N-(Guanidinoethyl)-2′-deoxy-5-methylisocytidine exhibits selective recognition of a CG interrupting site for the formation of anti-parallel triplexes

Article abstract of DOI:10.1039/c3ob40472b

The development of novel nucleoside analogues for the formation of triplex DNA containing pyrimidine-purine inversion sites has been a challenging field. In this paper, we describe the design and synthesis of non-natural nucleoside analogues, N-substituted-2′-deoxy-5-methylisocytidine derivatives, and their evaluation for triplex formation. It has been shown that N-(guanidinoethyl)-2′-deoxy-5-methylisocytidine exhibits selective recognition of a CG interrupting site and potentiates the formation of anti-parallel triplexes. This journal is The Royal Society of Chemistry 2013.

Full text of DOI:10.1039/c3ob40472b

Organic &
Biomolecular Chemistry
View Article Online
View Journal | View Issue
PAPER
N-(Guanidinoethyl)-2’-deoxy-5-methylisocytidine
exhibits selective recognition of a CG interrupting site
Cite this: Org. Biomol. Chem., 2013, 11,
3918
for the formation of anti-parallel triplexes†
Hidenori Okamura, Yosuke Taniguchi* and Shigeki Sasaki*
The development of novel nucleoside analogues for the formation of triplex DNA containing pyrimi-
dine–purine inversion sites has been a challenging field. In this paper, we describe the design and
synthesis of non-natural nucleoside analogues, N-substituted-2’-deoxy-5-methylisocytidine derivatives,
and their evaluation for triplex formation. It has been shown that N-(guanidinoethyl)-2’-deoxy-5-methyl-
isocytidine exhibits selective recognition of a CG interrupting site and potentiates the formation of anti-
parallel triplexes.
Received 7th March 2013,
Accepted 16th April 2013
DOI: 10.1039/c3ob40472b
www.rsc.org/obc
Introduction
Sequence specific recognition of duplex DNA by forming
triplex DNA with oligonucleotides (TFOs) is a powerful tool for
gene targeting agents and gene diagnosis.1 There are two types
of triplexes: one is a parallel triplex formed with homopyrimi-
dine TFO and the other is an anti-parallel triplex formed with
homopurine TFO. The TFO forms Hoogsteen base pairs in the
parallel triplex or reverse Hoogsteen base pairs in the anti-
parallel triplex.2 In both cases, a pyrimidine insertion in the
homopurine strand of the duplex DNA prevents stable triplex
DNA, as a Hoogsteen or reverse Hoogsteen base pair is not
formed.
A family of non-natural nucleoside analogues has been pro-
posed to overcome this problem, especially for parallel-type tri-
plexes.3 In contrast, only a few non-natural nucleosides have
been designed for anti-parallel triplexes.4 Previously, we de-
veloped W-shaped nucleoside analogues (WNA analogues) and
demonstrated WNA-βT and WNA-βC for the recognition of a TA
or a CG interrupting site, respectively.5 Subsequent studies
synthesised a variety of WNA-βT analogues to examine the
sequence dependence of TA base pair recognition,6 and WNA-
βT was applied to oncogene-targeting TFOs to achieve antipro-
liferative effects in tumour cells.7 However, recognition of a CG
base pair remains elusive,8 and thus the development of non-
natural nucleoside analogues for a CG interrupting site is still
an active area of research.
Fig. 1 The schematic structure of triplex DNA. (A) T–AT triplet, (B) T–CG
complex, (C) N-substituted-isodC–CG complex.
A thymidine forms a reverse Hoogsteen base pair with an
adenine base of an AT base pair to stabilize anti-parallel tri-
plexes (Fig. 1A). An NMR study showed that a single hydrogen
bond formed between the 4-carbonyl of the thymine and the
4-amino of the cytosine of a CG base pair resulted in a relative
stabilization of the anti-parallel triplex (Fig. 1B).9 Thus, we
attempted to design new nucleoside analogues for recognition
of a CG base pair based on a T–CG complex. A 2′-deoxy-5-
methyl isocytidine (isodC) unit was adopted to enhance the
selectivity for CG sites over AT sites. An additional hydrogen
bonding site was designed to attach to the 2-amino of isodC
through an alkyl linker (Fig. 1C). It was expected that hydrogen
bond formation at a Hoogsteen face of a guanine base of a CG
base pair would provide selective stabilization for a CG pair. In
this paper, we describe the synthesis of a variety of N-substi-
tuted-isodC derivatives and the evaluation of triplex formation
using TFOs containing these derivatives.
Graduate School of Pharmaceutical Sciences, Kyushu University, Fukuoka, Higashiku
Results and discussion
Maidashi 3-1-1, Japan. E-mail: taniguch@phar.kyushu-u.ac.jp,
sasaki@phar.kyushu-u.ac.jp; Fax: +81 92 642 6615; Tel: +81 92 642 6615
†Electronic supplementary information (ESI) available: HPLC, MALDI-TOF mass
and NMR data. See DOI: 10.1039/c3ob40472b
The synthetic scheme for TFOs with N-substituted-isodC
derivatives is shown in Scheme 1. A cyclic derivative of
3918 | Org. Biomol. Chem., 2013, 11, 3918–3924
This journal is © The Royal Society of Chemistry 2013

View Article Online
Organic & Biomolecular Chemistry
Paper
was named according to its modification: TFO(guanidino),
TFO(ureido) and TFO(amino). Consequently, we successfully
demonstrated the efficient synthesis of modified ODNs by
applying the reaction onto the synthesized ODN attached to
the CPG column. TFO bearing isodC, propyl-isodC and natural
thymidine were synthesized for comparison.
The target duplex was designed for the formation of anti-
parallel triplex with TFO to have four base pairs, XY = GC, CG,
AT and TA. In addition, flanking base pairs around XY of
duplex were complementary to N3 and N5 of TFO. Triplex stabi-
lity of parallel type triplexes is generally evaluated by UV
melting experiments. However, the thermal denaturing profile
of anti-parallel triplexes is complicated and often troublesome
for the determination of Tm values.8b Therefore triplex stabi-
lities of the synthesized TFOs were evaluated by gel shift analy-
sis in this study. The TFOs were incubated with a duplex with
the pyrimidine strand labelled with fluorescent FAM in the
presence of 20 mM Tris-HCl, 20 mM MgCl2, 2.5 mM spermi-
dine and 10% sucrose buffer at pH 7.5 for 12 h at 30 °C, and
the formed triplexes were confirmed to be low-mobility bands
within the non-denatured polyacrylamide gel. Examples of gel
shift analysis using TFO(et-guanidino) and TFO(propyl) with
N3ZN5 = AZG are shown in Fig. 2. The triplexes were observed
as low mobility bands in the gel in the case of TFO(et-guani-
dino) (Fig. 2A), and TFO(propyl) having a propylene linker unit
did not show remarkable triplex formation (Fig. 2B). The equi-
Scheme 1 Synthesis of the isodC unit and the TFOs. Reagents and conditions:
(a) (1) ethylenediamine (or propylenediamine), 1 h (80% or 94%), (2) FmocCl,
dioxane, 10% Na2CO3 solution, 2.5 h (78% for 2a and 62% for 2b). (b) Propyl-
amine, 15 h (97%). (c) (1) DMTrCl, pyridine, 1.5–2 h (65–97%), (2) iPr2NP(Cl)-
OCH2CH2CN, DIPEA, CH2Cl2, 0 °C, 1–2 h (67–97%). (d) DNA synthesis. (e) 1H-Pyra- librium association constants (Ks) were calculated from the
band intensities of the triplex and duplex DNA7 (Table 1). The
natural TFO(T) formed stable triplexes selectively with AT base
zole-1-carboxamidine hydrochloride, DBU, CH3CN. (f) TMSNCO, DBU, CH3CN,
55 °C. (g) (1) 28% NH3 solution, 55 °C, (2) HPLC purification.
pairs (Table 1, runs 1, 10, 16 and 22). These results were in
accord with the previous results reported for the formation of
thymine (1)10 was treated with ethylenediamine or propylene- an anti-parallel triplex including a T–AT base triplet (Fig. 1A).2
diamine to introduce the linker unit, and the resulting Triplexes were also formed with a CG pair, although the Ks
primary amino group was Fmoc protected to produce
values were smaller, indicating the possible formation of a
5-methyl-N-substituted-isodC skeleton 2a having an ethylene single hydrogen bond (Fig. 1B).12,13 Additionally, relatively
linker and 2b having a propylene linker. To obtain the control stable triplexes were formed with isodC at GC sites (Table 1,
compound (4) without the terminal amino unit, compound 1
runs 2, 11 and 23). These data suggested the formation of a
was reacted with aminopropane. The diol compounds (2a, 2b single hydrogen bond between isodC and dG such as that
and 4) were then converted to the corresponding phosphora- shown in the triplet structure in Fig. 3A. It should be noted
midite precursors (3a, 3b and 5, respectively). The amino-pro-
that TFO(et-guanidino) showed binding preference for a CG
tected isodC derivative was incorporated into TFO with base pair (Table 1, runs 3 and 12). As the 2-amino group of
flanking nucleotides around the isodC using an automated isodC was alkylated, the hydrogen bond expected to form
DNA synthesizer (Scheme 1).
between isodC and dG would probably not be formed for
A functional group was introduced to the amino group of guanidinoethyl-isodC (Fig. 3B). In contrast, ureido-, amino- or
the isodC of the synthesized oligodeoxynucleotides (ODNs) propyl-isodC did not significantly improve the stability of
before cleaving from the CPG column. First, the Fmoc group
triplex formation (Table 1, runs 4–6 and 13–15). To check the
was selectively deprotected using DBU in CH3CN, and the effects of the length of the linker unit on the triplex stability,
resulting primary amino group was converted to the corres- Ks values of the TFO incorporating isodC having a propylene-
ponding guanidino and ureido groups by treatment with 1H-
linked guanidino, ureido and amino group in the sequence of
pyrazole-1-carboxamidine11 and TMSNCO, respectively. The the 3′A–Z–G-5′ context were compared with those obtained
modified ODNs were then cleaved from the CPG resin and the with the corresponding ethylene-linked derivatives. The Ks
protecting groups of the nucleotides were removed in 28%
values indicated that the propylene linker caused a decrease in
NH4OH at 55 °C. The crude ODNs were purified using HPLC. stability and selectivity (Table 1, runs 3 and 4 for an ethylene
The main peak around 16 min was separated, and the struc- linker vs. 7 and 8 for a propylene linker). These results indicate
tures of the purified ODNs were determined by MALDI-TOF
that the ethylene linker is suitable for the guanidino group to
MS measurement (Fig. S1 and S2, Table S1, ESI†). Each TFO interact with the target CG site. The amino group did not
This journal is © The Royal Society of Chemistry 2013
Org. Biomol. Chem., 2013, 11, 3918–3924 | 3919

View Article Online
Paper
Organic & Biomolecular Chemistry
Table 1 Equilibrium association constants of triplexes (Ks, 106, M−1 a
Target base pair (XY)
)
Run
N3ZN5
A–Z–G
Z
GC
CG
AT
TA
0.98
0.56
<0.01
<0.01
0.11
<0.01
<0.01
<0.01
<0.01
0.38
1
2
3
4
5
6
7
8
T
2.30
10.9
0.28
8.00
29.2
isodC
8.40
5.16
3.70
0.23
1.84
0.80
2.68
0.91
6.78
3.92
12.4
3.95
2.96
1.16
0.47
<0.01
0.07
<0.01
<0.01
<0.01
6.73
<0.01
0.60
<0.01
<0.01
<0.01
<0.01
<0.01
<0.01
<0.01
<0.01
95.1
5.30
0.54
0.54
1.06
et-Guanidino
et-Ureido
et-Amino
Propyl
pr-Guanidino
pr-Ureido
pr-Amino
T
0.13
0.04
<0.01
1.94
<0.01
1.97
0.23
15.2
1.55
1.55
1.79
0.14
0.13
0.45
<0.01
<0.01
<0.01
<0.01
6.92
11.1
0.20
2.21
0.67
1.18
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
G–Z–G
A–Z–A
G–Z–A
isodC
7.45
1.36
1.54
1.59
et-Guanidino
et-Ureido
et-Amino
Propyl
1.19
32.6
1.19
T
<0.01
<0.01
<0.01
<0.01
<0.01
<0.01
0.48
<0.01
<0.01
<0.01
<0.01
<0.01
isodC
<0.01
<0.01
<0.01
<0.01
<0.01
39.2
<0.01
<0.01
<0.01
<0.01
<0.01
et-Guanidino
et-Ureido
et-Amino
Propyl
T
isodC
et-Guanidino
et-Ureido
et-Amino
Propyl
<0.01
0.74
1.50
a The Ks values were calculated using the following equation: Ks
=
[Triplex]/[Duplex][TFO]. Errors were estimated to be within 10% for
triplicate experiments.
Fig. 2 Gel-shift analysis of the triplex formation ability. Triplex was formed
using 100 nM duplex containing a FAM-labelled pyrimidine strand in the pres-
ence of TFO at various concentrations. A mixture was incubated for 12 h at
30 °C in 20 mM Tris-HCl, 20 mM MgCl2, 2.5 mM spermidine and 10% sucrose
buffer at pH 7.5. Electrophoresis was performed at 10 °C with a non-denatured
polyacrylamide gel. (A) TFO(et-guanidino-isodC) consisting of 3’-AZG-5’, (B)
TFO(Propyl-isodC) consisting of 3’-AZG-5’.
stabilize triplexes either in an ethylene linker or in a propylene
linker (Table 1, runs 5 and 9), although its protonated form
was expected to form a hydrogen bond with a guanine of a CG
pair. These results have suggested the formation of hydrogen
bonds between the guanidino group at the end of the ethylene
linker and the target CG pair. The optimized structure between
guanidinoethyl-isodC and a CG base pair and its schematic
illustration are shown in Fig. 4, and indicate that the guani-
dino group can interact with dG from the major groove to con-
tribute to the selectivity for recognition of a CG base pair in an
anti-parallel triplex formation. These results indicated that the
CG recognition ability of guanidino-isodC was potentiated by
the hydrogen bonding ability of the terminal guanidino group.
In this study, TFOs with A–Z–A or G–Z–A in the N3ZN5
Fig. 3 Speculated recognition structures. (A) isodC–GC complex and (B)
N-alkylated-isodC–GC complex.
To corroborate the recognition ability of TFO(et-guanidino)
context did not form stable triplexes, except in the case when Z for a CG base pair in comparison with the selectivity of
was the natural base T (Table 1). A similar sequence depen- TFO(T), DNase I foot-printing analysis was performed using
dence in anti-parallel triplex formation with TFO having A–Z–A long duplex DNA including the AT and CG target sites in one
or G–Z–A contexts was reported, although an explanation was sequence (Fig. 5). The bands corresponding to both the AT
not immediately apparent.4a,6,8c
target site and the CG site disappeared in the presence of
3920 | Org. Biomol. Chem., 2013, 11, 3918–3924
This journal is © The Royal Society of Chemistry 2013

View Article Online
Organic & Biomolecular Chemistry
Paper
Conclusions
In conclusion, we have demonstrated that the newly designed
N-guanidinoethyl-2′-deoxy-5-methyl-isodC is a selective, non-
natural base analogue for a CG base pair and potentiates the
formation of anti-parallel triplexes. This isodC has not pre-
viously been used as a platform to design a non-natural
nucleoside analogue for the formation of triplexes; thus, the
present study has revealed that isodC is a potential unit for the
formation of anti-parallel triplexes.
Fig. 4 Optimized structure of the N-guanidinoethyl-isodC–CG complex using
Gaussian09 B3LYP/6-31G* in vacuo. (A) CPK model. (B) Schematic structure.
Experimental
General
1
The H-NMR (400 MHz) and 13C-NMR (100, 125 MHz) spectra
were recorded by a VarianUNITY-400 and an INOVA-500
spectrometer. 31P-NMR (162 MHz) spectrum was recorded
using 10% phosphoric acid in D2O as the internal standard at
0 ppm. The IR spectra were obtained using a Perkin Elmer
FTIR-SpectrumOne. The high-resolution mass spectra were
recorded by an Applied Biosystems Mariner System 5299
spectrometer. The MALDI-TOF mass spectra were recorded by
a BRUKER DALTONICS Microflex.
N2-[2-[(9-Fluorenylmethyloxycarbonyl)amino]ethyl]-2′-deoxy-
5-methylisocytidine (2a). 2,5′-Anhydrothymidine (500 mg,
2.2 mmol) in 20 ml of ethylenediamine was stirred at room
temperature for 1 h. The solution was concentrated, and the
residue was purified by column chromatography (CHCl3–
MeOH–NH3 aq. = 10 : 5 : 1) to give a white foam (80%, 509 mg).
To a solution of this white foam (300 mg, 1.1 mmol) in 7 ml of
dioxane and 4 ml of a 10% aqueous Na2CO3 solution was
added 9-fluorenylmethyl chloroformate (545 mg, 2.1 mmol),
and then the mixture was stirred at room temperature for
2.5 h. The reaction mixture was concentrated, and the residue
was purified by column chromatography (CHCl3–MeOH =
10 : 1 to 6 : 1) to give 2a as a white powder (78%, 415 mg).
1
Mp = 135–137 °C; nmax (neat) 3296, 1698, 1663 cm−1; H NMR
(400 MHz, CD3OD) δ 7.77 (2H, d, J = 7.6 Hz), 7.60 (2H, d, J =
7.6 Hz), 7.53 (1H, s), 7.36 (2H, t, J = 7.4 Hz), 7.28 (2H, t, J = 7.4
Hz), 5.78–5.74 (1H, m), 4.42–4.41 (1H, m), 4.35–4.26 (2H, m),
4.16 (1H, t, J = 7.0 Hz), 3.90 (1H, q, J = 2.8 Hz), 3.74 (2H, ddd,
J = 2.4, 12.0, 20.0 Hz), 3.54–3.44 (2H, m), 3.34–3.29 (2H, m),
2.47–2.40 (1H, m), 2.18–2.13 (1H, m), 1.86 (3H, s); 13C NMR
(125 MHz, CD3OD) δ 174.6, 159.2, 154.7, 145.4, 145.3, 142.6,
138.8, 128.7, 128.1, 126.2, 126.1, 120.9, 114.7, 92.0, 89.2, 71.8,
67.8, 64.3, 62.0, 42.2, 41.4, 39.8, 13.5; HRMS (ESI-TOF) Calcd
for C27H31N4O6: [M + H]+, 507.2238; Found: 507.2212.
Fig. 5 DNase I foot-printing analysis of the selectivity of TFO(T) and TFO-
(et-guanidino). M is a marker of cleavage sites. D is an absence of TFOs. Black
bars show the triplex formation sites including the target AT or CG site.
N2-[2-[(9-Fluorenylmethyloxycarbonyl)amino]propyl]-2′-deoxy-
5-methylisocytidine (2b). 2,5′-Anhydrothymidine (500 mg,
2.2 mmol) in 20 ml of propylenediamine was stirred at room
temperature for 12 h. The solution was concentrated, and the
residue was purified by column chromatography (CHCl3–
MeOH–NH3 aq. = 10 : 5 : 1) to give a white foam (94%, 626 mg).
To a solution of this white foam (400 mg, 1.3 mmol) in 9 ml of
dioxane and 4.5 ml of a 10% aqueous Na2CO3 solution was
0.25–1.0 μM TFO(T), indicating that TFO(T) formed triplexes
with these regions and protected them from enzymatic
digestion. In the presence of TFO(et-guanidino), the bands
corresponding to the AT site were present and only bands
for the CG site disappeared. These results indicated that
TFO(et-guanidino) interacted selectively with the CG target
site.
This journal is © The Royal Society of Chemistry 2013
Org. Biomol. Chem., 2013, 11, 3918–3924 | 3921

View Article Online
Paper
Organic & Biomolecular Chemistry
added 9-fluorenylmethyl chloroformate (746 mg, 2.9 mmol), 0.7 mmol), and then the mixture was stirred at 0 °C for 1 h.
and then the mixture was stirred at room temperature for The solution was diluted with CH2Cl2 and successively washed
2.5 h. The reaction mixture was concentrated, and the residue with a saturated aqueous NaHCO3 solution and brine, dried
was purified by column chromatography (CHCl3–MeOH = over Na2SO4 and concentrated. The residue was purified by
10 : 1 to 6 : 1) to give 2b as a white powder (62%, 430 mg). Mp flash chromatography (CHCl3–MeOH = 1 : 0 to 100 : 1) to give
= 132–134 °C; nmax (neat) 3317, 2923, 1702, 1663, 1603 cm−1
;
3b as a white powder (97%, 242 mg). 1H NMR (400 MHz,
1H NMR (400 MHz, CD3OD) δ 7.78 (2H, d, J = 8.0 Hz), 7.64 (2H, CDCl3) δ 7.73 (2H, d, J = 7.2 Hz), 7.59 (2H, t, J = 7.2 Hz), 7.36
d, J = 8.0 Hz), 7.53 (1H, s), 7.37 (2H, t, J = 7.2 Hz), 7.29 (2H, t, (4H, t, J = 7.2 Hz), 7.30–7.17 (10H, m), 6.81–6.77 (4H, m), 6.07
J = 7.2 Hz), 5.81–5.78 (1H, m), 4.47–4.44 (1H, m), 4.35 (2H, d, (0.5H, s), 5.96 (0.5H, s), 5.79 (1H, dd, J = 8.0, 13.6 Hz),
J = 6.8), 4.19 (1H, t, J = 6.8 Hz), 3.94 (2H, t, J = 2.8 Hz), 3.79 5.52–5.50 (0.5H, m), 5.46–5.44 (0.5H, m), 4.63–4.56 (1H, m),
(2H, ddd, J = 2.4, 12.0, 19.6 Hz), 3.15 (2H, t, J = 6.8 Hz), 4.35–4.30 (2H, m), 4.22–4.07 (2H, m), 3.75 (3H, s), 3.74 (3H,s),
2.51–2.44 (1H, m), 2.24–2.19 (1H, m), 1.88 (3H, s), 1.75 (2H, t, 3.62–3.25 (8H, m), 3.18–3.14 (2H, m), 2.60–2.35 (4H, m),
J = 6.8 Hz); 13C NMR (100 MHz, CD3OD) δ 174.6, 159.0, 154.5, 1.73 (1.5H, s), 1.72 (1.5H, s), 1.67–1.62 (2H, m), 1.28–0.99
145.3, 142.6, 138.9, 128.7, 128.1, 126.1, 120.9, 114.5, 92.0, 89.1, (12H, m); 31P NMR (162 MHz, CDCl3) δ 148.9, 148.4; HRMS
71.8, 67.6, 62.0, 39.8, 39.3, 30.3, 13.6; HRMS (ESI-TOF) Calcd (ESI-TOF) Calcd for C58H68N6O9P [M + H]+: 1023.4780, Found:
for C28H33N4O6: [M + H]+: 521.2395, Found: 521.2437.
3′-O-[2-Cyanoethoxy(diisopropylamino)phosphino]-5′-O-(4,4′-
1023.4753.
N2-Propyl-2′-deoxy-5-methylisocytidine (4). 2,5′-Anhydrothy-
dimethoxytrityl)-N2-(2-((9-fluorenylmethyloxycarbonyl)amino)- midine (100 mg, 0.5 mmol) in 5 ml of propylamine was stirred
ethyl) 2′-deoxy-5-methylisocytidine (3a). 4,4′-Dimethoxytrityl at room temperature for 15 h. The solution was concentrated,
chloride (300 mg, 0.9 mmol) was added to a solution of 2 and the residue was purified by column chromatography
(300 mg, 0.6 mmol) in 6 ml of pyridine, and the mixture was (CHCl3–MeOH = 20 : 1 to 5 : 1) to give 4 as a white foam (97%,
stirred at room temperature for 1.5 h. The solution was diluted 122 mg). nmax (neat) 3312, 2926, 1663 cm−1
;
1H NMR
with CH2Cl2 and successively washed with a saturated aqueous (400 MHz, CDCl3) δ 7.51 (1H, s), 5.79 (1H, dd, J = 8.0, 6.0 Hz),
NaHCO3 solution and brine, dried over Na2SO4 and concen- 4.48–4.45 (1H, m), 3.94 (1H, qr, J = 2.8 Hz), 3.79 (2H, ddd, J =
trated. The residue was purified by flash chromatography 12.0, 6.8, 2.8 Hz), 3.41–3.32 (2H, m), 2.51–2.44 (1H, m),
(CHCl3–MeOH = 1 : 0 to 20 : 1) to give a white powder (84%, 2.22–2.16 (1H, m), 1.87 (3H, s), 1.60 (2H, sext, J = 7.2 Hz), 0.92
402 mg). To a solution of this white powder (330 mg, (3H, t, J = 7.2 Hz); 13C NMR (125 MHz, CD3OD) δ; 174.7, 154.6,
0.4 mmol) in 8.2 ml of CH2Cl2 were added DIPEA (430 μl, 139.0, 114.4, 92.3, 89.1, 71.9, 62.0, 44.2, 39.6, 23.4, 13.5, 11.6;
2.5 mmol) and 2-cyanoethyl-N,N-diisopropylchlorophosphora- HRMS (ESI-TOF) Calcd for C13H22N3O4: [M + H]+, 284.1605;
midite (275 μl, 1.2 mmol), and then the mixture was stirred at Found: 284.1633.
0 °C for 1 h. The solution was diluted with CH2Cl2 and succes-
3′-O-[2-Cyanoethoxy(diisopropylamino)phosphino]-5′-O-
sively washed with a saturated aqueous NaHCO3 solution and (4,4′-dimethoxytrityl)-N2-propyl-2′-deoxy-5-methylisocytidine (5).
brine, dried over Na2SO4 and concentrated. The residue was 4,4′-Dimethoxytrityl chloride (263 mg, 0.8 mmol) was
purified by flash chromatography (CHCl3–MeOH = 100 : 1 to added to a solution of 4 (110 mg, 0.4 mmol) in 4 ml of pyri-
50 : 1) to give 3a as a white powder (78%, 321 mg). 1H NMR dine, and the mixture was stirred at room temperature for 2 h.
(400 MHz, CDCl3) δ 7.72 (2H, d, J = 7.6 Hz), 7.54 (2H, m), 7.34 The solution was diluted with CH2Cl2 and successively washed
(4H, d, J = 7.2 Hz), 7.29–7.16 (10H, m), 6.80–6.77 (4H, m), 6.06 with a saturated aqueous NaHCO3 solution and brine, dried
(0.5H, br), 5.95 (0.5H, s), 5.78–5.70 (1H, m), 5.53–5.46 (1H, m), over Na2SO4 and concentrated. The residue was purified by
4.61–4.53 (1H, m), 4.31–4.30 (2H, m), 4.17–4.12 (2H, m), 3.75 flash chromatography (CHCl3–MeOH = 50 : 1 to 10 : 1) to give a
(6H, s), 3.60–3.24 (10H, m), 2.68–2.26 (4H, m), 1.72 (1.5H, s), white powder (97%, 211 mg). To a solution of a white powder
1.71 (1.5H, s), 1.24–1.00 (12H, m); 31P NMR (162 MHz, CDCl3) (155 mg, 0.3 mmol) in 2.7 ml of CH2Cl2 were added DIPEA
δ 148.9, 147.9; HRMS (ESI-TOF) Calcd for C57H66N6O9P: (280 μl, 1.6 mmol) and 2-cyanoethyl-N,N-diisopropylchlorophos-
[M + H]+, 1009.4623; Found: 1009.4613.
phoramidite (180 μl, 0.8 mmol), and then the mixture was
3′-O-[2-Cyanoethoxy(diisopropylamino)phosphino]-5′-O-(4,4′- stirred at 0 °C for 2 h. The solution was diluted with CH2Cl2
dimethoxytrityl)-N2-(2-((9-fluorenylmethyloxycarbonyl)amino)- and successively washed with a saturated aqueous NaHCO3
propyl) 2′-deoxy-5-methylisocytidine (3b). 4,4′-Dimethoxytrityl solution and brine, dried over Na2SO4 and concentrated. The
chloride (521 mg, 1.5 mmol) was added to a solution of 2b residue was purified by flash chromatography (CHCl3–MeOH =
(400 mg, 0.8 mmol) in 7.7 ml of pyridine, and the mixture was 100 : 1 to 80 : 1) to give 5 as a white powder (67%, 140 mg).
stirred at room temperature for 1 h. The solution was diluted 1H NMR (400 MHz, CDCl3) δ 7.36–7.20 (9H, m), 7.12 (0.5H, s),
with CH2Cl2 and successively washed with a saturated aqueous 7.01 (0.5H, s), 6.81–6.78 (4H, m), 5.72–5.55 (2H, m), 4.61–4.55
NaHCO3 solution and brine, dried over Na2SO4 and concen- (1H, m), 4.20 (0.5H, m), 4.15 (0.5H, m), 3.77 (3H, s), 3.76
trated. The residue was purified by flash chromatography (3H, s), 3.70–3.23 (8H, m), 2.75–2.26 (4H, m), 1.79 (1.5H, s),
(CHCl3–MeOH = 1 : 0 to 20 : 1) to give a white powder (65%, 1.76 (1.5H, s), 1.57–1.48 (2H, m), 1.24–1.04 (12H, m), 0.85–0.80
410 mg). To a solution of this white powder (200 mg, 0.2 mmol) (3H, m); 31P NMR (162 MHz, CDCl3) δ 149.63, 148.93; HRMS
in 4.9 ml of CH2Cl2 were added DIPEA (255 μl, 1.5 mmol) and (ESI-TOF) Calcd for C43H57N5O7P: [M + H]+, 786.3990; Found:
2-cyanoethyl-N,N-diisopropyl-chlorophosphoramidite (163 μl, 786.4010.
3922 | Org. Biomol. Chem., 2013, 11, 3918–3924
This journal is © The Royal Society of Chemistry 2013

View Article Online
Organic & Biomolecular Chemistry
Paper
Synthesis of TFO containing aminoethyl-isodC or propylethyl-
isodC derivatives
DNase I foot printing analysis
Each TFO (TFO(T): GGAAGGATGGAGGAGGGA or TFO(et-guani-
The TFO was cleaved from the CPG resin by heating in 28% dino): GGAAGGAZGGAGGAGGGA (Z = et-guanidine-isodC),
aqueous ammonia overnight at 55 °C, followed by HPLC purifi- 0 to 1 μM) was incubated with 100 nM of the 5′ FAM-labeled
cation (HPLC conditions: column: Nacalai tesque COSMOSIL duplex (5′ CCCCTCGGAAGGAAGGAGGAGGGATCCTCTCTCG-
5C18-ARII, 10 × 250 mm, solvents: A: 0.1 M TEAA buffer, B: GAAGGACGGAGGAGGGATCCCCC 3′ and 3′ GGGGAGCCTTC-
CH3CN, B: 10% to 40%/20 min, 40% to 100%/30 min, flow CTTCCTCCTCCCTAGGAGAGAGCCTTCCTGCCTCCTCCCTAGG-
rate: 3.0 ml min−1, UV: 254 nm). The DMTr group was depro- GGG-FAM 5′, 100 nM) in a buffer consisting of 20 mM Tris-
tected in 5% aqueous acetic acid at room temperature for HCl, 5 mM MgCl2, 2.5 mM spermidine and 10% sucrose at pH
15 min, followed by HPLC purification (HPLC conditions: 7.5 (total volume of 8 μl) for 12 h at 30 °C. 2 μl of a DNase I
column: SHISEIDO C18, 4.6 × 250 mm, solvents: A: 0.1 M solution (0.1 unit in a buffer containing 400 mM of Tris-HCl,
TEAA buffer, B: CH3CN, B: 10% to 30%/20 min, 30% to 100%/ 80 mM of MgCl2 and 50 mM of DTT at pH 7.5) was added and
30 min, flow rate: 1.0 ml min−1, UV: 254 nm).
the solution was digested for 1 min at 30 °C. The reaction was
stopped by adding formamide containing 20 mM EDTA at
90 °C, and electrophoresis was carried out with an 18% de-
naturing polyacrylamide gel containing 8 M urea. FAM-bands
were visualized by LAS-4000.
Synthesis of TFO containing guanidinoethyl-isodC derivative
A suspension of the support-bound TFO in 250 μl of CH3CN
was treated with 1H-pyrazole-1-carboxamidine hydrochloride
(1.0 mg) and DBU (50 μl) overnight at room temperature. The
support was washed two times with CH3CN, and the resulting
TFO was treated with 28% aqueous ammonia overnight at
55 °C, followed by HPLC purification (HPLC conditions:
column: Nacalai tesque COSMOSIL 5C18-ARII, 10 × 250 mm,
solvents: A: 0.1 M TEAA buffer, B: CH3CN, B: 10% to 40%/
20 min, 40% to 100%/30 min, flow rate: 3.0 ml min−1, UV:
254 nm). The DMTr group was deprotected in 5% aqueous
acetic acid at room temperature for 15 min, followed by HPLC
purification (HPLC conditions: column: SHISEIDO C18, 4.6 ×
250 mm, solvents: A: 0.1 M TEAA buffer, B: CH3CN, B: 10% to
Acknowledgements
This study was supported by a Grant-in-Aid for Scientific
Research (S) (S.S.; Grant Number 21229002) and a Grant-in-Aid
for Young Scientists (A) (Y.T.; Grant Number 24689006) from
the Japan Society for the Promotion of Science.
Notes and references
1 A. Mukherjee and K. M. Vasquez, Biochimie, 2011, 93, 1197.
2 V. N. Soyfer and V. N. Potaman, Triple-Helical Nucleic Acids,
Springer-Verlag New York, Inc., 1996.
30%/20 min, 30% to 100%/30 min, flow rate: 1.0 ml min−1
UV: 254 nm).
,
3 (a) Y. Hari, S. Obika and T. Imanishi, Eur. J. Org. Chem.,
2012, 2875; (b) Y. Hari, M. Akabane, Y. Hatanaka,
M. Nakahara and S. Obika, Chem. Commun., 2011, 47,
4424; (c) A. Semenyuk, E. Darian, J. Liu, A. Majumdar,
B. Cuenoud, P. S. Miller, A. D. MacKerell Jr. and
M. M. Seidman, Biochemistry, 2010, 49, 7867; (d) D. A. Rusling,
V. E. C. Powers, R. T. Ranasinghe, Y. Wang, S. D. Osborne,
T. Brown and K. R. Fox, Nucleic Acids Res., 2005, 33, 3025.
4 (a) N. A. Kolganova, A. K. Shchyolkina, A. V. Chudinov,
A. S. Zasedatelev, V. L. Florentiev and E. N. Timofeev,
Nucleic Acids Res., 2012, 40, 8175; (b) S. P. Parel and
C. J. Leumann, Nucleic Acids Res., 2001, 29, 2260.
5 (a) S. Sasaki, Y. Taniguchi, R. Takahashi, Y. Senko,
K. Kodama, F. Nagatsugi and M. Maeda, J. Am. Chem. Soc.,
2004, 126, 516; (b) S. Sasaki, H. Yamauchi, F. Nagatsugi,
R. Takahashi, Y. Taniguchi and M. Maeda, Tetrahedron
Lett., 2001, 42, 6915.
Synthesis of TFO containing ureidoethyl-isodC derivative
A suspension of the support-bound TFO in 250 μl of CH3CN
was treated with trimethylsilyl isocyanate (50 μl) and DBU
(50 μl) overnight at 55 °C. The support was washed two times
with CH3CN, and the resulting TFO was treated with 28%
aqueous ammonia overnight at 55 °C, followed by HPLC purifi-
cation (HPLC conditions: column: Nacalai tesque COSMOSIL
5C18-ARII, 10 × 250 mm, solvents: A: 0.1 M TEAA buffer, B:
CH3CN, B: 10% to 40%/20 min, 40% to 100%/30 min, flow
rate: 3.0 ml min−1, UV: 254 nm). The DMTr group was depro-
tected in 5% aqueous acetic acid at room temperature for
15 min, followed by HPLC purification (HPLC conditions:
column: SHISEIDO C18, 4.6 × 250 mm, solvents: A: 0.1 M
TEAA buffer, B: CH3CN, B: 10% to 30%/20 min, 30% to 100%/
30 min, flow rate: 1.0 ml min−1, UV: 254 nm).
6 Y. Taniguchi, A. Nakamura, Y. Senko, F. Nagatsugi and
S. Sasaki, J. Org. Chem., 2006, 71, 2115.
7 Y. Taniguchi and S. Sasaki, Org. Biomol. Chem., 2012, 10,
8336.
Computational calculation of the N-guanidinoethyl-isodC–CG
complex
Geometry optimization was performed using the B3LYP
density functional with 6-31G* basis set for N-guanidinoethyl-
isodC–CG complex in vacuo as implemented in the Gaussian09
program.
8 (a) Y. Taniguchi, H. Okamura, N. Fujino and S. Sasaki,
Tetrahedron, 2013, 69, 600; (b) E. Aoki, Y. Taniguchi,
Y. Wada and S. Sasaki, ChemBioChem, 2012, 13, 1152;
(c) Y. Taniguchi, Y. Uchida, T. Takaki, E. Aoki and S. Sasaki,
This journal is © The Royal Society of Chemistry 2013
Org. Biomol. Chem., 2013, 11, 3918–3924 | 3923

View Article Online
Paper
Organic & Biomolecular Chemistry
Bioorg. Med. Chem., 2009, 17, 6803; (d) Y. Taniguchi, 11 A. Semenyuk, E. Darian, J. Liu, A. Majumdar, B. Cuenoud,
M. Togo, E. Aoki, Y. Uchida and S. Sasaki, Tetrahedron,
2008, 64, 7164.
P. S. Miller, A. D. Mackerell Jr. and M. M. Seidman,
Biochemistry, 2010, 49, 7867.
9 K. Dittrich, J. Gu, R. Tinder, M. Hogan and X. Gao, 12 P. A. Beal and P. B. Dervan, Nucleic Acids Res., 1992, 20,
Biochemistry, 1994, 33, 4111. 2773.
10 (a) S. C. Jurczyk, J. T. Kodra, J. D. Rozzell, S. A. Benner and 13 R. H. Durland, T. S. Rao, G. R. Revankar, J. H. Tinsley,
T. R. Battersby, Helv. Chim. Acta, 1998, 81, 793; (b) Y. Tor
and P. B. Dervan, J. Am. Chem. Soc., 1993, 115, 461.
M. A. Myrick, D. M. Seth, J. Rayford, P. Singh and
K. Jayaraman, Nucleic Acids Res., 1994, 22, 3233.
3924 | Org. Biomol. Chem., 2013, 11, 3918–3924
This journal is © The Royal Society of Chemistry 2013