ103
<1.0ꢁ103[e]
7.1ꢁ105
<1.0ꢁ103[e]
7.0ꢁ103
7.5ꢁ103[f]
9.0ꢁ103
4.9ꢁ103
<1.0ꢁ103[e]
5.2ꢁ103
dT
2.2ꢁ104
[a] In all cases “X” is the nucleotide in the template. For synthesis, “Y” corresponds to the triphosphate insert-
ed, and for extension, it corresponds to the nucleotide at the nascent primer terminus. [b] For actual sequence
see Table 1. [c] Taken from reference [8]. [d] Taken from reference [9]. [e] Below the limit of detection. [f] Ki-
netic parameters were calculated based on n+2 product, as dCTP is inserted slowly against the unnatural base
pair and then efficiently against dG, the next nucleotide in the template.
dDMO–d5SICS replication as a
function of sequence context:
The steady-state kinetic data
described above suggest that Kf
recognizes
dDMO–d5SICS
better than dMMO2–d5SICS or
However, the thiomethoxy and furanyl substituents result in
approximately two- and 40-fold reduced efficiencies. Exten-
sion efficiencies of primers terminating with a natural nu-
cleotide paired opposite d5SICS have been reported previ-
ously.[8]
the other derivatized unnatural base pairs. Because the prac-
tical utility of an unnatural base pair depends on its se-
quence-independent replication, we examined replication of
dDMO–d5SICS in a second sequence context, hereafter re-
ferred to as sequence context II. In this context the unnatu-
ral nucleotide is positioned in the template between a 3’-dG
and a 5’-dT (Table 1 and Table 2), as opposed to between a
3’-dT and a 5’-dG as in the context examined above, here-
after referred to a context I.
Unnatural base pair extension—extension of d5SICS paired
opposite dMMO2 analogues: We next examined unnatural
base pair extension with the dMMO2 analogues in the tem-
plate paired opposite either the correct d5SICS nucleotide
or one of the incorrect unnatural or natural nucleotides at
the primer terminus (Table 2). For comparison, Kf extends
primers terminating with d5SICS paired opposite dMMO2
with an efficiency of 6.7ꢁ105 mÀ1 minÀ1. Kf does not effi-
ciently extend primers terminating with the dMMO2 self-
pair or the dG:dMMO2 mispair; however, the mispairs with
dA, dT, and especially dC are extended more efficiently.[8]
We found that primers terminating with d5SICS paired op-
posite dDMO are extended fourfold more efficiently than
when paired opposite dMMO2. Primers terminating with
the dDMO self-pair are extended less efficiently than those
terminating with the dMMO2 self-pair. As with dMMO2,
primers terminating with dG paired opposite dDMO are not
extended at a detectable rate, while primers terminating
with dA are extended slightly faster, and primers terminat-
ing with dT or dC are extended slower. Extension of
For comparison, Kf inserts dMMO2TP opposite d5SICS
in sequence context II with the same efficiency as in con-
A
has a slightly larger effect on dDMOTP insertion, with a
threefold lower efficiency in context II than in context I
(Table 1). Thus, while dDMOTP is inserted opposite d5SICS
in context I better than dMMO2TP, the two triphosphates
are inserted with the same efficiency in context II. Sequence
context also has
a larger effect on the synthesis of
d5SICS:dDMO than on that of d5SICS:dMMO2, in this
case the efficiency of synthesis is increased more than six-
fold, to the remarkable efficiency of 9.7ꢁ107 mÀ1 minÀ1,
which is the most efficient rate for the synthesis of any un-
natural base pair identified to date. In fact this efficiency is
only marginally less than that for a natural base pair in the
same sequence context (3.3ꢁ108 mÀ1 minÀ1). While the effi-
ciencies of mispairing with dDMO (i.e., self-pair formation)
Chem. Eur. J. 2010, 16, 12650 – 12659
ꢀ 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
12653

F. E. Romesberg, T. J. Dwyer et al.
and dA are also increased, they remain more than two-
orders of magnitude less efficient, and the mispairs resulting
from dCTP or dGTP insertion remain undetectable.
tive to insertion opposite either dMMO2 or dTMO. Thus,
for all three polymerases, d5SICSTP is inserted opposite
dMMO2 and dTMO with similar efficiencies, but it is insert-
ed opposite dFMO with an efficiency that is approximately
two-orders of magnitude reduced. These results suggest that
the factors disfavoring dFMO recognition are inherent to
the unnatural base pair.
The effect of sequence context on the Kf-mediated exten-
sion of dDMO–d5SICS was also examined. For comparison,
Kf extends dMMO2:d5SICS in context II approximately six-
fold less efficiently than in context I.[9] However, it generally
extends each mispair with lower efficiency, as well. We find
that dDMO:d5SICS is also extended fivefold less efficiently
in context II. In contrast, Kf extends d5SICS:dMMO2 in
context II threefold more efficiently than in context I, while
it extends each mispair less efficiently, with the exception of
dT:dMMO2, which it extends approximately threefold more
efficiently.[9] We find that Kf extends the d5SICS:dDMO
heteropair with similar efficiencies in both sequence con-
texts. Similar efficiencies were also observed for the exten-
sion of the mispairs with dG, dC, and dT paired opposite
dDMO in the template, but surprisingly, extension of the
mispair with dA is an order of magnitude less efficient in
context II than in context I.
PCR amplification of DNA containing the unnatural base
pairs: We recently showed that DNA containing dMMO2–
d5SICS or dNaM–d5SICS in a variety of sequence contexts
is PCR amplified with good efficiency and fidelity using
multiple thermostable polymerases, including exonuclease-
positive Deep Vent.[15] To further characterize the effects of
the major groove modifications, the Deep Vent-mediated
PCR amplification of DNA containing dDMO–d5SICS,
dTMO–d5SICS, or dFMO–d5SICS was characterized to de-
termine the amplification efficiency (fold amplification of
strand) and fidelity (percentage of strands that retain the
unnatural base pair per doubling) (Table 4 and Figure S2 in
Generality of unnatural base-pair recognition: While deriva-
tization of the nucleobase scaffold commonly results in large
effects on the recognition of the nucleotide as a triphos-
phate, modifications to the templating nucleotide are typi-
cally less perturbative.[9,10] Thus, it is surprising that Kf rec-
ognizes dFMO in the template so poorly, relative to
dMMO2 or dTMO, both during unnatural base pair synthe-
sis and extension. To determine whether this observation is
specific for Kf, or whether it is inherent to the unnatural
base pair itself, we characterized the ability of another
A family polymerase, Taq, as well as a more diverged
B family polymerase, exonuclease-negative Vent, to insert
d5SICSTP opposite dMMO2, dTMO, or dFMO (Table 3).
Table 4. PCR efficiency and fidelity.[a]
Template
Base-pair amplified
Amplification
Fidelity[b]
D1[c]
D1
D1
dMMO2–d5SICS
dDMO–d5SICS
dTMO–d5SICS
dFMO–d5SICS
dA–dT
dDMO–d5SICS
dDMO–d5SICS
dDMO–d5SICS
dMMO2–d5SICS
dDMO–d5SICS
dMMO2–d5SICS
dDMO–d5SICS
224
397
364
121
556
69
130
78
25
99.4
99.8
99.1
91.9
–
95.7
97.9
90.7
97.1
94.4
92.9
97.6
D1
D7[c]
D2
D3
D4
D5[c]
D5
12
52
109
D6[c]
D6
[a] Conditions: 1 ng of the DNA template; dNTPs:dXTPs=600:400 mm,
6 mm MgSO4, 0.03 UmLÀ1 of the enzyme, 8 min extension, 14 cycles.
[b] Calculated from sequencing data as described in Supporting Informa-
tion. [c] Taken from reference [15].
Table 3. Second-order rate constant for incorporation of d5SICSTP
against X in the template by different polymerases.[a]
Polymerase
X
kcat/KM [mÀ1 minÀ1
]
Kf
Kf
Kf
Taq
Taq
U
dMMO2
dTMO
dFMO
dMMO2
dTMO
dFMO
dMMO2
dTMO
dFMO
4.7ꢁ107[b]
2.7ꢁ107
4.9ꢁ105
3.5ꢁ106[c]
6.4ꢁ106
1.8ꢁ104
9.9ꢁ106[c]
5.5ꢁ106
1.1ꢁ105
the Supporting Information; templates range in size from
134 to 149 nucleotides). As predicted by the steady-state
data, dDMO–d5SICS is amplified with highest efficiency
and fidelity, followed by dTMO–d5SICS, and then dFMO–
d5SICS, which is replicated with lower efficiency and fidelity
than is dMMO2–d5SICS. With template D1, where the un-
natural base pair is flanked by a natural dG–dC and dA–dT,
dDMO–d5SICS is amplified with virtually natural like effi-
ciency and fidelity. To examine the sequence dependence of
amplification, dDMO–d5SICS was further characterized
with templates D2–D6 (see Supporting Information for full
sequences). As expected, both efficiency and fidelity de-
creased slightly with increasing dG–dC content of the flank-
ing DNA, as it does with natural sequences,[25,26] but the fact
that it remained high in the randomized sequence context of
duplex D6 suggests that the efficiencies and fidelities are
generally reasonable in different sequence contexts.
Taq
Vent
Vent
Vent
ACHTUNGTRENNUNG
ACHTUNGTRENNUNG
ACHTUNGTRENNUNG
[a] See the experimental section for experimental details. [b] Taken from
reference [8]. [c] Taken from reference [13].
We found that Taq and Vent insert d5SICSTP opposite
dMMO2 with an efficiency of 3.5ꢁ106 and 9.9ꢁ
106 mÀ1 minÀ1, respectively.[13] These two polymerases insert
the same triphosphate opposite dTMO in the template with
similar efficiencies of ꢀ6ꢁ106 mÀ1 minÀ1. However, just as
observed with Kf, the efficiency of d5SICSTP insertion op-
posite dFMO by either Taq or Vent is greatly reduced rela-
12654
www.chemeurj.org
ꢀ 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2010, 16, 12650 – 12659

Unnatural Base Pairs
FULL PAPER
Structures of the unnatural base pairs: To help elucidate the
factors underlying unnatural base pair recognition, we deter-
mined the NMR structure of a 12-mer duplex containing
d5SICS and dMMO2 at the complementary positions 7 and
18 within the duplex (Figure 3, top). Resonance assignments
average sugar pucker (pseudorotation phase angle) of 1378
(Figure S6 in the Supporting Information).
The structure clearly reveals that the unnatural nucleobas-
es pair via partial interstrand intercalation (Figure 4A).
While d5SICS7 stacks well with dT8, it is not well packed
Figure 4. Structure of unnatural base pairs viewed along the helix axis
(left; with sugar hydrogen atoms omitted for clarity) or from the major
groove (right). A) The NMR structure of the dMMO2–d5SICS base pair,
and B–D) the models generated from the parental base pair for dDMO–
d5SICS, dTMO–d5SICS, and dFMO–d5SICS, respectively. A color ver-
sion is provided in Supporting Information.
Figure 3. Top: Sequence of the duplex characterized by NMR and struc-
ture of d5SICS–dMMO2 with atoms labeled. Family of structures
(bottom left) and average structure (bottom right) generated from the
NMR data.
for the duplex followed conventional NOESY based meth-
ods.[27] The NOESY and DQF-COSY spectra suggest that
the unnatural base pair adopts a single, well defined struc-
ture, with only small distortions localized to the region of
with dC6, and instead reaches across the duplex and partially
intercalates into the opposite strand between dMMO218 and
dA17. Correspondingly, the nucleobase moiety of dMMO218
appears to stack rather poorly with both dA17 and dG19, and
instead packs with d5SICS7 from the opposite strand. This
mode of pairing appears to induce an approximately 5 ꢂ
stagger of the d5SICS7 nucleobase relative to that of
dMMO218. The ortho sulfur and methoxy groups are orient-
ed into the minor groove of the duplex, as predicted based
on the expected anti geometry of the nucleotides, which is
confirmed by cross-strand NOEs between dMMO218 CH3/
OCH3 and d5SICS7 HB, between d5SICS7 HB and
dMMO218 HH, as well as the absence of NOEs from HC,
HD, and HE of d5SICS7 to any proton of dMMO218. As fur-
ther support of this nucleotide geometry, the aromatic pro-
tons giving rise to sequential NOEs between aromatic and
C1’ protons along each strand include d5SICS7 HE and
dMMO218 HF. The methoxy group of dMMO218 rotates out
of planarity with the aromatic ring to achieve favorable van
der Waals contact with the polarizable sulfur group of
d5SICS7. This orientation necessarily places the ring substi-
tuted methyl groups of d5SICS7 and dMMO218 in close con-
the unnatural base pair. Following standard protocols,[28]
a
family of 15 structures were generated and used to generate
an average structure (Figure 3 bottom). In the average struc-
ture, both nucleobases of the unnatural base pair are posi-
tioned within the interior of a B-form duplex. Key cross-
peaks in the NOESY spectra that support this conclusion in-
clude: d5SICS7 HD to dC6 H5, dC6 H6, and dC6 C1’H;
dMMO218 CH3 to dG19 H8; d5SICS7 CH3 to A17 H8; and
dMMO218 CH3/OCH3 to dG10 H8, in addition to cross-
strand NOEs between d5SICS7 HB and dMMO218 CH3/
OCH3 and HH (see Figures S3 and S4 in the Supporting In-
formation). However, slight distortions of the duplex, rela-
tive to a canonical B-form duplex, were apparent at the site
occupied by the unnatural base pair. Specifically, relative to
a canonical B-form duplex, the C1’–C1’ distance within the
unnatural base pair is elongated ꢀ3 ꢂ, and the nucleobases
are inclined ꢀ108, tilted ꢀ308, and tipped ꢀ58, with an in-
crease in rise of ꢀ1.5 ꢂ. The deoxyribose rings of the
d5SICS7–dMMO218 adopt a C2’-endo conformation, with an
Chem. Eur. J. 2010, 16, 12650 – 12659
ꢀ 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
12655

F. E. Romesberg, T. J. Dwyer et al.
tact in the major groove. The sum of these interactions pro-
vides favorable hydrophobic packing, but drives the nucleo-
base of dMMO218 out of planarity with dT17 and dG19.
Within the d5SICS7–dMMO218 pair, the aromatic rings are
oriented such that C4 of d5SICS7 is positioned nearly direct-
ly over C3 of dMMO218 (Figure 4A).
Discussion
The effort to expand the genetic alphabet is predicated on
the availability of an unnatural base pair that is well repli-
cated and transcribed, and preferably also suitable for modi-
fication such that it may be used to enzymatically produce
site-specifically modified DNA and/or RNA. The data
reveal that dDMO–d5SICS is better replicated by Kf than is
the parental base pair, dMMO2–d5SICS. In the steady-state
experiments, dMMO2TP insertion opposite d5SICS limits
replication, and the ortho-methoxy group of dDMO increas-
es the rate of this step, at least in sequence context I. In the
opposite strand context, where increases in efficiency are
less critical (as it is already very efficient), d5SICSTP is in-
serted opposite dDMO slightly less efficiently than it is op-
posite dMMO2 in sequence context I, but slightly faster in
context II. In fact, the insertion of d5SICSTP opposite
dDMO in context II is the most efficient reported for an un-
natural base pair. Moreover, in both sequence contexts ex-
amined, extension of dDMO–d5SICS is more efficient than
that of dMMO2–d5SICS by approximately a factor of four,
except in the case of the extension with d5SICS in the
primer in sequence context II, in which both unnatural base
pairs were extended with similar efficiencies. In addition, no
mispairs between the unnatural or natural nucleotides and
dDMO are synthesized more efficiently than those with
dMMO2, and in fact, most are synthesized less efficiently.
Finally, the mispairs with dDMO are also generally extend-
ed less efficiently than those with dMMO2, except for the
mispairs with dA in sequence context I and dC in sequence
context II. These individual steps combine to make dDMO–
d5SICS replication significantly higher fidelity than
dMMO2–d5SICS (Table 5).
We next used the structure of d5SICS7–dMMO218 as a
starting point to model the structures of the derivative base
pairs in the same 12-mer duplex. Suitable parameters for
the derivative nucleotides (dDMO, dTMO, and dFMO)
were generated using DFT calculations (B3LYP/6-31G*),[29]
and then dMMO218 was replaced and the resulting duplex
was subjected to unconstrained minimization for up to 5000
steps in the Sander module of AMBER,[30] until the energy
converged (Figure 4B–D). Like the parental unnatural base
pair, each derivative base pair shows a similar level of inter-
strand intercalation. While the increased major groove bulk
of dFMO18 appears to introduce some additional local per-
turbations, none of the structures predict significant distor-
tions relative to the structure of DNA containing the paren-
tal base pair. The minor groove interactions between the
methoxy and sulfur groups are conserved in all of the struc-
tures. While the overall structure of the base pairs in the
major groove is also conserved, with the para substituent of
the dMMO2 analogue stacking against the methyl/aromatic
portion of d5SICS7, the models reveal differences in the
stacking interactions that result from derivatization. The
para-methoxy group of dDMO18 appears to rotate so that
the methyl group packs against the methyl group of d5SICS7
and the oxygen lone pairs are oriented into the major
groove. The increased size and hydrophobicity of the sulfur
substituent of dTMO appears to preclude packing of the
methyl group with d5SICS7, and instead the sulfur atom
packs with d5SICS7 and the hydrophobic methyl group is
oriented into the major groove. In contrast to dDMO, the
cyclic aryl ether bond of dFMO is unable to rotate and thus
the lone pairs of the oxygen atom are forced toward the
methyl group of d5SICS7. Furthermore, packing with the
flanking dC6–dG19 pair isolates this oxygen and precludes it
from potentially engaging in stabilizing interactions with
water or metal ions within the major groove.
The improved recognition of dDMO–d5SICS relative to
the other unnatural base pairs, including dMMO2–d5SICS,
is also apparent in the PCR data. Importantly, the efficien-
cies and fidelities of dDMO–d5SICS amplification appear to
be sufficient for in vitro applications.[31] For example,
dDMO–d5SICS appears to be uniquely suited for the site
specific labeling of DNA (and possibly RNA[11]) within a
format compatible with PCR (or transcription). Along with
analogous modifications of (d)5SICS, this should allow the
Table 5. Minimum single step and overall replication fidelities.
Primer[a] (Y)
Template[a] (X)
Minimum synthesis fidelity[b]
Minimum extension fidelity[b]
Minimum replication fidelity[c]
Context I
Context II
Context I
Context II
Context I
Context II
d5SICS
dMMO2
d5SICS
dDMO
d5SICS
dTMO
d5SICS
dFMO
dMMO2
d5SICS
dDMO
d5SICS
dTMO
d5SICS
dFMO
d5SICS
390 (dMMO2, dA)
2.8 (dG)
37 (dMMO2, dA)
2.0 (d5SICS, dG)
120 (dA)
0.56 (dC)
4.8 (dT)
2 (dC)
20 (dT)
8.6 (dC)
2.5 (dT)
1.3 (dA)
0.14 (dT)
0.85 (dT)
1.0 (dT)
1.2 (dC)
4.8 (dT)
7100 (dA)
130 (dT)
4300 (dA)
2600 (dT)
1100 (dA)
300 (dT)
5900 (dA)
56 (dT)
180
N
23000 (dA)
280 (dT)
13 (dG)
32 (dA)
12 (dG)
0.69 (dA)
0.19 (dG)
2.1 (d5SICS, dG)
[d]
[d]
[d]
–
–
–
–
–
–
–
–
[d]
[d]
[d]
–
[d]
[d]
[d]
0.90 (dA)
0.26 (dT)
–
[d]
[d]
[d]
–
–
[a] Primer and template sequences correspond to contexts I and II (see Table 1 and Table 2). [b] Minimum synthesis and extension fidelity represents the
ratio of second-order rate constants for the synthesis or extension of the correct unnatural pair to the most efficiently synthesized mispair (shown in pa-
rentheses). [c] Minimum replication fidelity corresponds to the product of the minimum fidelities for synthesis and extension (relative to the most effi-
ciently replicated mispair, shown in parentheses). [d] Not measured.
12656
www.chemeurj.org
ꢀ 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2010, 16, 12650 – 12659

Unnatural Base Pairs
FULL PAPER
site-specific modification of DNA and RNA with two differ-
ent functional groups, which should be useful for variety of
in vitro applications, including SELEX with an expanded ge-
netic alphabet,[32] as well as biophysical studies that rely on
the modification of DNA with multiple biophysical probes.
The mechanism by which DNA polymerases replicate pre-
dominantly hydrophobic unnatural base pairs is of great in-
terest for designing better base pairs, as well as for under-
standing the range of activities possible with these important
enzymes. It has been suggested that shape complementarity
is important;[2–4] however, it is critical to define in what con-
text it is manifest (i.e., the mode of pairing). Shape comple-
mentarity is usually evoked within a natural, Watson–Crick-
like mode of pairing, where two in-plane nucleobases inter-
act in an edge-on manner. Each natural base pair thus
adopts a similar shape that is thought to be uniquely well ac-
commodated by DNA polymerases.[2–4] In contrast, the
model proposed here (Figure 2) evokes a different mode of
base pairing, where instead of interacting edge-to-edge,
where little to no stabilization is available, the nucleobases
partially interstrand intercalate during base pair synthesis,
which is likely driven by their high stacking potential. How-
ever, extension of the nascent unnatural base pair requires
deintercalation to position the primer terminus 3’-OH ap-
propriately for continued elongation. While deintercalation
is favored by a stabilizing hydrogen-bond between the poly-
merase and the ortho substituents of the nucleobase ana-
logues,[33–38] the model emphasizes the balance of intercala-
tion propensity that must be possessed by the pairing nu-
volved in base pair recognition are inherent to the base pair
and not dependent on the polymerase supports the interpre-
tation of the structure in terms of replication.
The structural models highlight the importance of how
the different substituents affect the partitioning of the un-
natural nucleobases between intercalated and deintercalated
states, which appear to be required for synthesis and exten-
sion, respectively. In the intercalated state, the major groove
substituents form a central part of the nucleobase packing
interface, but upon deintercalation, these substituents are
more solvent exposed in a more traditional-like major
groove. The models suggest that the more efficient replica-
tion of dDMO–d5SICS results from an optimized balance of
forces governing the stability of the intercalated and deinter-
calated states. Synthesis is likely favored by optimized pack-
ing interactions between the major groove methyl groups of
dDMO and d5SICS. In addition, the structure adopted by
dDMO orients the oxygen lone pairs toward the major
groove, where upon deintercalation, they may engage in sta-
bilizing interactions with proximal water molecules and/or
metals, thus favoring unnatural base pair extension. While
anisole is generally not a strong metal ligand or hydrogen-
bond acceptor due to electron delocalACTHNUTRGENNUGizaAHCTUNGTERNNtUGN ion, both interac-
tions are favored when the conjugation is disrupted by rota-
tion,[39–42] as is observed in the modeled structure of dDMO–
d5SICS. The increased substituent size of dTMO appears to
induce subtle structural changes without any significant
affect on replication. In contrast, the cyclic structure of
dFMO appears to force the oxygen lone pairs directly into
the hydrophobic interface between the nucleobases, which is
likely destabilizing.[43–45] Moreover, if the furanyl oxygen is
solvated as the free triphosphate,[46,47] then this stabilizing
solvation will be lost upon insertion without being replaced
with any other favorable interactions. Moreover, deinterca-
lation is expected to force the hydrophobic methines further
into the hydrophilic major groove, which is likely further de-
stabilizing. Thus, with the aid of the structural models, the
intercalative mechanism nicely explains the relatively large
effects of the modifications on unnatural base pair synthesis
and extension.
ACHTUNGTRENNUNGcleobases: they must intercalate sufficiently for synthesis,
but not so much that extension is inhibited. This model
nicely explains a large body of previously reported kinet-
ic[5–10] and structural data.[12]
The solution structure of the parental dMMO2–d5SICS
pair, as well as the derivative model structures of the
dDMO–d5SICS, dTMO–d5SICS, and dFMO–d5SICS pairs
in duplex DNA supports the intercalative model of replica-
tion (Figure 2). The structures clearly reveal that the nucleo-
tides are accommodated within a B-form duplex, adopt anti-
orientations about their glycosidic bonds, and importantly,
pair in an intercalative manner. The data further reveal that
the stacking interface between the nucleobases is comprised
of the methyl group and proximal portion of the associated
aromatic ring of d5SICS and the para substituent of
dMMO2 or a dMMO2 analogue. It should be emphasized
that the structures suggest that the unnatural nucleobase an-
alogues only partially intercalate, they do not fully insert
into the opposite strand due to their size and the constraints
imposed by the duplex (nonetheless, we refer to the interac-
tion as intercalation for simplicity). Importantly, it is clear
that the various substituents examined are predicted to be
positioned within the stacking interface between the unnatu-
ral nucleobases, which accounts for their effects on replica-
tion. It should also be emphasized that the structural data is
based on the analogues embedded within a duplex, and not
at a primer terminus bound to a DNA polymerase. Howev-
er, the fact that at least some of the specific interactions in-
Conclusion
We have identified dDMO–d5SICS as an unnatural base
pair that is better replicated than the parental dMMO2–
d5SICS pair. In addition structural studies support an inter-
calative model of replication, as previously proposed based
on kinetic data[9] and help to explain the observed effects of
the various modifications. The intercalative mode of pairing
is likely not limited to the analogues examined in the pres-
ent work. Indeed, it is similar to that observed in the DNA
zipper motif, where alternating natural nucleobases are in-
terdigitated, as opposed to interacting in an edge-on
manner.[48–56] Moreover, a similar mode of pairing has been
observed previously by our group,[12] as well as by the Leu-
mann group[57] with unnatural nucleotides bearing large aro-
Chem. Eur. J. 2010, 16, 12650 – 12659
ꢀ 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
12657

F. E. Romesberg, T. J. Dwyer et al.
(Bio-Rad) with a total volume of 25 mL under the following thermal cy-
cling conditions: 948C, 30 s; 488C, 30 s; 658C, 8 min, 14 cycles. Upon
completion, PCR products were purified utilizing the PureLinkTM PCR
purification kit (Invitrogen), quantified by fluorescent dye binding
(Quant-iT dsDNA HS Assay kit, Invitrogen) and sequenced on 3730
DNA Analyzer (Applied Biosystems) to determine the fidelity of un-
natural base pair replication (see Supporting Information and refer-
ence[15] for details).
matic nucleobase analogues. However, in these cases the ex-
tended aromatic surface area of the nucleobase analogues
likely makes intercalation or extrusion from the duplex the
only viable options. The intercalative mode of pairing ob-
served between d5SICS and the dMMO2 derivatives occurs
despite their potential in-plane accommodation. It is likely
that such an intercalative mode of pairing is common to all
analogues that are incapable of engaging in stabilizing edge-
on interactions. It is also possible that some mispairs be-
tween natural nucleotides may be synthesized in a similar
manner. Regardless of its potential contribution to the repli-
cation of natural DNA, the elucidation of the intercalative
mode of pairing should prove invaluable for the further op-
timization of the unnatural base pairs as well as for our un-
derstanding of the potential substrate repertoires of DNA
polymerases in general.
Structural studies: Lyophilized duplex DNA containing the dMMO2–
d5SICS unnatural base pair was dissolved in buffer containing 10 mm
sodium phosphate, pH 7.0, 100 mm NaCl, and 0.1 mm EDTA in 99.99%
D2O to a final analyte concentration of 2 mm. All NMR spectra were ac-
quired at 258C to resolve as much cross peak overlap as possible on a
Varian Inova 500 MHz spectrometer. Proton resonance assignments were
made according to established procedures. NOESY spectra with a mixing
time of 300 ms were collected with a spectral width of 5913 Hz, 2048
complex points in t2 and 512 t1 increments (zero filled to 2048 on process-
ing); for each t1 value 64 scans were averaged using a recycle delay of 2 s.
The approach for computing the structure for the d5SICS–dMMO2
duplex was patterned as described.[28,58] Forcefield parameters for d5SICS
and dMMO2 were calculated using Gaussian 98.[29] All energy minimiza-
tion and restrained molecular dynamics (rMD) calculations were per-
formed with the SANDER module of AMBER9.[30] A total of 373 con-
straints were applied (including Watson–Crick hydrogen bonding con-
straints, 346 NMR-derived distance restraints and torsion restraints for
each sugar moiety) during rMD. Structures of duplexes containing
d5SICS:dDMO, d5SICS:dTMO, and d5SICS:dFMO shown in Figure 4
were modeled from the NMR determined d5SICS:dMMO2 structure.
Briefly, each nucleobase (DMO, TMO, FMO) was subjected to DFT cal-
culations to obtain charge distribution and geometrical parameters.
These analogues were used to replace dMMO2 in the NMR structure
and each duplex was then minimized (unconstrained) for up to 5000
steps in the Sander module of AMBER,[30] until the energy converged.
Experimental Section
Synthetic methods: dFMO and dTMO were synthesized as described in
Supporting Information and dDMO was synthesized as described previ-
ously.[7] Briefly, the corresponding arylbromides were lithiated and cou-
pled to 3,5-di-(tert-butyldimethylsilyloxy)-2-deoxy-erythropentofuranose
(Scheme S1 in the Supporting Information). After deprotection with
TBAF, anomeric mixtures of nucleosides were obtained, and the b-
anomer was purified by column chromatography. Nucleosides were con-
verted to triphosphates by POCl3 treatment in the presence of proton
sponge, followed by reaction with tributylammonium pyrophosphate.
Phosphoramidites of FMO and TMO were obtained from the free nu-
cleosides by 5’ DMT protection and reaction with 2-cyanoethyl N,N-di-
ACHTUNGTRENNUNGisopropylchlorophosphoramidite. Oligonucleotides were synthesized by
standard solid phase synthesis on controlled pore glass supports. Experi-
mental details together with characterization of all nucleosides, phosphor-
amidites, oligonucleotides, and triphosphates are provided in the Sup-
porting Information.
Acknowledgements
Funding for this work was provided by the National Institutes of Health
(GM060005). The NMR facility at USD was established with a grant
from the NSF-MRI program (0417731).
Kinetic assays: Primer oligonucleotides were 5’-radiolabeled with T4
polynucleotide kinase (New England Biolabs) and [g-32P]-ATP (Amer-
sham Biosciences) and annealed to template oligonucleotides by heating
to 958C followed by slow cooling. Reactions were initiated by adding a
solution of 2ꢁdNTP solution (5 mL) to a solution containing polymerase
(0.15–1.23 nm) and primer template (40 nm) in reaction buffer (5 mL, see
Supporting Information for details). After incubation at 258C (Kf) or
508C (Taq and Vent) for 3–10 min the reactions were quenched with
20 mL of loading dye (95% formamide, 20 mm EDTA, bromophenol
blue, and xylene cyanole), reaction products were resolved by 15% poly-
acrylamide gel electrophoresis, and gel band intensities corresponding to
the extended and unextended primers were quantified by phosphorimag-
ing (Storm Imager, Molecular Dynamics) and Quantity One software
(Bio-Rad). Plots of kobs versus triphosphate concentration were fit to a
Michaelis–Menten equation using the program Origin (Microcal Soft-
ware) to determine Vmax and KM. kcat was determined from Vmax by nor-
malizing by the total enzyme concentration. Each reaction was run in
triplicate and standard deviations for both KM and kcat were determined
(see Tables S1–S4 in the Supporting Information). Representative raw ki-
netic data are shown in Figure S1 in the Supporting Information.
[1] J. D. Watson, F. H. C. Crick, Nature 1953, 171, 737–738.
[2] M. F. Goodman, Proc. Natl. Acad. Sci. USA 1997, 94, 10493–10495.
[3] J. C. Morales, E. T. Kool, Nat. Struct. Biol. 1998, 5, 950–954.
[4] A. T. Krueger, E. T. Kool, Curr. Opin. Chem. Biol. 2007, 11, 588–
594.
[5] D. L. McMinn, A. K. Ogawa, Y. Wu, J. Liu, P. G. Schultz, F. E. Ro-
mesberg, J. Am. Chem. Soc. 1999, 121, 11585–11586.
[6] C. Yu, A. A. Henry, F. E. Romesberg, P. G. Schultz, Angew. Chem.
2002, 114, 3997–4000; Angew. Chem. Int. Ed. 2002, 41, 3841–3844.
[7] S. Matsuda, A. M. Leconte, F. E. Romesberg, J. Am. Chem. Soc.
2007, 129, 5551–5557.
[8] A. M. Leconte, G. T. Hwang, S. Matsuda, P. Capek, Y. Hari, F. E.
Romesberg, J. Am. Chem. Soc. 2008, 130, 2336–2343.
[9] Y. J. Seo, G. T. Hwang, P. Ordoukhanian, F. E. Romesberg, J. Am.
Chem. Soc. 2009, 131, 3246–3252.
[10] Y. J. Seo, F. E. Romesberg, ChemBioChem 2009, 10, 2394–2400.
[11] Y. J. Seo, S. Matsuda, F. E. Romesberg, J. Am. Chem. Soc. 2009, 131,
5046–5047.
PCR amplification: DNA duplexes used as templates in PCR amplifica-
tion reactions were synthesized as described previously.[15] PCR amplifi-
cation of duplexes D1-D6 (see Table 4 in the main text for details and
Supporting Information for sequences) was carried out in 1ꢁThermoPol
reaction buffer (New England Biolabs) with the following modifications:
MgSO4 (6.0 mm), natural dNTP (0.6 mm), unnatural triphosphate
(0.4 mm), primers (1 mm each, see Supporting Information for sequences),
and 0.03 unitmLÀ1 of DeepVent (exo+) in an iCycler Thermal Cycler
[12] S. Matsuda, J. D. Fillo, A. A. Henry, P. Rai, S. J. Wilkens, T. J.
Dwyer, B. H. Geierstanger, D. E. Wemmer, P. G. Schultz, G. Sprag-
gon, F. E. Romesberg, J. Am. Chem. Soc. 2007, 129, 10466–10473.
[13] G. T. Hwang, F. E. Romesberg, J. Am. Chem. Soc. 2008, 130, 14872–
14882.
[14] A. M. Leconte, F. E. Romesberg in Protein Engineering (Ed.:
C. K. a. U. L. RajBhandary), Springer, Berlin, 2009, pp. 291–314.
12658
www.chemeurj.org
ꢀ 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2010, 16, 12650 – 12659

Unnatural Base Pairs
FULL PAPER
[15] D. A. Malyshev, Y. J. Seo, P. Ordoukhanian, F. E. Romesberg, J. Am.
Chem. Soc. 2009, 131, 14620–14621.
[16] T. Mitsui, A. Kitamura, M. Kimoto, T. To, A. Sato, I. Hirao, S. Yo-
koyama, J. Am. Chem. Soc. 2003, 125, 5298–5307.
[17] I. Hirao, Curr. Opin. Chem. Biol. 2006, 10, 622–627.
[18] I. Hirao, M. Kimoto, T. Mitsui, T. Fujiwara, R. Kawai, A. Sato, Y.
Harada, S. Yokoyama, Nat. Methods 2006, 3, 729–735.
[19] I. Hirao, T. Mitsui, M. Kimoto, S. Yokoyama, J. Am. Chem. Soc.
2007, 129, 15549–15555.
[31] S. Klussmann, The Aptamer Handbook: Functional Oligonucleotides
and Their Applications, Wiley-VCH, Weinheim, 2006.
[32] A. D. Keefe, S. T. Cload, Curr. Opin. Chem. Biol. 2008, 12, 448–456.
[33] J. C. Morales, E. T. Kool, J. Am. Chem. Soc. 1999, 121, 2323–2324.
[34] J. C. Morales, E. T. Kool, J. Am. Chem. Soc. 2000, 122, 1001–1007.
[35] Y. Li, G. Waksman, Protein Sci. 2001, 10, 1225–1233.
[36] T. E. Spratt, Biochemistry 2001, 40, 2647–2652.
[37] A. S. Meyer, M. Blandino, T. E. Spratt, J. Biol. Chem. 2004, 279,
33043–33046.
[20] M. Kimoto, R. Kawai, T. Mitsui, S. Yokoyama, I. Hirao, Nucleic
Acids Res. 2008, 37, e14.
[38] M. D. McCain, A. S. Meyer, S. S. Schultz, A. Glekas, T. E. Spratt,
Biochemistry 2005, 44, 5647–5659.
[21] M. Chiaramonte, C. L. Moore, K. Kincaid, R. D. Kuchta, Biochem-
istry 2003, 42, 10472–10481.
[39] I. Nobeli, S. L. Yeoh, S. L. Price, R. Taylor, Chem. Phys. Lett. 1997,
280, 196–202.
[22] K. Kincaid, R. D. Kuchta, Nucleic Acids Res. 2006, 34.
[23] Unnatural triphosphate insertion opposite an unnatural base in the
template obviously results in the synthesis of the unnatural base
pair, thus unnatural triphosphate insertion and unnatural base-pair
synthesis in a specific primer:template strand context are used inter-
changeably throughout this manuscript.
[24] M. Hocek, M. Fojta, Org. Biomol. Chem. 2008, 6, 2233–2241.
[25] L. L. Hansen, J. Justensen in PCR Primer: A Laboratory Manual
(Eds.: C. W. Diffenbach, G. S. Dveksler), Cold Spring Harbor Labo-
ratory Press, Woodbury, 2003, pp. 226–235.
[40] B. Reimann, K. Buchhold, H. D. Barth, B. Brutschy, P. Tarakeshwar,
K. S. Kim, J. Chem. Phys. 2002, 117, 8805–8822.
[41] M. Becucci, G. Pietraperzia, M. Pasquini, G. Piani, A. Zoppi, R.
Chelli, E. Castellucci, W. Demtroeder, J. Chem. Phys. 2004, 120,
5601–5607.
[42] J. W. Ribblett, W. E. Sinclair, D. R. Borst, J. T. Yi, D. W. Pratt, J.
Phys. Chem. A 2006, 110, 1478–1483.
[43] R. A. Friedman, B. Honig, Biophys. J. 1995, 69, 1528–1535.
[44] K. S. C. Reid, P. F. Lindley, J. M. Thornton, FEBS Lett. 1985, 190,
209.
[26] B. Arezi, W. Xing, J. A. Sorge, H. H. Hogrefe, Anal. Biochem. 2003,
321, 226–235.
[27] D. R. Hare, D. E. Wemmer, S. H. Chou, G. Drobny, B. R. Reid, J.
Mol. Biol. 1983, 171, 319–336.
[28] J. A. Smith, L. Gomez-Paloma, D. A. Case, W. J. Chazin, Magnet.
Res. Chem. 1996, 34, S147–S155.
[29] Gaussian 98, Revision A.7, M. J. Frisch, G. W. Trucks, H. B. Schlegel,
G. E. Scuseria, M. A. Robb, J. R. Cheeseman, V. G. Zakrzewski,
[45] M. Egli, S. Sarkhel, Acc. Chem. Res. 2007, 40, 197–205.
[46] C. Glidewell, C. M. Zakaria, G. Ferguson, Acta Crystallogr. Sect. C
1996, 52, 1305–1309.
[47] T. Nakanaga, F. Ito, J. Phys. Chem. A 1999, 103, 5440–5445.
[48] S. H. Chou, L. M. Zhu, B. R. Reid, J. Mol. Biol. 1994, 244, 259–268.
[49] W. Shepard, W. B. T. Cruse, R. Fourme, E. de La Fortelle, T.
Prange, Structure 1998, 6, 849–861.
[50] S. H. Chou, Y. Y. Tseng, J. Mol. Biol. 1999, 285, 41–48.
[51] N. A. Spackova, I. Berger, J. Sponer, J. Am. Chem. Soc. 2000, 122,
7564–7572.
[52] S. H. Chou, K. H. Chin, J. Mol. Biol. 2001, 314, 139–152.
[53] S. H. Chou, K. H. Chin, J. Mol. Biol. 2001, 312, 753–768.
[54] S. H. Chou, K. H. Chin, A. H. J. Wang, Nucleic Acids Res. 2003, 31,
2461–2474.
[55] J. Kondo, S.-i. Umeda, K. Fujita, T. Sunami, A. Takenaka, J. Syn-
chrotron Radiat. 2004, 11, 117–120.
[56] T. Sunami, J. Kondo, I. Hirao, K. Watanabe, K.-i. Miura, A. Takena-
ka, Acta Crystallogr. Sect. D 2003, 60, 90–96.
[57] Z. Johar, A. Zahn, C. J. Leumann, B. Jaun, Chem. Eur. J. 2008, 14,
1080–1086.
[58] D. A. Pfaff, K. M. Clarke, T. A. Parr, J. M. Cole, B. H. Geierstanger,
D. C. Tahmassebi, T. J. Dwyer, J. Am. Chem. Soc. 2008, 130, 4869–
4878.
J. A. MontgomACHTUNGTRENNUNGery, Jr., R. E. Stratmann, J. C. Burant, S. Dapprich,
J. M. Millam, A. D. Daniels, K. N. Kudin, M. C. Strain, O. Farkas, J.
Tomasi, V. Barone, M. Cossi, R. Cammi, B. Mennucci, C. Pomelli,
C. Adamo, S. Clifford, J. Ochterski, G. A. Petersson, P. Y. Ayala, Q.
Cui, K. Morokuma, D. K. Malick, A. D. Rabuck, K. Raghavachari,
J. B. Foresman, J. Cioslowski, J. V. Ortiz, B. B. Stefanov, G. Liu, A.
Liashenko, P. Piskorz, I. Komaromi, R. Gomperts, R. L. Martin,
D. J. Fox, T. Keith, M. A. Al-Laham, C. Y. Peng, A. Nanayakkara,
C. Gonzalez, M. Challacombe, P. M. W. Gill, B. G. Johnson, W.
Chen, M. W. Wong, J. L. Andres, M. Head-Gordon, E. S. Replogle,
J. A. Pople, Gaussian, Inc., Pittsburgh, PA, 1998.
[30] AMBER 9, D. A. Case, T. A. Darden, T. E. I. Cheatham, C. L. Sim-
merling, R. E. Wang, R. E. Duke, R. Luo, M. Crowley, R. C.
Walker, W. Zhang, B. Wang, S. Hayik, A. Roitberg, G. Seabra, K. F.
Wong, F. Paesani, X. Wu, S. R. Brozell, V. Tsui, H. Gohlke, L. Yang,
C. Tan, J. Mongan, V. Hornak, G. Cui, P. Beroza, D. H. Mathews, C.
Schafmeister, W. S. Ross, P. A. Kollman, University of California,
San Francisco, 2006.
Received: April 14, 2010
Published online: September 21, 2010
Chem. Eur. J. 2010, 16, 12650 – 12659
ꢀ 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
12659