Major groove substituents and polymerase recognition of a class of predominantly hydrophobic unnatural base pairs

Article abstract of DOI:10.1002/chem.201102066

Expansion of the genetic alphabet with an unnatural base pair is a long-standing goal of synthetic biology. We have developed a class of unnatural base pairs, formed between d5SICS and analogues of dMMO2 that are efficiently and selectively replicated by

Full text of DOI:10.1002/chem.201102066

FULL PAPER
DOI: 10.1002/chem.201102066
Major Groove Substituents and Polymerase Recognition of a Class of
Predominantly Hydrophobic Unnatural Base Pairs
Thomas Lavergne, Denis A. Malyshev, and Floyd E. Romesberg*[a]
Abstract: Expansion of the genetic al-
phabet with an unnatural base pair is a
long-standing goal of synthetic biology.
We have developed a class of unnatural
base pairs, formed between d5SICS
and analogues of dMMO2 that are effi-
ciently and selectively replicated by the
Klenow fragment (Kf) DNA poly-
merase. In an effort to further charac-
terize and optimize replication, we
report the synthesis of five new
dMMO2 analogues bearing different
substituents designed to be oriented
into the developing major groove and
an analysis of their insertion opposite
d5SICS by Kf and Thermus aquaticus
DNA polymerase I (Taq). We also
expand the analysis of the previously
optimized pair, dNaM–d5SICS, to in-
clude replication by Taq. Finally, the
efficiency and fidelity of PCR amplifi-
cation of the base pairs by Taq or
Deep Vent polymerases was examined.
The resulting structure–activity rela-
tionship data suggest that the major de-
terminants of efficient replication are
the minimization of desolvation effects
and the introduction of favorable hy-
drophobic packing, and that Taq is
more sensitive than Kf to structural
changes. In addition, we identify an an-
alogue (dNMO1) that is a better part-
ner for d5SICS than any of the previ-
ously identified dMMO2 analogues
with the exception of dNaM. We also
found that dNaM–d5SICS is replicated
by both Kf and Taq with rates ap-
proaching those of a natural base pair.
Keywords: DNA · gene technology ·
Klenow fragment
·
polymerase
chain reaction · Taq polymerase
Introduction
Two of the most promising unnatural base pairs that we
have identified are those formed by d5SICS and either
dMMO2 (dMMO2–d5SICS) or dNaM (dNaM–d5SICS; Fig-
ure 1a and b).[5,6,9,13,14] Previous studies with the Klenow
fragment of E. coli DNA polymerase I (Kf) and T7 RNA
polymerase have demonstrated that d5SICS–dNaM is repli-
cated and transcribed with greater efficiency than dMMO2–
d5SICS.[14] However, the dMMO2 scaffold is simpler and
more atom-economical than dNaM. In addition, the
dMMO2 scaffold provides more options for linker attach-
The four letter genetic alphabet is conserved throughout
nature and is based on the complementary shape and hydro-
gen bonding (H bonding) of the natural purines and pyrimi-
dines. For over two decades, efforts have been focused on
the development of unnatural base pairs in which pairing is
mediated by orthogonal H bonding patterns, and progress
along this route continues.[1–4] However, we[5–16] and
others,[17–21] have demonstrated that hydrophobic and pack-
ing forces are also sufficient to underlie the efficient and se-
lective replication of an unnatural base pair. If sufficiently
well replicated, such unnatural base pairs could be used as
part of an expanded genetic system and would allow for an
increase in the information potential of a genome, but will
likely be useful immediately for in vitro applications, such as
the site-specific labeling of enzymatically synthesized DNA
or RNA with novel functionality (i.e., fluorophores or reac-
tive moieties) for SELEX (systematic evolution of ligands
by exponential enrichment)[22] or nanomaterial applica-
tions.[23]
[a] Dr. T. Lavergne, D. A. Malyshev, Prof. Dr. F. E. Romesberg
Department of Chemistry, The Scripps Research Institute
10550 North Torrey Pines Road, La Jolla, California 92037 (USA)
Fax : (+1)858-784-7472
Figure 1. a) The dMMO2–d5SICS unnatural base pair; b) dNaM and
dDMO; c) dMMO2 analogues synthesized and evaluated in this study.
Only nucleobase moieties are shown; sugar and phosphate backbone are
omitted for clarity.
E-mail: floyd@scripps.edu
Supporting information for this article is available on the WWW
under http://dx.doi.org/10.1002/chem.201102066.
Chem. Eur. J. 2012, 18, 1231 – 1239
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
1231

ment, which is required for site-specific labeling of the
DNA, including attachment at the site analogous to that
widely used with the natural pyrimidines[24] and not avail-
able with dNaM. Thus, our current efforts to expand the ge-
netic alphabet include the continued evaluation of dNaM–
d5SICS, with a particular focus on recognition by other
polymerases that enable specific applications, such as PCR,
as well as to continue to generate structure–activity relation-
ship (SAR) data that will facilitate the further optimization
of dMMO2–d5SICS.
A limiting step of replicating DNA containing dMMO2–
d5SICS is the incorporation of dMMO2TP opposite d5SICS.
Because existing SAR data suggest that this step is more
sensitive to modifications of the triphosphate than of the
templating nucleobase, we have focused on derivatizing
dMMO2TP. The SAR data also clearly reveal that the ortho
methoxy group is absolutely required for replication (the
methyl group facilitates triphosphate insertion and the
oxygen atom facilitates continued primer extension once the
unnatural nucleotide is incorporated at the terminus[6]). In
addition, the accumulated SAR data suggest that para deri-
vatization is more promising than meta derivatization.[13,15]
Initial efforts to identify beneficial modifications at the para
position yielded dDMO (Figure 1b). While the dDMO–
d5SICS unnatural base pair is replicated more efficiently
than the parental dMMO2–d5SICS pair, it is still replicated
less efficiently than dNaM–d5SICS.[8]
To continue our efforts to optimize the dMMO2 scaffold,
we now report the synthesis and characterization of five
new derivatives bearing different moieties at the para posi-
tion (Figure 1c). The specific modifications to the dMMO2
scaffold were selected to systematically vary the size, shape,
electronic properties, and H bonding potential of the nucleo-
base. The unnatural triphosphates were analyzed by deter-
mining the steady-state efficiencies with which they are in-
serted opposite d5SICS in a DNA template by Kf or by
Thermus aquaticus DNA polymerase I (Taq). To further ex-
plore dNaM–d5SICS, we characterized its synthesis in both
strand contexts (i.e., insertion of dNaMTP opposite d5SICS
and d5SICSTP opposite dNaM) by Taq. To facilitate the de-
tailed comparison of all the analogues in side-by-side experi-
ments, the previously reported efficiencies of dNaM–d5SICS
synthesis by Kf were redetermined, as were the insertion ef-
ficiencies of dMMO2TP and dDMOTP opposite d5SICS by
Kf and Taq. Finally, each triphosphate was also analyzed by
characterizing the PCR amplification of the corresponding
unnatural base pair with d5SICS by Taq or Deep Vent poly-
merases. The results reveal important, and in some cases,
polymerase-specific SAR data, and we found that
dNMO1TP is better optimized than the other new ana-
logues as a partner for d5SICS. The current analysis also re-
veals that dNaM–d5SICS is synthesized by Kf better than
previously appreciated, and synthesized equally well by Taq,
solidifying its position as the most promising unnatural base
pair identified to date.
Results
Nucleotide design, synthesis, and evaluation: The unnatural
nucleotides dAMO1, dAMO2, dAMO3, dPMO1, and
dNMO1 (Figure 1c) were designed to position different sub-
stituents in the developing major groove during replication.
Each substituent was attached via a single bond to the posi-
tion para to the glycosidic bond because SAR data suggest
that rotational flexibility is important for efficient triphos-
phate incorporation[8] (although dNaM is an interesting and
incompletely understood exception), presumably by allow-
ing for the optimization of the developing interactions with
d5SICS and/or the DNA polymerase. The simplest deriva-
tive of the series, dAMO1, bears only an amino substituent
at the para position. In dAMO2 and dAMO3, the amino
moiety is modified with acetyl and trifluoroacetyl groups,
which increase the size and reduce the ability of the sub-
stituent to donate electron density into the aromatic ring of
the nucleobase scaffold. The nitro group of dNMO1 is a
potent electron withdrawing substituent. In contrast, incor-
porating the nitrogen atom within the context of the pyrrolo
ring of dPMO1 should have more modest electronic effects,
but significantly increase the aromatic surface area of the
scaffold.
The unnatural nucleotide derivatives were synthesized
(Scheme 1). Briefly, the modified nucleoside 3 was obtained
in three steps through Heck coupling between the 2’-deoxy-
ribose glycal 1 and the appropriately iodinated N-Cbz-pro-
tected anisidine 2, followed by deprotection of the sugar
moiety and selective reduction of the resulting 3ꢁ keto
group. Acceptable yields of the Heck coupling product re-
quired the use of an electron withdrawing group to protect
the aromatic amine. The major coupling product was the de-
sired b-anomer, confirmed by NOE experiments, which was
separated from the minor a-anomer by silica gel column
chromatography. The hydroxyl groups were simultaneously
protected with tetraisopropyldisiloxane groups, and the Cbz
group was removed by hydrogenation. Compound 4 was
used as a common precursor to introduce diversity and
access each of the desired nucleotides. We found that even
under mildly acidic conditions, compound 4 is prone to epi-
merize to a mixture of a- and b-anomers, and careful con-
trol of all reaction conditions was required.
Toward dNMO1, the aromatic amine of 4 was first oxi-
dized by using a potassium iodide-tert-butyl hydroperoxide
catalyst, which cleanly converted the amine to the nitro
group, whereas approaches based on in situ generation of
the dimethyldioxirane or the use of methyltrioxorhenium/O2
resulted in incomplete oxidation to the nitroso and hydrox-
ylamine compounds, as well as the production of azoxy self
coupled products. dNMO1 (5a) was finally obtained by re-
moval of the silyl protecting groups. Protected dPMO1 was
obtained by acid-free condensation[25] in aqueous 2,5-di-
ACHUTNGERNmNUG ethoxyACHTUNTGRENtNUNG etrahydrofuran with microwave irradiation at
1408C, which afforded the pure b-anomer, and the free nu-
cleoside 5b was obtained by removal of the silyl protecting
group. Compounds 5c and 5d were obtained by acylation
1232
www.chemeurj.org
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2012, 18, 1231 – 1239

Hydrophobic Unnatural Base Pairs
FULL PAPER
provides a convenient assay to measure the overall rate at
which product is formed.[27] The most interpretable data
were the second order rate constant (or efficiency, kcat/KM)
relating the duplex-bound polymerase and free triphosphate
to the rate limiting transition state for the multiple turnover
reaction. Assays with Kf were performed at 258C, which is
close to the enzymeꢁs optimal temperature of 378C. Because
Taq is a thermophilic polymerase, assays with this enzyme
were performed at 508C to allow for the use of the same
primer–template substrates used with Kf and in previous
studies. Although it is approximately 208C below optimum,
Taq does retain a significant level of activity at this tempera-
ture.[28] Each analogue was also examined as a partner for
d5SICS by PCR.
Efficiency of insertion of dMMO2TP, dDMOTP, and each
natural dNTP opposite d5SICS: To gauge the efficiency of
unnatural base pair synthesis, we first analyzed the insertion
of dATP opposite dT in sequence context I (Table 1). In
Table 1. Kinetic data for Kf-mediated insertion of triphosphates (dYTP)
opposite d5SICS or dNaM in the template in sequence context I; inser-
tion of dATP opposite dT is provided for comparison.
5’-d(TAATACGACTCACTATAGGGAGA)
3’-d(ATTATGCTGAGTGATATCCCTCTXGCTAGGTTACGGCAGGATCGC)
X
Y
kcat
[minꢀ1
KM
[mm]
kcat/KM
G
]
[ꢂ105 mꢀ1 minꢀ1
]
T
A
4. 1ꢁ0.3
0. 0053ꢁ0.0004
0. 25ꢁ0.04
12. 2ꢁ1.5
35. 8ꢁ0.6
22. 0ꢁ3.5
20. 7ꢁ2.6
178ꢁ62
7700
580
22
3.8
23
20
0.86
1.1
0.15
2.9
0.40
1.5
5SICS
NaM
DMO
MMO2
NMO1
PMO1
AMO1
AMO3
AMO2
5SICS
A
G
C
T
5SICS
NaM
A
G
C
14. 6ꢁ0.8
27. 0ꢁ1.5
13. 7ꢁ2.0
50. 1ꢁ8.8
41. 7ꢁ6.7
15. 3ꢁ3.5
13. 4ꢁ2.8
7. 0ꢁ1.0
12. 6ꢁ0.7
2. 1ꢁ0.3
11. 7ꢁ1.3
n.d.[a]
Scheme 1. Conditions: a) CBz-Cl, NaHCO3, THF, room temperature,
20 min; b) I2, Ag2SO4, MeOH, ꢀ208C, 1 h; c) Pd
DMF, 708C, 15 h; d) TBAF 1m in THF, 08C!room temperature, 2 h;
e) NaBH(OAc)3, AcOH, CH3CN, 08C, 1 h; f) 1,3-dichloro-1,1,3,3-tetra-
isopropyldisiloxane, pyridine, room temperature, 2 h; g) 10% Pd/C, H2,
ACHTUGNTRENN(NUG OAc)2, AsPh3, nBu3N,
ACHTUNGTRENNUNG
ACHTUNGTRENNUNG
EtOAc, room temperature, 1 h; h) KI, t-butyl hydroperoxide aq. 70%,
CH3CN, dark, 758C, 2 h; i) 2,5-dimethoxytetrahydrofuran, H2O, micro-
wave 1408C, 30 min; j) Ac2O, Et3N, CH2Cl2, room temperature, 20 min;
k) trifluoroacetic anhydride, Et3N, CH2Cl2, 108C, 20 min; l) TBAF 1m in
117ꢁ30
464ꢁ100
44. 2ꢁ11.7
52. 4ꢁ7.2
75. 5ꢁ3.7
n.d.[a]
THF, 1 h; m) proton sponge, POCl3, PO
G
then Bu3N, (Bu3NH)2H2P2O7 in DMF, ꢀ108C!08C, 30 min then TEAB
buffer (0.5m), room temperature, 10 min; n) NH4OH 30%, room temper-
ature, 1 h.
<0.01
0.091
2100
95
2. 1ꢁ0.4
8. 3ꢁ1.1
51. 5ꢁ3.4
24. 7ꢁ4.7
n.d.[a]
230ꢁ11
NaM
0. 039ꢁ0.004
5. 4ꢁ0.3
14. 0ꢁ0.8
n.d.[a]
18
with acetic anhydride or trifluoroacetic anhydride, respec-
tively, followed by TBAF-mediated sugar deprotection.
Free nucleosides 5a–d were converted to the correspond-
ing triphosphates 6a–d by using Ludwig conditions,[26] and
purified by anion exchange chromatography, followed by
HPLC. dAMO1TP (6e) was obtained from dAMO3TP (6d)
by ammonia-mediated deprotection of the amino group at
room temperature. The purity of each triphosphate was con-
firmed by 31P NMR spectroscopy, HPLC, and MALDI-ToF
(see the Supporting Information). The triphosphates of
dMMO2, dDMO, dNaM and d5SICS were prepared as de-
scribed previously,[6,8,13] and the phosphoramidites of dNaM
and d5SICS were prepared and incorporated into DNA as
described previously.[13]
<0.01
<0.01
0.12
n.d.[a]
1. 6ꢁ0.2
n.d.[a]
129ꢁ15
T
[a] Below limits of detection.
good agreement with previous data, we found that dATP
was inserted opposite dT in the template with a kcat/KM of
7.7ꢂ108 mꢀ1 minꢀ1. We then examined the insertion of
dMMO2TP and dDMOTP opposite d5SICS under identical
conditions. We found that that dMMO2TP and dDMOTP
are inserted with efficiencies of 3.8ꢂ105 and 2.2ꢂ
106 mꢀ1 minꢀ1, respectively. To determine fidelity, we mea-
sured the rate of insertion of each natural triphosphate op-
posite d5SICS in the same sequence context. We found that
dATP, dGTP, and dTTP are inserted with efficiencies be-
tween 9ꢂ103 and 1.5ꢂ105 mꢀ1 minꢀ1, but dCTP was not in-
Each triphosphate was analyzed by examining its insertion
opposite a correct or incorrect nucleotide in a DNA tem-
plate by Kf and Taq under steady-state conditions, which
Chem. Eur. J. 2012, 18, 1231 – 1239
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
1233

F. E. Romesberg et al.
serted at a detectable level (kcat/KM <1ꢂ103 mꢀ1 minꢀ1). All
of the data are in good agreement with previously reported
results.[6,8] We also determined the efficiency with which Taq
inserts dATP opposite dT and dMMO2TP opposite d5SICS
in sequence context I and observed values of 8.2ꢂ107 and
9.7ꢂ104 mꢀ1 minꢀ1, respectively, also in good agreement with
previously reported data.[5]
opposite d5SICS by Taq was also not very efficient (3.2ꢂ
104 mꢀ1 minꢀ1), insertion of dNMO1TP was significantly
more efficient (4.3ꢂ105 mꢀ1 minꢀ1).
Of the new dMMO2 analogues examined, the most prom-
ising in sequence context I are dPMO1TP, and especially
dNMO1TP, thus, we next determined whether their inser-
tion efficiency by Kf opposite d5SICS is dependent on se-
quence context, using sequence context II (Table 3). Again,
Insertion efficiencies of dMMO2TP derivatives opposite
d5SICS: The insertion by Kf of each dMMO2 triphosphate
derivative opposite d5SICS was characterized in sequence
context I (Table 1). We found that the most simple deriva-
tive, dAMO1TP, is inserted opposite d5SICS with a second
order rate constant of 8.6ꢂ104 mꢀ1 minꢀ1. dAMO3TP was in-
serted with a similar efficiency (1.1ꢂ105 mꢀ1 minꢀ1), but
dAMO2TP was inserted sixfold less efficiently (1.5ꢂ
104 mꢀ1 minꢀ1). However, dPMO1TP and dNMO1TP were
inserted with higher efficiencies of 2.0ꢂ106 and 2.3ꢂ
106 mꢀ1 minꢀ1, respectively. The increased efficiency of
dPMO1TP and dNMO1TP insertion opposite d5SICS by Kf
resulted from both an increase in the apparent kcat and a de-
crease in the apparent KM.
Table 3. Kinetic data for Kf-mediated insertion of triphosphates (dYTP)
opposite d5SICS or dNaM in the template in sequence context II; inser-
tion of dATP opposite dT is provided for comparison.
5’-d(TAATACGACTCACTATAGGGAGC)
3’-d(ATTATGCTGAGTGATATCCCTCGXTCTAGGTTACGGCAGGATCGC)
X
Y
kcat
A
KM
[mm]
kcat/KM
]
]ꢂ105 mꢀ1 minꢀ1
]
T
A
NaM
0. 95ꢁ0.10
11. 4ꢁ2.3
14. 2ꢁ1.1
8. 6ꢁ0.2
0. 0017ꢁ0.0001
0. 41ꢁ0.01
35. 8ꢁ1.5
5800
280
3.9
1.9
15
5SICS
DMO
MMO2
NMO1
PMO1
5SICS
46. 6ꢁ7.1
33. 6ꢁ7.0
19. 0ꢁ1.6
5. 8ꢁ1.1
23. 0ꢁ0.1
13. 5ꢁ1.5
14
1200
NaM
0. 049ꢁ0.003
We next characterized the ability of Taq to insert each
dMMO2TP derivative opposite d5SICS in the same se-
quence context (Table 2). We found that Taq inserts
dDMOTP with an efficiency of 1.6ꢂ105 mꢀ1 minꢀ1, which is
virtually identical to the efficiency of dMMO2TP insertion.
We found that Taq inserts dAMO1TP, dAMO2TP, and
dAMO3TP opposite d5SICS much less efficiently, with
second order rate constants of 4.9ꢂ103, 1.2ꢂ103, and 1.6ꢂ
103 mꢀ1 minꢀ1, respectively. Although insertion of dPMO1TP
for comparison, we redetermined the efficiencies of dATP,
dMMO2TP or dDMOTP insertion opposite their cognate
base in the same sequence context. The natural base pair
was synthesized with an efficiency of 5.8ꢂ108 mꢀ1 minꢀ1,
whereas dMMO2TP was inserted opposite d5SICS with an
efficiency of 1.9ꢂ105 mꢀ1 minꢀ1; both values are in good
agreement with previously reported data.[13] Kf inserts
dDMOTP opposite d5SICS with an efficiency of 3.9ꢂ
105 mꢀ1 minꢀ1. Interestingly, we found that insertion of both
dPMO1TP and dNMO1TP opposite d5SICS by Kf is ap-
proximately four- and eightfold more efficient than insertion
of dDMOTP and dMMO2TP, respectively.
Table 2. Kinetic data for Taq-mediated insertion of triphosphates
(dYTP) opposite d5SICS or dNaM in the template in sequence context I;
insertion of dATP opposite dT is provided for comparison.
5’-d(TAATACGACTCACTATAGGGAGA)
3’-d(ATTATGCTGAGTGATATCCCTCTXGCTAGGTTACGGCAGGATCGC)
X
Y
kcat
[minꢀ1
KM
[mm]
kcat/KM
[ꢂ105 mꢀ1 minꢀ1
]
Efficiency and fidelity of dNaM–d5SICS synthesis: To pro-
vide a reference for how efficiently and selectively Taq syn-
thesizes dNaM–d5SICS, we first measured the efficiency of
Kf-mediated synthesis of dNaM–d5SICS and all possible
mispairs in both strand contexts of sequence context I
(Table 1). We found that d5SICSTP is inserted opposite
dNaM with an efficiency of 2.1ꢂ108 mꢀ1 minꢀ1, in good
agreement with previously reported data.[13] However, we
found that dNaMTP is inserted opposite d5SICS with an ef-
ficiency of 5.8ꢂ107 mꢀ1 minꢀ1. Although significantly greater
than reported previously for this sequence context, it is simi-
lar to that reported for the same insertion in sequence con-
text II.[13] To confirm the rates for insertion in sequence con-
text II, we reanalyzed the synthesis of dNaM–d5SICS in
both strand contexts of sequence context II (Table 3). We
found that d5SICSTP is inserted opposite dNaM and that
dNaMTP is inserted opposite d5SICS with efficiencies of
1.2ꢂ108 and 2.8ꢂ107 mꢀ1 minꢀ1, respectively, both in good
agreement with the previously published data.
G
]
T
A
2. 6ꢁ0.2
2. 7ꢁ0.4
3. 3ꢁ1.7
3. 4ꢁ0.3
5. 5ꢁ0.2
3. 6ꢁ1.4
0. 032ꢁ0.002
0. 35ꢁ0.04
21. 0ꢁ0.5
35. 0ꢁ6.0
12. 8ꢁ3.4
113ꢁ25
170ꢁ31
214ꢁ28
370ꢁ36
189ꢁ16
147ꢁ7
820
76
1.6
0.97
4.3
5SICS
NaM
DMO
MMO2
NMO1
PMO1
AMO1
AMO3
AMO2
5SICS
A
G
C
T
5SICS
NaM
A
G
C
0.32
0. 83ꢁ0.13
0. 35ꢁ0.06
0. 45ꢁ0.06
3. 4ꢁ0.5
0. 5ꢁ0.05
4. 5ꢁ0.1
n.d.[a]
0.049
0.016
0.012
0.18
0.035
0.21
<0.01
0.026
71
0.52
0.48
<0.01
<0.01
0.024
216ꢁ42
n.d.[a]
0. 8ꢁ0.1
2. 4ꢁ0.6
7. 9ꢁ1.4
4. 0ꢁ0.8
n.d.[a]
303ꢁ19
0. 34ꢁ0.03
151ꢁ9
NaM
84. 0ꢁ4.0
n.d.[a]
n.d.[a]
1. 0ꢁ0.2
n.d.[a]
T
421ꢁ71
[a] Below limits of detection.
1234
www.chemeurj.org
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2012, 18, 1231 – 1239

Hydrophobic Unnatural Base Pairs
FULL PAPER
As already mentioned, the most efficiently inserted dNTP
opposite d5SICS by Kf was dGTP, which we found to pro-
ceed with an efficiency of 1.5ꢂ105 mꢀ1 minꢀ1, although dATP
and dTTP were inserted less efficiently, dCTP was not in-
serted at detectable level, and d5SICSTP was inserted with
an efficiency of 2.9ꢂ105 mꢀ1 minꢀ1 (Table 1). With dNaM in
the template, the natural triphosphate most efficiently in-
serted by Kf was dATP, which proceeded with an efficiency
of 1.8ꢂ106 mꢀ1 minꢀ1 (Table 1). dTTP was also inserted, but
with a reduced efficiency of 1.2ꢂ104 mꢀ1 minꢀ1, whereas
dGTP and dCTP were not inserted at detectable levels
(kcat/KM<103 mꢀ1 minꢀ1). dNaMTP was inserted opposite
dNaM with an efficiency of 9.5ꢂ106 mꢀ1 minꢀ1. The rates for
the synthesis of these mispairs are all in good agreement
with previously published data.[13]
We next determined the efficiency and fidelity of dNaM–
d5SICS synthesis by Taq in both strands of sequence
context I. Again, for comparison we first measured the effi-
ciency with which Taq inserted dATP opposite dT in the
same sequence context, which we found to be 8.2ꢂ
107 mꢀ1 minꢀ1. We found that Taq inserts dNaMTP opposite
d5SICS and d5SICSTP opposite dNaM with efficiencies of
7.6ꢂ106 and 7.1ꢂ106 mꢀ1 minꢀ1, respectively. With d5SICS in
the template, Taq inserted dGTP more efficiently than the
other natural triphosphates, with an efficiency of 2.1ꢂ
104 mꢀ1 minꢀ1, followed by dATP and dTTP, with efficiencies
of 3.5ꢂ103 and 2.6ꢂ103 mꢀ1 minꢀ1, respectively. Taq did not
insert dCTP at a detectable rate (<103 mꢀ1 minꢀ1). The most
competitive mispair synthesized resulted from the insertion
of d5SICSTP, which proceeded with an efficiency of only
1.8ꢂ104 mꢀ1 minꢀ1. With dNaM in the template, Taq inserted
dATP most efficiently, with a second order rate constant of
4.8ꢂ104 mꢀ1 minꢀ1. dTTP was inserted with an efficiency of
2.4ꢂ103 mꢀ1 minꢀ1, whereas dGTP and dCTP were inserted
with undetectable rates (<103 mꢀ1 minꢀ1). dNaMTP was in-
serted opposite dNaM by Taq with an efficiency of 5.2ꢂ
104 mꢀ1 minꢀ1.
site d5SICS, followed by dDMO, dMMO2, and dPMO1
(Figure S28 in the Supporting Information).
To examine amplification under more practical and high
fidelity conditions we explored PCR using the exonuclease
proficient Deep Vent polymerase of the same unnatural
base pairs positioned in the middle of the 149 nt duplex re-
ferred to as D1, which was used previously to characterize
the amplification of dNaM–d5SICS and dMMO2–d5SICS[9]
(Table 4 and Figure S29 in the Supporting Information). In
Table 4. Fidelities of Deep Vent-mediated PCR amplification of unnatu-
ral base pairs.[a]
Base pair
Fidelity[b]
dNaM–d5SICS
dDMO–d5SICS
dMMO2–d5SICS
dPMO1–d5SICS
dNMO1–d5SICS
99.7
99.7
99.7
92.4
99.5
[a] See text for experimental details. [b] Fidelity is defined as %unnatural
base pair retention per doubling; see ref. [9].
this case, fidelity was characterized as described previously.[9]
In agreement with previous results, dNaM–d5SICS was re-
plicated with a remarkable fidelity of 99.7. Interestingly,
dNMO1–d5SICS, dDMO–d5SICS, and dMMO2–d5SICS
were also amplified with a similar fidelity, while as predicted
by the steady-state kinetic data, dPMO1–d5SICS was ampli-
fied with a significantly lower fidelity.
Discussion
The identification dMMO2–d5SICS was a landmark in our
efforts to identify an unnatural base pair, and early efforts
directed toward its optimization yielded dDMO–d5SICS
and in particular dNaM–d5SICS. While the former was
slightly better replicated than dMMO2–d5SICS, dNaM–
d5SICS was replicated significantly better, although whether
this was unique to Kf, or a general property of the unnatural
base pair was not known. In addition, the strategy of using
nucleobases with little or no structural homology to their
natural counterparts makes possible many different substitu-
ents, and it is unclear whether dNaM–d5SICS represents the
best route to optimize dMMO2–d5SICS, especially consider-
ing the increased potential for linker modification of the
more simple scaffolds.
In an effort to optimize the dMMO2 scaffold for pairing
with d5SICS, we examined derivatives with different sub-
stituents in place of the para methyl group. Specifically, five
different substituents expected to alter the physicochemical
properties of the nucleobases were examined, including
amine, amide, trifluoroamide, nitro, and pyrrolo groups. The
amine substituent is electron donating and expected to in-
Efficiency and fidelity of PCR amplification: To begin to ex-
amine unnatural base pair replication, which includes syn-
thesis and extension in both strand contexts, we first ex-
plored the Taq-mediated PCR amplification of DNA con-
taining d5SICS paired opposite either dNaM, dMMO2,
dDMO, dNMO1, or dPMO1. Taq was employed despite its
low fidelity for replication of the unnatural base pair, be-
cause it lacks exonuclease proofreading activity, to facilitate
comparison with the steady-state kinetic data. In addition,
the unnatural base pairs were incorporated into the 134 nt
DNA template, D6, in the middle of a six nucleotide
randomized region.[9] The randomized template was selected
to provide the strictest possible measure of fidelity as se-
quences with inherently low fidelity are expected to lose the
unnatural base pair and then efficiently amplify. While it is
not practical to characterize fidelity in these reactions due
to the significant read through, sequencing traces clearly in-
dicate that while d5SICS–dNaM is best replicated, amongst
the other analogues, dNMO1 is optimized for pairing oppo-
ꢀ
troduce a dipole along the C N bond directed toward the
aromatic ring. The amine group is also expected to form
H bonds with water molecules. While the amide groups are
Chem. Eur. J. 2012, 18, 1231 – 1239
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
1235

F. E. Romesberg et al.
less electron donating, along with increased steric demands,
they introduce increased H bonding relative to the amine.
The pyrrolo substituent reduces the electron donating ability
of the nitrogen and adds steric bulk, but within the context
of decreased H bonding and increased stacking potential. In
contrast, the nitro group is electron withdrawing and expect-
ed to introduce a significant dipole oriented along the
mediates favorable packing interactions with d5SICS or the
polymerase in the developing transition state. As with the
other analogues, Taq appears to be less accommodating to
alterations in the size of the substituent and tolerates the
nitro substituent, but not the pyrrole group.
The detailed kinetic analysis focused on the insertion of
the different triphosphate analogue opposite d5SICS. How-
ever, replication requires base pair synthesis in the other
strand context, the insertion of d5SICSTP opposite the ana-
logue in template DNA, as well as the continued primer
elongation in both strand contexts. The results of the PCR
analysis suggest that the nitro and pyrrolo substituents of
dNMO1 and dPMO1, respectively, do not significantly inter-
fere with any of these other steps of replication. Moreover,
the fidelities observed during PCR with Taq indicate that
the improvement in steady-state triphosphate insertion char-
acterized for dNMO1TP is also manifest as improved repli-
cation.
Generally, the data obtained with the five new analogues
examined suggest that optimizing hydrophobicity, including
reducing the cost of desolvation, and improving packing in
the developing major groove are the most efficacious routes
to optimization of the dMMO2 scaffold, although the inter-
actions must be more carefully manipulated with Taq than
with Kf, apparently due to a more discriminating active site.
The importance of hydrophobicity and packing is also con-
sistent with the remarkable insertion efficiency of dNaM op-
posite d5SICS. If supported by further study, these argu-
ments suggest that, at least from the perspective of the para
position of the dMMO2 scaffold, the developing major
groove of the duplex within the polymerase active site is
able to accommodate planar aromatic groups with favorable
packing interactions, but the waters and metal ions found
within the major groove of free duplex DNA are not yet
available. Regardless of the underlying mechanism, the
steady-state kinetic and PCR data indicate that dNMO1 is
the most promising dMMO2 analogue yet identified.
Previous data collected for the Kf-mediated synthesis of
dNaM–d5SICS suggested that its efficiency is strand and se-
quence context specific. However, this was based on the effi-
ciency of a single step in a single sequence context, the in-
sertion of dNaMTP opposite d5SICS in sequence context I,
which appeared to be significantly less efficient than that in
sequence context II, or than the insertion of d5SICSTP op-
posite dNaM in either sequence context. The efficiency of
this reaction was re-evaluated in the current work and we
found that the previous data underestimated the rate ap-
proximately tenfold, which we attribute to the presence of
an impurity. The corrected data places the efficiency of
dNaMTP insertion on par with that of the others. Thus, the
replication of dNaM–d5SICS does not appear to be either
strongly strand or sequence context dependent. The efficien-
cy of both steps of unnatural base pair synthesis are within
four- to 13-fold that of a natural base pair. Moreover, rela-
tive to the most competitive mispair, the overall fidelity
when both unnatural base pair synthesis and extension[13]
are combined is at least 104. To our knowledge, this repre-
ꢀ
carbon nitrogen bond away from the aromatic ring. How-
ever, like the pyrrolo substituent, the nitro group is expected
to decrease H bonding, being only a moderate H bond ac-
ceptor, and increase the ability of the nucleobase analogue
to stack with flanking nucleobases within the developing
duplex.
With both Kf and Taq, the analogues examined clearly
separate into two groups: dAMO1TP, dAMO2TP, and
dAMO3TP are inserted less efficiently opposite d5SICS
than dMMO2TP; and dNMO1TP and dPMO1TP are insert-
ed more efficiently. For dAMO1TP, the decrease is fourfold
with Kf, while with Taq it was 20-fold, with the difference
between the polymerases largely due to changes in the ap-
parent kcat; the modification increases kcat with Kf and de-
creases it with Taq while the KM was similarly increased
(~fivefold) with both enzymes. Because, the amino group is
expected to increase the electron density of the nucleobase
ring, the observed decrease in insertion efficiencies suggests
that any favorable increase in packing due to increased po-
larizability is offset by other deleterious factors, such as
forced desolvation of the amino group, which is consistent
with a similar effect on KM observed with both enzymes.
Modification of the amine with the acetyl group of
dAMO2TP decreases insertion efficiency by both enzymes,
relative to dMMO2TP, by a factor of 26 with Kf and more
than a factor of 83 with Taq. The large reduction in efficien-
cy with Taq results from a significant decrease in apparent
binding, and an even larger decrease in turnover. Modifica-
tion of the amino group with the trifluoroacetyl group of
dAMO3TP also reduced the efficiency of insertion, but very
differently with the two enzymes. With Kf, the decrease is
only fourfold relative to dMMO2TP, but it is more than 60-
fold with Taq. The large decrease in recognition by Taq
again results from both reduced binding and reduced turn-
over. Thus, insertion of these analogues appears to be limit-
ed by desolvation and steric or electrostatic clashes that are
polymerase specific and generally more severe with Taq.
Relative to dMMO2TP, the behavior of dPMO1TP and
dNMO1TP are very different from that of the other ana-
logues with both Kf and Taq. With Kf, in both sequence
contexts I and II, dPMO1TP and dNMO1TP are each in-
serted approximately fivefold more efficiently, due to in-
creased binding and increased turnover. In contrast, with in
sequence context I, dPMO1TP is inserted by Taq threefold
less efficiently then dMMO2TP, due to reduced binding, but
dNMO1TP is inserted fourfold more efficiently, due to a
small increase in turnover and a slightly larger increase in
apparent binding affinity. The data suggest that with Kf the
presence of the nitro or the pyrrole group likely reduces the
cost of desolvation relative to the amine or amide and also
1236
www.chemeurj.org
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2012, 18, 1231 – 1239

Hydrophobic Unnatural Base Pairs
FULL PAPER
ing pure NH-Cbz m-anisidine. Silver nitrate (4.48 g, 14.37 mmol) and
iodine (3.65 g, 14.37 mmol) were added to a solution of the Cbz-protect-
ed m-anisidine in MeOH (120 mL) at ꢀ208C. The mixture was stirred at
ꢀ208C for 1 h, quenched by saturated aqueous Na2S2O3 (80 mL) and fil-
tered through a Celite pad. The filtrate was concentrated to 10% of its
original volume and diluted with CH2Cl2 (200 mL). The organic layer was
quenched with saturated aqueous NaHCO3, washed with brine, dried
(Na2SO4), filtered and evaporated. The residue was subjected to silica gel
column chromatography with a step gradient of CH2Cl2 (20–80%) in
hexane. The desired compound 2 was obtained as white foam after evap-
oration of the solvent (4.04 g, 10.54 mmol, 65% yield). 1H NMR
(400 MHz, [D6]DMSO): d=9.89 (s, 1H, NH), 7.60 (d, J=8.5 Hz, 1H),
7.40 (m, 5H), 7.27 (d, J=2.3 Hz, 1H), 6.90 (m, 1H), 5.16 (s, 2H),
3.76 ppm (s, 3H); 13C NMR (100 MHz, CDCl3): d=158.66, 153.08,
139.53, 139.13, 135.79, 128.67, 128.49, 128.31, 112.37, 102.07, 78.04, 67.22,
56.33 ppm; HRMS (ESI+) m/z: calcd for C15H15INO3 [M+H]+ 384.0091,
found 384.0097.
sents the most efficient and high fidelity replication reported
to date for an unnatural base pair.
The synthesis of dNaM–d5SICS by Kf is remarkably effi-
cient and selective, and it appears to be just as efficiently
synthesized by Taq. Taq inserts both dNaMTP opposite
d5SICS and d5SICSTP opposite dNaM only tenfold less effi-
ciently than a natural base pair in the same sequence con-
text. Moreover, none of the natural dNTPs was inserted effi-
ciently opposite either d5SICS or dNaM in the template, re-
sulting in 150-fold or greater fidelities for this step alone.
The efficient and selective recognition of dNaM–d5SICS by
both Kf and Taq now allow us to conclude that the determi-
nants of efficient replication are inherent to the nucleotides
themselves.
Compound 3:
A mixture of palladium acetate (880 mg, 3.92 mmol,
0.15 equiv) and triphenylarsine (2 g, 3.92, 0.15 equiv) in dry dimethylfor-
mamide (150 mL) was stirred under argon atmosphere at room tempera-
Conclusion
ture for 20 min. Compound
2 (15 g, 39.2 mmol, 1.5 equiv), 1 (9 g,
26.1 mmol, 1 equiv) and tri-n-butylamine (9.3 mL, 39.2 mmol, 1.5 equiv)
in dimethylformamide (5 mL) were added to this mixture, and the result-
ing reaction mixture was stirred under nitrogen at 708C for 15 h. The
mixture was cooled to 08C and tetrabutylammonium fluoride (1m;
44 mL, 44 mmol) in tetrahydrofuran was added, and the mixture was
stirred for 2 h while being warmed to room temperature. The reaction
mixture was filtered through Celite and extracted with ethyl acetate and
saturated aqueous NaHCO3. The combined organic layers were dried
(Na2SO4), filtered and evaporated. The residue was subjected to silica gel
column chromatography with a step gradient of ethyl acetate (5–30%) in
CH2Cl2. The eluted product was dissolved in acetic acid (50 mL) and ace-
tonitrile (50 mL). The solution was cooled to 08C, sodium triacetoxybor-
ohydride (4.5 g, 21.23 mmol) was added, and the mixture was stirred for
1 h. The reaction mixture was diluted with ethyl acetate, quenched with
saturated aqueous NaHCO3, washed with brine, dried (Na2SO4), filtered
and evaporated. The residue was subjected to silica gel column chroma-
tography with a step gradient of methanol (0–4%) in ethyl acetate. The
desired compound 3 was obtained as white foam after evaporation of the
solvent (6.58 g, 17.62 mmol, 45% yield). 1H NMR (400 MHz, MeOD):
d=7.49–7.27 (m, 6H, H-ar, H-6), 7.26–7.17 (m, 1H, H-3), 6.95 (dd, J=
8.2, 2.0 Hz, 1H, H-5), 5.39 (dd, J=10.2, 5.5 Hz, 1H, H-1’), 5.17 (s, 2H,
OCH2Ar (Cbz)), 4.35–4.24 (m, 1H, H-3’), 3.93 (td, J=5.2, 2.7 Hz, 1H, H-
4’), 3.81 (s, 3H, OCH3), 3.74–3.59 (m, 2H, H-5’,H-5’’), 2.27 (ddd, J=13.1,
5.6, 1.9 Hz, 1H, H-2’), 1.82 ppm (ddd, J=13.1, 10.3, 6.1 Hz, 1H, H-2’’);
The data reveal that reducing the cost of nucleotide desolva-
tion and optimizing packing interactions within the develop-
ing major groove are promising routes to optimize the effi-
ciency of polymerase-mediated insertion of the dMMO2TP
analogues opposite d5SICS, and that other than dNaM,
dNMO1 is the most promising analogue identified to date.
While continued efforts toward the optimization of the
dNMO1 scaffold are justified by its potential for accommo-
dating linkers, the data reported herein for dNaM–d5SICS
demonstrate just how challenging the identification of a
more optimized base pair is likely to be. Thus, the data
strongly suggest that efforts toward developing an unnatural
base pair for in vitro applications should focus on the dNaM
scaffold, including efforts to identify suitable sites for linker
attachment to facilitate applications based on the site-specif-
ic modification of DNA or RNA. Such efforts are currently
underway.
13C NMR (100 MHz, MeOD): d=156.7 (C2(C OMe)), 154.4 (NHC=O),
ꢀ
Experimental Section
139.1 (C4(C NHCbz)), 136.6 (Cq, Car), 128.1–127.6 (CH, Ar), 126.0 (C6),
ꢀ
124.6 (C1(C sugar)), 110.2 (C5), 101.2 (C3), 87.1 (C4’), 74.8 (C1’), 73.0 (C3’),
ꢀ
General: All reactions were carried out in oven-dried glassware under
inert atmosphere, and all solvents were dried over 4 ꢃ molecular sieves
with the exception of tetrahydrofuran, which was distilled from sodium
66.1 (OCH2Ph), 62.7 (C5’), 54.3 (OCH3), 41.7 (C2’); HRMS (ESI+) m/z:
calcd for C20H24NO6 [M+H]+ 374.1598, found 374.1615.
Compound 4: 1,3-Dichloro-1,1,3,3-tetraisopropyldisiloxane (2.6 mL,
8.1 mmol, 1.2 equiv) was added to a solution of 3 (2.5 g, 6.7 mmol,
1 equiv) in dry pyridine (100 mL), dropwise over 15 min. The reaction
mixture was stirred for 2 h at room temperature under nitrogen atmos-
phere, concentrated twofold and diluted with CH2Cl2. The organic layer
was quenched with saturated aqueous NaHCO3, washed with brine, dried
(Na2SO4), filtered and evaporated. The residue was dissolved in ethyl
acetate (75 mL) and Et3N (250 mL, 1.76 mmol) was added. The resulting
solution was treated with 10% Pd/C (150 mg) under H2 atmosphere and
allowed to stir until the presence of the starting material could no longer
be detected by TLC (~1 h). The reaction mixture was filtered through
Celite and the filtrate was extracted with ethyl acetate and saturated
aqueous NaHCO3. The combined organic layers were dried (Na2SO4), fil-
tered and evaporated. The residue was subjected to a silica gel column
1
metal. All other reagents were purchased from Fisher or Aldrich. H, 13C
and 31P NMR spectra were recorded on Bruker DRX-600, DRX-500 or
Varian Inova-300 spectrometers. High-resolution mass spectroscopic data
were obtained on an ESI-ToF mass spectrometer (Agilent 6200 Series) at
the TSRI Open Access Mass Spectrometry Laboratory, and MALDI-ToF
mass spectrometry (Applied Biosystems Voyager DE-PRO System 6008)
was from the TSRI Center for Protein and Nucleic Acid Research.
Synthesis procedures and characterizations
Compound 1: This was synthesized according to the literature.[29]
Compound 2: NaHCO3 (1.65 g, 19.4 mmol, 1.2 equiv) was added to a so-
lution of m-anisidine (2 mL, 16.2 mmol, 1 equiv) in tetrahydrofuran
(50 mL) at 08C. Benzyl chloroformate (2.8 mL, 19.4 mmol, 1.2 equiv) was
then added dropwise under strong stirring. The mixture was allowed to
warm to room temperature over 20 min, stirred for an additional hour
and then diluted with CH2Cl2. The organic layer was quenched with satu-
rated aqueous NaHCO3, washed with brine, dried (Na2SO4), filtered and
evaporated. The residue was subjected to a short silica gel column chro-
matography with a step gradient of CH2Cl2 (20–100%) in hexane afford-
chromatography with
a step gradient with ethyl acetate (0–5%) in
CH2Cl2 containing 0.5% triethylamine. The desired compound 4 was ob-
tained as a colorless oil after evaporation of the solvent (21 g, 4.28 mmol,
1
64% yield). H NMR (500 MHz, CD3CN): d=7.10 (d, J=8.1 Hz, 1H, H-
6), 6.26 (d, J=2.1 Hz, 1H, H-3), 6.18 (dd, J=8.1, 2.1 Hz, 1H, H-5), 5.15
Chem. Eur. J. 2012, 18, 1231 – 1239
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
1237

F. E. Romesberg et al.
(m, 1H, H-1’), 4.47 (dt, J=7.7, 5.6 Hz, 1H, H-3’), 4.11 (s, 2H, NH2),
4.05–3.84 (m, 2H, H-5’,H-5’’), 3.75–3.68 (m, 4H, OCH3, H-4’), 2.20 (ddd,
J=12.7, 7.3, 5.4 Hz, 1H, H-2’), 2.00 (m, 1H, H-2’’), 1.13–1.00 ppm (m,
28H, iPr); 13C NMR (125 MHz, CD3CN): d=158.3 (C2), 149.6 (C4), 128.0
(C6), 120.2 (C1), 107.1 (C5), 98.6 (C3), 86.3 (C4’), 74.3 (C1’), 74.0 (C3’), 64.2
(C5’), 55.8 (OCH3), 42.5 (C2’), 17.9–13.4 ppm (iPr); HRMS (ESI+) m/z:
calcd for C24H44NO5Si2 [M+H]+ 482.2752, found 482.2748.
compound 5c was obtained as white foam after evaporation of the sol-
vent (75 mg, 0.27 mmol, 51% yield). 1H NMR (600 MHz, CD3OD): d=
7.40 (d, J=8.3 Hz, 1H, H-6), 7.33 (d, J=1.8 Hz, 1H, H-3), 7.02 (dd, J=
8.3, 1.8 Hz, 1H, H-5), 5.38 (dd, J=10.2, 5.6 Hz, 1H, H-1’), 4.27 (m, 1H,
H-3’), 3.90 (td, J=5.2, 2.7 Hz, 1H, H-4’), 3.80 (s, 3H, OCH3), 3.65 (m,
2H, H-5’, H-5’’), 2.27 (ddd, J=13.1, 5.5, 1.7 Hz, 1H, H-2’), 2.10 (s, 3H,
COCH3), 1.80 ppm (ddd, J=13.2, 10.3, 6.0 Hz, 1H, H-2’’); 13C NMR
(150 MHz, CD3OD): d=171.5 (NHC=O), 157.8 (C2), 140.1 (C4), 127.2
(C6), 127.2 (C1), 112.7 (C5), 103.7 (C3), 88.5 (C4’), 76.2 (C1’), 74.4 (C3’),
64.0 (C5’), 55.7 (OCH3), 43.1 (C2’), 23.9 ppm (COCH3); HRMS (ESI+) m/
z: calcd for C14H20NO5 [M+H]+ 282.1341, found 290.1351.
Compound 5a: A solution of 70% aqueous tert-butyl hydroperoxide
(160 mL, 1.18 mmol, 3.8 equiv) was added dropwise over a period of
15 min to a solution of 4 (150 mg, 0.31 mmol, 1 equiv) and potassium
iodide (5.1 mg, 0.031 mmol, 0.1 equiv) in CH3CN (1.1 mL), and the mix-
ture was stirred at 758C in the dark for 2 h. The mixture was quenched
with saturated aqueous Na2S2O3, washed with brine, extracted with ethyl
acetate, dried (Na2SO4), filtered and evaporated. The resulting residue
was dissolved in tetrahydrofuran (1.5 mL), tetrabutylammonium fluoride
(1m; 0.5 mL, 0.5 mmol) in tetrahydrofuran was added, and the mixture
was stirred for 1 h at room temperature. The reaction mixture was diluted
with ethyl acetate, quenched with saturated aqueous NaHCO3, washed
with brine, dried (Na2SO4), filtered and evaporated. The residue was sub-
jected to silica gel column chromatography with a step gradient of metha-
nol (0–4%) in ethyl acetate. The desired compound 5a was obtained as
white foam after evaporation of the solvent (32 mg, 0.12 mmol, 38%).
1H NMR (500 MHz, CD3CN): d=7.82 (dd, J=8.4, 2.2 Hz, 1H, H-5),
7.77–7.69 (m, 2H, H-6, H-3), 5.32 (dd, J=10.1, 5.8 Hz, 1H, H-1’), 4.24
(dt, J=5.2, 2.1 Hz, 1H, H-3’), 3.91 (s, 3H, OCH3), 3.88 (td, J=5.0,
2.6 Hz, 1H, H-4’), 3.63–3.59 (dd, J=5.0, 0.9 Hz, 2H, H-5’, H-5’’), 2.32
(ddd, J=13.0, 5.7, 2.0 Hz, 1H), 1.68 ppm (ddd, J=13.1, 10.1, 5.9 Hz,
1H); 13C NMR (125 MHz, CD3CN): d=157.4 (C2), 149.0 (C4), 140.3 (C1),
127.1 (C6), 116.6 (C5), 106.1 (C3), 88.5 (C4’), 75.5 (C1’), 73.9 (C3’), 63.7
(C5’), 56.8 (OCH3), 42.9 ppm (C2’); HRMS (ESI+) m/z: calcd for
C12H16NO6 [M+H]+ 270.0972, found 270.0984.
Compound 5d: Triethylamine (170 mL, 1.24 mmol, 1.7 equiv) and then
trifluoroacetic anhydride (170 mL, 0.88 mmol, 1.2 equiv) were added
dropwise to a solution of 4 (350 mg, 0.73 mmol, 1 equiv) in CH2Cl2
(2 mL) at 108C. The reaction mixture was stirred at room temperature
for 20 min at 108C and then quenched with saturated aqueous NaHCO3.
The organic layer was diluted with CH2Cl2, washed with brine, dried
(Na2SO4), filtered and evaporated. The resulting residue was dissolved in
tetrahydrofuran (5 mL), tetrabutylammonium fluoride (1m; 1.9 mL,
1.9 mmol) in tetrahydrofuran was added and the mixture was stirred for
1 h at room temperature. The reaction mixture was diluted with ethyl
acetate, quenched with saturated aqueous NaHCO3, washed with brine,
dried (Na2SO4), filtered and evaporated. The residue was subjected to
silica gel column chromatography with a step gradient of methanol (0–
10%) in CH2Cl2. The desired compound 5c was obtained as white foam
after evaporation of the solvent (200 mg, 0.60 mmol, 81% yield).
1H NMR (600 MHz, CD3CN): d=9.25 (s, 1H, NH), 7.50 (d, J=8.2 Hz,
1H, H-6), 7.27 (d, J=1.9 Hz, 1H, H-3), 7.19 (m, 1H, H-5), 5.27 (dd, J=
10.2, 5.6 Hz, 1H, H-1’), 4.22 (m, 1H, H-3’), 3.82 (d, J=27.6 Hz, 4H, H-4’,
OCH3), 3.59 (d, J=4.9 Hz, 2H, H-5’, H-5’’), 2.22 (m, 1H, H-2’), 1.72 ppm
(m, 1H, H-2’’); 13C NMR (150 MHz, CD3CN): d=157.5 (C2), 156.2–155.4
(NHC=O), 136.9 (C4), 129.7 (C6), 127.3 (C1), 119.8–114.1 (CF3), 113.7
(C5), 104.7 (C3), 88.2 (C4’), 75.4 (C1’), 74.1 (C3’), 63.9 (C5’), 56.2 (OCH3),
43.1 ppm (C2’); HRMS (ESI+) m/z: calcd for C14H17F3NO5 [M+H]+
336.1053, found 336.1066.
Compound 5b: A solution of 4 (250 mg, 0.52 mmol, 1 equiv) and 2,5-di-
methoxytetrahydrofuran (170 mg, 1.3 mmol, 2.5 equiv) in H2O (0.8 mL)
was heated to 1408C for 30 min in a microwave synthesizer (Biotage AB,
Sweden). The reaction was allowed to cool and the resulting mixture was
diluted with ethyl acetate, quenched with saturated aqueous NaHCO3,
washed with brine, dried (Na2SO4), filtered and evaporated. The resulting
residue was dissolved in tetrahydrofuran (3 mL), tetrabutylammonium
fluoride (1m; 1 mL, 1 mmol) in tetrahydrofuran was added and the mix-
ture was stirred for 1 h at room temperature. The reaction mixture was
diluted with ethyl acetate, quenched with saturated aqueous NaHCO3,
washed with brine, dried (Na2SO4), filtered and evaporated. The residue
was subjected to silica gel column chromatography with a step gradient
of methanol (0–8%) in CH2Cl2. The desired compound 5b was obtained
as white foam after evaporation of the solvent (95 mg, 0.33 mmol, 63%).
1H NMR (600 MHz, CD3CN): d=7.52 (d, J=8.0 Hz, 1H, H-6), 7.17 (m,
J=2.1 Hz, 2H, H-7), 7.02 (m, 2H, H-5, H-3), 6.29 (t, J=2.2 Hz, 2H, H-
8), 5.30 (dd, J=10.2, 5.6 Hz, 1H, H-1’), 4.23 (m, 1H, H-3’), 3.88 (s, 2H,
OCH3), 3.83 (td, J=5.0, 2.6 Hz, 1H, H-4’), 3.60 (t, J=5.1 Hz, 2H), 3.21
(d, J=3.7 Hz, 1H, OH-3’), 2.92 (t, J=5.7 Hz, 1H, OH-5’), 2.22 (m, 1H,
H-2’), 1.76 ppm (ddd, J=13.0, 10.3, 6.0 Hz, 1H, H-2’’); 13C NMR
(150 MHz, CD3CN): d=158.1 (C2), 141.6 (C4), 129.1 (C6), 128.0 (C1),
120.2 (C7), 112.6 (C5), 111.1 (C8), 104.0 (C3), 88.2 (C4’), 75.4 (C1’), 74.1
(C3’), 63.8 (C5’), 56.4 (OCH3), 43.1 ppm (C2’); HRMS (ESI+) m/z: calcd
for C16H20NO4 [M+H]+ 290.1387, found 290.1397.
General procedure for triphosphate synthesis: Proton sponge (1.3 equiv)
and the free nucleoside derivative (1.0 equiv) were dissolved in dry tri-
methyl phosphate (40 equiv) and cooled to ꢀ158C under nitrogen atmos-
phere. Freshly distilled POCl3 (1.3 equiv) was added dropwise and the re-
sulting mixture was stirred at ꢀ108C for 2 h. Tributylamine (6.0 equiv)
and a solution of tributylammonium pyrophosphate (5.0 equiv) in dime-
thylformamide (0.5m) were added. Over 30 min, the reaction was allowed
to warm slowly to 08C and then was quenched by addition of 0.5m aque-
ous Et3NH2CO3 (TEAB) pH 7.5 (2 vol. equiv). The mixture was diluted
twofold with H2O and the product was isolated on a DEAE Sephadex
column (GE Healthcare) with an elution gradient of 0 to 1.2m TEAB,
evaporated, co-distilled with H2O (3ꢂ). Additional purification by re-
verse-phase (C18) HPLC (0–35% CH3CN in 0.1m TEAB, pH 7.5) was
performed.
Compound 6a: 31P NMR (162 MHz, D2O): d=ꢀ10.52 (d, J=19.8 Hz, g-
P), ꢀ10.84 (d, J=20.2 Hz, a-P), ꢀ22.92 ppm (t, J=20.1 Hz, b-P); MS
(MALDI-ToFꢀ, matrix: 9-aminoacridine) m/z: [MꢀH]ꢀ calcd for
C12H17NO15P3, 508.2; found, 508.3; e(l=330 nm) =2200mꢀ1 cmꢀ1; e(l=285 nm)
=
4800mꢀ1 cmꢀ1
.
Compound 6b: 31P NMR (162 MHz, D2O): d=ꢀ10.22 (d, J=19.8 Hz, g-
P), ꢀ10.75 (d, J=20.1 Hz, a-P), ꢀ22.82 ppm (t, J=20.0 Hz, b-P); MS
(MALDI-ToF, matrix: 9-aminoacridine) m/z: [MꢀH]ꢀ calcd for
Compound 5c: Triethylamine (125 mL, 0.89 mmol, 1.7 equiv) and then
acetic anhydride (60 mL, 0.62 mmol, 1.2 equiv) were added dropwise to a
solution of 4 (250 mg, 0.52 mmol, 1 equiv) in CH2Cl2 (600 mL). The reac-
tion mixture was stirred at room temperature for 20 min and then
quenched with saturated aqueous NaHCO3. The organic layer was dilut-
ed with CH2Cl2, washed with brine, dried (Na2SO4), filtered and evapo-
rated. The resulting residue was dissolved in tetrahydrofuran (2 mL),
C16H21NO13P3, 528.3; found 527.8; e(l=283 nm) =5080mꢀ1 cmꢀ1; e(l=256 nm)
=
10850mꢀ1 cmꢀ1
.
Compound 6c: 31P NMR (202 MHz, D2O): d=ꢀ6.35 (d, J=16.9 Hz, g-
P), ꢀ10.74 (d, J=19.7 Hz, a-P), ꢀ22.38 ppm (m, b-P); MS (MALDI-
ToFꢀ, matrix: 9-aminoacridine) m/z: [MꢀH]ꢀ calcd for C14H21NO14P3,
520.2; found 519.3; e(l=282 nm) =2700mꢀ1 cmꢀ1; e(l=248 nm) =7500mꢀ1 cmꢀ1
.
tetraACHTUNGTRENNUNGbutylACHTUNGTRENNUNGammonium fluoride (1m; 1 mL, 1 mmol) in tetrahydrofuran
Compound 6d: 31P NMR (162 MHz, D2O): d=ꢀ10.38 (d, J=19.8 Hz, g-
P), ꢀ10.87 (d, J=20.2 Hz, a-P), ꢀ22.82 ppm (t, J=20.0 Hz, b-P); MS
(MALDI-ToFꢀ, matrix: 9-aminoacridine) m/z: [MꢀH]ꢀ calcd for
was added and the mixture was stirred for 1 h at room temperature. The
reaction mixture was diluted with ethyl acetate, quenched with saturated
aqueous NaHCO3, washed with brine, dried (Na2SO4), filtered and
evaporated. The residue was subjected to silica gel column chromatogra-
phy with a step gradient of methanol (0–12%) in CH2Cl2. The desired
C14H18F3NO14P3, 574.2; found 573.9; e(l=285 nm) =3780mꢀ1 cmꢀ1; e(l=251 nm)
=
7450mꢀ1 cmꢀ1
.
1238
www.chemeurj.org
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2012, 18, 1231 – 1239

Hydrophobic Unnatural Base Pairs
FULL PAPER
Compound 6e: A solution of 6d in aqueous ammonia (28% NH3 w/v;
1 mL) was stirred for 1 h. Ammonia was removed by vacuum concentra-
tion (SpeedVac, 20 min) and the resulting solution was separated by re-
verse-phase (C18) HPLC (0–35% CH3CN in 0.1m TEAB, pH 7.5) to pro-
vide pure compound 6e. 31P NMR (162 MHz, D2O): d=ꢀ9.21 (d, J=
20.0 Hz, g-P), ꢀ10.85 (d, J=20.4 Hz, a-P), ꢀ22.62 ppm (t, J=20.6 Hz, b-
P); MS (MALDI-ToF, matrix: 9-aminoacridine) m/z: [MꢀH]ꢀ calcd for
Acknowledgements
Funding for this work was provided by the National Institute for Health
(GM060005). We wish to thank Dr. Phillip Ordoukhanian, director of
The Center for Protein and Nucleic Acids Research at The Scripps Re-
search Institute, for analytical support.
C12H19NO13P3, 478.2; found 477.8; e(l=284 nm) =2450mꢀ1 cmꢀ1; e(l=240 nm)
=
9250mꢀ1 cmꢀ1
.
[1] J. Horlacher, M. Hottiger, V. N. Podust, U. Hꢄbscher, S. A. Benner,
Proc. Natl. Acad. Sci. USA 1995, 92, 6329–6333.
[2] M. J. Lutz, H. A. Held, M. Hottiger, U. Hꢄbscher, S. A. Benner, Nu-
cleic Acids Res. 1996, 24, 1308–1313.
[3] J. A. Piccirilli, T. Krauch, S. E. Moroney, S. A. Benner, Nature 1990,
343, 33–37.
[4] Z. Yang, F. Chen, S. G. Chamberlin, S. A. Benner, Angew. Chem.
2010, 122, 181–184; Angew. Chem. Int. Ed. 2010, 49, 177–180.
[5] G. T. Hwang, F. E. Romesberg, J. Am. Chem. Soc. 2008, 130, 14872–
14882.
[6] A. M. Leconte, G. T. Hwang, S. Matsuda, P. Capek, Y. Hari, F. E.
Romesberg, J. Am. Chem. Soc. 2008, 130, 2336–2343.
[7] A. M. Leconte, F. E. Romesberg, in Protein Engineering (Ed.:
C. K. a. U. L. RajBhandary), Springer, Berlin, 2009, pp. 291–314.
[8] D. A. Malyshev, D. A. Pfaff, S. I. Ippoliti, G. T. Hwang, T. J. Dwyer,
F. E. Romesberg, Chem. Eur. J. 2010, 16, 12650–12659.
[9] D. A. Malyshev, Y. J. Seo, P. Ordoukhanian, F. E. Romesberg, J. Am.
Chem. Soc. 2009, 131, 14620–14621.
[10] S. Matsuda, J. D. Fillo, A. A. Henry, P. Rai, S. J. Wilkens, T. J.
Dwyer, B. H. Geierstanger, D. E. Wemmer, P. G. Schultz, G. Sprag-
gon, F. E. Romesberg, J. Am. Chem. Soc. 2007, 129, 10466–10473.
[11] S. Matsuda, A. M. Leconte, F. E. Romesberg, J. Am. Chem. Soc.
2007, 129, 5551–5557.
[12] D. L. McMinn, A. K. Ogawa, Y. Wu, J. Liu, P. G. Schultz, F. E. Ro-
mesberg, J. Am. Chem. Soc. 1999, 121, 11585–11586.
[13] Y. J. Seo, G. T. Hwang, P. Ordoukhanian, F. E. Romesberg, J. Am.
Chem. Soc. 2009, 131, 3246–3252.
[14] Y. J. Seo, S. Matsuda, F. E. Romesberg, J. Am. Chem. Soc. 2009, 131,
5046–5047.
[15] Y. J. Seo, F. E. Romesberg, ChemBioChem 2009, 10, 2394–2400.
[16] C. Yu, A. A. Henry, F. E. Romesberg, P. G. Schultz, Angew. Chem.
2002, 114, 3997–4000; Angew. Chem. Int. Ed. 2002, 41, 3841–3844.
[17] I. Hirao, Curr. Opin. Chem. Biol. 2006, 10, 622–627.
[18] I. Hirao, M. Kimoto, T. Mitsui, T. Fujiwara, R. Kawai, A. Sato, Y.
Harada, S. Yokoyama, Nat. Methods 2006, 3, 729–735.
[19] I. Hirao, T. Mitsui, M. Kimoto, S. Yokoyama, J. Am. Chem. Soc.
2007, 129, 15549–15555.
[20] M. Kimoto, R. Kawai, T. Mitsui, S. Yokoyama, I. Hirao, Nucleic
Acids Res. 2009, 37, e14.
[21] T. Mitsui, A. Kitamura, M. Kimoto, T. To, A. Sato, I. Hirao, S. Yo-
koyama, J. Am. Chem. Soc. 2003, 125, 5298–5307.
dNaMTP: dNaMTP was synthesized by using the general procedure de-
scribed above, starting from dNaM nucleoside (Berry & Associates, Inc.).
31P NMR (162 MHz, D2O): d=ꢀ8.96 (d, J=19.4 Hz, g-P), ꢀ10.81 (d, J=
20.1 Hz, a-P), ꢀ22.66 ppm (t, J=20.2 Hz, b-P); MS (MALDI-ToFꢀ,
matrix: 9-aminoacridine) m/z: [MꢀH]ꢀ calcd for C16H20O13P3, 513.2;
found 513.4; e(l=230 nm) =75000mꢀ1 cmꢀ1
.
d5SICSTP: d5SICSTP was synthesized by using the general procedure
described above, starting from the d5SICS nucleoside (Berry & Associ-
ates, Inc.). 31P NMR (162 MHz, D2O): d=ꢀ10.11 (d, J=20.0 Hz, g-P),
ꢀ11.05 (d, J=20.2 Hz, a-P), ꢀ22.75 ppm (t, J=20.0 Hz, b-P); MS
(MALDI-ToFꢀ, matrix: 9-aminoacridine) m/z: [MꢀH]ꢀ calcd for
C15H19NO12P3S, 530.3; found 529.3; e(l=365 nm) =3950mꢀ1 cmꢀ1
.
Gel-based kinetic assays: Primer oligonucleotides (Integrated DNA Tech-
nologies) were 5’-radiolabeled with T4 polynucleotide kinase (New Eng-
land Biolabs) and [g-32P]-ATP (GE Biosciences) and annealed to tem-
plate oligonucleotides[13] by heating to 958C followed by slow cooling to
room temperature. Reactions were initiated by adding a solution of 2ꢂ
dNTP (5 mL) to a mixture containing polymerase (0.10–1.23 nm) and
primer template (40 nm) in reaction buffer (5 mL); Klenow reaction
buffer (50 mm Tris-HCl, pH 7.5, 10 mm DTT, 50 mgmLꢀ1 acetylated BSA)
for Kf polymerase, ThermoPol reaction buffer (20 mm Tris-HCl, 10 mm
(NH4)2SO4, 10 mm KCl, 2 mm MgSO4, 0.1% Triton X-100, pH 8.8) for
Taq polymerase. After incubation at 258C (Kf) or 508C (Taq) for 3–
10 min the reactions were quenched with loading dye (20 mL; 95% for-
mamide, 20 mm EDTA, and sufficient amounts of bromophenol blue and
xylene cyanole). Reaction products were resolved by polyacrylamide
(15%) gel electrophoresis, and gel band intensities corresponding to the
extended and unextended primers were quantified by phosphorimaging
(Storm Imager, Molecular Dynamics) and Quantity One (BioRad) soft-
ware. Plots of kobs versus triphosphate concentration were fit to the Mi-
chaelis–Menten equation by using the program Origin (Microcal Soft-
ware) to determine Vmax and KM. The kcat was determined from Vmax by
normalizing by the total enzyme concentration. Each reaction was run in
triplicate and standard deviations for both kinetic parameters were deter-
mined (Tables 1–3). An example of the raw kinetic data is shown in Fig-
ure S27 in the Supporting Information.
PCR amplification: DNA templates D1 and D6 were synthesized as de-
scribed previously.[9] PCR amplification (see the Supporting Information
for details and sequences) was carried out starting with D6 (0.1 ng) or of
D1 (1 ng; Taq or DeepVent, respectively) in 1ꢂThermoPol reaction
buffer with the following modifications: MgSO4 adjusted to 6.0 mm, 0.6
or 0.7 mm of each natural dNTP (Taq or DeepVent, respectively), each
unnatural triphosphate (0.1 mm), each primer (1 mm; see the Supporting
Information for sequences), and Taq (0.03 unitmLꢀ1) or DeepVent (exo+;
0.02 unitmLꢀ1) in an iCycler Thermal Cycler (Bio-Rad) under following
thermal cycling conditions: 948C, 30 s; 488C, 30 s; 658C, 4 min, 18 or 13
cycles (Taq or DeepVent, respectively). Upon completion, PCR products
were purified utilizing the PureLinkTM PCR purification kit (Invitrogen),
quantified by fluorescent dye binding (Quant-iT dsDNA HS Assay kit,
Invitrogen) and sequenced on 3730 DNA Analyzer (Applied Biosystems)
to determine fidelity of unnatural base pair replication (see the Support-
ing Information and ref. [9] for details).
[22] A. D. Keefe, S. T. Cload, Curr. Opin. Chem. Biol. 2008, 12, 448–456.
[23] W. Fritzsche, F. Bier, in International Symposium on DNA-Based
Nanodevices, Vol. 1062, American Institute of Physics Conference
Proceedings, 2008.
[24] M. Vrꢅbel, R. Pohl, I. Votruba, M. Sajadi, S. A. Kovalenko, N. P.
Ernsting, M. Hocek, Org. Biomol. Chem. 2008, 6, 2852–2860.
[25] M. A. Wilson, G. Filzen, G. S. Welmaker, Tetrahedron Lett. 2009, 50,
4807–4809.
[26] J. Ludwig, F. Eckstein, J. Org. Chem. 1989, 54, 631–635.
[27] M. S. Boosalis, J. Petruska, M. F. Goodman, J. Biol. Chem. 1987,
262, 14689–14696.
[28] K. Datta, V. J. LiCata, Nucleic Acids Res. 2003, 31, 5590–5597.
[29] E. Larsen, P. T. Jørgensen, M. A. Sofan, E. B. Pederson, Synthesis
1994, 1037–1038.
Received: July 5, 2011
Published online: December 21, 2011
Chem. Eur. J. 2012, 18, 1231 – 1239
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
1239