Pyrene chromophores for the photoreversal of psoralen interstrand crosslinks

Article abstract of DOI:10.1039/c4ob00603h

Applying psoralen interstrand crosslinks for the photoactivation of nucleic acids is a new concept. To find chromophores that can efficiently stimulate crosslink repair we screened several pyrenes and appended them to peptide nucleic acids for their site-selective addressing. Even though pyrenes conjugated to uracil revealed desirable spectroscopic properties they were not effective in crosslink reversal. In contrast, bare pyrenes are well suitable for crosslink repair with 350 nm light showing an uncaging efficiency similar to classical photocaging groups.

Full text of DOI:10.1039/c4ob00603h

Organic &
Biomolecular Chemistry
View Article Online
View Journal | View Issue
PAPER
Pyrene chromophores for the photoreversal of
psoralen interstrand crosslinks†
Cite this: Org. Biomol. Chem., 2014,
12, 5260
Jens M. Stadler and Thorsten Stafforst*
Applying psoralen interstrand crosslinks for the photoactivation of nucleic acids is a new concept. To find
chromophores that can efficiently stimulate crosslink repair we screened several pyrenes and appended
them to peptide nucleic acids for their site-selective addressing. Even though pyrenes conjugated to
uracil revealed desirable spectroscopic properties they were not effective in crosslink reversal. In contrast,
bare pyrenes are well suitable for crosslink repair with 350 nm light showing an uncaging efficiency
similar to classical photocaging groups.
Received 20th March 2014,
Accepted 22nd May 2014
DOI: 10.1039/c4ob00603h
www.rsc.org/obc
strong impact of a single crosslink on the biological function
of a nucleic acid. Along those lines, we demonstrated that
Introduction
Psoralen is a plant natural product that can damage nucleic psoralen crosslinks can be reversed in a photolyase-like
acids in a light-dependent manner.1 Both DNA and double- manner by steering an external photoelectron transfer (PET)
stranded RNA can be interstrand crosslinked via two consecu- chromophore to the crosslink.4 Reversal occurs in a two-step
tive [2 + 2] cycloadditions of the psoralen moiety with neigh- mechanism involving formation of one unmodified strand and
boring pyrimidine bases in particular on 5′-d(TA) and 5′-r(UA) one strand carrying a psoralen monoadduct. The psoralen
motifs (Scheme 1). Such crosslinked nucleic acids cannot be monoadduct can be subsequently removed in a light-depen-
unwound, their secondary structure is frozen and their biologi- dent way either by direct absorption or by a second electron
cal activity is often completely blocked. Since psoralen inter- transfer reaction.4 For many biological functions the freezing
strand crosslinks are difficult to repair in vivo2 they are highly of the structure limits the function. Thus the function is
mutagenic and useful as warheads3 in antisense and antigene already restored upon breakdown of the crosslink into the
applications. We consider site-selective psoralen-crosslinks as monoadduct. A typical example for this is the photocontrol of
useful tools to manipulate gene functions with light due to the transcription/translation from a psoralen-crosslinked lucife-
rase gene as we have recently achieved.5 Even though the cross-
link is not fully removed the gene activity was readily activated
with light. Since no residual luciferase activity above the back-
ground was observed for the crosslinked gene, very high photo-
activation efficiencies (≥500 fold) were obtained.5 However,
application in biology requires more suitable chromophores
than the phenothiazine used in our initial study4 in particular
with respect to the photo-activation wavelength and efficiency
(εφ). The method could also benefit from an orthogonally
excitable or a more photostable chromophore than 1-amino-
pyrene.5 Thus, we have screened several pyrene chromophores
Scheme 1 General scheme for the caging of nucleic acids with psora-
len (AMT 1). The interstrand crosslink can be removed in a photo- with strong absorbance (ε) between 330 and 450 nm which we
electron-dependent manner by addressing a suitable chromophore in
report here.
proximity to the crosslink applying a peptide nucleic acid (PNA),4 for
instance.
Results and discussion
Interfaculty Institute of Biochemistry, Auf der Morgenstelle 15, University of
Tübingen, 72076 Tübingen, Germany. E-mail: thorsten.stafforst@uni-tuebingen.de;
Reversal of the crosslink requires the injection of a photo-
http://www.ifib.uni-tuebingen.de/research/stafforst.html; Fax: +49 (0)7071295070
electron into the crosslink. We anticipate that electron transfer
†Electronic supplementary information (ESI) available: NMR spectra of
occurs to the 5,6-alkylated thymidine moieties of the cross-
compounds 3, 4, 6, and 8 HR-LC-MS data for PNAs 9–11, gels and densitometry,
and determination of quantum yields. See DOI: 10.1039/c4ob00603h
link.6 From excess electron transfer studies in DNA7 several
5260 | Org. Biomol. Chem., 2014, 12, 5260–5266
This journal is © The Royal Society of Chemistry 2014

View Article Online
Organic & Biomolecular Chemistry
Paper
electron donors are known to inject electrons readily into thy-
midine, 5,6-dihydrothymidine and thymine oxetanes.8 All such
donors are possible candidates for the repair of the psoralen
crosslink too. The class of pyrene chromophores is particularly
interesting because pyrenes exhibit very strong extinction
coefficients (ε) and have been used already in the context of
DNA and RNA as probes to monitor hybridization, sequence,
or to inject electrons.9 Beside the bare pyrene chromophore,
derivatized pyrenes with interesting properties have been
described, in particular those that are conjugated to uracil.10
Attachment of the pyrene directly at its 1-position to the C5-
carbon of uracil results in a chromophore with a slightly red-
shifted absorbance spectrum that has been used for the study
of excess electron transfer through the nucleobase stack. Inser-
tion of an additional two-atom ethynyl bridge between the
pyrene and the uracil moieties even further shifts the absorp-
tion spectra to the red and strongly increases the excitation
coefficient (λmax = 392 nm with 40 mM−1 cm−1).11 If such chro-
mophores could efficiently transfer an electron to the crosslink
and stimulate the breakdown of the crosslink the application
of the method may become possible at a much more suitable
wavelength for cellular experiments (350–450 nm). For this
reason we have synthesized peptide nucleic acids carrying a
C-terminal modification with either a bare pyrene or a pyrene
conjugated to uracil including or lacking an ethynyl bridge.
Peptide nucleic acids (PNA) are nucleic acid analogs that
contain a non-charged, highly flexible pseudo-peptidic amino-
ethylglycine (aeg) instead of the natural phosphodiester
backbone.12 The canonical nucleo bases are attached via acetic
acid moieties to the backbone. PNAs bind DNA and RNA with
very high free energy gain and strong mismatch discrimi-
nation. Due to the lack of charge they invade into dsDNA, dis-
place one strand and bind the other via the Watson–Crick
sites. We wanted to make use of the invasion-driven antigene
binding mode in order to bring the chromophore, in a
sequence-addressable way, as close as possible to the
crosslink.4
Scheme 2 Invasion strategy for the sequence-specific addressing of
the pyrene chromophores in proximity to the crosslink in a self-paired,
crosslinked 24 + 24 nt DNA (12). The uracil-conjugated pyrenes could
potentially base-pair to the orphan adenosine at the crosslink site. PNA
is shown in gray with small letters.
We designed the PNA probes such that they approach the
crosslinked 5′-d(TA) site from the 3′-end (Scheme 2). This may
potentially allow for base-pairing of the orphan adenosine at
the crosslink site with the pyrene-modified uracil. For this the
To attach the bare pyrene group to the PNA, commercially
chromophores had to be installed at the C-terminus of the available 1-acetyl pyrene 2 was activated as the pentafluoro-
PNA. To circumvent the synthesis of complete Fmoc-protected phenol ester 3 (Scheme 3). In order to introduce the pyrene
aeg building blocks for each pyrene derivative we decided to chromophore at the C5-carbon of uracil, we first synthesized
modify an L-diaminopropionic acid (Dpr) with various pyrene 5-iodo-uridine-N-acetic acid 4 in two steps similarly to literature
acetic acids directly on the solid support instead. The install- protocols for similar compounds.14 The direct attachment of
ment of the pyrene moieties at the C-terminus via the Dpr the chromophore was achieved by a Pd-catalyzed Suzuki cross-
building block results in a “PNA-like” building block, however coupling with commercially available pyrene-1-boronic acid
not in a conventional aeg PNA building block but rather 5.15 The intermediate acid was directly transformed into the
in a S-γ-modified aeg PNA building block (Scheme 3). Since pentafluorophenylester 6 by transesterification with penta-
S-γ-modified PNAs are well studied and are known for the posi- fluorophenol trifluoroacetate in DCM–pyridine for solid phase
tive effects of the γ-modification on the PNA/DNA duplex PNA synthesis. The attachment via an ethynyl bridge was
stability,13 we consider the uracil-pyrene derivates as being achieved by Sonogashira coupling with commercially available
delivered in a backbone context that would potentially support 1-ethynyl-pyrene 7.11 The intermediate acid was activated as
or at least not obstruct the base pairing with the orphan the respective pentafluorophenolester 8. PNAs were synthe-
adenosine.
sized from commercially available building blocks by applying
This journal is © The Royal Society of Chemistry 2014
Org. Biomol. Chem., 2014, 12, 5260–5266 | 5261

View Article Online
Paper
Organic & Biomolecular Chemistry
chromophores 3, 6, or 8 were coupled to the β-amino group of
the Dpr building block respectively. Subsequently, PNA syn-
thesis was continued by deprotection of the α-Fmoc protection
group of the Dpr residue. Unfortunately, removal of the Mtt
group was impossible at the end of the PNA synthesis because
the Bhoc protection groups were unstable with Mtt removal.
All PNAs were purified by HPLC and their integrity was con-
firmed by high-resolution mass spectrometry.
The comparison of the UV-spectra of the new pyrene-modi-
fied probes (9–11) and our previously reported phenothiazine-
containing PNA clearly reveals the attractive absorption pro-
perties of the latter. All three chromophores absorb light at
λ ≥ 350 nm with substantial extinction coefficients. The bare
pyrene chromophore attached to PNA 9 still exhibits the typical
absorbance spectra with maxima at 334 nm (20 mM−1 cm−1
)
and 350 nm (29 mM−1 cm−1). Since the bands are very steep the
bare pyrene hardly absorbs above 365 nm (≈2 mM−1 cm−1 at
365 nm). Even though the positions of the bands stay nearly
unchanged, the pyrene absorption bands get broadened upon
conjugation to the uracil base in PNA 10. Hence, this PNA still
has a significant absorbance at 365 nm (12 mM−1 cm−1).
Further incorporation of the ethynyl bridge into PNA 11 gives
an enormous red-shift of ≈60 nm and a strong increase in
absorbance (Fig. 1).
We tested the PNAs for the opening of a short crosslinked
double-stranded nucleic acid substrate basically as before.4
The substrate was obtained by crosslinking the partially self-
pairing 24 nt oligomer 5′-d(pGGAACAGCAGCCTAGGCGAGCA
GG) with aminomethyltrisoralen17 (1) as described before.4
The two PNA binding sites are directly located downstream of
the 5′-TA crosslink site (italic) and allow for the positioning of
the pyrene chromophore in closest proximity to the cross-
linked site. For photoactivation, the crosslinked DNA species
12 was diluted in argon-saturated sodium phosphate buffer
(100 mM NaCl, pH 7.0) to a final concentration of 1 µM. The
respective PNA 9, 10, or 11 was added to a final concentration
of 4 µM providing an excess of two equivalents of PNA per PNA
binding site. The mixture was briefly heated to 70 °C, re-hybri-
dized at 15 °C and was then irradiated at 15 °C using a
Scheme 3 Synthesis of the pyrene-modified peptide nucleic acids
(PNA). (a) PfpOTFA, DCM–pyridine; (b) Pd(PPh3)4, NaOH, THF–water
reflux; (c) PfpOTFA, DCM–pyridine; (d) Pd(PPh3)4, CuI, Hünig base, DMF,
80 °C; (e) PfpOTFA, DCM–pyridine; (f) 0.5% TFA in DCM–HFIP 2 : 1; (g)
3, 6, or 8, Hünig base, DMF o.n.
the Fmoc/Bhoc strategy and HATU/HOAt activation proto-
cols on TG-RR Rink amide resin (NovaBiochem).16 The
sequence of the PNAs was H-Lys–ctgctcgcc–Dpr(β-pyrene)–Lys–
Lys–NH. Directly after coupling of the Fmoc–Dpr(Mtt)–OH
building block, peptide synthesis was stopped for the introduc-
tion of the respective pyrene chromophore. For this, the Mtt
group was removed selectively on the solid support by treat-
Fig. 1 UV absorbance spectra of synthesized PNAs 9, 10, and 11 that
ment with 0.5% TFA in HFIP–DCM 1 : 2. Then the pyrene carry a pyrene or the phenothiazine4 moiety respectively.
5262 | Org. Biomol. Chem., 2014, 12, 5260–5266
This journal is © The Royal Society of Chemistry 2014

View Article Online
Organic & Biomolecular Chemistry
Paper
fluorescence spectrometer under exact control of the wave- of the single-stranded product was determined to be 5.4
length and irradiation time. After various time points (0 to 0.5 min and reached a plateau after formation of ≈1.4 µOD
80 min) aliquots (2.5 µOD DNA) were taken out and subjected (Fig. 2). In contrast, both PNAs 10 and 11 with the pyrene
to denatured 15% polyacrylamide electrophoresis. In order to chromophore conjugated to uracil failed to reverse the crosslink
reduce the smearing effect caused by the strong binding of the significantly over the background reaction. For the ethynyl-
PNA even in the presence of urea, 1.5% formaldehyde was bridged pyrene PNA 11 one could have expected a failure because
added to the loading buffer and the samples were heated this chromophore is incapable of injecting excess electrons into
(90 °C) prior to loading on the gel. For densitometric analysis the nucleobase stack,18 a process that should be energetically
a series of known amounts of the starting material and the very similar to the injection of an excess electron into the thymi-
single-stranded 24 nt DNA product were loaded on the gel dine part of the crosslink.19,4,8b From the injection energetics
(Fig. 2).
one would expect that at least 3 eV, or light with λ ≤ 410 nm, are
Upon irradiation at 350 20 nm PNA 9 carrying the bare required: ≈2 eV for the reduction of the crosslink, ≥0.5 eV
pyrene chromophore quickly opens the crosslinked DNA in for- driving force to overcome the reorganizational energy and
mation of the expected 24 nt single-stranded DNA product. ≥0.5 eV for the oxidation of the charge donor.5 However, it is
From the densitometric analysis the half-life for the formation unclear why the uracil-conjugated pyrene chromophore in PNA
10 fails as it was demonstrated before that U-pyrene quickly
undergoes charge separation (U−–pyr+) upon photoexcitation.9 By
transient absorbance spectroscopy it was further shown that the
excess electrons from the uridine base can travel into the nucleo-
base stack.15,20 However, it is difficult to assess from such spec-
troscopic experiments if the charge-separated state is long-lived
enough to efficiently stimulate crosslink reversal or if a fast
charge recombination will inhibit the repair reaction.
Compared to our previously reported phenothiazine-PNA
(half-life ≈ 26 min at 330 20 nm for the opening of the cross-
linked DNA into the product and a monoadduct)4 the crosslink
reversal with the bare pyrene is notably efficient, and shifted
to a more suitable wavelength. Since photoactivation in bio-
logical but also non-biological settings is routinely performed
with 365 nm light we repeated the irradiation experiment with
the pyrene-PNA 9 at 365 20 nm. Again we observed the for-
mation of the desired single-stranded DNA product, however,
at a reduced rate (half-life = 12.8 1.2 min). The less efficient
opening is in accordance with the lower extinction coefficient
of pyrene at 365 nm compared to 350 nm.
In order to determine the photoactivation efficiency εφ we
directly compared the formation of the single-stranded product
with the liberation of cAMP from a dimethoxy-nitro-benzyl-
caged (DMNB) precursor5 at 350 20 nm under identical set-
tings. From the reported value εφ = 600 M−1 cm−1 and the
measured half-life for the formation of cAMP of 3.5 0.2 min
we can directly estimate εφ for the crosslink reversal by pyrene
PNA 9 to be ≈400 M−1 cm−1. Thus, the reversal of a psoralen
crosslink can be achieved with an efficiency that is reduced but
comparable to that of the classical photocaging group DMNB.
Since up to two pyrene-PNAs need to be taken into account the
quantum yield can be estimated to be in the range of ≈1%.
Fig. 2 Gel assay and kinetic analysis for the photoreversal of cross-
linked DNA 12 with PNAs 9, 10, and 11, or in the absence of PNA at 350
20 nm irradiation. Top: PAGE analysis of the photoreaction. As con-
trols, known amounts (µOD) of both xl24 DNA 12 (upper band) and the
expected ss24 product (lower band) were loaded: A = 2.5 µOD; B = 1.25
µOD; C = 0.63 µOD; D = 0.31 µOD. Bottom: kinetic analysis of the
Conclusions
formed 24 nt single-stranded DNA (lower band). Amounts (µOD) of the
formed ss24 product were determined by comparison with the mean
gray values of reference DNA (controls A–D). Trend lines were obtained
by fitting 1st-order kinetics. The half-life for the crosslink removal with
PNA 9 (line) was determined to be 5.4 0.5 min. The trend line for the
PNA-free experiment is dotted.
In summary, we have established a bare pyrene as a chromo-
phore that can photoactivate psoralen crosslinks with
350–365 nm light with an efficiency similar to that of the
DMNB group. We further reported on a fast synthesis of PNA
probes that were C-terminally modified with different PET
This journal is © The Royal Society of Chemistry 2014
Org. Biomol. Chem., 2014, 12, 5260–5266 | 5263

View Article Online
Paper
Organic & Biomolecular Chemistry
chromophores including a bare pyrene and two uracil–pyrene (20 mL) under an inert gas. Tetrakis(triphenylphosphane)-pal-
conjugated chromophores. Why the latter two are incapable ladium(0) (200 mg = 10 mol%) and sodium hydroxide (1.36 g)
of reversing the crosslink remains elusive. However, they may in water (20 mL) were added. Methanol (20 mL) was added
be useful as hybridization probes or for the assembly of nano- and the mixture was refluxed at 80 °C for 4 h and heated at
materials.9,21 Similar strategies that mimic photolyase-like 60 °C overnight. Solvents were removed, and the residue was
activity may also be useful to reverse other crosslinks.22
distributed between water and chloroform, Pd was removed by
filtration. The aqueous layer was extracted with chloroform
(3 × 50 mL), acidified to pH < 2 (HCl) and the precipitated
product was taken up in ethylacetate, washed with ammonium
chloride (5%, 3 × 50 mL) and brine, and was dried over
sodium sulphate to obtain 72 mg of the yellow raw product
Experimental section
Pentafluorophenyl 2-(pyren-1-yl)acetate (3)
1
1-Pyrene acetic acid 2 (112 mg, 0.43 mmol) was dissolved in
dry DCM (30 mL), and pyridine (0.10 mL) and pentafluorophe-
nol trifluoroacetate (0.1 mL) were added. After 2 h of stirring at
r.t. DCM was removed, ethyl acetate (50 mL) was added and
extracted with saturated NaHCO3 (3 × 50 mL), brine, and 1%
HCl (3 × 50 mL), and brine, and dried over sodium sulfate.
The product was obtained as a faint yellow residue (180 mg,
0.42 mmol) and was used in PNA synthesis without further
purification. TLC (ethyl acetate): RF (product) = 0.91; RF (free
which was characterized by H-NMR and high resolution mass
analysis. The raw product (16 mg, 43 µmol) was dissolved in
dry DCM (20 mL). Dry pyridine (0.1 mL) and pentafluorophe-
nol trifluoroacetate (0.1 mL) were added. After 2 h of stirring at
r.t. DCM was removed, ethyl acetate (50 mL) was added and
extracted with saturated NaHCO3 (3 × 50 mL), brine, 1% HCl
(3 × 50 mL), and brine, and dried over sodium sulphate to obtain
6 as a yellow solid (10 mg, 19 µmol) that was used in PNA syn-
thesis without further purification. TLC (ethylacetate):
1
1
acid of product) = 0.05; H-NMR (400.2 MHz, CDCl3): δ = 4.59
RF (product) = 0.91; RF (free acid of product) = 0.05; H-NMR
(s, 2H; CH2), 7.90–8.20 (m, 9H; pyrene CH); 13C-NMR
(100.6 MHz, CDCl3, 1H uncoupled, not 19F uncoupled): δ =
38.4 (CH2), 122.5 (CH), 124.6 (CF), 124.9 (CH), 125.1 (CF),
125.4 (CH), 125.6 (CH), 125.7 (C), 126.2 (CH), 127.3 (CH), 127.7
(CH), 128.3 (CH), 128. 5 (CH), 129.5 (CF), 130.7 (CF), 131.2
(CF), 131.3 (CF), 167.5 (CO) ppm, CH could be discriminated
(250.1 MHz, D6-DMSO): free acid: δ = 4.57 (s, 2H; CH2);
7.92–8.35 (m, 10H; H-6, pyrene CH); 13.21 (s br, 1H; COOH);
13C NMR (101 MHz, D6-DMSO): δ = 170.0 (COOH), 163.5 (C-4),
151.3 (C-2), 146.1 (CH, C-6), 131.1 (C), 131.0 (C), 130.7 (C),
129.8 (C), 129.2 (C), 128.6 (CH), 128.0 (CH), 127.7 (CH), 127.7
(CH), 126.8 (CH), 125.8 (CH), 125.6 (CH), 125.4 (C), 125.0 (CH),
124.3 (CH), 124.1 (C), 113.0 (C-5), 49.2 (CH2); HR-ESI-TOF-MS:
free acid: 369.0881 expected for C22H13N2O4, found 369.0876.
1
from CF via H/13C HSQC, HR-ESI-TOF-MS: 449.0571 expected
for C24H11F5O2Na1, 449.0573 found.
5-Iodo-uracil-N1-acetic acid (4)
Pentafluorophenyl 2-(5-(pyren-1-ylethynyl)uracyl)acetate (8)
5-Iodouracil (5 g, 21 mmol) was suspended in dry DMF
(100 mL) under an inert atmosphere. 1-Bromo-methylacetate
(2.1 mL, 21 mmol) and potassium carbonate (3.1 g, 22 mmol)
were added and the mixture was stirred at r.t. for 14 h. The
solvent was removed, water (150 mL) was added, and pH was
adjusted to 7.0 with HCl. The precipitated product was separ-
ated on a funnel, washed with cold water (500 mL) and dried.
The raw product (2 g, 6.45 mmol) was dissolved in THF
(20 mL). Under stirring at 0 °C, LiOH (0.7 g, 29 mmol) in water
(30 mL) was added and the mixture was stirred for 2 h. The
solution was acidified (<pH 2.0) with HCl at 0 °C and the pre-
cipitate was filtered and was washed with ice-cold 0.1% HCl
solution (2 × 50 mL) and dried to obtain 1.3 g (4.4 mmol) of
product 4 as a white powder. TLC (ethyl acetate–MeOH 9 : 1 +
1% AcOH): RF = 0.35; 1H-NMR (600.13 MHz, D6-DMSO): δ = 4.42
(s, 2H; CH2); 8.22 (s, 1H; H-6); 11.78 (s, 1H; NH); 13.30 (s br,
1H; OH) ppm; 13C-NMR (150.9 MHz, D6-DMSO): δ = 49.4 (CH2);
68.9 (C-5); 151.1 (C-6); 151.6 (C-2); 162.0 (C-4); 170.2 (COOH)
5-Iodo-uracil-N1-acetic acid 4 (0.5 g, 1.7 mmol), 1-ethynyl-
pyrene 7 (0.4 g, 1.7 mmol), tetrakis(triphenyl phosphane)-pal-
ladium(0) (97 mg = 5 mol%), and copper(I)-iodide (32 mg =
10 mol%) were dissolved in dry DMF–Hünig base 10 : 1
(11 mL) under an inert atmosphere. The mixture was stirred
overnight at room temperature. Then the mixture was heated
to 80 °C for 4 h until a black precipitate was formed. Solvents
were removed under high vacuum. The mixture was distribu-
ted between 1% NaOH–water and chloroform, the product was
extracted into the aqueous 1% NaOH layer (3×), the combined
aqueous layers were extracted with chloroform (3 × 50 mL),
and then acidified to pH < 2 (HCl). The precipitate was taken
up in ethyl acetate, washed with 0.1% HCl, brine, dried over
sodium sulfate and reduced to dryness to obtain a yellow raw
product (500 mg). The raw product was suspended in DCM
(20 mL). Dry pyridine (1 mL) and pentafluorophenol trifluoro-
acetate (0.8 mL) were added. After 2 h solvents were removed,
ethyl acetate (50 mL) was added and extracted with saturated
NaHCO3 (3 × 50 mL), brine, 1% HCl (3 × 50 mL), and brine,
and dried over sodium sulfate. Silica gel (5 g) was added and
the solvent was removed. The product was eluted from the
silica gel with ethylacetate–hexane 1 : 1 (300 mL), the solvent
was removed, the product was obtained as a yellow solid and
1
ppm; C–H connectivity was assigned via H/13C-HSCQ; the N1-
regioisomer was clearly assigned via 1H/13C-HMBC; HR-ESI-
TOF-MS: 296.9367 expected for C6H6I1N2O4, 296.9363 found.
Pentafluorophenyl 2-(5-(pyren-1-yl)-uracyl)acetate (6)
5-Iodo-uracil-N1-acetic acid 4 (0.5 g, 1.7 mmol) and pyrene-1- was used in solid phase PNA synthesis without further purifi-
boronic acid 5 (0.42 g, 1.7 mmol) were dissolved in THF cation. TLC (ethylacetate 100%): RF (product) = 0.95; RF (free
5264 | Org. Biomol. Chem., 2014, 12, 5260–5266
This journal is © The Royal Society of Chemistry 2014

View Article Online
Organic & Biomolecular Chemistry
Paper
1
acid of product) = 0.05; H-NMR (250.1 MHz): δ = 4.50 (s, 2H; 10 nm light under stirring in a fluorimeter (75 W xenon arc
CH2); 8.06–8.63 (m, 10H; H-6, pyrene CH); 11.86 (NH) ppm; lamp); after 3 h the same amount of AMT (15 μL) was added
13C-NMR (101 MHz, D6-DMSO): δ = 169.6 (COO), 162.3 (C4), again and the irradiation was continued for further 3 h. The
150.4 (C2), 149.7 (C6), 131.3 (C), 131.1 (C), 130.9 (C), 129.4 (C), raw DNA was precipitated with ethanol/NaOAc dissolved in
129.3 (C), 129.1 (CH), 129.1 (CH), 128.7 (CH), 127.6 (CH), 127.1 180 μL gel loading buffer (1× TBE, 7 M urea, xylene cyanol and
(CH), 126.3 (CH), 126.3 (CH), 126.0 (C), 125.3 (C), 125.2 (CH), bromophenol blue), heated to 90 °C (3 min) and loaded on a
124.0 (CH), 123.7 (C), 98.8 (C5), 98.1 (ethinyl C), 91.6 (ethinyl 1 mm 15% denaturating (7 M urea) PAGE mini gel. The gel
C), 49.4 (CH2); HR-ESI-TOF-MS: 583.0688 expected for was run at 140 V in 1× TBE buffer for 120 min. The crosslinked
C30H13F5N2O4Na1: 583.0687 found.
species run a little bit faster than the xylene cyanol band while
the single-stranded starting material runs slightly slower than
the bromophenol blue band. The crosslinked species was cut
Solid phase PNA synthesis
Synthesis was performed for each PNA (9–11) on a 3 µmol out of the gel without staining or UV shadowing only by its
scale on TG-RR Rink amide resin (Novabiochem) preloaded relative position to the xylene cyanol band since 254 nm light
with Fmoc–Lys(Boc)–Lys(Boc) to 150 µmol g−1 resin. Fmoc– reverses the crosslink. The crosslinked species 12 was extracted
Dpr(Mtt)–OH was coupled via the HBTU/HOBt activation pro- from the gel by the crush and soak method into pure water
tocol with 12 µmol Dpr and 11.5 µmol HBTU. After coupling of and was concentrated by ethanol–NaOAc precipitation. The
the Dpr residue, the Fmoc group was retained and the Mtt final product was dissolved in 200 µL water resulting in an
group was removed by dropping (1 mL min−1) 15 mL 0.5% TFA OD260 nm = 13.5 giving an overall yield of 2.7 OD [17%].
in DCM–hexafluoro-2-propanol (2 : 1) over the resin. The resin
was washed with DCM and NMP and prior to coupling of the
Irradiation experiments
pyrene chromophores, the resin was treated with 2% Hünig
Irradiation was performed on a QuantaMaster 7 (Photon Tech-
base–DMF. Pyrene chromophores were coupled by incubation
nology International) fluorescence spectrometer, equipped
with excitation/emission monochromators, with
of the resin with ≥12 µmol of either 3, 6, or 8 in 120 µL dry
a peltier
DMF overnight. Uncoupled amino groups were capped with
acetic acid anhydride (8% in DMF–Hünig base 10 : 1). Syn-
thesis of the PNA was continued after Fmoc removal of the Dpr
residue following the HATU/HOAt protocol described
earlier.4,16 The finished PNAs were released from the resin by
dropping 5% triisopropylsilane in TFA (20 mL) over the resin.
PNAs were purified on a preparative HPLC (Shimadzu LC20;
linear gradients of eluent A (0.1% TFA–water) and eluent B
(0.05% TFA in 90% acetonitrile) using a Macherey–Nagel
Nucleodur column VP250/10 100-5 C18sec). PNA-sequences:
PNA 9: H-Lys–ctgctcgcc–Dpr(β-pyrene 3)–Lys–Lys–NH: UV:
ε (mM−1 cm−1) = 90 (260 nm), 21 (334 nm), 29 (350 nm),
element to control the sample temperature, and automatic
shutters to control the irradiation time. The 24 nt crosslinked
DNA substrate was diluted in 55 µL 10 mM sodium phosphate,
100 mM NaCl, and pH 7.0 buffer to a final OD260 nm = 0.5 (≈1
µM). Prior to irradiation, the respective PNAs 9–11 were
obtained from 40–50× stock solutions to achieve a final
OD260 nm = 0.35–0.4 (≈4 µM). At various time points (0, 2.5,
5.0, 10, 20, 40, and 80 min), samples (5.0 µL) were taken and
subjected to a 15% (7.5 M urea) PAGE (19 : 1), 1× TBE. Prior to
loading, 10 µL of loading buffer (TBE 1×, 7 M urea, 1.5 vol%
37% formaldehyde in water, cyanol blue dye) were added and
then heated to 90 °C for 5 min. To determine the amounts of
product and starting material densitometrically a dilution
series of starting material 12 and the desired 24 nt ssDNA
product was load on the gel (each 2.5 µOD, each 1.25 µOD,
each 12.5 µOD, and each 0.31 µOD). After running the gel in
TBE 1×, the gel was stained with SybrGold (Invitrogen) for
10 min in 1× TBE–acetic acid pH 7.8. The gel was documented
on a gel Laser scanner (Fujifilm FLA 5100).
2.0 (365 nm); MS: 775.8475 expected for [M
133H178N56O34, found: 775.8490; PNA 10: H-Lys–ctgctcgcc–
+
4H]4+:
C
Dpr(β-pyrene 6)–Lys–Lys–NH: UV: ε (mM−1 cm−1) = 100
(260 nm), 26 (350 nm), 12 (365 nm); MS: 803.3504 expected for
[M + 4H]4+: C137H180N58O36, found: 803.3518; PNA 11: H-Lys–
ctgctcgcc–Dpr(β-pyrene 8)–Lys–Lys–NH: UV: ε (mM−1 cm−1) =
100 (260 nm), 20 (365 nm), 36 (400 nm), 25 (430 nm);
MS: 809.3504 expected for [M
+
4H]4+: C137H180N58O36,
found: 809.3513. Extinction coefficients used for PNA:
t (8.4 mM−1 cm−1), a (15.2 mM−1 cm−1), c (7.05 mM−1 cm−1),
g (12.0 mM−1 cm−1).
Acknowledgements
Synthesis of the 24 + 24 nt crosslinked DNA
We thank the DFG (STA 1053/3-1), the Fonds der Chemischen
Industrie and the University of Tübingen for generous finan-
cial support.
The self-pairing 24 nt ssDNA (Microsynth, Switzerland, HPLC
purified, 5′-d(pGGAACAGCAGCCTAGGCGAGCAGG), 15.5 OD,
ε ≈ 250 mM−1 cm−1, ≈62 nmol) was dissolved in 1.5 mL buffer
(50 mM Tris/HCl, 10 mM MgCl2, 100 mM NaCl, 1 mM EDTA,
15 mM NaN3, pH 7.5) and purged with argon gas. Then amino-
methyltrisoralen hydrochloride 1 (15 µL of 19 mM in DMSO,
ca. 15 equiv. per duplex) was added. The solution was cooled
down from 70 °C to 4 °C and irradiated at 4 °C with 340
Notes and references
1 G. D. Cimino, H. B. Gamper, S. T. Isaacs and J. E. Hearst,
Annu. Rev. Biochem., 1985, 54, 1151.
This journal is © The Royal Society of Chemistry 2014
Org. Biomol. Chem., 2014, 12, 5260–5266 | 5265

View Article Online
Paper
Organic & Biomolecular Chemistry
2 P. A. Muniandy, J. Liu, A. Majumdar, S.-T. Liu and 12 (a) M. Egholm, O. Buchardt, L. Christensen, C. Behrens,
M. M. Seidman, Crit. Rev. Biochem. Mol. Biol., 2010,
45, 23.
3 (a) W. A. Saffran, M. Goldenberg and C. R. Cantor, Proc.
Natl. Acad. Sci. U. S. A., 1982, 79, 4594; (b) M. Raha,
G. Wang, M. M. Seidman and P. M. Glazer, Proc. Natl. Acad.
Sci. U. S. A., 1996, 93, 2941; (c) G. Wang, D. D. Levy,
S. M. Freier, D. A. Driver, R. H. Berg, S. K. Kim, B. Norden
and P. E. Nielsen, Nature, 1993, 365, 566; (b) P. Wittung,
P. E. Nielsen, O. Burchardt, M. Egholm and B. Norden,
Nature, 1994, 368, 561; (c) For an overview see: Pseudo-
Peptides in Drug Discovery, ed. P. E. Nielsen, Wiley-VCH,
Weinheim, 2004.
M. M. Seidman and P. M. Glazer, Mol. Cell. Biol., 1995, 13 (a) S. Rapireddy, R. Bahal and D. H. Ly, Biochemistry, 2011,
15, 1759; (d) A. Majumdar, A. Khorlin, N. Dyatkina,
F.-L. M. Lin, J. Powell, J. Liu, Z. Fei, Y. Khripine,
K. A. Watanabe, J. George, P. M. Glazer and
50, 3913–3918; (b) J. I. Yeh, B. Shivachev, S. Rapireddy,
M. J. Crawford, R. R. Gil, S. Du, M. Madrid and D. H. Ly,
J. Am. Chem. Soc., 2010, 132, 10717–10727.
M. M. Seidman, Nat. Genet., 1998, 20, 212; (e) K.-H. Kim, 14 (a) O. Buchardt, et al., J. Org. Chem., 1994, 59, 5767–5773;
P. E. Nielsen and P. M. Glazer, Biochemistry, 2006, 45, 314;
(f) A. K. Thazhathveetil, S.-T. Liu, F. E. Indig and
(b) G. Qu, Z. Zhang, H. Guo, M. Geng and R. Xia, Molecules,
2007, 12, 543–551.
M. M. Seidman, Bioconjugate Chem., 2007, 18, 431; 15 (a) N. Amann, E. Pandurski, T. Fiebig and H.-A. Wagenknecht,
(g) K.-H. Kim, P. E. Nielsen and P. M. Glazer, Nucleic Acids
Res., 2007, 35, 7604.
4 T. Stafforst and D. Hilvert, Angew. Chem., Int. Ed., 2011, 50,
9483–9486.
5 T. Stafforst and J. M. Stadler, Angew. Chem., Int. Ed., 2013,
52, 12448–12451.
6 (a) A. Sancar, Chem. Rev., 2003, 103, 2203–2237;
Chem. – Eur. J., 2002, 8, 4877–4883; (b) N. Amann,
E. Pandurski, T. Fiebig and H.-A. Wagenknecht, Angew.
Chem., Int. Ed., 2002, 41, 2978–2980.
16 T. Stafforst and U. Diederichsen, Eur. J. Org. Chem., 2007,
681.
17 S. T. Isaacs, C.-K. J. Shen, J. E. Hearst and H. Rapoport, Bio-
chemistry, 1977, 16, 1058.
(b) A. Mees, T. Klar, P. Gnau, U. Hennecke, A. P. M. Eker, 18 (a) S. T. Gaballah, G. Collier and T. L. Netzel, J. Phys. Chem.
T. Carell and L.-O. Essen, Science, 2004, 306, 1789–1793.
7 K. Siriwong and A. A. Voityuk, WIREs Comput. Mol. Sci.,
2012, 2, 780–794.
B, 2005, 109, 12175–12181; (b) S. T. Gaballah,
Y. H. A. Hussein, N. Anderson, T. T. Lian and T. L. Netzel,
J. Phys. Chem. A, 2005, 109, 10832–10845.
8 (a) T. Stafforst and U. Diederichsen, Chem. Commun., 2005, 19 (a) M. P. Scannell, G. Prakash and D. E. Falvey, J. Phys.
3430–3432; (b) T. Stafforst and U. Diederichsen, Angew.
Chem., Int. Ed., 2006, 45, 5376–5380; (c) S. Breeger,
Chem. A, 1997, 101, 4332–4337; (b) S. Yeh and D. E. Falvey,
J. Am. Chem. Soc., 1991, 113, 8557–8558.
M. v. Meltzer, U. Hennecke and T. Carell, Chem. – Eur. J., 20 M. Raytchev, E. Mayer, N. Amann and H.-A. Wagenknecht,
2006, 12, 6469–6477. ChemPhysChem, 2004, 5, 706–712.
9 (a) A. Okamoto, A. Kanatani and I. Saito, J. Am. Chem. Soc., 21 (a) S. Sezi and H.-A. Wagenknecht, Chem. Commun.,
2004, 126, 4820–4827; (b) J. Telser, K. A. Cruckshank,
L. E. Morrison and T. L. Netzel, J. Am. Chem. Soc., 1989,
111, 6966–6976; (c) R. Kierzek, Y. Li, D. H. Turner and
P. C. Bevilacqua, J. Am. Chem. Soc., 1993, 115, 4985–4992;
(d) S. M. Langenegger and R. Haner, Chem. Commun., 2004,
2792–2793; (e) K. Yamana, H. Zako, K. Asazuma, R. Iwase,
H. Nakano and A. Murakami, Angew. Chem., Int. Ed., 2001,
40, 1104–1106; (f) M. Manoharan, K. L. Tivel, M. Zhao,
2013, 49, 9257–9259; (b) C. Boonlua, C. Vilaivan,
H.-A. Wagenknecht and T. Vilaivan, Chem. – Asian J., 2011,
6, 3251–3259; (c) J. Barbaric and H.-A. Wagenknecht, Org.
Biomol. Chem., 2006, 4, 2088–2090; (d) E. Mayer-Enthart
and H.-A. Wagenknecht, Angew. Chem., Int. Ed., 2006, 45,
3372–3375; (e) E. Mayer, L. Valis, C. Wagner, M. Rist,
N. Amann and H.-A. Wagenknecht, ChemBioChem, 2004, 5,
865–868.
K. Nafisi and T. L. Netzel, J. Phys. Chem., 1995, 99, 17461– 22 (a) M. M. Haque, H. Sun, S. Liu, Y. Wang and X. Peng, Angew.
17472; (g) M. Nakamura, Y. Fukunaga, K. Sasa, Y. Ohtoshi,
K. Kanaori, H. Hayashi, H. Nakano and K. Yamana, Nucleic
Acids Res., 2005, 33, 5887–5895.
Chem. Int. Ed., 2014, 53, DOI: 0.1002/anie.201310609;
(b) A. Shigeno, T. Sakamoto, Y. Yoshimuraa and K. Fujimoto,
Org. Biomol. Chem., 2012, 10, 7820–7825; (c) L. L. G. Carrette,
E. Gyssels, J. Loncke and A. Madder, Org. Biomol. Chem.,
2014, 12, 931–935; (d) S. Hentschel, J. Alzeer, T. Angelov,
O. D. Schärer and N. W. Luedtke, Angew. Chem. Int. Ed., 2012,
51, 3466–3469.
10 T. L. Netzel, M. Zhao, K. Nafisi, J. Headrick, M. S. Sigman
and B. E. Eaton, J. Am. Chem. Soc., 1995, 117, 9119–9128.
11 M. Rist, N. Amann and H.-A. Wagenknecht, Eur. J. Org.
Chem., 2003, 2498–2504.
5266 | Org. Biomol. Chem., 2014, 12, 5260–5266
This journal is © The Royal Society of Chemistry 2014