Synthesis and study of 2-amino-7-bromofluorenes modified with nitroxides and their precursors as dual anti-amyloid and antioxidant active compounds

Article abstract of DOI:10.1016/j.ejmech.2011.01.059

A series of 2-aminofluorenes N-alkylated with nitroxides or their precursors were synthesized. The new compounds were tested on hydroxyl radical and peroxyl radical scavenging ability and inflammatory assay on the endothelial brain cells. In agreement with ROS scavenging ability the same compound 7-bromo-N -[(1-Oxyl-2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridine-4yl)methyl]- 9H-fluoren-2-amine (3b) and its hydroxylamine salt (3b/OH/HCl) showed the anti-inflammatory property on the endothelial brain cells.

Full text of DOI:10.1016/j.ejmech.2011.01.059

European Journal of Medicinal Chemistry 46 (2011) 1348e1355
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Original article
Synthesis and study of 2-amino-7-bromofluorenes modified with nitroxides and
their precursors as dual anti-amyloid and antioxidant active compounds
,
Tamás Kálai a, Jitka Petrlova b, Mária Balog a, Hnin Hnin Aung c, John C. Voss b, Kálmán Hideg a
*
a Institute of Organic and Medicinal Chemistry, University of Pécs, Szigeti st. 12, H-7624 Pécs, Hungary
b Department of Biochemistry and Molecular Medicine, School of Medicine, University of California Davis, One Shields Avenue, 4303 Tupper Hall Davis, CA 95616-8635, USA
c Division of Cardiovascular Medicine, Department of Internal Medicine, University of California Davis, Davis, CA 95616, USA
a r t i c l e i n f o
a b s t r a c t
Article history:
A series of 2-aminofluorenes N-alkylated with nitroxides or their precursors were synthesized. The new
compounds were tested on hydroxyl radical and peroxyl radical scavenging ability and inflammatory
assay on the endothelial brain cells. In agreement with ROS scavenging ability the same compound 7-
bromo-N e[(1-Oxyl-2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridine-4yl)methyl]-9H-fluoren-2-amine (3b)
and its hydroxylamine salt (3b/OH/HCl) showed the anti-inflammatory property on the endothelial
brain cells.
Received 12 August 2010
Received in revised form
14 January 2011
Accepted 26 January 2011
Available online 3 February 2011
Ó 2011 Published by Elsevier Masson SAS.
Keywords:
Alzhemer’s disease
Antioxidants
Free radicals
Nitroxides
Spin trapping
1. Introduction
membranes [8], as well as changes in membrane fluidity in indi-
viduals at risk for AD [9].
Research on senile dementia and Alzhemer’s disease (AD)
covers an extremely broad range of scientific activities. [1]
Attaching a nitroxide to structures that have high affinity for Ab
not only has potential for biophysical characterization of AD
etiology, but also provides dual-action potential based on its unique
ability to scavenge reactive oxygen species. As established in
laboratory and clinical studies, reactive oxygen and nitrogen
species represent major intermediary species in AD progression
pathways that ultimately lead to neurodegeneration. In fact, accu-
mulating evidence points to oxidative stress as the ultimate
Formation of
contributing factor in the pathogenesis of AD. A
toxic segment of amyloid A -peptides which forms fibrillary
b-amyloid (Ab) plaques in brain is the major
b
(25-35) is a highly
b
aggregates. The etiology of AD is still not well understood; there-
fore neither prevention strategies nor long-term effective treat-
ment modalities are available for this disease. Detection of A
b
plaques in the brain will be potentially useful in early diagnosis and
monitoring progression of the disease. Identified imaging candi-
dates include Congo red [2], benzothiazoles [3], dimethylamino-
fluorene [4] and stilbenes [5] just to mention a few examples. The
downstream component of Ab-induced toxicity, involving a feed-
back loop that ultimately leads to neuronal self-digestion via
mitochondrial dysfunction, increased Ca2þ levels, protein break-
down, free radical formation and lipid peroxidation [10,11]. Cyclic
nitroxides can be regarded as synthetic, multifunctional antioxi-
dant molecules, owing their unique features to either their reduced
forms, hydroxylamines or their oxidized forms oxoammonium
cations [12]. It has been shown a decade ago [13] that nitroxides
form superoxide dismutase mimetic oxoammonium cations, fol-
lowed by reduction of the latter species with superoxide (eq. (1)
and (2), Fig. 1). Hydroxylamines can act as proton and electron
donor molecules reducing any radical species (eq. (3)). Nitroxides
are also capable of inhibiting .OH formation by oxidizing Fe2þ to
Fe3þ and hence preventing its participation in Fenton-reactions (eq.
(4)) [14]. The fully reduced form of the nitroxide e a sterically
high affinity of these compounds for assemblies of Ab also provide
clues for compounds that may serve as biophysical probes that can
report the molecular events associated with AD. One class of
biophysical probes is the sterically-hindered nitroxides, whose
motion, chemical environment and spatial separation can be
detected by electron paramagnetic resonance (EPR) spectroscopy.
For example, EPR of nitroxides has evaluated the structure and
dynamics of the
Ab peptide [6,7] and its interaction with
* Corresponding author. Tel.: þ36 72 536 221; fax: þ36 72 536 219.
E-mail address: kalman.hideg@aok.pte.hu (K. Hideg).
0223-5234/$ e see front matter Ó 2011 Published by Elsevier Masson SAS.
doi:10.1016/j.ejmech.2011.01.059

T. Kálai et al. / European Journal of Medicinal Chemistry 46 (2011) 1348e1355
1349
OOH + H+
hindered amine e is easily oxidized to nitroxide by various ROS (eq.
(5)) [15]. This nitroxide is in an equilibrium with the hydroxylamine
depending upon oxidative or reductive nature of its environment
(eq. (6)) [16].
+ H2O2
+
(1)
N
N
O
O
While Ab is known to modulate cascades leading to increased
oxidative stress and apotosis, a direct participation of the peptide in
generating ROS has also been identified. Dikalov et al. demon-
O2
R
+
+ O2
(2)
(3)
strated that amyloid
oxidation of hydroxilamines to nitroxides [17] and Butterfield et al.
concluded that A (25-35) peptide displays H2O2 like activity
toward nitroxide spin probes [18]. Thus nitroxides targeted to the
proximity of A at cells may be especially useful.
As far as we know, no study on A aggregate specific ligands,
b peptides can enhance the metal catalyzed
N
N
O
O
b
b
+ RH
N
b
N
OH
such as fluorenes, with antioxidant tag (nitroxide or its precursor)
has been reported yet. These compounds may be useful in diag-
nostics and on the other hand the therapeutic significance of new
compounds as antioxidant (ROS scavenging) molecules are to
prevent or slow the neurodegenerative processes. Reported herein
are preliminary results of the structure-activity relationship,
e.g. ROS scavenging ability and anti-inflammatory properties of
fluorenes modified on amino function with various nitroxides (five-
or six-membered with or without substituents) or their reduced
forms. Current treatments of AD include administration of
nonsteroidal anti-inflammatory drugs, which inhibit the synthesis
of prostaglandins reduce the rate of deterioration of cognitive
functions in patients with advanced AD. Cholinergic drugs are also
O
+ Fe2+
+ Fe3+
+ H+
(4)
(5)
N
OH
N
O
ROS
N
O
N
H
ox
used in the treatment of AD [19]. For example, Ab increases NMDA
(6)
N
O
N
OH
receptor activation, and one of the newer drugs for the treatment of
AD (Memantine) targets NMDA receptors in order to block gluta-
mate excitotoxicity. Among other pathways, over-stimulation of
NMDA receptors activates phospholipase A, leading to elevated
red
Fig. 1. Possible radical scavenging mechanisms and transformations of nitroxides and
pre-nitroxides.
a
Br
+
R Br
NHR
Br
NH2
2a-d
1
3a-d
2, 3
c
a
b
d
Br
R
N
O
N
O
N
N
CH3
O
b
d
Q
3a
Br
N
N
O
H
Q
4
5
c
4, 5
3b
Br
N
H
H
N
H
2Cl
OH
3b/OH/2HCl
Scheme 1. (a) 2a-d (1.0 equiv.), K2CO3 (1.0 equiv.), DMSO, 60 ꢀC, 6 h, 38e45%; (b) (H2CO)n excess, NaBH3CN (6.0 equiv.), AcOH, rt., 18h, then PbO2, O2, 15 min, 64%; (c) Fe (10.0 equiv.),
AcOH, 70 ꢀC, 30 min, 47%; (d) EtOH/HCl, rt., 15 min. 71%.

1350
T. Kálai et al. / European Journal of Medicinal Chemistry 46 (2011) 1348e1355
Fig. 2. Hydroxyl radical scavenging ability of compounds 3-5 by HORAC assay. Distilled water was used as the control sample.
arachidonic acid levels, which in turn generates oxygen free radi-
cals and further activation of phosholipases [20]. In summary,
because Alzheimer’s disease is a multi-factorial disease where
oxidative stress represents a general pathogenic basis for the ulti-
mate neuronal death, developing dual active compounds that both
target the instigator of Alzheimer’s as well the downstream
Hydroxylamine salt of compound 3b/OH/2HCl was achieved
by treatment of radical 3b with ethanol saturated previously with
HCl gas. Compound 3a was methylated on aromatic nitrogen
atom by treatment with paraformaldehyde and cyanoborohydride
as a reducing agent in acetic acid to give compound 4 in 64% yield
[4]. The sterically hindered amine derivative 5 was achieved by
reduction of radical 4 with iron powder in acetic acid [25]
(Scheme 1).
consequences, represents
a novel approach for treating this
complex disease. Thus developing compounds that mitigate more
than one process within the disease pathway are of particular
interest.
3. Results and discussion
Superoxide and hydroxyl radicals are the predominant reactive
oxygen species that cause damage in cells. To evaluate the ability of
our modified fluorenes to decrease the levels of produced hydroxyl
radical, we used a hydroxyl radical antioxidant capacity (HORAC)
2. Chemistry
The key reaction in synthesis of paramagnetic 2-amino-7-bro-
mofluorenes is alkylation of compound 1 with equivalent amount
allylic bromides (2a-d) [21e24] in the presence of K2CO3 in DMSO
at 60 ꢀC offered the monoalkylated products 3a-d in 38e45% yield
(Scheme 1).
assay, that uses
proportional to the level of surviving radical. We therefore
measured the ability of each compound (at 0.2, 1 and 10 M) to
a reporter whose fluorescence is inversely
m
maintain indicator signal in the presence of hydroxyl radical. As
shown in Fig. 2, all of the fluorene compounds have a capability to
scavenge hydroxyl radicals and all three concentrations were
effective, although in general the efficiency of scavenging rises with
the raising concentration of fluorene compounds. The most effec-
tive compounds are 3b, 3b/OH/HCl and 5 (Fig. 2). These findings are
not unexpected, as the hydroxylamine salt compound 3b has
a lower redox potential and is more readily oxidized to nitroxide
(see eq. (3) in Fig. 1.), compared to the corresponding five-
membered, sterically hindered compounds. One of the five-
membered compounds, the amine 5 readily oxidizes to stable
nitroxide (eq. (5) of Fig. 1), which again is in good agreement with
OH
CH3
Br
N
N
O
CH3
KO-162
TEMPOL
Scheme 2. Chemical structure of TEMPOL and KO-162.

T. Kálai et al. / European Journal of Medicinal Chemistry 46 (2011) 1348e1355
1351
Fig. 3. Peroxyl radical scavenging ability of compounds 3-5 by ORAC assay. Distilled water was used as the control sample.
our previous results and assumptions [26]. In general, the hybrid of
the fluorene with the nitroxide/nitroxide precursor provides
superior hydroxyl scavenging activity compared to the base fluo-
rene alone (KO-162; Scheme 2 and Fig. 2), where we have previ-
ously measured antioxidant activity [27]. The same is found when
comparing the hybrids to a nitroxide alone (TEMPOL; Scheme 2 and
Fig. 2), with the exception of the bromo-substituted 3c. We also
determined the efficiency of the compounds to scavenge super-
oxide radicals using the Oxygen Radical Antioxidant Capacity
(ORAC) assay using an indicator whose fluorescence is quenched by
the radical. As shown in Fig. 3, each of the of the fluorene
compounds had some capability to scavenge peroxyl radicals at the
The levels of free radicals in solution can also be detected by EPR
spectroscopy of spin trapping reagents. We used the 5-tert-butox-
ycarbonyl 5-methyl-1-pyrroline N-oxide (BMPO) spin trap due to its
ability to form a more stable and distinctive adduct with superoxide
[28]. The EPR spectra of BMPO adduct with hydroxyl radicals
10
mM concentration. Among the compounds tested, sterically
hindered amines, such as compound 3d and compound 5 were the
most efficient ones. Compounds 3b/OH/HCl and 3c also exhibited
limited activity (Fig. 3). Neither TEMPOL alone nor the base fluo-
rene KO-162 exhibit significant scavenging of peroxyl radicals.
Fig. 5. EPR scans in the presence of the BMPO spin trap of compound 3b/OH/2HCl
(dotted), the BMPO-OOꢁ adduct (gray), and the BMPO-OOꢁ adduct in the presence of
3b/OH/2HCl (black). See text for experimental details.
Table 1
Hydroxyl and peroxyl radical scavenging ability of compounds 3a-d, 4, 5 estimated
by integration of EPR spectral area.
Compound
Hydroxyl radical scavenging Peroxyl radical scavenging
ability (%)a by EPR
ability (%) by EPR
3a (HO-4160)
3b (HO-4191)
3b/OH/2HCl
28
26
61
73
ND
80
(HO-4191/OH/2HCl)
3c (HO-4192)
3d (HO-4198)
4 (HO-4161)
10
29
18
18
ND
100
ND
100
5 (HO-4166)
Fig. 4. EPR scans in the presence of the BMPO spin trap of compound 3b/OH/2HCl
(dotted), the BMPO-ꢁOH adduct (gray), and the BMPO-ꢁOH adduct in the presence of
3b/OH/2HCl (black). See text for experimental details.
a
Based on 3 measuments, accuracy ꢂ 5%. ND: not determined.

1352
T. Kálai et al. / European Journal of Medicinal Chemistry 46 (2011) 1348e1355
ATF3
A
35
30
25
20
15
10
5
#
#
*
#
0
l
a
3
4
5
L
T
L
b
3
d
3
+
+
SO
DM
+
L
L
L
HC
/
+
L
+
L
T+
H
T+
T+
T+
O
T+
T+
/
3b
L+
T+
IL-8
B
2.5
#
2
#
1.5
1
0.5
0
l
5
+
L
T
O
DMS
3a
+
+4
L
+L
L
+3b
+L
HC
/
+3d
+L
T
L
+
T
T+
T+
OH
T
T
/
+3b
+L
T
COX-2
C
4
3
2
1
0
#
#
5
+
L
T
L
O
Cl
3a
+4
3d
+
+
L
L
H
+3b
+L
T+
L
L
H/
T+
T+
DMS
T+
O
T
T+
/
+3b
L
T+
Fig. 6. TGRL lipolysis products induced gene expression was suppressed by compounds in HBMVEC. A) mRNA expression of activating transcription factor (ATF3) was significantly
suppressed by compounds 4 and further induced by compounds 3a and 5 compared to TGRL lipolysis products treated cells. B) mRNA expression of interleukin 8 (IL-8) was
significantly suppressed by compounds 3b compared to TGRL lipolysis products treated cells. C) mRNA expression of cyclooxygenase 2 (COX-2) was significantly suppressed by
compounds 4 compared to TGRL lipolysis products treated cells. N ¼ 3, * ¼ P ꢃ 0.002 and # ¼ ꢃ P 0.05. T ¼ Triglyceride-rich lipoproteins, L ¼ lipoprotein lipase.
(generated via iron(II)-sulfate/H2O2,) is shown in Fig. 4 (gray). The
spectrum of the fluorene compound 3b/OH/2HCl alone is shown in
dotted line. Upon generation of hydroxyl radicals, compound
decreases by 61% the amount of BMPO-hydroxyl adduct (black line)
compared to the sample without a fluorene compound addition
(Fig. 4). An efficient scavenging of the superoxide anion radical was
observed by EPR (Fig. 5). The superoxide anion (generated horse-
radish peroxidase/H2O2)eBMPO adduct (shown in gray) totally
disappears by adding compound 3b/OH/2HCl, while its triplet signal
is increased shown in black. The spectrum of the fluorenecompound
3b/OH/2HCl alone is shown in dotted line (Fig. 5). In agreement with
results from ORAC assay we observe very strong peroxyl scavenging
activity by compounds 3b, 3B/OH/2HCl, 3d and 5 using EPR. Here
again, fluorene compounds 3b/OH/2HCl and 5 most significantly
reduce the EPR signal of hydroxyl radicals (Table 1).
Inflammation has also been implicated in the etiology of AD
[29]. We therefore also evaluated the new compounds for their
ability to down-regulate markers of inflammation in a brain
endothelial cell line. Fig. 6 shows the anti-inflammatory activity of
the compounds according to the expression of 3 marker genes as

T. Kálai et al. / European Journal of Medicinal Chemistry 46 (2011) 1348e1355
1353
measured by RT-PCR. In the assay, genes encoding transcription
factors, activating transcription factor 3 (ATF3) and inflammatory
response genes interleukin 8 (IL-8) and prostaglandin-endoper-
oxide synthase 2 (PTGS2; also known as cyclooxygenase 2 (COX-2))
were activated by TGRL lipolysis products in HBMVEC by 22.8, 1.8
and 3.1-fold, respectively. Compound 4 significantly suppresses
lipolysis product-induced expression of ATF3 and COX-2 by 18.3
and 2.7 fold, respectively. Only a small, but insignificant supression
of IL-8 expression is observed by compound 4. ATF3 and especially
IL-8 expression are also suppressed by compounds 3b/OH/2HCl and
3b. Compounds 3a, 3c, 3d and 5 further increased ATF3, IL-8 and
COX-2 gene expressions.
5.1.1.1. 7-Bromo-N e[(1-Oxyl-2,2,5,5-tetramethyl-2,5-dihydro-1H-
pyrrol-3-yl)methyl]-9H-fluoren-2-amine radical (3a). 130 mg, 40%,
yellowsolid, mp 177e180 ꢀC, Rf:0.32 (hexane-EtOAc, 2:1). MS (EI) m/
z (%): 411/413 (Mþ, 17/17), 381/383 (15/15), 259/261 (100/100), 180
(82).1H NMR of NH form(CD3OD):
d: 1.25 (s, 6H),1.38 (s, 6H), 3.70 (s,
2H), 3.77 (s, 2H) 5.50 (s,1H), 6.63 dd (J ¼ 8.6 Hz, J ¼ 2.2 Hz,1 H), 6.77
(s,1H), 7.34e7.51 (m, 4H).13C NMRof NH form(CD3OD,100 MHz): 2.0
(2C), 3.0 (2C), 10.5, 14.7, 38.6, 41.4, 83.0, 86.3, 91.8, 93.5, 94.6, 101.8,
103.6, 104.3, 105.2, 116.0, 118.7 (2C), 119.0, 123.1.Anal. Calcd. for
C22H24BrN2O C64.08, H5.87, N6.79; found: C 64.00, H5.75, N 6.80.
5.1.1.2. 7-Bromo-N
e[(1-Oxyl-2,2,6,6-tetramethyl-1,2,3,6-hexahy-
dropyridine-4-yl)methyl]-9H-fluoren-2-amine radical (3b). 383 mg,
4. Conclusion
45%, deep yellow solid, mp 177e179 ꢀC, Rf: 0.53 (hexane-EtOAc,
2:1). 1H NMR of NH form(CD3OD):
d: 1.32 (s, 6H),1.37 (s, 6H), 2.13 (s,
A new series of 7-bromo-2-aminofluorene compounds were
synthesized modified by nitroxides and their precursors. Among
the new compounds compound 3b and its hydroxylamine salt 3b/
OH/HCl has both ROS scavenge property (based on HORAC, ORAC
and spin trapping assays) and anti-inflammatory property on the
endothelial brain cells. The fluorene nitroxide precursor hybrid
compounds exhibited superior radical scavenging activity than
TEMPOL or KO-162 (7-bromo-2-dimethylaminofluorene) compo-
unds themselves. Four compounds increased ATF3, IL-8 and COX-2
gene expressions, but three compounds (3b, 3b/OH/HCl, 4) have
beneficial effects on inflammatory processes. The additions of the
anti-oxidant and anti-inflammatory activities to fluorenes that
2H), 3.74 (s, 2H), 3.77 (s, 2H), 5,67 (s, 1H), 6.64 dd (J ¼ 8.6 Hz,
J ¼ 2.2 Hz, 1 H), 6.79 (s, 1H), 7.36e7.55 (m, 4H). 13C NMR of NH form
(CD3OD, 100 MHz): 0.6 (2C), 1.95 (2C), 10.3, 10,5 (2C) 28.16, 29.31,
83.2, 86.4, 91.9, 93.5, 94.6,99.9, 101.8, 103.7, 104.4, 105.9, 116.0, 118.7,
119.0, 122.9. MS (EI) m/z (%): 425/427 (Mþ, 5/5), 395/397 (2/2), 272/
274 (46/45), 259/261 (50/50), 154 (100). Anal. Calcd. for C23H26
BrN2O C64.79, H6.15, N6.57; found: 64.68, H6.02, N 6.39.
-
5.1.1.3. 7-Bromo-N e[(1-Oxyl-4-bromo-2,2,5,5-tetramethyl-2,5-dihy-
dro-1H-pyrrol-3-yl)methyl]-9H-fluoren-2-amineradical(3c). 412 mg,
42%, yellow solid, mp 153e156 ꢀC, Rf: 0.55 (hexane-EtOAc, 2:1). 1H
NMR of NH form(CD3OD): d: 1.28 (s, 6H), 1.30 (s, 6H), 3.74 (s, 2H),
target the toxic assembly of A
b
[27] and its downstream activity
3.93 (s, 2H) 6.64 dd (J ¼ 8.6 Hz, J ¼ 2.2 Hz, 1 H), 6.80 (s, 1H),
7.35e7.54 (m, 4H). 13C NMR of NH form(CD3OD, 100 MHz): 1.9 (2C),
2.4 (2C), 10.5, 15.2, 39.6, 40.3, 82.8, 86.1, 91.8, 93.5, 94.6, 101.8, 101.9,
103.6, 104.2, 115.9, 116.1, 118.7, 119.1, 123.1. MS (EI) m/z (%): 489/491/
493 (Mþ, 5/11/5), 459/461/463 (4/10/4), 272/274(100/100), 259/261
(48/48), 152 (49). Anal. Calcd. for C22H23Br2N2O C53.79, H4.72,
N5.70; found: C53.66, H4.75, N5.54.
provides a novel approach for treating AD. Further investigations
with these compounds are under way.
5. Experimental protocols
5.1. Chemistry
Melting points were determined with a Boetius micro melting
point apparatus and are uncorrected. Elemental analyses (C, H, N, S)
were performed on Fisons EA 1110 CHNS elemental analyzer. Mass
spectra were recorded on a Thermoquest Automass Multi and VG
TRIO-2 instruments and in the EI mode. 1H NMR spectra were
recorded with Varian UNITYINOVA 400 WB spectrometer. Chemical
shifts are referenced to Me4Si. Measurements were run at 298 K
probe temperature in CDCl3 solution. ESR spectra were taken on
Miniscope MS 200 in 10ꢄ4 M CHCl3 solution and monoradicals gave
triplet line.
Flash column chromatography was performed on Merck Kie-
selgel 60 (0.040e0.063 mm). Qualitative TLC was carried out on
commercially available plates (20 ꢅ 20 ꢅ 0.02 cm) coated with
Merck Kieselgel GF254. TEMPOL and all other chemicals were
purchased from Aldrich, compound 2a [21], 2b [22], 2c [23], 2d [24]
and KO-162 [4] was prepared as described earlier. Diamagnetic
forms of 3a, 3b, 3c for NMR study were synthesized as described for
compound 5.
5.1.1.4. 7-Bromo-N e[(1,2,2,5,5-pentamethyl-2,5-dihydro-1H-pyrrol-
3-yl)methyl]-9H-fluoren-2-amine (3d). 312 mg, 38%, beige solid, mp
153e155 ꢀC, Rf: 0.35 (CHCl3-MeOH, 1:1). MS (EI) m/z (%): 410/412
(Mþ, 8/8), 395/397 (12/12), 272/274 (100/100), 124 (94). 1H NMR
(CD3OD): d: 1.22 (s, 6H),1.35 (s, 6H), 2.45 (s, 3H), 3.76 (s, 2H), 3.85 (s,
2H) 5.59 (s, 1H), 6.66 d (J ¼ 7.6 Hz), 6.81 (s, 1H), 7.39e7.55 (m, 4H).
Anal. Calcd. for C23H27BrN2 C67.15, H6.62, N6.81; found: C67.08,
H6.58, N6.72.
5.1.2. 7-Bromo-N-methyl-N e[(2,2,5,5-tetramethyl-2,5-dihydro-
1H-pyrrol-3-yl)methyl]-9H-fluoren-2-amine radical (4)
To a solution of compound 3a(412 mg, 1.0 mmol) and para-
formaldehyde (600 mg) in AcOH (5 mL) NaBH3CN (550 mg,
8.7 mmol) was added in 3 portions for 10 min under well ventilated
hood. The mixture was stirred at rt. for 18h, then poured onto
mixture of 40 g ice and 10% aq. NaOH (40 mL). After melting the ice
the mixture was extracted with CH2Cl2 (2 ꢅ 20 mL), then the
organic phase was dried (MgSO4), PbO2 (100 mg, 0.4 mmol) was
added and O2 was bubbled through the solution for 15 min. The
solution was filtered, evaporated and the residue was purified by
flash column chromatography (hexane/EtOAc) to give the title
compound as a yellow solid 273 mg (64%), mp 174e175 ꢀC, Rf: 0.52
(hexane-EtOAc, 2:1). MS (EI) m/z (%): 425/427 (Mþ, 20/20), 395/397
(7/7), 286/2288 (100/100), 43 (75). Anal. Calcd. for C23H26BrN2O
C64.79, H6.15, N6.57; found: 64.74, H6.10, N 6.41.
5.1.1. Synthesis of compounds 3a, 3b, 3c, 3d; general procedure
A mixture of 7-bromo-2-aminofluorene 1 (520 mg, 2.0 mmol),
K2CO3 (276 mg, 2.0 mmol) and allylic bromide 2a or 2b or 2c or 2d
(2.0 mmol) in DMSO (10 mL) was stirred and heated at 60 ꢀC till the
consumption of starting materials (w6 h). After cooling the mixture
was poured onto water (50 mL), extracted with EtOAc (3 ꢅ 20 mL).
The combined organic layer was washed with water (10 mL), the
organic phase was dried (MgSO4), filtered and evaporated. The
residue was purified by flash column chromatography (hexane/
EtOAc or CHCl3/MeOH) to give the N-alkylated fluorenes in 38e45%
yield.
5.1.3. 7-Bromo-N-methyl-N e[(2,2,5,5-tetramethyl-2,5-dihydro-
1H-pyrrol-3-yl)methyl]-9H-fluoren-2-amine (5)
To a solution of compound 4 (426 mg, 1.0 mmol) in glacial acetic
acid (10 mL) Fe powder (560 mg, 10.0 mmol) was added and the

1354
T. Kálai et al. / European Journal of Medicinal Chemistry 46 (2011) 1348e1355
mixture was warmed up to 70 ꢀC until the reaction started and the
mixture was stirred at rt. for 60 min. After diluting with water
(30 mL) the solution was decanted from iron residue and in
a 250 mL baker the solution was made alkaline (pH ¼ 9) by solid
K2CO3 (intense foaming!). The mixture was extracted with CHCl3/
MeOH (9:1 mixture) (2 ꢅ 20 mL), the organic phase was dried
(MgSO4), filtered and evaporated. The residue was purified by flash
column chromatography (CHCl3:MeOH) to yield the title
compound 193 mg (47%) as a beige solid, mp 160e162 ꢀC, Rf: 0.39
(CHCl3:MeOH, 2:1). MS (EI) m/z (%): 410/412 (Mþ, 18/18), 395/397
5.2.3. Human TGRL isolation
This study was approved by the Human Subjects Review
Committee at the University of California Davis. Postprandial blood
samples were obtained 3.5 h after consumption of a moderately
high fat meal, which corresponds to the peak elevation in plasma
triglyceride concentrations. Triglyceride-rich lipoproteins (TGRL)
were isolated from human plasma at d < 1.0063 g/mL by aspiration
with a narrow-bore pipet followed by 18 h centrifugation at
40,000 rpm in an SW41 Ti swinging bucket rotor (Beckman Coulter,
Sunnyvale, CA) held at 14 ꢀC within a Beckman L8-70M (Beckman)
ultracentrifuge. The top fraction (TGRL) was collected and dialyzed
in Spectrapor membrane tubing (mol wt cut off 3500; Spectrum
Medical Industries, Los Angeles, CA) at 4 ꢀC overnight against
a saline solution containing 0.01%EDTA.
(5/5), 286/288 (100/100), 122 (43). 1H NMR (CD3OD):
d: 1.22 (s, 6H),
1.38 (s, 6H), 3.03 (s, 3H), 3.78 (s, 2H), 3.99 (s, 2H) 5.27 (s,1H), 6.71 dd
(J ¼ 8.6 Hz, J ¼ 2.2 Hz, 1 H), 6.89 (s, 1H), 7.36e7.55 (m, 4H). Anal.
Calcd. for C23H27BrN2 C67.15, H6.62, N6.81; found: 67.05, H6.50, N
6.69.
Lipoprotein lipase (LpL) was purchased from Sigma (catalog no.
L2254). PCR primers were from Operon (Huntsville, AL).
5.1.4. 7-Bromo-N e[(1-hydroxy-2,2,6,6-tetramethyl-1,2,3,6-
hexahydropyridine-4-yl)methyl]-9H-fluoren-2-amine radical
Hydrochloride salt (3b/OH/2HCl)
5.2.4. Cell culture and lipid treatments
Human Brain Microvascular Endothelial Cells (HBMEC) (ACBRI
376) (passage 6, Cell Systems Corp., Kirkland, WA) were cultured in
CSC Complete Serum-Free Medium (SF-4Z0-500) and CSC
Complete Medium which includes 10% serum (4Z0-500); CSC
Attachment FactorÔ (4Z0-210) under an atmosphere of 5% CO2:
95% air and 37 ꢀC. Cells were exposed for 3 h to the following
conditions, media, TGRL (T) (150 mg/dL ¼ 1.5 mg/mL), Lipoprotein
lipase (L) (2 U/mL), and T (150 mg/dL) þ L (2 U/mL) pre-incubated
for 30 min at 37 ꢀC before application. Cells treated with T þ L are
referred as “lipolysis” from here on. To test the suppression of
Compound 3b (426 mg, 1. 0 mmol) was dissolved in 10 mL EtOH
saturated previously with HCl gas and stirred at room temperature
for 15 min, then solvent was evaporated off and the residue was
crystallized from acetone/Et2O solution to give a pale yellow solid
352 mg (71%), mp 202e205 ꢀC 1H NMR (CD3OD):
d: 1.37 (bs, 3H),
1.41 (bs, 3H),1.48 (bs, 6H), 3.85 (s, 2H), 3.92 (s, 2H), 4.00 (s, 2H), 5.78
(s,1H), 7.40 dd (J ¼ 8.0 Hz, J ¼ 2.0 Hz,1 H), 7.58 (s,1H), 7.77e7.98 (m,
4H). Anal. Calcd. for C23H28BrCl2N2O C 55.33, H 5.65, N 5.61; found:
55.20, H 5.80, N 5.40.
compounds, cells were pre-treated with the 200
cated compound for 30 min.
mM of the indi-
5.2. Biology assays
5.2.5. mRNA expression by quantitative RT-PCR (qRT-PCR)
5.2.1. Antioxidant assays
RT-PCR was performed to evaluate the TGRL lipolysis induced
gene expression. After incubation cells were washed with cold PBS
and total RNA was extracted from Control and treated 6-well plate
using RNeasy Mini Kit (Qiagen, Valencia, CA) including the DNA
For
a determination of antioxidant activity of fluorene
compounds Hydroxyl Radical Antioxidant Capacity (HORAC) assay
(Cell Biolabs, INC., USA) was used. The samples were measured by
Fluorescence microplate reader (Molecular Devices, SpectraMax
M2) with a 485 nm excitation filter and 530 nm emission filter. The
samples were prepared according a recommended protocol by the
manufacture. For a determination of antioxidant activity of fluorene
compounds toward peroxyl radicals we use The Oxygen Radical
Antioxidant Capacity (ORAC) assay (Cell Biolabs, INC., USA). The
samples were measured by Fluorescence microplate reader with
a 480 nm excitation filter and 520 nm emission filter. The samples
were prepared according the recommended protocol of the
manufacturer.
digestion step as described by the manufacturer. A 5 mg of total RNA
extracted from each sample was reverse-transcribed to obtain
cDNA using Superscript-III reverse transcriptase kit (Invitrogen,
Carlsbad, CA) as described by the manufacturer. The real-time
polymerase chain reaction (RT-PCR) method with SYBR Green as
fluorescent reporter was used to quantify the gene expression. The
gene specific primers were designed with Primer Express 1.0
software (Applied Biosystems) using designed from published
cDNA sequences as follows: ATF3 (GenBank acc. no. NM_001674):
50-TTCTCCCAGCGTTAACACAAAA-30 (forward) and 50-AGAG-
GACCTGCCATCATGCT-30 (reverse); IL-8 (GenBank acc. no.
NM_000584): 50- CCTTTCCACCCCAAATTTATCA-30 (forward) and 50-
TGGTCCACTCTCAATCACTCTCAG -30 (reverse); PTGS2 (also known
as COX-2) (GenBank acc. no. NM_000963): 50- CTGAATGTGCCA-
TAAGACTGACCT-30 (forward) and 50- TCCACAGATCCCTCAAAA-
CATTT-30 (reverse). The reaction was carried out in 384 well optical
plates containing 25 ng RNA in each well. The applied RNA quantity
was normalized by amplifying cDNA samples simultaneously with
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) specific
primers: 50-CACCAACTGCTTAG-30 (forward) and 50-TGGTCAT-
GAGTCCT-30 (reverse). The transcript levels were measured by real-
time RT-PCR using the ABI PRISM 7700 Sequence detection system
(PE Applied Biosystems, Foster City, CA). The PCR amplification
parameters were: initial denaturation step at 95 ꢀC for 10 min
followed by 40 cycles, each at 95 ꢀC for 15 s (melting) and 60 ꢀC for
1 min (annealing and extension). A comparative CT method [30]
was used to calculate relative changes in gene expression deter-
mined from real-time quantitative PCR experiments (Applied Bio-
systems User Bulletin No.2 (P/N4303859). The threshold cycle, Ct,
5.2.2. EPR measurements
Electron paramagnetic resonance measurements of BMPO spin
traps were collected at room temperature with a JEOL X-band
spectrometer fitted with a loop-gap resonator. For samples con-
taining hydroxyl radicals, 1
H2O2 (3%), 10 l of BMPO (100 mM) and 88
microliters of the ROS mixture was then immediately combined
with 1 l of the fluorene compound (in a 2 mM stock), and
approximately 5 l of the samples was loaded into a sealed quartz
capillary tube. For trapping in the presence of superoxide radicals,
m
l of ammonium iron (II) sulfate, 1
ml of
m
ml of PBS pH 7.4. Nine
m
m
2
ml of Horseradish Peroxidase (10 mg/ml), 2
ml of H2O2 (3%), 2
ml of
l of
Na3N, 2 l of DTPA (100 mM), 46 ml of BMPO (100 mM) and 46
m
m
PBS pH 7.4 were mixed and immediately combined with the fluo-
rene compound (9 l of the mixture and 1 l of 2 mM fluorene). All
m
m
spectra were obtained by averaging two 2 min scans with a sweep
width of 100 G at a microwave power of 3 mW and modulation
amplitude optimized to the natural line width of the spin probe. All
the spectra were recorded at room temperature.

T. Kálai et al. / European Journal of Medicinal Chemistry 46 (2011) 1348e1355
1355
[13] M.C. Krishna, A. Russo, J.B. Mitchell, S. Goldstein, H. Hafni, A. Samuni, Do
nitroxide antioxidants act as scavengers of O2 or as SOD mimics? J. Biol. Chem.
271 (1996) 26026e26031.
[14] J. Glebska, L. Pulaski, K. Gwozdzinski, J. Kolimowski, Structure-activity rela-
tionship studies of protective function of nitroxides in fenton system, Biol.
Met. 14 (2001) 159e170.
[15] P. Twomey, J. Taira, W. DeGraff, J.B. Mitchell, A. Russo, M.C. Krishna,
H.O. Hankovszky, L. Frank, K. Hideg, Direct evidence for in vivo nitroxide free
radical production from a new antiarrhythmic drug by EPR spectroscopy, Free
Rad. Biol. Med. 22 (1997) 909e916.
[16] A. Bobko, I.A. Kirilyuk, I.A. Grigor’ev, J.L. Zweier, V.V. .Khramtsov, Reversible
reduction of nitroxides to Hydroxilamines: roles of ascorbate and glutathione,
Free Rad. Biol. Med. 42 (2007) 404e412.
which correlates inversely with the target mRNA levels, was
measured as the cycle number at which the SYBR Green emission
increases above a preset threshold level. The specific mRNA tran-
scripts were expressed as fold difference in the expression of the
specific mRNAs in RNA samples from the TGRL lipolysis treated cells
compared to those from the TGRL alone treated cells.
Acknowledgments
This work was supported by a grant from Hungarian National
Research Fund (OTKA K 81123) and grant from National Institutes of
Health (R01 AG029246). The authors Krisztina Kish for elemental
analysis and Zoltán Berente (Dept of. Biochemistry and Medicinal
Chemistry, University of Pécs) for NMR measurements.
[17] S.I. Dikalov, M.P. Vitek, K.R. Maples, R.P. Mason, Amiloid
b peptides do not
form peptide-derived free radicals spontaneously, but can enhance metal-
catalyzed oxidation of hydroxylamines to nitroxides, J. Biol. Chem. 274 (1999)
9392e9399.
[18] A.D. Butterfield, L. Martin, J.M. Carney, K. Hensley, A
b(25-35) Peptide Displays
H2O2-like reactivity towards aqueous Fe2þ
,
nitroxide spin probes, and
synaptosomal membrane-proteins, Life Sci. 58 (1995) 217e228.
[19] K.N. Prasad, A.R. Hovland, W.C. Cole, K.C. Prasad, P. Nahreini, J. Prasad-
Edwards, C.P. Andreatta, Multiple antioxidants int he prevention and treat-
ment of alzheimer disease: analysis of biologic rationale, Clin. Neuro-
pharmacol. 23 (2000) 2e13.
References
[1] (a) R. Roetne-Jakob, H. Jacobsen, Alzheimer’s disease: from pathology to
therapeutic approaches, Angew. Chem. 48 (2009) 3030e3059;
(b) M.P. Mattson, Pathways towards and away from Alzheimer’s disease,
Nature 430 (2004) 631e639.
[20] A.A. Farooqui, H.C. Yang, L. Horrocks, Involvement of phospholipase A2 in
neurodegeneration, Neurochem. Int. 30 (1997) 517e522.
[21] H.O. Hankovszky, K. Hideg, L. Lex, L. Nitroxyls VII, Synthesis and reactions of
Highly Reactive 1-Oxyl-2,2,5,5-tetramethyl-2,5-dihydropyrrole-3-ylmethyl
Sulfonates, Synthesis (1980) 914e916.
[2] G.W. Kabalka, V. Namboodiri, M.R. Akula, Synthesis of 123I labeled Congo Red
via solid phase organic chemistry, J. Labeled Cpd. Radiopharm. (2001) 921e929.
[3] W.E. Klunk, G.-F.
J WangHuang, M.L. Debnath, D.P. Holt, C.A. Mathis,
}
[22] J. Cseko, H.O. .Hankovszky, K. Hideg, Synthesis of novel, highly reactive 1-
Uncharged thioflavin-T deribatives bind to amyloid-beta protein with high
affinity and readily enter the brain, Life Sci. (2001) 1471e1484.
oxyl-2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridine derivatives, Can. J. Chem.
63 (1985) 940e943.
[4] W.C. Lee, M.P. Kung, C. Hou, H.F. Kung, Dimethylamino-fluorenes: ligands for
}
[23] T. Kálai, M. Balog, J. Jeko, K. Hideg, 3-Substituted-2,2,5,5-tetramethyl-2,5-
detecting
b-amilod plaques in the brain, Nucl. Med. Biol. 30 (2003) 573e580.
dihydro-1H-pyrrol-1-yloxyl radicals as a verstile synthon for synthesis of new
[5] C. Riviére, T. Richard, L. Quentin, S. Krisa, J.-M. Mérillon, J.-P. Monti, Inhibitory
paramagnetic heterocycles, Synthesis (1998) 1476e1482.
[24] L. Columbus, T. Kálai, J. Jeko, K. Hideg, W.L. Hubbell, Molecular motion of spin
activity ofstilbenes on Allzheimer’s
Chem. 15 (2007) 1160e1167.
b-amyloid fibrils in vitro, Bioorg. Med.
}
labeled side chains in alpha-helices: analysis by variation of side chain
structure, Biochemistry 40 (2001) 3828e3846.
[6] M. Torok, S. Milton, R. Kayed, P. Wu, T. McIntire, C.G. Glabe, R. Langen,
Structural and dynamic features of Alzheimer’s Abeta peptide in amyloid
fibrils studied by site-directed spin labeling, J. Biol. Chem. 277 (2002)
40810e40815.
[7] J. Wu, L. Breydo, J.M. Isas, J. Lee, Z.G. Kuznetsov, R. Langen, C Glabe, Fibrillar
oligomers nucleate the oligomerization of monomeric amyloid beta but do not
seed fibril formation, J. Biol. Chem. 285 (2009) 6071e6079.
[8] C. Esposito, A. Tedeschi, M. Scrima, G.D. ’Ericcdo, M.F. Ottaviani, P. Rovero,
A.M. D’Ursi, Exploring interaction of beta-amyloid segment (25e35) with
membranemodelsthroughparamagneticprobes, J. Pept. Sci. 12(2006)766e774.
[9] G.S. Zubenko, U. Kopp, T. Seto, L.L. Firestone, Platelet membrane fluidity
individuals at risk for Alzheimer’s disease: a comparison of results from
fluorescence spectroscopy and electron spin resonance spectroscopy,
Psychopharmacology 145 (1999) 175e180.
[25] P.C. Sár, T.Kálai, M.N. Bárácz, G. Jerkovich, K. Hideg, Selective reduction of
nitrones and nitroxides to Functionalized Secondary amines, Synth. Commun.
25 (1995) 2929e2940.
}
[26] B. Bognár, S. Ahmed, M.L. Kuppusamy, K. Selvendrian, M. Khan, J. Jeko,
H.O. Hankovszky, T. Kálai, P. Kuppusamy, K. Hideg, Synthesis and study of new
paramagnetic and diamagnetic verapamil derivatives, Bioorg. Med. Chem. 18
(2010) 2954e2963.
[27] H.S. Hong, I. Maezawa, M. Budamagunta, S. Rana, A. Shi, R. Vassar, R. Liu,
K.S. Lam, R.H. Cheng, D.H. Hua, J.C. Voss, L.-W. Jin, Candidate anti-A
b fluorene
compounds selected from analogs of amyloid imaging agents, Neurobiol.
Aging 31 (2010) 1690e1699.
[28] N.C. Khan, M. Wilmot, G.M. Rosen, E. Demidenko, J. Sun, J. Joseph, J. O’Hara,
B. Kalyanaraman, H.M. Swartz, Spin traps: in vitro toxicity and stability of
radical adducts, Free Radic. Biol. Med. 34 (2003) 1473e1481.
[29] C.K. Glass, K. Saijo, B. Winner, M.C. Marchetto, F.H. Cage, Mechanisms
underlying inflammation in neurodegeneration, Cell 140 (2010) 918e934.
[30] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods 25
(2001) 402e408.
[10] M.T. Lin, M.M.F. Beal, Mitochondrial dysfunction and oxidative stress in
neurodegenerative diseases, Nature 443 (2006) 787e795.
[11] S.A. Lipton, Paradigm shift in neuroprotection by NMDA receptor blockade:
memantine and beyond, Nat. Rev. Drug Discov. 5 (2006) 160e170.
[12] A.M. Lam, D.I. Pattison, S.E. Bottle, J.D. Keddie, J.M. Davies, Nitric oxide and
nitroxides can act as efficient scavengers of protein ederived free radicals,
Chem. Res. Toxicol. 21 (2008) 2111e2119.