Synthesis and biological evaluation of halogenated curcumin analogs as potential nuclear receptor selective agonists

Article abstract of DOI:10.1016/j.bmc.2012.11.033

This report describes the synthesis of analogs of curcumin, and their analysis in acting as nuclear receptor specific agonists. Curcumin (CM), a turmeric-derived bioactive polyphenol found in curry, has recently been identified as a ligand for the vitamin

Full text of DOI:10.1016/j.bmc.2012.11.033

Bioorganic & Medicinal Chemistry 21 (2013) 693–702
Contents lists available at SciVerse ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Synthesis and biological evaluation of halogenated curcumin analogs
as potential nuclear receptor selective agonists
Shane Batie, Jamie H. Lee, Rabia A. Jama, Drew O. Browder, Luis A. Montano, Chanh C. Huynh,
⇑
Lisa M. Marcus, Dorian G. Tsosie, Zeynab Mohammed, Vu Trang, Pamela A. Marshall, Peter W. Jurutka ,
⇑
Carl E. Wagner
School of Mathematical and Natural Sciences, New College of Interdisciplinary Arts and Sciences, Arizona State University, 4701 W. Thunderbird Road, Glendale, AZ 85306,
United States
a r t i c l e i n f o
a b s t r a c t
Article history:
This report describes the synthesis of analogs of curcumin, and their analysis in acting as nuclear receptor
specific agonists. Curcumin (CM), a turmeric-derived bioactive polyphenol found in curry, has recently
been identified as a ligand for the vitamin D receptor (VDR), and it is possible that CM exerts some of
its bioeffects via direct binding to VDR and/or other proteins in the nuclear receptor superfamily. Using
mammalian-two-hybrid (M2H) and vitamin D responsive element (VDRE) biological assay systems, we
tested CM and 11 CM synthetic analogs for their ability to activate VDR signaling. The M2H assay revealed
that RXR and VDR association was induced by CM and several of its analogs. VDRE-based assays demon-
strated that pure curcumin and eight CM analogs activated transcription of a luciferase plasmid at levels
approaching that of the endocrine 1,25 dihydroxyvitamin D3 (1,25D) ligand in human colon cancer cells
(HCT-116). Additional experiments were performed in HCT-116 utilizing various nuclear receptors and
hormone responsive elements to determine the receptor specificity of curcumin binding. CM did not
appear to activate transcription in a glucocorticoid responsive system. However, CM along with several
analogs elicited transcriptional activation in retinoic acid and retinoid X receptor (RXR) responsive sys-
tems. M2H assays using RXR–RXR, VDR–SRC1 and VDR–DRIP revealed that CM and select analogs stim-
ulate RXR homodimerization and VDR–coactivator interactions. These studies may lead to the discovery
of novel curcumin analogs that activate nuclear receptors, including RXR, RAR and VDR, resulting in sim-
ilar health benefits as those for vitamins A and D, such as lowering the risk of epithelial and colon cancers.
Ó 2012 Elsevier Ltd. All rights reserved.
Received 19 September 2012
Revised 17 November 2012
Accepted 24 November 2012
Available online 5 December 2012
Keywords:
Curcumin
Vitamin D receptor
Retinoid X receptor
Rexinoid
Resveratrol
1. Introduction
largely consisting of demethoxycurcumin (2) and bisdemethoxy-
curcumin (3), and a very small amount of cyclocurcumin (4).1
The yellow spice powder turmeric, extracted from the Curcuma
longa L. rhizome, derives its power to stain rice a bright canary yel-
low in Chinese and Indian curries from a variety of closely related
substances termed curcuminoids. The primary constituent of the
curcuminoids, termed curcumin (1) (CM), accounts for 5% of
turmeric powder by weight, with the other minor curcuminoids
Abbreviations: CM, curcumin; RAR, retinoic acid receptor; HRE, hormone
responsive element; M2H, mammalian two hybrid; RXR, retinoid X receptor; TR,
thyroid hormone receptor; T3, triiodothyronine; VDR, vitamin D receptor; VDRE,
vitamin
glucocorticoid receptor; BEX, bexarotene; DEX, dexamethasone; SRC, steroid
receptor coactivator; DRIP, vitamin receptor interacting protein; SNuRMs,
selective nuclear receptor modulators; AD, Alzheimer’s disease; 1,25D, 1,25
dihydroxyvitamin D3.
D responsive element; GRE, glucocorticoid responsive element; GR,
In addition to being an essential spice in Chinese and Indian cui-
sine, turmeric has a long history of use in traditional Chinese and
Indian medicines. Recent studies have shown the principally active
D
⇑
Corresponding authors. Tel.: +1 602 543 6937; fax: +1 602 543 6073.
E-mail addresses: Peter.Jurutka@asu.edu (P.W. Jurutka), Carl.Wagner@asu.edu
chemical component, curcumin, to possess
a wide range of
pharmacological and biological activities including antioxidant2,
(C.E. Wagner).
0968-0896/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.bmc.2012.11.033

694
S. Batie et al. / Bioorg. Med. Chem. 21 (2013) 693–702
anti-angiogenic3, anti-inflammatory4, antiviral5, antimicrobial,
chemo-preventive6 and anticancer7 characteristics through bio-
chemical pathways and bio-molecular receptor interactions
1.1. Chemistry
Towards the above two goals, we have synthesized a wide range
of novel, halogenated curcumin analogs (5–9), as well as tetrahy-
drocurcumin (10)1 and halogenated curcumin analogs that have
been reported in literature (11–15).
including various transcriptional factors (NF-j
B)8, cell survival reg-
ulators (e.g., cFLIP, BcI-xL, and BcI-2)9, cell proliferation regulators
(e.g, c-myc, and cyclin D1)10, caspase activation signals (e.g., cas-
pase-3, caspase-8, and caspase-9)11, death receptor regulators
(e.g., DR5 and DR4)12, tumor suppressor factors (e.g. p21 and
p53)13, protein kinase cascades (e.g., Akt, JNK, and AMPK)14, and
mitochondrial pathways. It is precisely this wide-range of pharma-
cological activities that may well endow curcumin with extraordi-
nary potential in cancer chemoprevention.15
Recently, it has been shown that curcumin is a molecule that
can bind to and activate the vitamin D receptor (VDR), a nuclear
receptor that has been shown not only to regulate bone growth
and mineral homeostasis but also cell proliferation through tumor
suppressor factors such as p21.16 Many, but not all, of the nuclear
receptor proteins have an endogenous ligand(s) that binds to a spe-
cific pocket within the protein, altering the conformation of the
receptor and allowing the protein to bind to a specific molecular
scaffold on DNA. The association of the nuclear receptor protein
with the DNA results in modulation of gene expression ultimately
leading to a physiological effect. Examples of nuclear receptor
endogenous ligands include vitamin A (the all trans retinoic acid
form) as a biologically active ligand for the retinoic acid receptor
(RAR)17, the hormonally active form of vitamin D (calcitriol) as
the endogenous ligand for VDR18, and triiodothyronine (T3) as
the ligand for the thyroid hormone receptor (TR).19
Tetrahydrocurcumin (10)1 is reported to have potent biological
activities, without the deeply staining color of curcumin. The chlori-
nated curcumin analog 11 has been patented as a potential therapeutic
target in the treatment of Alzheimer’s disease.23 The dibromo curcu-
min analog 1224 has been reported to have comparable antioxidant
and cytotoxicity properties as curcumin. The dibromo curcumin analog
Appropriate nuclear receptor activity is vital to the healthy
functioning of physiological processes. For example, the lack of
biologically active vitamin D, either through malnutrition or a ge-
netic disorder that prevents the body from being able to make cal-
citriol, results in a condition known as Rickets where there is
softening of the bones.20 Also, the potential for VDR to up-regulate
the tumor suppressing gene p21, as well as the role of vitamin D in
chemoprevention of colon and prostate cancers21 suggests that if
curcumin activates VDR as well as vitamin D, then curcumin and
its analogs have tremendous pharmacological potential.
Despite the fact that curcumin has been shown to be safe, even at
high doses22 in human and animal models, it has not thus far been
FDA approved or validated as a bona fide therapeutic agent. Three fac-
tors that may explain why, despite its multi-targeting of important bio-
logical pathways implicated in cancer, curcumin has not been FDA
approved to treat cancer are its poor water solubility, its intense stain-
ing ability, and its seemingly low ‘bioavailability’ (ability to be ab-
sorbed, and access various affected systems, in the body).1 While
various approaches have been taken to develop curcumin formulations
that increase bioavailability and limit its intense staining properties,
there is still ample motivation to prepare novel molecular analogs of
curcumin that vary in the substitution of various atoms or structural
motifs in order to evaluate their efficacy vis-à-vis curcumin in VDR
and other nuclear receptor binding/activation.
1325 has been reported to have a lower IC50 (33 M)25a than curcumin
l
(>400 lM) for the p300 histone acetyltransferase enzyme, an enzyme
implicated in several human cancers and disease pathways. While 1426
was synthesized for examination as a potential curcumin analog to in-
hibit the human platelet 12-lipoxygenase (P-12-LOX) enzyme, curcu-
min possessed a much lower IC50 (66 lM) than 14 (>100 lM).
Finally, analog 1527 has been shown to be nearly as potent as curcumin
in its ability to bind to Alzheimer’s amyloid-beta proteins. The fact that
several of the reported halogenated curcumin analogs have moderate
bioactivities, and the observation that halogen substitutions can occa-
sionally increase binding and activation of nuclear receptors relative to
a given agonist,28 encouraged us to synthesize this array of haloge-
nated curcumin analogs for testing as potential VDR agonists.
The synthesis of analogs 5–15 followed the reported synthetic
routes29 for curcumin (1) and tetrahydrocurcumin (10). For exam-
ple, the difluoro analog (5) was synthesized from commercially
available fluoro-vanillin (16), in a one-pot reaction that combined
16 with pentane-2,4-dione, tributylborate, tributylamine, and bo-
ric anhydride in ethyl acetate for 24 h at 40 °C according to
Scheme 1.
The reduction of analog 5 to the difluoro tetrahydrocurcumin 6
was accomplished by hydrogenation with 10% Palladium on carbon

S. Batie et al. / Bioorg. Med. Chem. 21 (2013) 693–702
695
quantitation of luciferase production in colorectal carcinoma cells
(HCT-116) (Fig. 2A and B, respectively). In the VDR/SRC-1 assay
(Fig. 2A), VDR-mediated recruitment of SRC-1 was exhibited with
the endocrine VDR ligand (1,25D), as well as with the curcumin
parent compound, and all three analogs tested (12, 14, and 15).
The level of ligand-induced SRC binding to VDR was almost as po-
tent (or more potent) with the curcumin compounds as it was with
the authentic 1,25D hormone (Fig. 2A, black bar). Similar patterns
of luciferase activation are seen in the VDR/DRIP205 assay (Fig. 2B),
with the parent compound displaying significantly more activation
than in the VDR/SRC-1 assay when compared to the 1,25D control,
and the CM analogs possessing almost equal activity as 1,25D. The
results in Figure 2 demonstrate the ability of curcumin and select
halogenated analogs to bind VDR and recruit additional co-factor
proteins that are obligatory for VDR-directed transcriptional acti-
vation and control of vitamin D target genes.
Scheme 1.
in a continuous hydrogenation flow reactor30 as shown below
(Scheme 2).
All analogs 5–15 were synthesized in methods similar to those
in Schemes 1 and 2.
1.2. Biological assays and rationale
Biological evaluation of synthetic halogenated curcumin ana-
logs (5–9), tetrahydrocurcumin (10), and those halogenated curcu-
min analogs reported in literature (11–15) was first carried out in
two different VDRE-luciferase reporter systems and then repeated
in a mammalian two-hybrid assay in colorectal carcinoma cells
(HCT-116) (Fig. 1A–C, respectively). These assays test the ability
of the analog to bind to or activate the vitamin D receptor (VDR)
and induce transcription as measured by luciferase output.
Prior to testing the analogs in these assays, initial dose-response
experiments were carried out with CM in the mammalian two-
hybrid assay in colorectal carcinoma cells to determine the approx-
imate EC50 for CM activity. The estimated EC50 from these initial
We next probed whether receptor activation by curcumin and
analogs (5–15) is a VDR-specific phenomenon by employing the
glucocorticoid responsive element (GRE), retinoid
X receptor
responsive element (RXRE), and a retinoic acid receptor respon-
sive element (RARE) (Fig. 3A–C, respectively) transfected in colo-
rectal carcinoma cells (HCT-116). These assay systems are similar
to the one employed in Figure 1, except different responsive ele-
ment-luciferase constructs are employed, and the cells are treated
with the appropriate receptor ligands. In the glucocorticoid recep-
tor (GR) and responsive element system (Fig. 3A), the results indi-
cate that while dexamethasone (DEX), a bona fide GR ligand,
stimulates dramatic luciferase production, the parent CM com-
pound and analogs 5–15 do not activate GR compared to the
DMSO control vehicle as measured by activation of luciferase
activity. Utilizing an RXRE (Fig. 3B) system with the known RXR
ligand bexarotene (BEX) as a positive control, the parent com-
pound along with analogs 9 and 11–15 induced transcription of
the luciferase gene. When cells were transfected with the retinoic
acid receptor and responsive element construct (Fig. 3C), again
the parent compound along with analogs 9 and 11–15 induced
transcription of the luciferase gene in excess of the negative con-
trol (DMSO). Interestingly, the pattern of activation between the
RXR and RAR systems (Fig. 2), and the VDR–VDRE system
(Fig. 1) is similar, perhaps with the exception of analog 5. Thus,
these experiments demonstrate that although CM does not acti-
vate the GR system, CM and analog activation of VDR is appar-
ently not solely receptor specific because other proteins in the
nuclear receptor superfamily like RXR and RAR are activated by
CM and select analogs, at least under these conditions. Moreover,
this pattern of receptor activation may be related to the observa-
tion that GR is exclusively in the homodimerizing class of nuclear
receptors, while RXR, RAR and VDR are all in the heterodimer
sub-family. If CM and CM analogs not only bind to VDR, as our
results and those of Bartik et al.16 demonstrate, but also bind to
RXR, then this may explain why the pattern of activation is so
similar between the RAR, RXR and VDR systems, since all
three receptors contain RXR in their transcriptional activation
complex.
experiments (data not shown) was approximately 20–40 lM, and
this concentration of ligand was thus utilized in subsequent assays
with CM and CM analogs. In the VDRE-based assay (Fig. 1A), in
which the activation of VDR by a ligand is quantitated when the ac-
tive VDR-analog complex is bound to a potent authentic VDRE
from the CYP3A4 gene, the results indicate that analogs 6–8 do
not activate VDR when compared to the DMSO vehicle control,
while analogs 5 and 10 display a very mild (but statistically signif-
icant) stimulation of luciferase activity, and analogs 9, 11–15 re-
veal significant activation in this system. Employing a different,
less potent VDRE in the context of the natural promoter from the
CYP24A1 gene (Fig. 1B), the profile of activation is similar to the
CYP3A4 VDRE-based assay, although there is some expected atten-
uation of activity as a percentage of the DMSO control (compared
to Fig. 1A) in this system, especially with the parent compound
(curcumin) and with analogs 9 and 11–15 which display VDRE-
mediated stimulation of luciferase similar to analogs 5 and 10,
while analogs 6–8 remain inactive in both systems. Finally, utiliz-
ing a mammalian two-hybrid (M2H) assay (Fig. 1C), which detects
the ability of each analog to induce VDR-RXR heterodimerization,
the range of VDR-RXR activation by our panel of analogs is similar
to that of the two VDRE-based assays. The parent compound, along
with analogs 5, 9, and 11–15 exhibit activation while 6–8 are inac-
tive. Taken together, the results in Figure 1 demonstrate that cur-
cumin, and select CM analogs (especially halogenated
compounds 12, 14, 15) can not only induce the RXR-VDR heterodi-
mer that is required for biological activity (Fig. 1C), but the analogs
can bind to VDR and drive transcription mediated by two distinct
VDREs (Fig. 1A and B).
Therefore, we next sought to further evaluate the potential for
CM and CM analogs to directly stimulate RXR–RXR homodimeriza-
tion using the M2H system (Fig. 4) in colorectal carcinoma cells
(HCT-116). Similar to the RXRE experiment (Fig. 3B), analogs 9
and 11–15 were shown to induce RXR homodimerization and thus
activate the luciferase gene. Taken together, the observations in
Figures 3 and 4 further support the hypothesis that CM and select
analogs may function as selective nuclear receptors modulators
(SNuRMs), either by direct receptor binding in the ligand pocket,
as is the case with VDR31,16 or by modulating the transcriptional
activation potential of the receptor, which may perhaps be the
mechanism with RAR and RXR.
The M2H assay was also employed to further detect the ability
of select halogenated analogs (12, 14, and 15) to bind to VDR and
recruit the known VDR coactivators SRC-1 and DRIP205, again via
Scheme 2.

696
S. Batie et al. / Bioorg. Med. Chem. 21 (2013) 693–702
Figure 1. Evaluation of curcumin analogs in activating VDR using a vitamin D responsive element (VDRE)-luciferase reporter system and the mammalian two hybrid (M2H)
system transfected into human colon cancer cells (HCT-116): Experiments were performed using 10ꢀ10 M 1,25-dihydroxyvitamin D, 3.75 ꢁ 10ꢀ5 M curcumin (CM) and
analogs, or DMSO vehicle in complete media with 24 h of treatment. Error bars indicate standard deviation; the data shown are representative of three independent
experiments with triplicate samples in each experiment. (A) Transfection with a firefly luciferase plasmid containing two copies of the vitamin D responsive element, XDR3
from the CYP3A4 gene. Utilizing a Students’ unpaired, homoscedastic t-test, compounds 5 and 10 are significantly more active than DMSO (p <0.05) and 1,25D, CM, 9, and 11–
15 are significantly more active than DMSO (p <0.01). (B) Luciferase-based transcriptional assay using the natural promoter from the human CYP24A1 gene, which contains 2
VDREs. As analyzed by a Students’ unpaired, homoscedastic t-test, 1,25D, CM, 5 and 9–15 are significantly more active than DMSO (p <0.03). (C) Cells transfected with the
expression vectors VDR-AD (prey) and RXRa-BD (bait) along with a firefly luciferase reporter vector (pFR-luc) and Renilla luciferase control plasmid to measure the amount of
ligand-stimulated VDR-RXR interaction and to quantitate transfection efficiency, respectively. 1,25D, CM, 9, and 11–15 are able to drive VDR–RXR dimerization significantly
more than DMSO (p <0.05), as determined by a Students’ unpaired, homoscedastic t-test.
Finally, it has been reported that certain compounds can
potentiate VDR activity.32 Thus, we evaluated the ability of resve-
ratrol, a phytoalexin found in the skin of red grapes, to elicit a
synergistic effect when added to cells dosed with curcumin or
1,25D using the XDR3-luciferase reporter system (similar to
Fig. 1A) in transfected colorectal carcinoma cells (Fig. 5). CM
along with analogs 12, 14 and 15 all activated transcription of
the luciferase gene at approximately 3-fold over the negative con-
trol (DMSO). However, when cells were treated with resveratrol
and curcumin in combination, CM along with analogs 12, 14
and 15 again activated transcription of the luciferase gene but
this time at levels of approximately 8-fold over DMSO. Similarly,
1,25D elicits an 8-fold activation of luciferase while 1,25D plus
resveratrol achieves a 22-fold induction. These results suggest
that resveratrol may be potentiating the activity of not only
1,25D-VDR, but also CM-VDR. This latter observation may be of
particular significance in that nutritionally derived lipids with
known or postulated health benefits (vitamin D, curcumin and

S. Batie et al. / Bioorg. Med. Chem. 21 (2013) 693–702
697
tial screen, the compounds were not mutagenic and have exciting
potential as additional nutritional additives.
2. Conclusions
We have shown in this manuscript that CM16 and CM analogs
are potent ligands of the VDR. Moreover, our novel data also reveal
that CM and CM analogs are able to activate transcription on
RXR-homodimer responsive elements as well as RAR-responsive
elements. The RXR activation is intriguing given the very recent re-
ports surrounding the effects of RXR agonists on beta-amyloid pla-
que clearance in mouse models of Alzheimer’s disease (AD).35
Additional work has also shown that curcumin in vitro and
in vivo has many therapeutic activities towards AD phenotypes.36
We speculate that CM may modulate RXR homo- or heterodimer-
ization activity to help alleviate beta-amyloid accumulation. This
beta-amyloid clearing activity is of vast clinical significance as bex-
arotene, the therapeutic RXR analog that is utilized to activate
RXR-mediated pathways and potentially treat AD32 has untoward
side effects of hyperlipidemia—likely due to RXR/LXR activa-
tion37—and hypothyroidism38 while curcumin ingestion does not
cause these issues. Furthermore, our enticing results that curcumin
and its analogs demonstrate synergy with resveratrol in binding to
or activating VDR could lead the way to data-driven medically
sound advice about healthful diet choices, based upon therapeutic
needs of the patient. In summary, curcumin, a nutritionally-
derived bioactive lipid, and several curcumin analogs, bind to or
activate multiple nuclear receptors/pathways, including VDR,
RXR, and RAR, and further demonstrate synergy with resveratrol
in VDR signaling.
Figure 2. Analysis of CM and CM analogs to stimulate interaction of VDR with VDR
coactivators, SRC-1 and DRIP in mammalian two hybrid system (M2H):
Experiments were performed using 10ꢀ10
1,25-dihydroxyvitamin D,
a
M
3.75 ꢁ 10ꢀ5 M curcumin (CM) and analogs, or DMSO vehicle in complete media
with 24 h of treatment. Error bars indicate standard deviation; the data shown are
representative of experiments in duplicate with triplicate samples in each
experiment. (A) HCT-116 cells transfected with the expression vectors VDR-AD
(prey) and SRC-1-BD (bait) along with a firefly luciferase reporter vector (pFR-luc)
and Renilla luciferase control plasmid to measure the amount of ligand-stimulated
VDR-SRC-1 interaction and to measure transfection efficiency, respectively. (B) Cells
transfected with the expression vectors VDR-AD (prey) and DRIP205-BD (bait) to test
for association of VDR and DRIP after treatment with curcumin or analogs. Utilizing
a Students’ unpaired, homoscedastic t-test, all compounds are statistically signif-
icantly able to stimulate VDR-coactivator interaction, as compared to DMSO
control, (p <0.001).
3. Experimental section
3.1. Transfection of cultured mammalian cells and
transcriptional activation assays
Cells (HCT-116 colorectal carcinoma) were grown at 37 °C un-
der a humidified atmosphere of 5% carbon dioxide. All cell lines
in this study originated from ATCC (Manassas, VA) and were trans-
fected in Falcon 24-well plates from Beckton Dickinson using Ex-
press-In Transfection Reagent supplied by Thermo Scientific
resveratrol) culminate in modulation of nuclear receptor signaling
to exert healthful bioeffects.
(Waltham, MA). HCT-116 cells were plated at
a density of
The concentrations of CM and the CM analogs used in order to
stimulate biological activity are within the range published in pre-
vious studies,16 but may be much higher than needed in in vivo
systems due to limitations of the cell culture model. Specifically,
in vivo curcumin has been shown to be poorly bioavailable,22c
but nonetheless metabolized to potentially active compounds33
suggesting that other components found in vivo are missing in
an in vitro system.34 Additionally, in the gut, even very small levels
of CM seem to be quite efficacious34 suggesting that additional
physiological mechanisms are at work in vivo that are attenuated
in cell culture. Therefore, the cell culture system may require com-
pensatory higher concentrations of CM and CM analogs to elicit a
biological effect due to the loss of the in vivo milieu.
In order to assess the potential for these analogs to be utilized
as pharmaceuticals, we employed a Saccharomyces cerevisiae-based
mutagenicity assay.28a This assay uses a strain of yeast that will
demonstrate a phenotypic change in response to a genome lesion.
In this assay, we tested CM and the analogs for their ability to mu-
tate DNA. DNA mutation is scored either as a color change from
white to red on complete (YPD media) or as the ability to grow
on synthetic media lacking either tryptophan or isoleucine. CM
and all the analogs did not increase the number of red colonies
on YPD nor did they increase the number of colonies on synthetic
media over DMSO only control (data not shown). Thus, in our ini-
90,000 cells/well approximately 24 h prior to transfection in Dul-
becco’s modified eagle medium (DMEM), supplemented with 10%
fetal bovine serum (FBS), 0.1 mM nonessential amino acids,
100 U/ml penicillin and 100
procedure was adapted from the manufacturer’s protocol. Briefly,
each well received 2 l/well Express-In and the appropriate DNA
lg/ml streptomycin. The transfection
l
plasmids as indicated in the figure legends, along with 20 ng of
pRL-null (constitutively expressing low levels of Renilla reniformis
luciferase) to monitor transfection efficiency. The luciferase-con-
taining vectors were included in the amount of 250 ng of pLuc-
MCS plasmid (Stratagene, La Jolla, CA, USA) containing an oligonu-
cleotide (cloned between the HindIII and BglII sites) with two cop-
ies of a nuclear receptor responsive element upstream of the firefly
(Photinus pyralis) luciferase gene. The VDRE, designated XDR3, was
the distal element from the human cytochrome P450 (CYP) 3A4
gene.39 The entire sequence inserted into pLuc-MCS reporter vector
was CAGAGGGTCAGCAAGTTCATTCACAGAGGGTCAGCAAGTTCAT
TCA, with the half elements underlined. The VDRE, designated
CYP24 contained 5.5 kb of the promoter region40 of the human
CYP24 gene (kindly provided by Drs. S. Christakos and J. W. Pike,
New Jersey Medical School and University of Wisconsin, respec-
tively) cloned into a firefly luciferase plasmid. The human CYP24
gene possesses two antisense DR3 VDREs (AGGTGAN3AGGGCG

698
S. Batie et al. / Bioorg. Med. Chem. 21 (2013) 693–702
Figure 3. Examination of receptor specificity by curcumin and analogs in transfected human colon cancer cells (HCT-116): Experiments were performed using 2.4 ꢁ 10ꢀ5
M
curcumin (CM) and analogs in complete media with 24 h of treatment, as well as DMSO vehicle. The data were normalized for transfection efficiency and expressed as a
percent of ligand-mediated transactivation. Error bars indicate standard deviation. (A) Dexamethasone (10ꢀ7 M) along with CM and analogs were tested using a GRE-based
luciferase system. Utilizing a Students’ unpaired, homoscedastic t-test, DEX only is significantly different than DMSO (p <0.001). (B) Bexarotene (10ꢀ8 M) along with CM and
analogs tested in an RXRE assay. As analyzed by a Students’ unpaired, homoscedastic t-test, Bex, CM, 11–15 are significantly more able to stimulate transcription than DMSO
(p <0.05). (C) All-trans retinoic acid (10ꢀ6 M) along with CM and analogs tested in the RARE system. ATRA, CM, 9, and 11–15 are significantly more able to activate
transcription than DMSO (p <0.05), as determined by a Students’ unpaired, homoscedastic t-test.
and AGTTCAN3GGTGTG) at ꢀ170 and ꢀ291 bp, respectively, rela-
tive to the transcription start site. A glucocorticoid responsive ele-
ment (GRE) derived from the rat tyrosine aminotransferase gene
was employed, and the sequence cloned into pLuc-MCS was
AGCTAGAACATCCTGTACAGCAGAGCTAGAACATCCTGTACAGCAG.41
The reporter construct containing a retinoid X receptor responsive
element (RXRE) was based on a naturally occurring double-repeat
responsive element from the rat cellular retinol binding protein II
gene.42 The sequence used was AAAATGAACTGTGACCTGTGA
CCTGTGACCTGTGAC. A retinoic acid responsive element (RARE) is
an optimized element that has been described previously43 and
is responsive to the RAR ligand, all-trans retinoic acid. The
sequence of the double RARE is (50-AAAGGTCACCGAAAGGTCAC-
CATCCCGGGAAAAGGTCACCGAAAGGTCACC-30), with the half
elements underlined. Following transfection, the cells were treated
with dimethyl sulfoxide (DMSO) vehicle, 1,25-dihydroxyvitamin
D3, resveratrol, CM, or CM analogs as described in the figure
legends, 18 h after completion of transfection; treatment times
ranged from 22 to 26 h. After incubation with ligands, cells were
collected and the amount of reporter gene product (luciferase) pro-
duced in the cells was measured using the Dual-Luciferase Repor-
ter Assay System according to the manufacturer’s protocol
(Promega, Madison, WI, USA). To control for transfection efficiency,
general cell death and ligand-induced cellular toxicity, the amount
of luminescence produced by inducible firefly luciferase was
divided by luminescence created by constitutively expressed
Renilla luciferase; this ratio was then multiplied by 10,000 to
simplify data presentation. The mean ratio of firefly luciferase to

S. Batie et al. / Bioorg. Med. Chem. 21 (2013) 693–702
699
Figure 4. Ability of CM and analogs to stimulate RXR–RXR homodimerization using the M2H system in human colon cancer cells (HCT-116): Experiments performed using
10ꢀ8 M Bexarotene and 3.75 ꢁ 10ꢀ5 M curcumin (CM) and analogs in complete media with 24 h of treatment, as well as DMSO vehicle. Cells were transfected with the
expression vectors RXRa-AD (prey) and RXRa-BD (bait) along with a firefly luciferase reporter vector (pFR-luc) and Renilla luciferase control plasmid to measure the amount
of ligand-stimulated RXR–RXR interaction and to assess transfection efficiency, respectively. Error bars indicate standard deviation; the data shown are representative of
three independent experiments with triplicate samples in each experiment. Bex, CM, 9, and 11–15 are significantly more able to stimulate RXR homodimerization than DMSO
(p <0.05), as analyzed by a Students’ unpaired, homoscedastic t-test.
Figure 5. Evaluation of transcriptional synergism between curcumin, CM analogs and resveratrol employing a VDRE-luciferase reporter system in human colon cancer cells
(HCT-116): Experiments were performed using either DMSO vehicle, 10ꢀ10 M 1,25-dihydroxyvitamin D, 3.75 ꢁ 10ꢀ5 M curcumin (CM) and analogs, or 2.8 ꢁ 10ꢀ5
M
resveratrol (Res) in complete media with 24 h of treatment. Cells were transfected with a firefly luciferase plasmid containing two copies of the vitamin D responsive element,
XDR3. Error bars indicate standard deviation; the data shown are representative of three independent experiments with triplicate samples in each experiment. Utilizing a
Students’ unpaired, homoscedastic t-test, all treatments are significantly more able to stimulate VDRE-mediated transcription (p <0.01) than DMSO alone.
Renilla luciferase signal was determined for each experimental
group, and the standard deviation was calculated using MS Excel
(expressed as error bars). All data are reported as either the
average of two or more experiments, or are representative of two
or more trials. Each experimental treatment group was replicated
in at least three, and often as many as six, wells.
manufacturer’s protocol and results were analyzed as described
above.
3.3. Saccharomyces mutagenicity assay
Yeast D7 strain was grown as described in Marshall44 and one
nonrevertant strain was selected. This strain was used for the
remainder of the assays. Cells were incubated for two hours with
compounds solubilized in DMSO or DMSO alone (control), at
increasing concentrations from 0.008 mg/ml to 0.1 mg/ml and then
plated on YPD or selective media lacking tryptophan or isoleucine.
Growth was scored after 5 days at 30 °C, and compared to DMSO
only control. Mutagenicity would be scored as the formation of col-
onies in numerical excess as compared to DMSO only control. Ethi-
dium bromide was used as a positive control.
3.2. Mammalian two-hybrid (M2H) transfections
HCT-116 cells were transfected with components of the mam-
malian two-hybrid system from Agilent Technologies (Santa Clara,
CA), employing similar procedures to those outlined above. RXR
a
was cloned into pCMV-BD (bait) and VDR into pCMV-AD (prey).
SRC-1 was cloned into the pM vector from Clontech (Mountain
View, CA, USA), which is similar to the pCMV-BD construct and is
compatible with pCMV-AD. DRIP205 was cloned into pCMV-BD.
RXRa
was likewise cloned into pCMV-AD in order to test RXR-
3.4. Statistical analysis
RXR interactions. Each well received 50 ng of bait, 50 ng of prey
vectors and 20 ng of pRL-null; 250 ng of pFR-luc, a firefly luciferase
reporter construct, was also introduced into the cells. The cells
were assayed for luciferase activity according to the
A Students’ unpaired T-test, with two tails, homoscedastic var-
iance was used to compare all data to controls and are as indicated
in the figure legends.

700
S. Batie et al. / Bioorg. Med. Chem. 21 (2013) 693–702
3.5. Instrumentation
for
C21H19O6F2 405.1150, found 405.1143. Anal. Calcd for
C
9.3.
21H18O6F2: C, 62.38; H, 4.49; F, 9.40. Found: C, 62.05; H, 4.87; F,
A 400 MHz Bruker spectrometer was used to acquire 1H NMR
and 13C NMR spectra. Chemical shifts (d) are listed in ppm against
residual non-deuterated solvent peaks in a given deuterated sol-
vent (e.g. CHCl3 in CDCl3) as an internal reference. Coupling con-
stants (J) are reported in Hz, and the abbreviations for splitting
include: s, single; d, doublet; t, triplet; q, quartet; p, pentet; m,
multiplet; br, broad. All 13C NMR spectra were acquired on a Bruker
instrument at 100.6 MHz. Chemical shifts (d) are listed in ppm
against deuterated solvent carbon peaks as an internal reference.
High resolution mass spectra were recorded using either a JEOL
GCmate (2004), a JEOL LCmate (2002) high resolution mass spec-
trometer or an ABI Mariner (1999) ESI-TOF mass spectrometer.
Melting points were assayed on a Thomas Hoover capillary melting
point apparatus.
3.7.2. (1E,4Z,6E)-1,7-Bis(2-fluoro-4-hydroxyphenyl)-5-
hydroxyhepta-1,4,6-trien-3-one (7)
Bright yellow crystalline product (0.44 g, 12.6%): mp 213–
216 °C; 1H NMR (400 MHz, DMSO-d6) d 10.58 (br s, 2H), 7.68 (t,
J = 8.8 Hz, 2H), 7.60 (d, J = 16 Hz, 2H), 6.77 (d, J = 16 Hz, 2H), 6.70
(dd, J = 8.4, 2.4 Hz, 2H), 6.65 (dd, J = 12.8, 2.4 Hz, 2H), 6.09 (s,
1H), 3.16 (s, 2H); 13C NMR (100.6 MHz, DMSO-d6) d 183.0, 163.2,
161.4, 161.3, 160.7, 132.4, 132.4, 130.3, 130.2, 122.9, 122.8,
113.4, 113.3, 112.7, 103.1, 102.8, 101.6, 48.6; LC-APCI-MS [M++H]
calcd for C19H15O4F2 345.0938, found 345.0925. Anal. Calcd for
C19H14O4F2: C, 66.28; H, 4.10; F, 11.04. Found: C, 65.35; H, 4.33;
F, 10.6.
3.6. General procedures
3.7.3. (1E,4Z,6E)-1,7-Bis(3-chloro-4-hydroxy-5-
methoxyphenyl)-5-hydroxyhepta-1,4,6-trien-3-one (9)
Bright yellow powder (0.43 g, 9.8%): mp 227–230 °C; 1H NMR
(400 MHz, DMSO-d6) d 16.29 (br s, 1H), 10.06 (br s, 2H), 7.53 (d,
J = 16 Hz, 2H), 7.39 (d, J = 1.6 Hz, 2H), 7.34 (d, J = 1.6 Hz, 2H), 6.88
(d, J = 15.6 Hz, 2H), 6.05 (s, 1H), 3.89 (s, 6H); 13C NMR
(100.6 MHz, DMSO-d6) d 183.1, 148.8, 144.9, 139.6, 126.5, 122.7,
120.2, 109.9, 101.5, 56.3; LC-APCI-MS [M++H] calcd for
Tetrahydrofuran, methylene chloride, diethyl ether, and ben-
zene were dried by filtration through alumina according to the
procedure described by Grubbs.45 Removal of volatile solvents
transpired under reduced pressure using a Büchi rotary evapora-
tor and is referred to as removing solvents in vacuo. Thin layer
chromatography was conducted on precoated (0.25 mm thick-
ness) silica gel plates with 60F-254 indicator (Merck). Column
chromatography was conducted using 230–400 mesh silica gel
(E. Merck reagent silica gel 60). 3-Fluoro-4-hydroxy-5-
methoxybenzaldehyde was purchased from Apollo Scientific. 2-
Fluoro-4-hydroxybenzaldehyde was purchased from Oakwood
Products, Inc. 5-Iodovanillin, 2,4-pentanedione, n-butylamine,
hydroxybenzaldehyde, and tributylborate were purchased from
ACROS. 5-Bromovanillin was purchased from Indofine Chemicals.
Boron oxide, 3-chloro-4-hydroxy-5-methoxybenzaldehyde, 3-
chloro-4-hydroxybenzaldehyde, and 3-bromo-4-methoxybenzal-
dehyde were purchased from Aldrich. Trifluoromethylvanillin
was purchased from JRD Fluorochem. All tested compounds were
analyzed for purity by combustion analysis through Columbia
Analytical Services (formerly Desert Analytics in Tucson, AZ).
C
C
21H19O6Cl2 437.0559, found 437.0563. Anal. Calcd for
21H18O6Cl2: C, 57.68; H, 4.15; Cl, 16.22. Found: C, 57.48; H,
4.24; Cl, 16.30.
3.7.4. (1E,4Z,6E)-1,7-Bis(3-chloro-4-hydroxyphenyl)-5-
hydroxyhepta-1,4,6-trien-3-one (11)
Bright yellow powder (0.70 g, 18.8%): mp 199–205 °C; 1H NMR
(400 MHz, DMSO-d6) d 16.29 (br s, 1H), 10.82 (br s, 2H), 7.79 (s,
2H), 7.53 (d, J = 9.2 Hz, 2H), 7.51 (d, J = 15.6 Hz, 2H), 7.00 (d,
J = 8.4 Hz, 2H), 6.81 (d, J = 16.0 Hz, 2H), 6.02 (s, 1H); 13C NMR
(100.6 MHz, DMSO-d6) d 183.1, 155.1, 139.1, 129.9, 128.8, 127.1,
122.3, 120.5, 116.9, 101.6; LC-APCI-MS [M++H] calcd for
C
C
19H15O4Cl2 377.0347, found 377.0349. Anal. Calcd for
19H14O4Cl2: C, 60.50; H, 3.74; Cl, 18.80. Found: C, 60.21; H,
3.99; Cl, 19.3.
3.7. General procedure to synthesize 5, 7, 9, and 11–15
3.7.5. (1E,4Z,6E)-1,7-Bis(3-bromo-4-hydroxy-5-
3.7.1. (1E,4Z,6E)-1,7-Bis(3-fluoro-4-hydroxy-5-methoxyphenyl)-
5-hydroxyhepta-1,4,6-trien-3-one (5)
methoxyphenyl)-5-hydroxyhepta-1,4,6-trien-3-one (12)24
Bright orange crystalline solid (0.65 g, 12.3%): mp 224–232 °C
(lit. 236–238 °C);24 1H NMR (400 MHz, DMSO-d6) d 16.30 (br s,
1H), 10.10 (s, 1H), 7.53 (d, J = 16.0 Hz, 2H), 7.52 (d, J = 2.0 Hz,
2H), 7.38 (d, J = 2.0 Hz, 2H), 6.88 (d, J = 16.0 Hz, 2H), 6.05 (s, 1H),
3.89 (s, 6H); 13C NMR (100.6 MHz, DMSO-d6) d 183.1, 148.5,
146.0, 139.4, 127.2, 125.6, 122.6, 110.4, 109.6, 101.4, 56.3; LC-
APCI-MS [M++H] calcd for C21H19O6Br2 526.9528, found
526.9539. Anal. Calcd for C21H18O6Br2: C, 47.94; H, 3.45; Br,
30.37. Found: C, 47.85; H, 3.40; Br, 29.4.
The method of Muzumder and co-workers was followed.29 To a
solution of 3-fluoro-4-hydroxy-5-methoxybenzaldehyde (3.40 g,
20.0 mmol), 1,4-pentanedione (1.03 mL, 10.0 mmol), boron oxide
(0.50 g, 7.2 mmol), and tributylborate (5.4 mL, 20.0 mmol) in ethyl
acetate (10.0 mL) was added dropwise a solution of butyl amine
(1.10 g, 15.0 mmol) in ethyl acetate (10.0 mL). The reaction was
stirred at 40 °C for 24 h and then quenched by the addition of
10% HCl (10.0 mL) and stirring at 60 °C (1 h). The solution was
poured into water (20 mL), and the organic layer was separated.
The aqueous layer was extracted with ethyl acetate and the com-
bined organic layers were washed with water, separated, and dried
over sodium sulfate. The solvents were removed in vacuo to give a
crude, dark powder that was purified by column chromatography
(silica gel, hexanes/ethyl acetate 1:1) to give a deep red crystalline
product (0.42 g, 10%): mp 221–222 °C; 1H NMR (400 MHz, DMSO-
d6) d 9.89 (br s, 2H), 7.53 (d, J = 15.6 Hz, 2H), 7.25 (d, J = 11.2 Hz,
2H), 7.21 (s, 2H), 6.86 (d, J = 15.6 Hz, 2H), 6.03 (s, 1H), 3.87 (s,
6H), 3.16 (s, 1H); 13C NMR (100.6 MHz, DMSO-d6) d 183.1, 152.5,
150.1, 149.7, 149.6, 139.9, 136.9, 136.7, 125.4, 124.3, 122.7,
109.2, 109.0, 108.0, 101.5, 56.3, 48.6; LC-APCI-MS [M++H] calcd
3.7.6. (1E,4Z,6E)-1,7-Bis(3-bromo-4-hydroxyphenyl)-5-
hydroxyhepta-1,4,6-trien-3-one (13)25a
Bright orange crystalline solid (0.87 g, 18.5%): mp 218–222 °C
(lit. 175–176 °C);25a 1H NMR (400 MHz, DMSO-d6) d 16.29 (s, 1H),
10.89 (s, 2H), 7.93 (d, J = 2.0 Hz, 2H), 7.56 (dd, J = 8.4, 2.0, 2H),
7.51 (d, J = 16.0 Hz, 2H), 6.99 (d, J = 8.4 Hz, 2H), 6.80 (d,
J = 16.0 Hz, 2H), 6.02 (s, 1H); 13C NMR (100.6 MHz, DMSO-d6) d
183.1, 156.1, 139.0, 132.9, 129.3, 127.6, 122.2, 116.5, 110.0,
101.6; LC-APCI-MS [M++H] calcd for C19H15O4Br2 464.9337, found
464.9345. Anal. Calcd for C19H14O4Br2: C, 48.96; H, 3.03; Br,
34.28. Found: C, 48.93; H, 2.85; Br, 35.5.

S. Batie et al. / Bioorg. Med. Chem. 21 (2013) 693–702
701
3.7.7. (1E,4Z,6E)-5-Hydroxy-1,7-bis(4-hydroxy-3-iodo-5-
Acknowledgements
methoxyphenyl)hepta-1,4,6-trien-3-one (14)26
Golden brown powder (0.96 g, 7.7%): mp 230–233 °C; 1H NMR
(400 MHz, DMSO-d6) d 16.32 (br s, 1H), 10.19 (s, 2H), 7.70 (s,
2H), 7.55 (d, J = 15.6 Hz, 2H), 7.42 (s, 2H), 6.89 (d, J = 16 Hz, 2H),
6.10 (s, 1H), 3.92 (s, 6H); 13C NMR (100.6 MHz, DMSO-d6) d
183.1, 148.5, 147.1, 139.3, 131.4, 128.2, 122.4, 111.0, 101.3, 84.8,
56.2; LC-APCI-MS [M++H] calcd for C21H19O6I2 620.9272, found
620.9300. Anal. Calcd for C21H18O6I2: C, 40.60; H, 3.08. Found: C,
40.93; H, 2.84.
We thank Dr. Natalya Zolotova of the High-Resolution Mass
Spectrometry Lab at ASU Tempe. Shane Batie and Jamie Lee wish
to thank ASU Tempe for School of Life Sciences Undergraduate Re-
search (SOLUR) fellowships. Drew Browder was also supported by
the SOLUR Program. The human CYP24 gene for the VDRE was
kindly provided by Drs. S. Christakos and J. W. Pike, New Jersey
Medical School and University of Wisconsin, respectively.
Supplementary data
3.7.8. (1E,4Z,6E)-5-Hydroxy-1,7-bis(4-hydroxy-3-
(trifluoromethoxy)phenyl)hepta-1,4,6-trien-3-one (15)27
Golden brown powder (0.25 g, 11%): mp 144–153 °C (lit. 173–
174 °C);27 1H NMR (400 MHz, DMSO-d6) d 10.88 (2.14), 7.70–7.60
(m, 4H), 7.57 (d, J = 16 Hz, 2H), 7.06 (d, J = 8.0 Hz, 2H), 6.82 (d,
J = 16 Hz, 2H); 13C NMR (100.6 MHz, DMSO-d6) d 183.1, 152.0,
139.1, 136.3, 129.0, 126.6, 123.2, 122.6, 121.6, 119.1, 118.0,
101.5; LC-APCI-MS [M++H] calcd for C21H15O6F6 477.0773, found
477.0776. Anal. Calcd for C21H14O6F6: C, 52.95; H, 2.96; F, 23.93.
Found: C, 51.22; H, 3.25; F, 22.90.
Supplementary data (1H NMR and 13C NMR spectra of all com-
pounds reported in the experimentals) associated with this article
can be found, in the online version, at http://dx.doi.org/10.1016/
j.bmc.2012.11.033.
References and notes
1. Anand, R.; Thomas, S. G.; Kunnumakkara, A. B.; Sundaram, C.; Harikumar, K. B.;
Sung, B.; Tharakan, S. T.; Misra, K.; Priyadarsini, I. K.; Rajasekharan, K. N.;
Aggarwal, B. B. Biochem. Pharm. 2008, 76, 1590.
2. Ruby, A. J.; Kuttan, G.; Dinesh Babu, K. V.; Rajasekharan, K. N.; Kuttan, R. Cancer
Lett. 1995, 94, 79.
3. Adams, B. K.; Ferstl, E. M.; Davis, M. C.; Herold, M.; Kurtkaya, S.; Camalier, R. F.;
Hollingshead, M. G.; Kaur, G.; Sausville, E. A.; Rickles, F. R.; Snyder, J. P.; Liotta,
D. C.; Shoji, M. Bioorg. Med. Chem. 2004, 12, 3871.
3.8. General procedure to synthesize 6, 8, and 10
3.8.1. (Z)-1,7-Bis(3-fluoro-4-hydroxy-5-methoxyphenyl)-5-
hydroxyhept-4-en-3-one (6)
4. Zambre, A. P.; Kulkarni, V. M.; Padhye, S.; Sandur, S. K.; Aggarwal, B. B. Bioorg.
Med. Chem. 2006, 14, 7196.
A 0.25 M solution of 5 (0.1403 g, 0.34 mmol) in a 1:1 ethyl ace-
tate/ethanol solution (1.4 mL) was passed through a 10% Pd/C car-
tridge in the ThalesNano H-cubeÒ at 70 °C and 14 bar. The resulting
solution was concentrated in vacuo to give crude 6 that was puri-
fied by column chromatography (silica gel, hexanes/ethyl acetate
1:1) to give a colorless crystalline product (0.068 g, 49%): mp
136–139 °C; 1H NMR (400 MHz, CDCl3) d 15.40 (br s, 1H), 6.55
(dd, J = 10.8, 2.0 Hz, 2H), 6.48 (d, J = 1.6 Hz, 2H), 5.41 (s, 1H), 5.31
(br s, 2H), 3.87 (s, 6H), 2.80 (t, J = 8.0 Hz, 4H), 2.53 (t, J = 8.0 Hz,
4H); 13C NMR (100.6 MHz, CDCl3) d 202.9, 192.7, 151.5, 149.1,
148.0, 147.9, 132.0, 131.9, 131.8, 108.7, 108.5, 106.7, 106.7,
106.6, 106.6, 99.8, 57.5, 56.3, 45.1, 39.9, 31.1, 31.0, 28.9; LC-
APCI-MS [M+] calcd for C21H22O6F2 408.1385, found 408.1405.
Anal. Calcd for C21H22O6F2: C, 61.76; H, 5.43. Found: C, 61.84; H,
5.41.
5. Vajragupta, O.; Boonchoong, P.; Morris, G. M.; Olson, A. J. Bioorg. Med. Chem.
Lett. 2005, 15, 3364.
6. Zhang, Q.; Zhong, Y.; Yan, L.-N.; Sun, X.; Gong, T.; Zhang, Z.-R. Bioorg. Med.
Chem. Lett. 2011, 21, 1010.
7. Surh, Y. J. Rev. Cancer 2003, 3, 768.
8. Singh, S.; Aggarwal, B. B. Biol. Chem. 1995, 270, 24995.
9. Aggarwal, S.; Ichikawa, H.; Takada, Y.; Sandur, S. K.; Shishodia, S.; Aggarwal, B.
B. Pharmacology 2006, 69, 195.
10. (a) Dorai, T.; Aggarwal, B. B. Cancer Lett. 2004, 215, 129; (b) Mukhopadhyay, A.;
Banerjee, S.; Stafford, L. J.; Xia, C.; Liu, M.; Aggarwal, B. B. Oncogene 2002, 21,
8852.
11. Shikora, E.; Bielak-Zmijewska, A.; Magalska, A.; Piwocka, K.; Mosieniak, G.;
Kalinowska, M.; Widlak, P.; Cymerman, I. A.; Bujnicki, J. M. Cancer Ther. 2006, 5,
927.
12. Jung, E. M.; Lim, J. H.; Lee, T. J.; Park, J.-W.; Choi, K. S.; Kwon, T. K. Carcinogenesis
1905, 2005, 26.
13. Choudhuri, T.; Pal, S.; Agwarwal, M. L.; Das, T.; Sa, G. FEBS Lett. 2002, 512, 334.
14. (a) Woo, J.-H.; Kim, Y.-H.; Lee, K.-S.; Bae, J. H.; Min, D. S.; Chang, J.-S.; Jeong, Y.-
J.; Lee, Y. H.; Park, J.-W.; Kwon, T. K. Carcinogenesis 2003, 24, 1199; (b) Siwak, D.
R.; Shishodia, S.; Aggarwal, B. B.; Kurzrock, R. Cancer 2005, 104, 879.
15. Ravindran, J.; Prasad, S.; Aggarwal, B. B. AAPS J. 2009, 11, 495.
16. Bartik, L.; Whitfield, G. K.; Kaczmarska, M.; Lowmiller, C. L.; Moffet, E. W.;
Furmick, J. K.; Hernandez, Z.; Haussler, C. A.; Haussler, M. R.; Jurutka, P. W. J.
Nutr. Biochem. 2010, 21, 1153.
17. Dawson, M. I.; Jong, L.; Hobbs, P. D.; Cameron, J. F.; Chao, W.; Pfahl, M.; Lee, M.-
O.; Shroot, B.; Pfahl, M. J. Med. Chem. 1995, 38, 3368.
18. Wu-Wong, J. R.; Nakane, M.; Ma, J.; Dixon, D.; Gagne, G. Leuk. Lymphoma 2006,
47, 727.
3.8.2. (Z)-1,7-Bis(2-fluoro-4-hydroxyphenyl)-5-hydroxyhept-4-
en-3-one (8)
Off white, crystalline solid (0.1295 g, 76%): mp 89–91 °C; 1H
NMR (400 MHz, CDCl3) d 15.29 (br s, 1H), 6.94–6.98 (m, 2H),
6.50–6.54 (m, 2H), 6.51 (s, 2H), 5.42 (br s, 2H), 5.41 (s, 1H), 2.85
(t, J = 8.0 Hz, 4H), 2.53 (t, J = 8.0 Hz, 4H); 13C NMR (100.6 MHz,
CDCl3) d 193.3, 162.6, 160.1, 155.3, 155.2, 131.0, 130.9, 119.2,
119.1, 111.1, 111.0, 103.3, 103.0, 99.8, 38.6, 24.5; LC-APCI-MS
[M+] calcd for C19H19O4F2 349.1251, found 349.1247. Anal. Calcd
for C19H19O4F2: C, 65.51; H, 5.21; F, 10.91. Found: C, 65.20; H,
5.25; F, 10.9.
19. Baxter, J. D.; Goede, P.; Apriletti, J. W.; West, B. L.; Feng, W.; Mellstrom, K.;
Fletterick, R. J.; Wagner, R. L.; Kushner, P. J.; Ribeiro, R. C. J.; Webb, P.; Scanlan,
T. S.; Nilsson, S. Endocrinology 2002, 143, 517.
20. Haussler, M. R.; Whitfield, G. K.; Haussler, C. A.; Hsieh, J.-C.; Jurutka, P. W. Nuclear
Vitamin
D Receptor: Natural Ligands, Molecular Structure–Function, and
Transcriptional Control of Vital Genes. In Vitamin D; Feldman, D., Pike, J. W.,
Adams, J. S., Eds., 3rd ed.; Academic Press: Amsterdam, 2011; pp 137–170. Vol. 1.
21. Haussler, M. R.; Haussler, C. A.; Whitfield, G. K.; Hsieh, J.-C.; Thompson, P. D.;
Barthel, T. K.; Bartik, L.; Egan, J. B.; Wu, Y.; Kubicek, J. L.; Lowmiller, C. L.;
Moffet, E. W.; Forster, R. E.; Jurutka, P. W. J. Steroid Biochem. Mol. Biol. 2010, 121,
88.
22. (a) Sharma, R. A.; Euden, S. A.; Platton, S. L.; Cooke, D. N.; Shafayat, A.; Hewitt,
H. R.; Marczylo, T. H.; Morgan, B.; Hemingway, D.; Plummer, S. M.; Pirohamed,
M.; Gescher, A. J.; Steward, W. P. Clin. Cancer Res. 2004, 10, 6847; (b) Lao, C. D.;
Ruffin, M. T., IV; Normolle, D.; Heath, D. D.; Murray, S. I.; Bailey, J. M.; Boggs, M.
E.; Crowell, J.; Rock, C. L.; Brenner, D. E. BMC Complement. Altern. Med. 2006, 6,
6; (c) Dhillon, N.; Aggarwal, B. B.; Newman, R. A.; Wolff, R. A.; Kunnumakkara,
A. B.; Abbruzzese, J. L.; Ng, C. S.; Badmaev, V.; Kurzrock, R. Clin. Cancer Res.
2008, 14, 4491.
3.8.3. (Z)-5-Hydroxy-1,7-bis(4-hydroxy-3-methoxyphenyl)hept-
4-en-3-one (10)
White, crystalline solid (0.0929 g, 61%): mp 95–97 °C; 1H NMR
(400 MHz, CDCl3) d 6.83–6.80 (m, 2H), 6.68 (s, 2H), 6.67–6.65 (m,
2H), 5.53 (br s, 2H), 5.42 (s, 1H), 3.85 (s, 6H), 2.86–2.76 (m, 4H),
2.57–2.53 (t, J = 7.2, 4H); 13C NMR (100.6 MHz, CDCl3) d 203.4,
193.2, 146.3, 143.9, 132.5, 120.7, 114.2, 110.9, 110.8, 99.8, 57.6,
55.8, 45.4, 40.3, 31.2, 29.0. GC-MS [M+] calcd for C21H24O6
372.1573, found 372.1574. Anal. Calcd for C21H24O6: C, 67.73; H,
6.50. Found: C, 68.32; H, 6.41.
23. (a) Cashman, J.R.; Fiala, M. PCT Int. Appl. WO 2008048410 A2 20080424, 2008.;
(b) Takahasi, T.; Hijikuro, I.; Sugimoto, H.; Kihara, T.; Shimmyo, Y.; Niidome, T.

702
S. Batie et al. / Bioorg. Med. Chem. 21 (2013) 693–702
PCT Int. Appl. WO 2008066151 A1 20080605, 2008.; (c) Cashman, J.R.; Abel, K.J.
PCT Int. Appl. WO2010068935 A2 20100617, 2010.
24. Venkateswarlu, S.; Ramachandra, M. S.; Subbaraju, G. V. Bioorg. Med. Chem.
2005, 13, 6374.
32. Dampf-Stone, A. et al Proc. Ariz.-Nev. Acad. Sci. 2012, 47(1), 17.
33. Ireson, C. R.; Jones, D. J.; Orr, S.; Coughtrie, M. W.; Boocock, D. J.; Williams, M.
L.; Farmer, P. B.; Steward, W. P.; Gescher, A. J. Cancer Epidemiol. Biomarkers Prev.
2002, 11, 105.
25. (a) Costi, R.; Di Santo, R.; Artico, M.; Miele, G.; Valentini, P.; Novellino, E.;
Cereseto, A. J. Med. Chem. 2007, 50, 1973; (b) Mai, A.; Cheng, D.; Bedford, M. T.;
Valente, S.; Nebbioso, A.; Perrone, A.; Brosch, G.; Sbardella, G.; De Bellis, F.;
Miceli, M.; Altucci, L. J. Med. Chem. 2008, 51, 2279.
26. Jankun, J.; Aleem, A. M.; Malgorzewicz, S.; Szkudlarek, M.; Zavodszky, M. I.;
DeWitt, D. L.; Feig, M.; Selman, S. H.; Skrzypczak-Jankun, E. Mol. Cancer Ther.
2006, 5, 1371.
27. Yanagisawa, D.; Shirai, N.; Amatsubo, T.; Taguchi, H.; Hirao, K.; Urushitani, M.;
Morikawa, S.; Inubushi, T.; Kato, M.; Kato, F.; Morino, K.; Kimura, H.; Nakano, I.;
Yoshida, C.; Okada, T.; Sano, M.; Wada, K.-N.; Yamamoto, A.; Tooyama, I.
Biomaterials 2010, 31, 4179.
28. (a) Wagner, C. E.; Jurutka, P. W.; Marshall, P. A.; Groy, T. L.; van der Vaart, A.;
Ziller, J. W.; Furmick, J. K.; Graeber, M. E.; Matro, E.; Miguel, B. V.; Tran, I. T.;
Kwon, J.; Tedeschi, J. N.; Moosavi, S.; Danishyar, A.; Philp, J. S.; Khamees, R. O.;
Jackson, J. N.; Grupe, D. K.; Badshah, S. L.; Hart, J. W. J. Med. Chem. 2009, 52,
5950; (b) Furmick, J. K.; Kaneko, I.; Walsh, A. N.; Yang, J.; Bhogal, J. S.; Gray, G.
M.; Baso, J. C.; Browder, D. O.; Prentice, J. L. S.; Montano, L. A.; Huynh, C. C.;
Marcus, L. M.; Tsosie, D. G.; Kwon, J. S.; Quezada, A.; Reyes, N. M.; Lemming, B.;
Saini, P.; van der Vaart, A.; Groy, T. L.; Marshall, P. A.; Jurutka, P. W.; Wagner, C.
E. ChemMedChem 2012, 7, 1551.
34. Irving, G. R. B.; Karmokar, A.; Berry, D. P.; Brown, K.; Steward, W. P. Best Pract.
Res. Clin. Gastroenterol. 2001, 25, 519.
35. Cramer, P. E.; Cirrito, J. R.; Wesson, D. W.; Lee, C. Y. D.; Karlo, J. C.; Zinn, A. E.;
Casali, B. T.; Restivo, J. L.; Goebel, D. A.; James, M. J.; Brunden, K. R.; Wilson, D.
A.; Landreth, G. E. Science 2012, 335, 1503.
36. (a) Hamaguchi, T.; Ono, K.; Yamada, M. CNS Neurosci. Ther. 2010, 16, 285; (b)
Yang, F.; Lim, G. P.; Begum, A. N.; Ubeda, O. J.; Simmons, M. R.; Ambegaokar, S.
S.; Chen, P. P.; Kayed, R.; Glabe, C. G.; Frautschy, S. A.; Cole, G. M. J. Biol. Chem.
2005, 280, 5892.
37. (a) Murthy, S.; Born, E.; Mathur, S. N.; Field, F. J. J. Lipid Res. 2002, 43, 1054; (b)
Field, F. J.; Born, E.; Mathur, S. N. J. Lipid Res. 2004, 45, 905.
38. Sherman, S. I.; Gopal, J.; Haugen, B. R.; Chiu, A. C.; Whaley, K.; Nowlakha, P.;
Duvic, M. N. Engl. J. Med. 1999, 340, 1075.
39. Thompson, P. D.; Jurutka, P. W.; Whitfield, G. K.; Myskowski, S. M.; Eichhorst, K.
R.; Dominguez, C. E.; Haussler, C. A.; Haussler, M. R. Biochem. Biophys. Res.
Commun. 2002, 299, 730.
40. Jin, C. H.; Kerner, S. A.; Hong, M. H.; Pike, J. W. Mol. Endocrinol. 1996, 10, 945.
41. Jantzen, H. M.; Strahle, U.; Gloss, B.; Stewart, F.; Schmid, W.; Boshart, M.;
Miksicek, R.; Schutz, G. Cell 1987, 49, 29.
42. Mangelsdorf, D. J.; Umesono, K.; Kliewer, S. A.; Borgmeyer, U.; Ong, E. S.; Evans,
R. M. Cell 1991, 66, 555.
43. Forman, B. M.; Umesono, K.; Chen, J.; Evens, R. M. Cell 1995, 81, 541.
44. Marshall, P. A. CBE-LSE 2007, 6, 307.
29. Muzumder, A.; Neamati, N.; Sunder, S.; Schulz, J.; Pertz, H.; Eich, E.; Pommier,
Y. J. Med. Chem. 1997, 40, 3057.
30. The ThalesNano H-CubeÒ was used for this hydrogenation reaction.
31. Menegaz, D.; Mizwicki, M. T.; Barrientos-Duran, A.; Chen, N.; Henry, H. L.;
Norman, A. W. Mol. Endocrinol. 2011, 25, 1289.
45. Pangborn, A. B.; Giardello, M. A.; Grubbs, R. H.; Rosen, R. K.; Timmers, F. J.
Organometallics 1996, 15, 1518.