Bioisosteric replacement of an acylureido moiety attached to an indolin-2-one scaffold with a malonamido or a 2/4-pyridinoylamido moiety produces a selectively potent Aurora-B inhibitor

Article abstract of DOI:10.1016/j.ejmech.2014.07.033

Bioisosteric replacement of acylureido moiety in 6-acylureido-3- pyrrolylmethylidene-2-oxoindoline derivatives resulted in a series of malonamido derivatives with indolin-2-one scaffold (11-14). Further conformational restrictions of the malonamido moiety led to 2-oxo-1,2-dihydropyridine (21-25) or a 4-oxo-1,4-dihydropyridine derivatives (31-36). 4-Oxo-1,4-dihydropyridine derivatives were more potent Aurora B inhibitors than their 2-oxo-1,2- dihydropyridine counterparts and demonstrated cytotoxicities against A549 and HepG2 cells in the submicromolar range. In A549 cells, 31h decreased phosphorylation of histone H3, triggered polyploidy, induced expression of pro-apoptotic Fas and FasL with subsequent activation of caspase 8, resulting into apoptosis. In a Huh7-xenograft mouse model, 31h demonstrated potent in vivo efficacy with a daily dose of 5 mg/kg.

Full text of DOI:10.1016/j.ejmech.2014.07.033

European Journal of Medicinal Chemistry 84 (2014) 312e334
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Original article
Bioisosteric replacement of an acylureido moiety attached to an
indolin-2-one scaffold with a malonamido or a 2/4-pyridinoylamido
moiety produces a selectively potent Aurora-B inhibitor
,
,
Hsiao-Chun Wang a 1, Ajit Dhananjay Jagtap a 1, Pei-Teh Chang a, Jia-Rong Liu a,
Chih-Peng Liu b, Hsiang-Wen Tseng b, Grace Shiahuy Chen c **, Ji-Wang Chern a
,
, d, *
a School of Pharmacy and Center for Innovative Therapeutics Discovery, National Taiwan University, No. 33, LinSen South Road, Taipei 10051, Taiwan
b Biomedical Engineering Research Laboratories, Industrial Technology Research Institute, No. 321, Section 2, Guangfu Road, Hsinchu 30011, Taiwan
c Department of Applied Chemistry, Providence University, No. 200, Section 7, Taiwan Boulevard, Taichung 43301, Taiwan
d Department of Life Science, College of Life Science, National Taiwan University, No. 1, Section 4, Roosevelt Road, Taipei 10617, Taiwan
a r t i c l e i n f o
a b s t r a c t
Article history:
Bioisosteric replacement of acylureido moiety in 6-acylureido-3-pyrrolylmethylidene-2-oxoindoline
derivatives resulted in a series of malonamido derivatives with indolin-2-one scaffold (11e14). Further
conformational restrictions of the malonamido moiety led to 2-oxo-1,2-dihydropyridine (21e25) or a 4-
oxo-1,4-dihydropyridine derivatives (31e36). 4-Oxo-1,4-dihydropyridine derivatives were more potent
Aurora B inhibitors than their 2-oxo-1,2-dihydropyridine counterparts and demonstrated cytotoxicities
against A549 and HepG2 cells in the submicromolar range. In A549 cells, 31h decreased phosphorylation
of histone H3, triggered polyploidy, induced expression of pro-apoptotic Fas and FasL with subsequent
activation of caspase 8, resulting into apoptosis. In a Huh7-xenograft mouse model, 31h demonstrated
potent in vivo efficacy with a daily dose of 5 mg/kg.
Received 5 May 2014
Received in revised form
8 July 2014
Accepted 10 July 2014
Available online 10 July 2014
Keywords:
Aurora B
Kinase inhibitor
Indolin-2-one
Anticancer
© 2014 Elsevier Masson SAS. All rights reserved.
Structureeactivity relationship
1. Introduction
Abbreviations: FasL, Fas ligand; TEA, triethylamine; VEGFR, vascular endothelial
growth factor; PDGFR, platelet-derived growth factor receptor; c-Met, MNNG HOS-
transforming gene; Flt-3, Faline McDonough Sarcoma like tyrosine kinase 3; CHK1,
checkpoint kinase 1; EGFR, epithelial growth factor receptor; Her2, human
epidermal growth factor receptor 2; FGFR1, fibroblast growth factor receptor 1; IGF-
1R, insulin-like growth factor-1 receptor; JAK2, Janus-associated kinase 2; JNK2, c-
Jun N-terminal kinase 2; Lck, lymphocyte-specific protein tyrosine kinase; mTOR,
mammalian target of rapamycin; Plk1, polo-like kinase 1; ROCK1, Rho-associated,
coiled-coil-containing protein kinase 1; Tie-2, angiopoietin receptor 2; SAR, struc-
tureeactivity relationships; HH3, histone H3; Bid, BH3 Interacting Domain; SCID,
Severe combined immune deficiency; EDCI, 1-Ethyl-3-(3-dimethylaminopropyl)
carbodiimide; DMF-DMA, N,N-Dimethylformamide dimethyl acetal; DMAP, 4-
Dimethylaminopyridine; TBTU, O-(Benzotriazol-1-yl)-N,N,N0,N0-tetramethyluro-
nium tetrafluoroborate; PBS, phosphate buffered saline; GF-AFC, glycylphenyla-
Aberrantcell growth is pathological hallmark of cancer. Cell cycle-
signaling pathways and regulators of these pathways have long been
considered the “holy grails” of pharmacological manipulation in
oncology [1]. Various cell-cycle components and regulators,
includingAurora kinases, have beenpursued as targets of anti-cancer
agents [2,3]. Auroras A, B, and C, which are serineethreonine kinases,
are found in different cellular locations and have different functions
during mitosis [4]. Various human cancers, including lung [5], breast
[6], colorectal [7], pancreatic [8], head and neck cancer [9], and he-
patocellular carcinoma [10], exhibit increased expression or gene
amplification of Aurora A. Aurora B is overexpressed in non-small-
cell lung cancer [11], glioblastoma cells [12], oral squamous cell
carcinoma [13,14], and hepatocellular carcinoma [15], and is associ-
ated with poor tumor differentiation [11], lymph-node involvement
[11,13], higher-grade tumor stages [14], poor prognosis, and short-
ened patient survival [15], Recent studies revealed that pharmaco-
logical targeting of Aurora A or both Aurora A and B produces a
phenotype similar to that of Aurora-B alone [16,17], suggesting that
inhibition of only Aurora B may provide antitumor activity.
lanyl-aminofluorocoumarin;
bis-AAF-R110,
bis-alanylalanyl-phenylalanyl-
rhodamine 110; DEPC, diethylpyrocarbonate; TGI, tumor-growth inhibition.
* Corresponding author. School of Pharmacy and Center for Innovative Thera-
peutics Discovery, National Taiwan University, No. 33, LinSen South Road, Taipei
10051, Taiwan.
** Corresponding author.
E-mail addresses: grace@pu.edu.tw (G.S. Chen), jwchern@ntu.edu.tw
(J.-W. Chern).
1
H.-C. Wang and A.D. Jagtap equally contributed to this work.
http://dx.doi.org/10.1016/j.ejmech.2014.07.033
0223-5234/© 2014 Elsevier Masson SAS. All rights reserved.

H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
313
Indolin-2-one is a kinase-privileged scaffold [18e21] and is
found in certain Aurora B inhibitors exemplified by the specific
Aurora-B inhibitor hesperadin (1) [22] and the multi-kinase in-
hibitor SU6668 (2) [23], which has been reported to be Aurora-A
and -B inhibitor (Fig. 1). Moreover, 5-benzenesulfonamidoindolin-
2-one derivatives bearing a 40-oxo-40,50,60,70-tetrahydroindole-type
moiety at the position C-3, as exemplified by 3a and 3b, have been
reported to be Aurora inhibitors [24].
We have shown that 6-arylureido- [25] and 6-
acylureidoindoiln-2-one [26] derivatives are multi-kinase in-
hibitors. Among them, 4 and 5 are potent Aurora-B inhibitors. A
perusal of the literature revealed that the acylureido moiety acts as
a bioisosteric surrogates of malonamide [27] and 2/4-oxo-1,2-
dihydropyridine [28]. In this report, we designed and synthesized
a series of compounds by replacing the acylureido moiety with a
malonamido or 2/4-oxo-1,2-dihydropyridine moiety to assess their
potential as Aurora-B inhibitors (Fig. 2).
intramolecular cyclization provided the corresponding pyridone
esters, which, without purification, were saponified by 10% (w/w)
NaOH(aq) to give the corresponding pyridone carboxylic acids
16aeg in 18e65% yields. Pyridone carboxylic acid 16h was obtained
by methylation of 2-hydroxynicotinic acid using methyl iodide [34].
Similarly, 16i was synthesized by alkylation of methyl 2-
hydroxynicotinate using 2-bromoethanol. Amidation of 1-(4-
fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylic acid (16a)
with 4-, 6-, or 7-aminoindolin-2-one afforded the corresponding 1-
(4-fluorophenyl)-2-pyridinoylamidoindolin-2-ones 17, 19, and 20a,
respectively, in excellent yields. Compound 16a was reacted with
thionyl chloride to give the corresponding acid chloride, which was
reacted with 5-aminoindolin-2-one to obtain 1-(4-fluorophenyl)-
2-pyridinoylamidoindolin-2-one 18. Aldol condensation of 17, 18,
19, and 20a with pyrrole-2-carboxaldehyde afforded 21, 22, 23, and
24a, respectively. Similarly, the 2-oxo-1,2-dihydropyridine-3-
carboxylic acids 16bei were each reacted with 6-aminoindolin-2-
one to yield the corresponding 2-pyridinoylamidoindolin-2-ones
20bei, which then underwent aldol condensations with various
pyrrole-2-carbaldehydes to afford 24aei. Similarly, condensation of
20a and 20h with 3,5-dimethyl-4-hydroxycarbonyl-1H-pyrrole-2-
carboxaldehyde afforded 25a and 25h, respectively.
2. Results and discussion
2.1. Chemistry
Reaction of substituted arylacetyl chlorides 26aeh and Mel-
The syntheses of compounds with a malonamido (11e13) or a
spirocyclopropylmalonamido (14) moietyare illustrated in Scheme 1.
Reaction of 4-fluoro (6a) and 4-methoxy (6b) substituted anilines
and ethyl 3-chloro-3-oxopropanoate in the presence of TEA followed
by saponification using 10% (w/w) NaOH(aq) afforded 7a [29,30] and
7b [31] in 75 and 66% yields, respectively. Similarly, 6a and 6b were
reacted with 1-(chlorocarbonyl)cyclopropane carboxylic acid, which
was prepared by reaction of cyclopropane-1,1-dicarboxylic acid with
thionyl chloride in situ prior to addition of6a or6b, to give 8a [32] and
8b [33] in 70 and 82% yields, respectively. Amidation of 7a/b and 8a/b
with 6-aminoindolin-2-one afforded the corresponding malona-
mido/cyclopropylmalonamidoindolin-2-ones 9a/b and 10a/b,
respectively. Aldol condensation of 9a/b and 10a/b with substituted
pyrrole-2-carbaldehydes in the presence of a catalytic amount of
pyrrolidine afforded 11a/b, 12, 13, and 14a/b.
drum's acid afforded the corresponding aryl-
which were then cyclized to the respective ethyl 5-aryl-4-oxo-1,4-
dihydropyridine-3-carboxylates by N,N-dimethylformamide
b-keto esters 27aeh,
dimethyl acetal and ammonium acetate (Scheme 3). The resultant
ethyl esters were hydrolyzed to give the corresponding 5-aryl-4-
oxo-1,4-dihydropyridine-3-carboxylic acids 29aeh. Ethyl 3-
oxopentanoate (28) was cyclized by s-triazine in the presence of
sodium ethoxide to give 29i [35]. Compounds 29aei were coupled
with 6-aminoindolin-2-one to form the carboxamides 30aei,
which were then subjected to aldol condensation with various
pyrrole aldehydes to provide 31e36.
2.2. Biology
To improve the Aurora-B-binding affinities of the malonamido
derivatives, the number of rotatable bonds was reduced by
replacing the malonamido groups with 2-oxo-1,2-dihydropyridine
groups as depicted in Scheme 2. Condensation of substituted ani-
lines 6aeg with methyl 2-oxo-2H-pyran-3-carboxylate followed by
2.2.1. Structureeactivity relationships
The synthesized compounds were first screened for their in vitro
enzymatic inhibitory activities against Auroras A/B/C, VEGFR-2,
PDGFRa/b, c-Met, and Flt-3 using a radioisotope-based P81 filter-
binding assay. The IC50 values were determined for those
Fig. 1. Indolin-2-one-based Aurora-B inhibitors.

314
H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
Fig. 2. Replacement of the acylurea linker with N3-malonamide, 2-oxo-1,2-dihydropyridine, or 4-oxo-1,4-dihydropyridine.
Scheme 1. Syntheses of the N3-Malolnamide Compounds 11e14a.
compounds with percentage enzyme inhibition >60% at a con-
centration of 1 M. The effects of these compounds on cell viability
(IC50, 176.7 nM). Compound 12, bearing 30,50-dimethyl and 40-
carboxylate moieties on the pyrrole ring, has a six-fold increase in
Aurora-B inhibitoryactivity (IC50, 5.9 nM) anda three-fold increase in
Flt-3 inhibitory activity (IC50, 6.4 nM) relative to 11b. Additionally,12
m
were evaluated using A549 and HepG2 cells due to their high levels
of Aurora B [15,36].
Initially, the SARs of the N3-arylmalonamido compounds 11a/b,
12, 13, and 14a/b were explored (Table 1). Compound 11a with an 3-
N3-(4-fluorophenyl)malonamido group and a 5-pyrrolemethylidene
moiety on indolin-2-one has an inhibitory activity profile against
showed a good inhibitory profile against Aurora A, Aurora C, PDGFR
a,
PDGFR , and c-Met (IC50, 203.0, 153.5 < 1.0, 8.1, and 31.1 nM,
b
respectively). Although 13, the amide analog of 12 with an N-(2-
(pyrrolidin-1-yl)ethyl)acetamide group at the C-40 position of pyr-
Aurora B, Aurora C, PDGFR
a
and
b, and Flt-3 (IC50, 25.0, 67.2, 7.2, 86.9,
role ring as in compound 5, showed potent activity against PDGFR
a
and 11.0 nM, respectively). Compound 11b with 4-methoxy substit-
uent on the phenyl ring had IC50 values of 29.6 and 16.6 nM against
Aurora B and Flt-3, respectively, values similar to those of 11a.
and , VEGFR-2, Flt-3, and c-Met (IC50, <1.0, 1.54, 20.7, 2.1, and
b
10.6 nM, respectively), its activity against Aurora B (IC50, 93.0 nM)
decreased 15-fold in comparison with that of 12b. In the case of the
sterically hindered spirocyclopropylmalonamide analogs 14a and
However, the activity of 11b against PDGFRb decreased by two-folds

H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
315
Scheme 2. Syntheses of Compounds 21e25a.
14b, they preferentially inhibited Aurora-B activity (IC50, 252.6 and
347.0 nM, respectively) in comparison with their effects on the ac-
tivities of the other kinases (Table 1). However, the Aurora B inhibi-
tory activities of 14a and 14b decreased more than 10-fold relative to
those of 11a and 11b. Thus, the malonamide group was conforma-
tionally constrained by 2-oxo-1,2-dihydropyridine as in compounds
21e25 (Table 2) or by 4-oxo-1,4-dihydropyridine in 31e36 (Table 3)
in order to investigate whether the binding affinity could be
improved by reducing the number of rotatable bonds.
Taking 11a as the lead compound, compounds 21e24a with a N-
(4-fluorophenyl)pyridinonylamido substituent at the positions 4, 5,
7, or 6 of the indolin-2-one scaffold, respectively, were prepared.
Compounds 21e23 did not show Aurora B inhibitory activity
(Table 2). Compound 24a demonstrated weak inhibition against
Aurora B (IC50, 791.1 nM) and VEGFR-2 (56% inhibition at 1 M) but
m
was highly potent against Flt-3 (IC50, 8.6 nM) (Data for VEGFR-2 and
Flt-3 not shown). These results highlight the importance of the
orientation and conformation of the indolin-2-one substituent for
kinase inhibition. Thus, further study was focused on the C6
substituted indolin-2-one derivatives.
To investigate the substituent effects of phenyl ring in 24a (4-
FPh) on Aurora B inhibition, compounds 24beg were prepared.
Interestingly, 24c (IC50, 87.4 nM) with an unsubstituted phenyl ring
showed a 10-fold better inhibition against Aurora B compared to
24a. Compounds 24b (4-OCH3Ph, IC50, 209.3 nM) and 24d (4-
CH3Ph, IC50, 209.4 nM), each with an electron-donating group,
also had improved Aurora B inhibitory activities. Conversely, 24e
(percentage inhibition &10% at 1
mM) and poor cytotoxicity

316
H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
Scheme 3. Syntheses of Compounds 29e34a.
(4-ClPh) and 24f (4-CF3Ph), each with an electron-withdrawing
group, showed weak inhibition against Aurora B (z50% inhibition
at 1 mM). The inhibitory activity of 24g (3-ClPh; IC50, 250.6 nM)
IC50, 63.2 nM), 31e (4-ClPh; IC50, 53.8 nM), and 31h (4-FPh; IC50,
25.5 nM) were potent Aurora-B inhibitors. N-Methyl substituted 31i
also exhibited potent Aurora B inhibitory activity with an IC50 value
of 29.2 nM. Notably, the Aurora B inhibitory potencies of 4-oxo-1,4-
dihydropyridine derivatives 31aeh are reflected in their cytotox-
icities with IC50 values in the submicromolar range against A549
and HepG2 cells. Among them, 31e was the most potent compound
mirrored those of 24c and 24d. N-Alkyl substituted derivatives 24h
(Me) and 24i (HOEt) had improved Aurora B inhibitory activity,
with IC50 values of 102.2 and 32.5 nM, respectively. In this series of
compounds, only 24a was moderately cytotoxic against A549 and
HepG2 cells (Table 2) while other N-substituted-pyridinonylamido
compounds 24bei showed weak cytotoxicity.
To our surprise, an introduction of 3,5-diCH3 and 4-CO2H groups
on the pyrrole ring of 24a and 24h resulted in 25a and 25h,
respectively, which dramatically improved Aurora B inhibitory ac-
tivity. Compound 25a and 25h effectively inhibited Aurora B with
IC50 values of 10.7 and 14.3 nM, respectively. However, their
inhibitory activities did not translate to cytotoxicity (Table 2).
By employing scaffold hopping strategies, derivatives 31e36,
each with a 4-oxo-1,4-dihydropyridine group, were prepared for
SAR study. Overall, this series of compounds possessed higher
with IC50 value <0.1
showed weak cytotoxicities against HepG2 and A549 cells (IC50
values of 3.1 and 5.5 M, respectively), even though it has potent
mM against A549 cells. Unexpectedly, 31i
m
Aurora B inhibitory activity.
Again, an introduction of 3,5-diCH3 and 4-CO2H groups on the
pyrrole ring of 31c resulted in 32, which improved Aurora B
inhibitory activity. Compound 32 effectively inhibited Aurora B
with IC50 value of 4.5 nM. However, 32 was not cytotoxic
(IC50 > 10 mM) to A549 and HepG2 cells. This discrepancy may arise
owing to solubility limits that prohibit diffusion of 32 across the cell
membrane [37]. Thus, amide derivatives 33e36 were investigated.
Although the N-methylpiperazino analogs 33 and 34 possessed
moderate Aurora-B inhibitory activities, both derivatives improved
Aurora
B inhibitory potency in comparison to 2-oxo-1,2-
dihydropyridine derivatives (Table 3). Among them, 31b (4-
OCH3Ph; IC50, 10.2 nM), 31c (Ph; IC50, 33.1 nM), 31d (4-CH3Ph;
cytotoxicities with IC50 values of z0.6 mM against A549 and HepG2

H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
317
Table 1
Kinase inhibitory activities and cytotoxicities of malonamido- and spirocyclopropylmalonamido-substituted indolin-2-one derivatives 11e14.
a
b
Compound
Inhibition of kinase activity IC50 (nM)
Cytotoxicity IC50
A549
(mM)
Aurora A
Aurora B
Aurora C
PDGFR
a
PDGFR
b
VEGFR-2
Flt-3
c-Met
HepG2
11a
11b
12
13
551.9
(24%)c
203
(54%)
(10%)
(4%)
e
25.0
29.6
5.9
93.0
252.6
347.0
e
67.2
7.2
86.9
176.7
8.1
1.54
ND
1771.5
(48%)
(44%)
20.7
ND
11.0
16.6
6.4
(0%)c
(4%)
31.1
10.6
ND
0.7 0.1
3.8 0.5
5.4 0.6
5.4 0.6
0.9 0.1
5.9 1.1
0.1 0.0
1.8 0.0
2.8 0.0
7.8 0.6
5.1 0.6
1.0 0.2
3.9 0.5
0.1 0.0
(31%)
153.5
(50%)
(18%)
(14%)
e
(44%)
<1.0
<1.0
NDd
(34%)
e
2.1
14a
(56%)
(44%)
e
14b
(39%)
e
(27%)
e
(6%)
e
AZD1152e
a
Mean value from two independent doseeresponse curves with a variation <30%.
Mean value S.D. (n > 2).
b
c
Mean value of the percentage enzyme inhibition at 1.0
Not determined.
m
M (n ¼ 2).
d
e
AZD1152-HQPA was used as the reference.
Table 2
2.2.2. Mechanism of cytotoxicity
Kinase inhibitory activities and cytotoxicities of 2-oxo-1,2-dihydropyridine-3-
Compound 31h was selected to investigate if its cytotoxicity was
a consequence of Aurora-B inhibition. The effects of 31h on the
phosphorylation states of Aurora B and HH3 in A549 and HepG2
cells were investigated using a high-throughput dot-blot system.
The results showed that the level of pHH3 was reduced to a similar
amidoindolin-2-one derivatives 21e25.
extent in 10
mM of 31h-treated or AZD1152-treated A549 and
HepG2 cells (Fig. 3). The decreased level of pHH3 reflected the
decreased Aurora-B activity. Moreover, polyploid cells were
observed in 31h-treated A549 cells (Fig. 4), the characteristic
morphological change associated with Aurora-B inhibition [38].
A number of recent studies have suggested that Aurora kinase-
type inhibitors exert their antitumor effects by inducing apoptosis
[39,40]. For 31h, its ability to inhibit cell viability, to act as a cyto-
toxic agent, and to induce apoptosis were assessed by the one-pot,
fluorescent and luminescent ApoTox-Glo Triplex assay. Cell viability
of A549 cells decreased in a concentration-dependent manner after
31h treatment (Fig. 5A). Compound 31h inhibited cell survival to a
greater extent than did AZD1152. Interestingly, 31h induced acti-
vation of caspases in a concentration-dependent manner as re-
flected by cell apoptosis while AZD1152 has less effect (Fig. 5B).
As shown in Fig. 5C and D, compound 31h showed slight effect
on caspase-9 but dramatically triggered caspase-8 activation in a
dose-dependent manner, in accordance with the reported study
that the level of cleaved caspase-8 was increased in Aurora-B in-
hibitor-treated oral squamous-cell carcinoma cell lines [41]. Since
caspase-8 is a downstream effector of the extrinsic apoptotic
pathway triggered by FaseFasL binding, the levels of Fas, FasL, and
Bid (pro-apoptotic protein cleaved by caspase 8) mRNAs were
quantified in A459 cells treated with 31h for 18 h. The mRNA levels
of these proteins were significantly elevated in a dose-dependent
manner (Fig. 6). The increase in the FasL mRNA level correlated
with the increase in its phosphorylated state (Fig. 3). Overall, these
results provide compelling evidence that 31h exerted its cytotox-
icity via inhibition of Aurora B and subsequent induction of the
extrinsic apoptotic pathway.
b
Compound Position
R
Aurora-
Cytotoxicity IC50
(
m
M)
B inhibition
A549
HepG2
a
IC50
(mM)
21
22
23
4
5
7
6
6
6
6
6
6
6
6
6
6
6
e
4-F Ph
4-F Ph
4-F Ph
4-F Ph
4-OMe Ph 209.3
Ph
4-Me Ph
4-Cl Ph
4-CF3 Ph
3-Cl Ph
Me
(CH2)2OH
4-F Ph
Me
(7%)c
(10%)
(10%)
791.1
4.8 0.2
5.4 0.2
4.5 0.4
0.7 0.2
3.3 0.6
4.7 0.2
1.6 0.1
4.9 0.7
3.7 0.3
1.5 0.1
5.9 0.7
4.5 0.4
6.3 0.2
6.6 0.4
0.1 0.0
4.6 0.5
5.4 0.7
3.9 0.4
0.9 0.2
5.6 0.4
5.8 0.2
4.2 0.3
6.7 0.4
3.1 0.5
4.9 0.5
7.0 0.4
3.9 0.4
6.1 0.4
8.1 0.8
0.1 0.0
24a
24b
24c
24d
24e
24f
24g
24h
24i
87.4
209.4
(49%)
(29%)
250.6
102.2
32.5
10.7
14.3
e
25a
25h
AZD1152d
e
a
Mean value from two independent doseeresponse curves with a variation of
<30%.
b
c
Mean value S.D. (n > 2).
Mean value of the percentage enzyme inhibition at 1.0
AZD1152-HQPA was used as the reference.
m
M (n ¼ 2).
d
cells (Table 3). Surprisingly, amide derivative 35 with a morpholine
group resulted in a high Aurora B inhibitory activity with IC50 value
of 2.9 nM. However, the morpholino analogs 35 and 36 displayed a
ten-fold reduction in cytotoxicity.
The expression of Aurora B has been linked to lung and oral
cancer cell invasion of lymph nodes [11,13], and thus the potential

318
H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
Table 3
2.2.4. In vivo antitumor activity
Kinase inhibitory activities and cytotoxicities of 4-oxo-1,4-dihydropyridine-3-
The in vivo efficacy of 31h was examined using a human Huh7
cancer cell, with high Aurora B expression level [42], xenograft
model in SCID mice (Fig. 7). As compound 31h possessed low sol-
ubility at cultural conditions, an oral administration of 31h might
lose its anti-tumor activity due to a poor gastrointestinal absorp-
tion. To evaluate the in vivo activity, in vivo antitumor evaluations of
31h have been carried out through intravenous administration (iv).
Mice were subcutaneously implanted with Huh7 cells in their right
flank and received 31h iv once daily for 14 days. At 2.5 mg/kg, 31h
had inhibited tumor growth by 56 15% by day 9. But uncontrolled
growth resumed thereafter and by the end of the experiment (day
14) inhibition was 38 20%, which was not statistically different
from that observed for the vehicle-control group. The compound
halted tumor growth effectively at a dose of 5 mg/kg by 61 11%
(on day 9). Compound 31h (5 mg/kg, iv, qd) and sorafenib (30 mg/
kg, po, qd) demonstrated similar efficacies by the end of the
experiment. On average, none of the experimental groups' mem-
bers experiences significant weight loss (Fig. 7B).
amidoindolin-2-one derivatives 31e36.
Compound
R
n
R2
Aurora B
Cytotoxicity
inhibition (IC50
,
m
M)b
a
IC50 (nM)
A549
HepG2
31a
31b
31c
31d
31e
31f
31g
31h
31i
32
4-F Ph
4-OMe Ph
Ph
4-Me Ph
4-Cl Ph
4-CF3 Ph
3-Cl Ph
2-F Ph
Me
e
e
e
e
e
e
e
e
e
0
e
e
e
e
e
e
e
e
e
OH
127.6
10.2
33.1
63.2
53.8
348.0
161.4
25.5
29.2
4.5
0.5 0.1 1.4 0.2
0.6 0.1 0.8 0.0
0.5 0.0 1.1 0.1
0.5 0.0 0.7 0.1
<0.1
0.7 0.1
0.5 0.1 0.7 0.0
0.5 0.1 0.6 0.0
0.5 0.1 0.6 0.1
5.5 0.2 3.1 0.4
3. Conclusion
A series of indolin-2-one derivatives substituted with malona-
mido, 2-oxo-1,2-dihydropyridino, and 4-oxo-1,4-dihydropyridino
groups were investigated as Aurora B inhibitors. The SAR results
showed the applicability of substituting a benzoylureido moiety
with a malonamido group or a pyridone as a conformationally
restrictive bioisostere of the malonamido group. The 4-oxo-1,4-
dihydropyridine compounds provide superior inhibition of Aurora
B and are more cytotoxic than are their 2-oxo-1,2-dihydropyridine
counterparts. Compound 31h is one of the most potent Aurora B
inhibitors described herein, and it is a selective Aurora B inhibitor
4-OMe Ph
>10
>10
33
34
35
36
4-F Ph
4-F Ph
4-F Ph
0
1
0
70.5
91.6
2.9
0.6 0.1 0.7 0.1
0.6 0.0 0.7 0.1
5.8 0.3 6.7 0.6
(IC50, 25.5 nM) with weak Flt-3 inhibitory (IC50, 0.1 mM) over a panel
4-F Ph
1
73.9
5.2 0.3 6.7 0.5
0.1 0.0 0.1 0.0
of kinase profiling on other 25 kinases (Table 7). Compound 31h
demonstrated efficacy comparable to that of sorafenib in a SCID
mouse/Huh7-xenograft model.
AZD1152c
e
e
e
e
a
Mean value from two independent doseeresponse curves with a variation of
<30%.
b
c
Mean value S.D. (n > 2).
AZD1152-HQPA was used as the reference.
4. Experimental
4.1. Chemistry
of 24a, 25a, 31a and 31h to halt metastasis was evaluated (Table 4).
All four compounds effectively hampered the cell migration. As to
the, 4-oxo-1,4-dihydropyridine derivatives 31a and 31h also
showed potent anti-invasion while 2-oxo-1,2-dihydropyridine de-
rivatives 24a and 25a were inactive. Among them, 31h was the
All solvents were ACS grade, obtained from Merck, ECHO, or
Mallinckrodt, and were dried using an SP-1 Stand Alone Solvent
Purification System (LC Technology Solutions) to contain water less
than 10 ppm as determined by Karl-Fischer moisture analysis.
Chemicals were purchased from Acros, Aldrich, Alfa Aesar, Carbo-
synth, Matrix, Ryss, or Zealing and used without further purifica-
tion. Flash-column chromatography used Merck Silica gel 60
most potent inhibitor against the cell migration (IC50, 4.1
the cell invasion (IC50, 3.2 M).
mM) and
m
(40e63 m
m). 1H and 13C NMR spectra were obtained with DMSO-d6
2.2.3. Safety and pharmacokinetics
as the internal standard whose central peak assigned as 2.49 ppm
using a Bruker Avance 400- or 200-MHz NMR spectrometer with a
QNP probe. Melting points were determined with a MEL-TEMP
melting-point apparatus and are uncorrected. Mass spectroscopy
was performed using a Bruker Esquire 2000 spectrometer with an
ESI source or a JEOL JMS-700 with a FAB source.
Compound 31h had no effect on the major metabolic cyto-
chrome P450 CYP3A4, CYP2D6, and CYP1A2 activities (Table 5).
However, it showed inhibitory activity against CYP2C9 and
CYP2C19 with IC50 values of 0.04
Compound 31h did not affect hERG binding to its channel at 100
mM and 3.5 mM, respectively.
mM
and was not cytotoxic to Vero cells (data not shown). Further, the
pharmacokinetic properties of 31h were assessed in rats (Table 6).
Plasma samples were collected over a 24-h period after the rats had
received a single intravenous dose of 31h, and the samples were
subjected to LCeESI-MS/MS. The plasma concentration of 31h was
on average 4786.7 ng/mL 5 min after dosing and decreased to
10.0 ng/mL by 24 h. Compound 31h had a fair volume of distribu-
tion (9335.2 1853.2 mL/kg), a long half-life (11.8 3.4 h), and a
4.1.1. General synthetic procedure for compounds 7a and 7b
Ethyl malonyl chloride (1.3 equiv) was added dropwise into a
solution of appropriate aniline (1 equiv) and TEA (1.2 equiv) in DCM
(0.1 M) under ice bath. The mixture was stirred at 0 ꢀC for 4 h and
then quenched by addition of saturated NaHCO3(aq). The crude
product was extracted three times with EtOAc (50 mL). The organic
layers were combined, washed with brine, and dried over anhy-
drous MgSO4. The ethyl ester of 3-((4-fluorophenyl)amino)-3-
oxopropanic acid was obtained after solvent removal in vacuo and
relatively low clearance rate (564.5
130.1 mL/kg/h), which
accounted to less than 0.5% of the cardiac output in the rats.

H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
319
chloride (3.5 mL, 27.3 mmol) in presence of TEA (3.5 mL,
25.0 mmol) afforded compound 7a. Yield: 3.1 g, 75%; mp 174 ꢀC. 1H
NMR (400 MHz, DMSO-d6) d 12.60 (br s, 1H), 10.2 (s, 1H), 7.60e7.56
(m, 2H), 7.16e7.11 (m, 2H), 3.33 (s, 2H).
4.1.1.2. 3-((4-Methoxyphenyl)amino)-3-oxopropanoic acid (7b).
Reaction of p-anisidine (500.0 mg, 4.1 mmol) with ethyl malonyl
chloride (0.7 mL, 5.2 mmol) in presence of TEA (0.7 mL, 4.9 mmol)
afforded compound 7b. Yield: 561.2 mg, 66%; mp 155 ꢀC (lit. [31]
156 ꢀC). 1H NMR (400 MHz, DMSO-d6)
d 12.60 (br s, 1H), 9.98 (s,
1H), 7.47 (d, J ¼ 9.2 Hz, 2H), 6.87 (d, J ¼ 9.2 Hz, 2H), 3.71 (s, 3H), 3.29
(s, 2H).
4.1.2. General synthetic procedure for compounds 8a and 8b
TEA (1 equiv) was added dropwise into a solution of cyclopro-
pane-1,1-dicarboxylic acid (1 equiv) in THF (0.1 M) under ice bath
and then stirred at 0 ꢀC or 15 min, after which SOCl2 (1 equiv) was
added, and the mixture was stirred at 0 ꢀC for another 20 min. Next,
appropriate aniline (1 equiv) in THF (0.1 M) was slowly added. Then,
the reaction mixture was warmed to room temperature and stirred
for 18 h. After that, the mixture was diluted with EtOAc, and the
remaining dicarboxylic acid was neutralized with 10% (w/v) NaO-
Fig. 3. Levels of phosphorylated Aurora B (pAurora B), phosphorylated histone H3
(pHH3), and Fas ligand (FasL) in A549 and HepG2 cells treated with 10 M of 31h or
AZD1152-HQPA for h. pAurora B, pHH3, and FasL were reacted with Thr232-
phosphorylated Aurora-B antibody, Ser10-phosphorylated HH3 antibody, or FasL
antibody, respectively, visualized after incubation with goat anti-rabbit horseradish
peroxidase-linked IgG and reaction with ImmPACT diaminobenzidine, and their
amounts quantified using Un-Scan-It gel software (*, p < 0.05).
m
4
H(aq) (0.5 mL). The reaction mixture was extracted with EtOAc; the
organic layer was washed with water and brine, then concentrated
in vacuo. Solid precipitated by addition of n-heptane was collected
by filtration and dried in vacuo to give appropriate analogs of 8.
was further saponified with 10% (w/v) NaOH in EtOH at reflux for
1.5 h. The reaction mixture was then adjusted to pH 1 by titrating
with 3 N HCl. The precipitate that formed during acid workup was
collected by filtration to give appropriate analogs of 7, which were
used without further purification.
4.1.2.1. 1-((4-Fluorophenyl)carbamoyl)cyclopropanecarboxylic acid
(8a). The reaction of cyclopropane-1,1-dicarboxylic acid (390.0 mg,
3.0mmol)withSOCl2 (0.20 mL,2.9mmol)inpresenceofTEA (0.40 mL,
3.1 mmol) afforded 1-(chlorocarbonyl)cyclopropanecarboxylic acid,
which further on reaction with 4-fluoroaniline (0.30 mL, 3.0 mmol)
gave 8a. Yield: 468.0 mg, 70%; mp 167e170 ꢀC. 1H NMR (400 MHz,
4.1.1.1. 3-((4-Fluorophenyl)amino)-3-oxopropanoic
acid
(7a).
Reaction of 4-fluoroaniline (2.0 mL, 20.8 mmol) with ethyl malonyl
Fig. 4. Effects of 31h and AZD1152 on the cell morphology of A549 cells. Cells were treated with 10 mM of 31h or AZD1152-HQPA for 20 h. Images shown are from at least three
independent experiments, which had similar results.

320
H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
Fig. 5. Effects of 31h and AZD1152-HQPA on cell survival and apoptosis of A549 cells. Cells after treatment with test compounds were assessed for their survival and pan-caspase or
caspase 8/9 activation during apoptosis and by the ApoTox-Glo triplex assay or Caspase-Glo 8(9) assay systems. Cells were incubated with 31h or AZD1152-HQPA for 24 h before
assessing their effects on (A) cell survival, (B) apoptosis, and (C) caspase 9 activation, and (D) caspase 8 activation. Data are expressed as the mean SEM of three independent
determinations. *p < 0.05. Vehicle vs 1 or 10 mM tested compound.
DMSO-d6)
4H).
d
10.57 (s,1H), 7.62e7.59 (m, 2H), 7.15e7.10 (m, 2H),1.40 (s,
4.1.3.1. 1-(4-Fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylic
acid (16a). The reaction of 4-fluoroaniline (0.23 mL, 2.4 mmol)
with methyl 2-oxo-2H-pyran-3-carboxylate (375.0 mg, 2.4 mmol)
in presence of EDCI (465.0 mg, 2.4 mmol) and DMAP (75.0 mg,
0.6 mmol) afforded methyl 1-(4-fluorophenyl)-2-oxo-1,2-
dihydropyridine-3-carboxylate which further on saponification
gave 16a. Yield: 214.0 mg, 38%; mp 218e220 ꢀC. 1H NMR (400 MHz,
4.1.2.2. 1-((4-Methoxyphenyl)carbamoyl)cyclopropanecarboxylic
acid (8b). The reaction of cyclopropane-1,1-dicarboxylic acid
(390.0 mg, 3.0 mmol) with SOCl2 (0.20 mL, 2.9 mmol) in presence of
TEA (0.40 mL, 3.1 mmol) afforded 1-(chlorocarbonyl)cyclo-
propanecarboxylic acid, which further on reaction with p-anisidine
(387.0 mg, 3.1 mmol) gave 8b. Yield: 580.0 mg, 82%; mp
DMSO-d6)
d
8.47 (dd, J ¼ 7.2, 2.0 Hz, 1H), 8.19 (dd, J ¼ 6.8, 2.0 Hz,
1H), 7.59e7.62 (m, 2H), 7.39e7.43 (m, 2H), 6.78 (dd, J ¼ 7.2, 6.8 Hz,
1H).
133e136 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 10.42 (s, 1H), 7.49 (d,
J ¼ 8.8 Hz, 2H), 6.85 (d, J ¼ 8.8 Hz, 2H), 3.71 (s, 3H), 1.40 (s, 4H); 13
C
4.1.3.2. 1-(4-Methoxyphenyl)-2-oxo-1,2-dihydropyridine-3-
carboxylic acid (16b). The reaction of p-anisidine (310.0 mg,
2.5 mmol) with methyl 2-oxo-2H-pyran-3-carboxylate (390.6 mg,
2.5 mmol) in presence of EDCI (484.4 mg, 2.5 mmol) and DMAP
(75.0 mg, 0.6 mmol) afforded methyl 1-(4-methoxyphenyl)-2-oxo-
1,2-dihydropyridine-3-carboxylate which further on saponification
gave 16b. Yield: 270.0 mg, 45%; mp 202e205 ꢀC. 1H NMR (200 MHz,
NMR (100 MHz, DMSO-d6)
d 175.6, 167.8, 156.8, 133.3, 122.2, 115.1,
56.0, 28.9, 17.9 (CH2). MS (ESI), m/z ¼ 233.8 [MꢁH]ꢁ. Anal. calcd. for
C
12H13NO4$0.5H2O: C, 59.01; H, 5.78; N, 5.73. Found C, 59.16; H,
5.51; N, 5.71.
4.1.3. General synthetic procedure for compounds 16ae16g [43,44]
Appropriate aniline (1 equiv) was added into a solution of
methyl 2-oxo-2H-pyran-3-carboxylate (1 equiv) in DMF (1.0 M)
under ice bath. The resulting mixture was then allowed to warm to
room temperature and stirred for 6 h. To this mixture was further
added EDCI (1 equiv) and DMAP (0.25 equiv), and it was stirred for
12 h. The reaction mixture was then poured into water (20 mL),
neutralized with 3 N HCl and extracted with EtOAc (3 ꢂ 10 mL). The
organic layers were combined, washed with brine, dried over
anhydrous MgSO4, and concentrated in vacuo to give crude methyl
DMSO-d6)
d
14.43 (br s, 1H), 8.47 (dd, J ¼ 7.2, 2.0 Hz, 1H), 8.16 (dd,
J ¼ 6.6, 2.0 Hz, 1H), 7.44 (dd, J ¼ 8.8, 8.8 Hz, 2H), 7.09 (dd, J ¼ 8.8,
8.8 Hz, 2H), 6.77 (dd, J ¼ 7.2, 6.6 Hz, 1H), 3.81 (s, 3H); 13C NMR
(100 MHz, DMSO-d6) d 165.3, 164.5, 160.1, 146.6, 146.0, 132.5, 128.4,
117.7, 114.9, 108.7, 56.1; MS (ESI), m/z ¼ 243.9 [MꢁH]ꢁ. Anal. calcd.
for C13H11NO4$0.4H2O: C, 61.85; H, 4.71; N, 5.55. Found C, 61.89; H,
4.54; N, 4.94.
4.1.3.3. 2-Oxo-1-phenyl-1,2-dihydropyridine-3-carboxylic acid (16c).
The reaction of aniline (0.45 mL, 4.9 mmol) with methyl 2-oxo-2H-
pyran-3-carboxylate (765.6 mg, 4.9 mmol) in presence of EDCI
(949.4 mg, 4.9 mmol) and DMAP (153.1 mg, 1.23 mmol) afforded
methyl 1-(phenyl)-2-oxo-1,2-dihydropyridine-3-carboxylate which
further on saponification gave 16c. Yield: 446.6 mg, 43%. 1H NMR
1-aryl-2-oxo-1,2-dihydropyridine-3-carboxylate,
which
was
further saponified by 10% (w/v) NaOH (10 mL) in MeOH (20 mL) at
reflux for 3 h. The reaction mixture was then adjusted to pH 1 by
titrating with 3 N HCl. The precipitate was collected by filtration,
washed with MeOH, water, and diethyl ether, and dried to give
appropriate analogs of 16.
(400 MHz, DMSO-d6)
d
14.29 (br s, 1H), 8.48 (dd, J ¼ 7.3, 2.0 Hz, 1H),

H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
321
presence of EDCI (484.4 mg, 2.5 mmol) and DMAP (75.0 mg,
0.6 mmol) afforded methyl 1-(4-methylphenyl)-2-oxo-1,2-
dihydropyridine-3-carboxylate which further on saponification
gave 16d. Crude 16d was used without further purification. Yield:
103.0 mg, 18%; mp 163e164 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d
14.30 (s, 1H), 8.47 (dd, J ¼ 7.2, 2.0 Hz, 1H), 8.17 (dd, J ¼ 6.8, 2.0 Hz,
1H), 7.39 (dd, J ¼ 8.4, 8.4 Hz, 2H), 7.36 (dd, J ¼ 8.4, 8.4 Hz, 2H), 6.78
(dd, J ¼ 7.2, 6.8 Hz, 1H); MS (ESI), m/z ¼ 227.9 [MꢁH]ꢁ.
4.1.3.5. 1-(4-Chlorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylic
acid (16e). The reaction of 4-chloroaniline (601.5 mg, 4.9 mmol)
with methyl 2-oxo-2H-pyran-3-carboxylate (765.6 mg, 4.9 mmol)
in presence of EDCI (949.4 mg, 4.9 mmol) and DMAP (153.1 mg,
1.23 mmol) afforded methyl 1-(4-chlorophenyl)-2-oxo-1,2-
dihydropyridine-3-carboxylate which further on saponification
gave 16e. Crude 16e was used without further purification. Yield:
778.8 mg, 64%; mp 223e226 ꢀC. 1H NMR (400 MHz, DMSO-d6)
Fig. 6. Expression levels of pro-apoptotic genes in A549 cells treated with 31h or
AZD1152-HQPA. Compound 31h significantly elevated the mRNA levels of the pro-
apoptotic Fas, FasL, and Bid genes by 18 h.
d
14.15 (s, 1H), 8.47 (dd, J ¼ 7.2, 2.0 Hz, 1H), 8.19 (dd, J ¼ 6.8, 2.0 Hz,
1H), 7.64 (dd, J ¼ 8.8, 8.8 Hz, 2H), 7.58 (dd, J ¼ 8.8, 8.8 Hz, 2H), 6.78
(dd, J ¼ 7.2, 6.8 Hz,1H); 13C NMR (100 MHz, DMSO-d6)
d 165.1,164.0,
146.9, 145.4, 138.5, 134.5, 129.8, 129.3, 118.0, 108.9; MS (ESI), m/
z ¼ 247.8 [MꢁH]ꢁ. Anal. calcd. for C12H8NO3Cl$0.1H2O: C, 57.32; H,
3.29; N, 5.57. Found C, 56.93; H, 3.44; N, 5.59.
Table 4
Anti-metastatic effects of selected Aurora-B inhibitors on A549 cells.
a
Compound
IC50
(m
M)
4.1.3.6. 2-Oxo-1-(4-(trifluoromethyl)phenyl)-1,2-dihydropyridine-3-
carboxylic acid (16f). The reaction of 4-trifluoromethylaniline
(0.61 mL, 4.9 mmol) with methyl 2-oxo-2H-pyran-3-carboxylate
(765.6 mg, 4.9 mmol) in presence of EDCI (949.4 mg, 4.9 mmol)
and DMAP (153.1 mg, 1.23 mmol) afforded methyl 1-(4-(tri-
fluoromethyl)phenyl)-2-oxo-1,2-dihydropyridine-3-carboxylate
which further on saponification gave 16f. Yield: 790.0 mg, 36%; mp
Anti-migration (scratch
wound model)
Anti-invasion (Transwell
invasion model)
24a
25a
31a
31h
7.3 0.9
7.9 0.8
6.6 0.7
4.1 0.8
8.3 0.8
>10
>10
7.8 1.2
3.2 0.3
5.4 0.5
AZD1152
a
239e240 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 14.05 (s, 1H), 8.49 (dd,
Mean S.D. (n > 3).
J ¼ 7.2, 2.0 Hz, 1H), 8.24 (dd, J ¼ 6.8, 2.0 Hz, 1H), 7.97 (dd, J ¼ 8.4,
8.4 Hz, 2H), 7.81 (dd, J ¼ 8.4, 8.4 Hz, 2H), 6.81 (dd, J ¼ 7.2, 6.8 Hz,
Table 5
In vitro safety profile of 31h.
1H); 13C NMR (100 MHz, DMSO-d6)
d 165.1, 163.9, 147.0, 145.1, 143.0,
128.6,127.2, 126.9,118.3, 108.9; MS (ESI), m/z ¼ 281.9 [MꢁH]ꢁ. Anal.
calcd. for C13H8NO3F3: C, 55.13; H, 2.85; N, 4.95. Found C, 54.78; H,
2.78; N, 4.82.
Protein
IC50
(
m
M)
CYPa1A2
CYP2C9
CYP2D6
CYP2C19
CYP3A4
hERGb
>10
0.04
>10
3.5
>10
>100
4.1.3.7. 1-(3-Chlorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylic
acid (16g). The reaction of m-chloroaniline (0.50 mL, 4.9 mmol) with
methyl 2-oxo-2H-pyran-3-carboxylate (765.6 mg, 4.9 mmol) in
presence of EDCI (949.4 mg, 4.9 mmol) and DMAP (153.1 mg,
1.23 mmol) afforded methyl 1-(3-chlorophenyl)-2-oxo-1,2-
dihydropyridine-3-carboxylate which further on saponification
gave 16g. Yield: 548.0 mg, 45%; mp 236 ꢀC. 1H NMR (400 MHz,
a
Cytochrome P450.
Human Ether-a-go-go-Related Gene.
b
ꢀ
DMSO-d6)
d
14.07 (s,1H), 8.48 (dd, J ¼ 6.8, 2.0 Hz,1H), 8.22 (dd, J ¼ 6.8,
8.20 (dd, J ¼ 6.8, 2.0 Hz, 1H), 7.50e7.59 (m, 5H), 6.79 (dd, J ¼ 7.2,
2.0 Hz,1H), 7.74 (d, J ¼ 2 Hz,1H), 7.64e7.58 (m, 2H), 7.54e7.52 (m,1H),
6.8 Hz, 1H).
6.78 (dd, J ¼ 6.8, 6.8 Hz, 1H); 13C NMR (100 MHz, DMSO-d6)
d 165.1,
163.9, 146.9, 145.4,140.8,133.8, 131.5, 129.9,127.6,126.3,118.1, 108.8;
MS (ESI), m/z ¼ 247.8 [MꢁH]ꢁ. Anal. calcd. for C12H8NO3Cl$0.1H2O: C,
57.32; H, 3.29; N, 5.57. Found C, 57.06; H, 3.23; N, 5.58.
4.1.3.4. 2-Oxo-1-(p-tolyl)-1,2-dihydropyridine-3-carboxylic
acid
(16d). The reaction of p-toluidine (263.0 mg, 2.5 mmol) with
methyl 2-oxo-2H-pyran-3-carboxylate (390.6 mg, 2.5 mmol) in
4.1.4. Synthesis of 1-Methyl-2-oxo-1,2-dihydropyridine-3-
carboxylic acid (16h) [45]
Table 6
Pharmacokinetic properties of 31h in rats.a
A
mixture of 2-hydroxypyridine-3-carboxylic acid (3.0 g,
21.6 mmol) and potassium hydroxide (2.5 g, 45.0 mmol), methanol
(5 mL) and water (35 mL) was warmed to dissolve the acid salt.
Methyl iodide (14.0 mL, 224.9 mmol) was added into the solution,
and the resulting reaction mixture was heated at reflux for 2 h. The
reaction mixture then concentrated in vacuo to half-volume, cooled
and acidified to pH 1 by 3 N HCl. The resultant solid was collected by
filtration and dried to give 16h, which was used without further
purification. Yield: 2.28 g, 69%; mp 176e177 ꢀC (lit. [34] 180 ꢀC). 1H
Parameter
iva
Dose
2 mg/kg
11.8 3.4
564.5 130.1
9335.2 1853.2
3661.6 757.6
Plasma t1/2 (h)
Cl (mL/kg/h)
Vss (mL/kg)
AUC0e24h (ng/mL/h)
a
n ¼ 3; t1/2, half-life; Cl, clearance; Vss, volume of distribution;
AUC, area under the curve.

322
H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
Fig. 7. Anti-tumor activity of 31h assessed using a SCID mouse/Huh7 xenograft model. Treatment was started in fifteen days after tumor implantation. Compound 31h was iv
administrated at a dose of 2.5 mg/kg or 5 mg/kg once daily for 14 days (n ¼ 5). Sorafenib served as the reference and was administrated orally 30 mg/kg once daily (n ¼ 4). Mice
were assessed for tumor growth (A), and body weight (B). Mean tumor volume SEM is shown.
NMR (400 MHz, DMSO-d6)
8.24 (dd, J ¼ 6.8, 2.0 Hz,1H), 6.70 (dd, J ¼ 7.2, 6.8 Hz,1H), 3.64 (s, 3H).
d
14.68 (s,1H), 8.35(dd, J ¼ 7.2, 2.0 Hz,1H),
(2.0 mL, 14.6 mmol) with Meldrum's acid (2.1 g, 14.6 mmol) in
presence of TEA (5.0 mL, 35.6 mmol) gave 5-(2-(4-fluorophenyl)-1-
hydroxyethylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione,
which
further on treatment with ethanol afforded ethyl 4-(4-
fluorophenyl)-3-oxobutanoate (27a). 27a without further purifica-
tion was reacted with DMF-DMA (5.0 mL, 37.3 mmol) and ammo-
nium acetate (5.63 g, 72.7 mmol) to give ethyl 5-(4-fluorophenyl)-
4-oxo-1,4-dihydropyridine-3-carboxylate, which further on
saponification afforded 29a. Yield: 671.2 mg, 21%; mp > 300 ꢀC. 1H
4.1.5. Synthesis of 1-(2-hydroxyethyl)-2-oxo-1,2-dihydropyridine-
3-carboxylic acid (16i)
A mixture of methyl 2-hydroxynicotinate (1.92 g, 12.5 mmol), 2-
bromoethanol (2.3 mL, 32.4 mmol), potassium carbonate (2.52 g,
18.2 mmol) and acetone (30 mL) was heated at reflux for 60 h. Excess
of potassium carbonate was removed by filtration, and the filtrate
was concentrated to give crude methyl 1-(2-hydroxyethyl)-2-oxo-
1,2-dihydropyridine-3-carboxylate, which was saponified by 5% (w/
v) KOH(aq) (50 mL) at reflux for 12 h. The reaction mixture was then
adjusted to pH 1 by titrating with 3 N HCl. The white needle crystals
were collected by filtration, washed with water, and dried to give
16i. Yield: 1.35 g, 59%; mp, 206e207 ꢀC. 1H NMR (400 MHz, DMSO-
NMR (400 MHz, DMSO-d6)
d 13.16 (s, 1H), 8.60 (s, 1H), 8.24 (s, 1H),
7.72 (m, 2H), 7.27 (dd, J ¼ 8.8, 8.8 Hz, 1H).
4.1.6.2. 5-(4-Methoxyphenyl)-4-oxo-1,4-dihydropyridine-3-
carboxylic acid (29b). The reaction of 2-(4-methoxyphenyl)acetyl
chloride (0.95 mL, 6.2 mmol) with Meldrum's acid (0.87 g,
6.2 mmol) in presence of TEA (2.0 mL, 14.8 mmol) gave 5-(1-
hydroxy-2-(4-methoxyphenyl)ethylidene)-2,2-dimethyl-1,3-
dioxane-4,6-dione, which further on treatment with ethanol
afforded ethyl 4-(4-methoxyphenyl)-3-oxobutanoate (27b). 27b
without further purification was reacted with DMF-DMA (2.0 mL,
15.5 mmol) and ammonium acetate (2.40 g, 31.0 mmol) to give
d6)
d
14.64 (s,1H), 8.38 (dd, J ¼ 7.2, 2.0 Hz,1H), 8.13 (dd, J ¼ 6.8, 2.0 Hz,
1H), 6.71 (dd, J ¼ 7.2, 6.8 Hz, 1H), 4.97 (t, J ¼ 5.6 Hz, 1H, OH), 4.15 (t,
J ¼ 5.2 Hz, 2H, CH2), 3.72e3.68 (m, 2H, CH2); 13C NMR (100 MHz,
DMSO-d6)
d 165.4, 164.3, 146.7, 145.8, 116.7, 108.4, 58.5, 53.2; MS
(ESI) m/z ¼ 181.8 [MꢁH]ꢁ. Anal. calcd. for C8H9NO4: C, 52.46; H, 4.95;
N, 7.65. Found C, 52.45; H, 4.89; N, 7.53.
ethyl
carboxylate, which further on saponification afforded 29b. Yield:
280.5 mg, 16%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
13.10
5-(4-methoxyphenyl)-4-oxo-1,4-dihydropyridine-3-
4.1.6. General synthetic procedure for compounds 29aeh [43,46]
Appropriate phenylacetyl chloride (1 equiv) was added drop-
wise into a solution of Meldrum's acid (1 equiv) and TEA (2.4 equiv)
in DCM (1 M) under ice bath. The reaction mixture was then
allowed to warm to room temperature and stirred for 3.5 h. The
reaction mixture was extracted with a mixture of CH2Cl2 and 1 N
HCl solution. The organic layer was washed with brine, dried over
MgSO4, and concentrated. To the residue was added absolute
ethanol (1 M), and the reaction mixture was heated at reflux for 2 h.
The solvent was removed in vacuo, and to the resulting ethyl-4-
aryl-3-oxobutanoate (27) in xylene (1 M) was added DMF-DMA
(2.5 equiv). The resulting mixture was heated at reflux for 4 h
and then concentrated in vacuo. To the solution of residue in MeOH
(1 M) was added ammonium acetate (5 equiv), and the resultant
mixture was heated at reflux for 4 h. The crude ethyl ester of
appropriate 29 was saponified by 10% (w/v) NaOH (10 mL) in MeOH
(20 mL) at reflux for 2.5 h. The mixture was then adjusted to pH 1
by titrating with 3 N HCl. The precipitate was collected by filtration,
washed with MeOH, water, and diethyl ether, and dried to give
appropriate analogs of 29.
d
(s, 1H), 8.57 (d, J ¼ 1.6 Hz, 1H), 8.18 (d, J ¼ 1.6 Hz, 1H), 7.62 (dd,
J ¼ 8.8, 8.8 Hz, 2H), 6.99 (dd, J ¼ 8.8, 8.8 Hz, 2H), 3.79 (s, 3H); 13C
NMR (100 MHz, DMSO-d6)
d 177.8, 166.9, 159.8, 142.0, 138.7, 130.6,
129.5, 125.6, 115.7, 114.2, 55.7. Anal. Calc. for C13H11NO4: C, 63.67; H,
4.52; N, 5.71. Found C, 63.62; H, 4.51; N, 5.65.
4.1.6.3. 4-Oxo-5-phenyl-1,4-dihydropyridine-3-carboxylic acid (29c).
The reaction of 2-phenylacetyl chloride (0.95 mL, 7.1 mmol) with
Meldrum's acid (1.0 g, 7.1 mmol) in presence of TEA (2.4 mL,
17.0 mmol) gave 5-(1-hydroxy-2-phenylethylidene)-2,2-dimethyl-
1,3-dioxane-4,6-dione, which further on treatment with ethanol
afforded ethyl 3-oxo-4-phenylbutanoate (27c). 27c without further
purification was reacted with DMF-DMA (2.4 mL, 17.7 mmol) and
ammonium acetate (2.75 g, 35.5 mmol) to give ethyl 4-oxo-5-
phenyl-1,4-dihydropyridine-3-carboxylate, which further on
saponification afforded 29c. Yield: 328.2 mg, 22%. 1H NMR
(400 MHz, DMSO-d6)
(d, J ¼ 1.6 Hz, 1H), 7.65 (dd, J ¼ 8.0, 8.0 Hz, 2H), 7.50e7.41 (m, 3H).
d
13.16 (br s, 1H), 8.60 (d, J ¼ 1.6 Hz, 1H), 8.23
4.1.6.1. 5-(4-Fluorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic
4.1.6.4. 4-Oxo-5-p-tolyl-1,4-dihydropyridine-3-carboxylic acid (29d).
acid (29a). The reaction of 2-(4-fluorophenyl)acetyl chloride
Oxalyl chloride (1.0 mL, 11.7 mmol) was added into the solution of

H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
323
Table 7
Kinase profiling of 31h.
DMA (2.44 mL, 18.25 mmol) and ammonium acetate (2.82 g,
36.5 mmol) to give ethyl 4-oxo-5-(4-(trifluoromethyl)phenyl)-1,4-
dihydropyridine-3-carboxylate, which further on saponification
afforded 29f. Yield: 681.5 mg, 33%; mp > 300 ꢀC. 1H NMR (400 MHz,
Kinase
Inhibition (%)a
Kinase
Inhibition (%)a
Abl-1
Akt1
Aurora A
Aurora C
0
JAK2
0
DMSO-d6)
d
13.27 (br s, 1H), 8.64 (d, J ¼ 1.4 Hz, 1H), 8.34 (d,
2.8
10.6
16.1
0
51.5
12.2
0
JNK2
VEGFR-2
Lck
Lyn
Mek1
mTOR
PDGFR
PDGFR
Plk1
8.9
7.7
7.7
0
0.6
0
37.2
23.9
0
J ¼ 1.4 Hz, 1H), 7.90 (dd, J ¼ 8.1, 8.1 Hz, 2H), 7.80 (dd, J ¼ 8.1, 8.1 Hz,
2H); 13C NMR (100 MHz, DMSO-d6)
d 177.6, 166.6, 143.0, 140.1, 137.7,
b
-Raf
130.1, 128.9 (q, 1JCF ¼ 31.6 Hz), 128.22, 126.1, 125.5 (q, 2JCF ¼ 3.7 Hz),
c-Kit
c-Met
c-Src
CHK1
EGFR
123.4, 116.1; MS (ESI), m/z ¼ 281.8 [MꢁH]ꢁ. Anal. Calc. for
C13H8F3NO3: C, 55.13; H, 2.85; N, 4.95. Found C, 55.24; H, 3.10; N,
a
b
0
0
4.84.
ErbB2/Her2
FGFR1
IGF-1
5.8
0
13.8
ROCK1
Tie-2/TEK
Flt-3
0
7.3
IC50 ¼ 0.1
4.1.6.7. 5-(3-Chlorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic
acid (29g). Oxalyl chloride (1.0 mL, 11.7 mmol) was added into the
solution of 3-chlorophenylacetic acid (1.2480 g, 7.3 mmol) and DMF
(cat) in DCM (20 mL). The mixture was heated at reflux for 1 h to
give 2-(3-chlorophenyl)acetyl chloride (26g). The reaction of 26g
(1.38 mL, 7.3 mmol) with Meldrum's acid (1.0 g, 7.3 mmol) in
presence of TEA (2.46 mL, 17.52 mmol) gave 5-(2-(3-chlorophenyl)-
1-hydroxyethylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione, which
further on treatment with ethanol afforded ethyl 4-(3-
chlorophenyl)-3-oxobutanoate (27g). 27g without further purifi-
cation was reacted with DMF-DMA (2.44 mL, 18.25 mmol) and
ammonium acetate (2.82 g, 36.5 mmol) to give ethyl 5-(3-
m
Mb
a
The percentage inhibition in the presence of vehicle (DMSO) was set to 0 for
each kinase. The assays were performed twice in the single-dose mode starting at a
concentration of 1.0 mM.
b
The IC50 value is the average of two independent three-fold serial dilution
doseeresponse curves, with a coefficient of variation <30%, and were performed in
the presence of 20 mM of ATP.
p-tolylacetic acid (1.09 g, 7.3 mmol) and DMF (cat) in DCM (20 mL).
The mixture was heated at reflux for 1 h to give 2-p-tolylacetyl
chloride (26d). The reaction of 26d (1.35 g, 7.3 mmol) with Mel-
drum's acid (1.05 g, 7.3 mmol) in presence of TEA (2.5 mL,
17.5 mmol) gave 5-(1-hydroxy-2-p-tolylethylidene)-2,2-dimethyl-
1,3-dioxane-4,6-dione, which further on treatment with ethanol
afforded ethyl 3-oxo-4-p-tolylbutanoate (27d). 27d without further
purification was reacted with DMF-DMA (2.4 mL, 18.25 mmol) and
ammonium acetate (2.82 g, 36.5 mmol) to give ethyl 5-(4-
chlorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxylate,
further on saponification afforded 29f. Yield: 538.5 mg, 29%;
mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
13.31 (br s, 1H), 8.63
(d, J ¼ 1.4 Hz, 1H), 8.32 (d, J ¼ 1.4 Hz, 1H), 7.78 (m, 1H), 7.64 (m, 1H),
7.47 (m, 1H); 13C NMR (100 MHz, DMSO-d6)
177.5, 166.7, 142.7,
which
d
d
139.8, 135.6, 133.3, 130.5, 129.0, 128.5, 128.1, 127.9, 115.9; MS (ESI),
m/z ¼ 247.8 [MꢁH]ꢁ. Anal. Calc. for C12H8ClNO3$0.6H2O: C, 55.34;
H, 3.56; N, 5.38. Found C, 55.27; H, 3.55; N, 5.22.
fluorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxylate,
further on saponification afforded 29d. Yield: 287.0 mg, 17%; 1H
NMR (400 MHz, DMSO-d6)
which
d
13.11 (br s, 1H), 8.59 (d, J ¼ 1.2 Hz, 1H),
8.21 (d, J ¼ 1.2 Hz, 1H), 7.57 (dd, J ¼ 8.0, 8.0 Hz, 2H), 7.24 (dd, J ¼ 8.0,
4.1.6.8. 5-(2-Fluorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic
acid (29h). Oxalyl chloride (1.0 mL, 11.7 mmol) was added into the
solution of 2-fluorophenylacetic acid (1.1300 g, 7.3 mmol) and DMF
(cat) in DCM (20 mL). The mixture was heated at reflux for 1 h to
give 2-(2-fluorophenyl)acetyl chloride (26h). The reaction of 26h
(1.25 mL, 7.3 mmol) with Meldrum's acid (1.0 g, 7.3 mmol) in the
presence of TEA (2.46 mL, 17.52 mmol) gave 5-(2-(2-fluorophenyl)-
1-hydroxyethylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione, which
on treatment with ethanol afforded ethyl 4-(2-fluorophenyl)-3-
oxobutanoate (27h). 27h without further purification was reacted
with DMF-DMA (2.44 mL, 18.25 mmol) and ammonium acetate
(2.82 g, 36.5 mmol) to give ethyl 5-(3-chlorophenyl)-4-oxo-1,4-
dihydropyridine-3-carboxylate, which further on saponification
afforded 29h. Yield: 757.0 mg, 44%; mp, 270e271 ꢀC. 1H NMR
8.0 Hz, 2H), 2.36 (s, 3H).
4.1.6.5. 5-(4-Chlorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic
acid (29e). The reaction of 2-(4-chlorophenyl)acetyl chloride
(0.95 mL, 6.9 mmol) with Meldrum's acid (1.0 g, 6.9 mmol) in
presence of TEA (2.32 mL,16.56 mmol) gave 5-(2-(4-chlorophenyl)-
1-hydroxyethylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione, which
further on treatment with ethanol afforded ethyl 4-(4-
chlorophenyl)-3-oxobutanoate (27e). 27e without further purifi-
cation was reacted with DMF-DMA (2.31 mL, 17.25 mmol) and
ammonium acetate (2.67 g, 34.5 mmol) to give ethyl 5-(4-
chlorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxylate,
further on saponification afforded 29e. Yield: 396.0 mg, 23%;
mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
13.20 (br s, 1H), 8.61
which
d
(400 MHz, DMSO-d6)
d 13.41 (br s, 1H), 8.64 (s, 1H), 8.21 (s, 1H),
7.48e7.41 (m, 2H), 7.28e7.23 (m, 2H); 13C NMR (100 MHz, DMSO-
(d, J ¼ 1.6 Hz, 1H), 8.27 (d, J ¼ 1.6 Hz, 1H), 7.71 (dd, J ¼ 8.4, 8.4 Hz,
2H), 7.50 (d, J ¼ 8.4, 8.4 Hz, 2H); 13C NMR (100 MHz, DMSO-d6)
d6)
d
177.4, 166.7, 160.1 (d, 1JCF ¼ 245.0 Hz), 143.0, 140.6, 132.4 (d,
3JCF ¼ 3.1 Hz), 130.9 (d, 3JCF ¼ 8.3 Hz), 125.5, 124.5 (d, 4JCF ¼ 3.2 Hz),
121.3 (d, 2JCF ¼ 15.2 Hz), 115.9 (d, 2JCF ¼ 21.7 Hz), 115.5; MS (ESI), m/
z ¼ 231.8 [MꢁH]ꢁ. Anal. Calc. for C12H8FNO3$0.2H2O: C, 60.87; H,
3.58; N, 5.92. Found C, 60.82; H, 3.46; N, 5.85.
d
177.6, 166.7, 142.7, 139.6, 133.4, 132.3, 131.1, 128.7, 128.5, 115.9; MS
(ESI), m/z ¼ 247.8 [MꢁH]ꢁ. Anal. Calc. for C12H8ClNO3$0.3H2O: C,
56.51; H, 3.40; N, 5.49. Found C, 56.26; H, 3.26; N, 5.29.
4.1.6.6. 4-Oxo-5-(4-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-
carboxylic acid (29f). Oxalyl chloride (1.0 mL,11.7 mmol) was added
into the solution of 4-(trifluoromethyl)phenylacetic acid (1.09 g,
7.3 mmol) and DMF (cat) in DCM (20 mL). The mixture was heated
at reflux for 1 h to give 2-(4-(trifluoromethyl)phenyl)acetyl chlo-
ride (26f). The reaction of 26f (1.62 mL, 7.3 mmol) with Meldrum's
acid (1.0 g, 7.3 mmol) in presence of TEA (2.46 mL,17.52 mmol) gave
5-(1-hydroxy-2-(4-(trifluoromethyl)phenyl)ethylidene)-2,2-
dimethyl-1,3-dioxane-4,6-dione, which further on treatment with
ethanol afforded ethyl 3-oxo-4-(4-(trifluoromethyl)phenyl)buta-
noate (27f). 27f without further purification was reacted with DMF-
4.1.7. Synthesis of 5-Methyl-4-oxo-1,4-dihydropyridine-3-
carboxylic acid (29i) [35]
Ethyl propionylacetate (1.0 mL, 7.0 mmol) and s-triazine
(580.0 mg, 7.2 mmol) were added into a solution of sodium
(170.0 mg, 7.4 mmol) in absolute EtOH (20 mL). The reaction
mixture was heated at reflux for 1 h, and then concentrated in
vacuo. To the residue was added water, and the solution was
adjusted to pH 4 with 3 N HCl. The precipitate was collected by
filtration, washed with EtOH and diethyl ether to give ethyl 5-
methyl-4-oxo-1,4-dihydropyridine-3-carboxylate,
which
was

324
H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
saponified by 5% (w/v) NaOH (24 mL) at reflux for 1.5 h. The cooled
reaction mixture was then adjusted to pH 1 by titrating with 3 N
HCl. The precipitate was collected by filtration, washed with water
and diethyl ether, and dried to afford 29i. Yield: 175.5 mg, 17%;
J ¼ 8.0 Hz, 1H), 7.04 (d, J ¼ 8.0 Hz, 1H), 6.86 (dd, J ¼ 8.8, 8.8 Hz, 2H),
3.71 (s, 3H), 3.39 (s, 2H), 1.43 (s, 4H); 13C NMR (100 MHz, DMSO-d6)
d
177.3, 168.8, 168.7, 156.2, 144.3, 138.7, 132.2, 124.7, 122.9, 121.2,
114.1, 113.4, 102.6, 55.7, 35.9, 31.6, 16.1; MS (ESI), m/
mp > 300 ꢀC (lit. [35] 315 ꢀC). 1H NMR (400 MHz, DMSO-d6)
d 12.79
z ¼ 363.9 [MꢁH]ꢁ.
(s, 1H), 8.53 (s, 1H), 8.01 (s, 1H), 2.02 (s, 3H).
4.1.8.5. 1-(4-Fluorophenyl)-2-oxo-N-(2-oxoindolin-4-yl)-1,2-
4.1.8. General syntheses for compounds 9a, 9b, 10a and 10b
dihydropyridine-3-carboxamide
(17). 4-Aminoindolin-2-one
(Scheme 1)
(80.0 mg, 0.5 mmol) was reacted with 16a (125.5 mg, 0.5 mmol)
in the presence of TBTU (250.0 mg, 0.8 mmol) and TEA (0.23 mL,
1.6 mmol) in DMF/acetonitrile (1:3, 3.2 mL) to afford 17. Yield:
110.0 mg, 56%; mp 293e295 ꢀC. 1H NMR (400 MHz, DMSO-d6)
Appropriate aminoindolin-2-one (1 equiv) was added to a
mixture of appropriate 3-amino-3-oxopropanoic acid/2-pyridone
acid/4-pyridone acid (1 equiv), TBTU (1.5 equiv) and TEA
(3 equiv) in DMF/acetonitrile (1:3, 0.16 M). The resulting reaction
mixture was stirred at room temperature for 3 h. Reaction mixture
was then concentrated in vacuo. Title compound was collected as
solid by filtration and dried.
d
11.77 (s, 1H), 10.41 (s, 1H), 8.58 (dd, J ¼ 7.6, 2.0 Hz, 1H), 8.10 (dd,
J ¼ 6.6, 1.6 Hz, 1H), 7.77 (d, J ¼ 8.4 Hz, 1H), 7.59 (m, 2H), 7.41 (dd,
J ¼ 8.8, 8.8 Hz, 2H), 7.17 (dd, J ¼ 8.4, 7.6 Hz, 1H), 6.71 (dd, J ¼ 7.6,
6.6 Hz, 1H), 6.68 (d, J ¼ 7.6 Hz, 1H), 3.36 (s, 2H); 13C NMR (100 MHz,
1
DMSO-d6)
d
176.0, 162.5, 162.4 (d, JCF ¼ 251.0 Hz), 161.5, 145.4,
4.1.8.1. N1-(4-Fluorophenyl)-N3-(2-oxoindolin-6-yl)malonamide
(9a). 6-Aminoindolin-2-one (148.0 mg, 1.0 mmol) was reacted
with 7a (197.0 mg, 1.0 mmol) in the presence of TBTU (487.0 mg,
1.5 mmol) and TEA (0.42 mL, 3.0 mmol) in DMF/acetonitrile (1:3,
6 mL) to afford 9a. Yield: 213.0 mg, 65%; mp 221 ꢀC (dec.). 1H NMR
144.6, 144.5, 136.9, 134.8, 129.8 (d, 3JCF ¼ 9.1 Hz), 128.8, 120.9, 116.7
2
(d, JCF ¼ 22.9 Hz), 115.7, 113.9, 107.5, 105.9, 34.7; MS (ESI), m/
z ¼ 361.9 [MꢁH]ꢁ. Anal. calcd. for C20H14N3O3F$0.3H2O: C, 65.14; H,
3.99; N, 11.40. Found C, 65.37; H, 4.23; N, 10.69.
(400 MHz, DMSO-d6)
d
10.35 (s, 1H), 10.20 (s, 1H), 10.11 (s, 1H),
4.1.8.6. 1-(4-Fluorophenyl)-2-oxo-N-(2-oxoindolin-7-yl)-1,2-
7.63e7.59 (m, 2H), 7.35 (s, 1H), 7.17e7.12 (m, 2H), 7.10 (d, J ¼ 8.4 Hz,
dihydropyridine-3-carboxamide
(19). 7-Aminoindolin-2-one
1H), 7.01 (d, J ¼ 8.4 Hz, 1H), 3.43 (s, 2H), 3.39 (s, 2H); 13C NMR
(52.0 mg, 0.4 mmol) was reacted with 16a (82.0 mg, 0.4 mmol) in
the presence of TBTU (195.0 mg, 0.6 mmol) and TEA (0.12 mL,
0.8 mmol) in DMF/acetonitrile (1:3, 2.5 mL) to afford crude 19.
Yield: 81.8 mg, 81%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
(100 MHz, DMSO-d6)
d
177.2, 165.9, 165.8, 158.6 (d, 1JCF ¼ 238.0 Hz),
3
144.5, 138.9, 135.9, 124.9, 121.4 (d, JCF ¼ 8.0 Hz), 120.9, 115.8 (d,
2JCF ¼ 22.0 Hz), 113.1, 101, 46.4, 35.9. MS (ESI), m/z ¼ 325.9 [MꢁH]ꢁ.
Anal. calcd. for C17H14FN3O3$H2O: C, 59.13; H, 4.67; N, 12.17. Found
C, 59.11; H, 4.54; N, 12.35.
d
11.28 (s, 1H), 9.99 (s, 1H), 8.52 (dd, J ¼ 6.8, 2.0 Hz, 1H), 8.07 (dd,
J ¼ 6.8, 2.0 Hz, 1H), 7.59e7.55 (m, 2H), 7.41 (dd, J ¼ 8.8, 8.4 Hz, 2H),
7.16 (d, J ¼ 8.0 Hz, 1H), 7.08 (d, J ¼ 7.2 Hz, 1H), 6.93 (dd, J ¼ 8.0,
7.2 Hz, 1H), 6.69 (dd, J ¼ 6.8, 6.8 Hz, 1H), 3.42 (s, 2H); 13C NMR
4.1.8.2. N1-(4-Methoxyphenyl)-N3-(2-oxoindolin-6-yl)malonamide
(9b). 6-Aminoindolin-2-one (148.0 mg, 1.0 mmol) was reacted
with 7b (212.0 mg, 1.0 mmol) in the presence of TBTU (487.0 mg,
1.5 mmol) and TEA (0.42 mL, 3.0 mmol) in DMF/acetonitrile (1:3,
6 mL) to afford 9b. Yield: 98.0 mg, 29%; mp 210e212 ꢀC. 1H NMR
(100 MHz, DMSO-d6)
d 176.5, 162.2, 145.2, 144.2, 138.0, 136.2, 129.8
3
(d, JCF ¼ 9.0 Hz), 127.6, 123.9, 122.2, 121.9, 121.3, 120.3, 116.1 (d,
2JCF ¼ 22.8 Hz), 107.3, 36.5.
(400 MHz, DMSO-d6)
d
10.35 (s, 1H), 10.10 (s, 1H), 9.99 (s, 1H), 7.50
4.1.8.7. 1-(4-Fluorophenyl)-2-oxo-N-(2-oxoindolin-6-yl)-1,2-
(dd, J ¼ 8.8, 8.8 Hz, 2H), 7.35 (s, 1H), 7.10 (d, J ¼ 8.0 Hz, 1H), 7.01 (d,
dihydropyridine-3-carboxamide
(20a). 6-Aminoindolin-2-one
J ¼ 8.0 Hz,1H), 6.88 (dd, J ¼ 8.8, 8.8 Hz, 2H), 3.71 (s, 3H), 3.41 (s, 2H),
(67.5 mg, 0.5 mmol) was reacted with 16a (108.0 mg, 0.5 mmol)
in the presence of TBTU (250.0 mg, 0.8 mmol) and TEA (0.23 mL,
1.6 mmol) in DMF/acetonitrile (1:3, 3.2 mL) to afford 20a. Yield:
3.39 (s, 2H); 13C NMR (100 MHz, DMSO-d6)
d 177.2, 165.9, 165.4,
155.8, 144.5, 138.9, 132.6, 124.9, 121.2, 120.9, 114.4, 112.1, 101.3, 55.7
(OCH3), 46.3 (CH2), 35.9 (CH2). MS (ESI), m/z ¼ 337.9 [MꢁH]ꢁ. Anal.
calcd. for C18H17N3O4$0.6H2O: C, 61.74; H, 5.24; N, 12.00. Found C,
61.43; H, 5.24; N, 11.92.
176.0 mg, 81%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 11.90
(s, 1H), 10.43 (s, 1H), 8.54 (dd, J ¼ 7.2, 1.2 Hz, 1H), 8.07 (dd, J ¼ 6.8,
1.2 Hz, 1H), 7.59e7.56 (m, 2H), 7.49 (s, 1H), 7.42e7.38 (m, 2H), 7.13
(d, J ¼ 8.0 Hz, 1H), 6.97 (d, J ¼ 8.0 Hz, 1H), 6.69 (dd, J ¼ 7.2, 6.8 Hz,
4.1.8.3. N-(4-Fluorophenyl)-N-(2-oxoindolin-6-yl)cyclopropane-1,1-
dicarboxamide (10a). 6-Aminoindolin-2-one (148.0 mg, 1.0 mmol)
was reacted with 8a (240.0 mg, 1.1 mmol) in the presence of TBTU
(487.0 mg, 1.5 mmol) and TEA (0.42 mL, 3.0 mmol) in DMF/aceto-
nitrile (1:3, 6 mL) to afford 10a. Yield: 118.0 mg, 31%. 1H NMR
1H), 3.42 (s, 2H); 13C NMR (100 MHz, DMSO-d6)
d
177.8, 162.5, 162.4
1
(d, JCF ¼ 245 Hz), 161.7, 145.3, 144.6, 144.2, 138.1, 136.7 (d,
3
4JCF ¼ 3.0 Hz), 129.7 (d, JCF ¼ 9.0 Hz), 125.3, 121.7, 120.9, 116.6 (d,
2JCF ¼ 23.0 Hz), 112.9, 107.6, 101.9, 35.9; MS (ESI), m/z ¼ 361.9
[MꢁH]ꢁ. Anal. calcd. for C20H14FN3O3$1.2H2O: C, 62.40; H, 4.29; N,
10.92. Found C, 62.80; H, 4.01; N, 10.89.
(400 MHz, DMSO-d6)
d 10.37 (s, 1H), 10.01 (s, 1H), 9.97 (s, 1H),
7.62e7.59 (m, 2H), 7.31 (s, 1H), 7.15e7.06 (m, 4H), 3.39 (s, 2H), 1.44
(s, 4H); 13C NMR (100 MHz, DMSO-d6)
d
177.3, 168.9, 168.5, 158.7 (d,
4.1.8.8. 1-(4-Methoxyphenyl)-2-oxo-N-(2-oxoindolin-6-yl)-1,2-
1JCF ¼ 250.0 Hz), 144.3, 138.8, 135.7, 124.7, 122.9 (d, JCF ¼ 7.8 Hz),
121.2, 115.5 (d, 2JCF ¼ 22.1 Hz), 113.5, 10.27, 35.9, 31.9, 15.9; MS (ESI),
m/z ¼ 351.9 (MꢁH)ꢁ. Anal. calcd. for C19H16FN3O3$0.3H2O: C, 63.61;
H, 4.66; N, 11.71. Found C, 63.43; H, 4.68; N, 11.68.
dihydropyridine-3-carboxamide
(20b). 6-Aminoindolin-2-one
3
(50.0 mg, 0.3 mmol) was reacted with 16b (80.0 mg, 0.3 mmol) in
the presence of TBTU (146.1 mg, 0.45 mmol) and TEA (0.13 mL,
0.9 mmol) in DMF/acetonitrile (1:3, 1.9 mL) to afford crude 20b.
Yield: 80.0 mg, 63%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
4.1.8.4. N-(4-Methoxyphenyl)-N-(2-oxoindolin-6-yl)cyclopropane-
d
11.98 (s, 1H), 10.41 (s, 1H), 8.53 (dd, J ¼ 6.9, 1.6 Hz, 1H), 8.04 (dd,
1,1-dicarboxamide
(10b). 6-Aminoindolin-2-one
(88.8
mg,
J ¼ 6.9, 1.6 Hz, 1H), 7.51 (s, 1H), 7.42 (dd, J ¼ 8.8, 8.8 Hz, 2H), 7.12 (d,
J ¼ 8.0 Hz, 1H), 7.08 (dd, J ¼ 8.8, 8.8 Hz, 2H), 6.95 (d, J ¼ 8.0 Hz, 1H),
6.67 (dd, J ¼ 6.9, 6.9 Hz, 1H), 3.82 (s, 3H), 3.41 (s, 2H); 13C NMR
0.6 mmol) was reacted with 8b (137.0 mg, 0.6 mmol) in the pres-
ence of TBTU (292.2 mg, 0.9 mmol) and TEA (0.25 mL, 1.8 mmol) in
DMF/acetonitrile (1:3, 3.75 mL) to afford 10b. Yield: 82.0 mg, 39%;
(100 MHz, DMSO-d6)
d 177.2, 162.5, 161.7, 159.9, 144.9, 144.8, 144.6,
mp 242e245 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d
10.36 (s, 1H), 10.10
138.3, 133.4, 128.6, 125.2, 121.5, 120.9, 114.8, 112.7, 107.4, 101.7, 56.1,
(s, 1H), 9.76 (s, 1H), 7.47 (dd, J ¼ 8.8, 8.8 Hz, 2H), 7.31 (s, 1H), 7.08 (d,
35.9; MS (ESI), m/z ¼ 373.9 [MꢁH]ꢁ.

H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
325
4.1.8.9. 2-Oxo-N-(2-oxoindolin-6-yl)-1-phenyl-1,2-dihydropyridine-
3-carboxamide (20c). 6-Aminoindolin-2-one (148.0 mg, 1.0 mmol)
was reacted with 16c (216.0 mg, 1.0 mmol) in the presence of TBTU
(487.0 mg, 1.5 mmol) and TEA (0.42 mL, 3.0 mmol) in DMF/aceto-
nitrile (1:3, 6 mL) to afford 20b. Yield: 141.0 mg, 40%; mp 255 ꢀC
J ¼ 8.0 Hz, 1H), 6.96 (d, J ¼ 8.0 Hz, 1H), 6.69 (dd, J ¼ 7.2, 6.8 Hz, 1H),
3.40 (s, 2H); 13C NMR (100 MHz, DMSO-d6)
177.3, 162.2, 161.5,
145.3, 144.8, 143.9, 141.7, 138.2, 133.8, 131.4, 129.6, 127.8, 126.5,
125.2, 121.6, 121.2, 112.7, 107.6, 101.8, 35.9; MS (ESI), m/z ¼ 377.9
[MꢁH]ꢁ.
d
(dec.). 1H NMR (400 MHz, DMSO-d6)
d 11.93 (s, 1H), 10.41 (s, 1H),
8.55 (dd, J ¼ 7.2, 2.0 Hz, 1H), 8.08 (dd, J ¼ 6.6, 2.0 Hz, 1H), 7.67 (d,
J ¼ 7.6 Hz, 1H), 7.50e7.57 (m, 4H), 7.34 (t, J ¼ 7.8 Hz, 1H), 7.12 (d,
J ¼ 8.0 Hz, 1H), 6.95 (dd, J ¼ 8.0, 2.0 Hz, 1H), 6.70 (dd, J ¼ 7.2, 6.6 Hz,
1H), 3.41 (s, 2H); MS (ESI), m/z ¼ 343.9 [MꢁH]ꢁ. Anal. calcd. for
4.1.8.14. 1-Methyl-2-oxo-N-(2-oxoindolin-6-yl)-1,2-dihydropyridine-
3-carboxamide (20h). 6-Aminoindolin-2-one (148.0 mg, 1.0 mmol)
was reacted with 16h (161.3 mg, 1.1 mmol) in the presence of TBTU
(487.0 mg, 1.5 mmol) and TEA (0.42 mL, 3.0 mmol) in dry DMF/
acetonitrile (1:3, 6 mL) to afford 20h. Yield: 242.0 mg, 86%;
C
20H0N3O3$0.3H2O: C, 68.48; H, 4.48; N, 11.98. Found C, 68.63; H,
4.81; N, 11.56.
mp > 300 ꢀC (dec.). 1H NMR (400 MHz, DMSO-d6)
d 12.18 (s, 1H,
NH), 10.40 (s, 1H, NH), 8.42 (dd, J ¼ 7.2, 2.0 Hz, 1H, pyridone-H), 8.13
(dd, J ¼ 6.8, 2.0 Hz,1H, pyridone-H), 7.51 (d, J ¼ 1.6 Hz,1H, ArH), 7.15
(d, J ¼ 8.0 Hz, 1H, ArH), 6.99 (dd, J ¼ 8.0, 1.6 Hz, 1H, ArH), 6.59 (dd,
J ¼ 7.2, 6.8 Hz, 1H, pyridone-H), 3.61 (s, 3H, CH3), 3.33 (s, 2H, CH2);
4.1.8.10. 2-Oxo-N-(2-oxoindolin-6-yl)-1-(p-tolyl)-1,2-
dihydropyridine-3-carboxamide
(20d). 6-Aminoindolin-2-one
(105.0 mg, 0.7 mmol) was reacted with 16d (151.3 mg, 0.7 mmol)
in the presence of TBTU (341.0 mg, 1.0 mmol) and TEA (0.30 mL,
2.1 mmol) in DMF/acetonitrile (1:3, 4.4 mL) to afford 20d. Yield:
13C NMR (100 MHz, DMSO-d6)
d 177.2, 162.6, 161.9, 144.9, 144.8,
144.0, 138.4, 125.2, 121.4, 119.8, 112.6, 107.1, 101.7, 38.4, 35.9; MS
(ESI) 281.9 (MꢁH)ꢁ. Anal. Calc. for C15H13N3O3$0.6H2O: C, 61.26; H,
4.87; N, 14.29. Found: C, 61.42; H, 4.96; N, 14.56.
145.0 mg, 57%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 11.98
(s, 1H), 10.40 (s, 1H), 8.53 (d, J ¼ 6.0 Hz, 1H), 8.04 (d, J ¼ 4.8 Hz, 1H),
7.50 (s, 1H), 7.33 (s, 4H), 7.12 (d, J ¼ 7.6 Hz, 1H), 6.95 (d, J ¼ 6.8 Hz,
1H), 6.69 (dd, J ¼ 6.0, 4.8 Hz, 1H), 3.41 (s, 2H), 2.39 (s, 3H); 13C NMR
4.1.8.15. 1-(2-Hydroxyethyl)-2-oxo-N-(2-oxoindolin-6-yl)-1,2-
(100 MHz, DMSO-d6)
d
177.2, 162.4, 161.3, 144.9, 144.8, 144.4, 139.1,
dihydropyridine-3-carboxamide
(20i). 6-Aminoindolin-2-one
138.3, 138.1, 130.2, 127.1, 125.2, 121.5, 120.9, 112.7, 107.4, 101.7, 35.9,
(148.0 mg, 1.0 mmol) was reacted with 16i (186.0 mg, 1.0 mmol)
in the presence of TBTU (487.0 mg, 1.5 mmol) and TEA (0.42 mL,
3.0 mmol) in dry DMF/acetonitrile (1:3, 6 mL) to afford 20i. Yield:
192.0 mg, 59%; mp 294 ꢀC (dec.). 1H NMR (400 MHz, DMSO-d6)
21.2; MS (ESI), m/z
¼
358.0 [MꢁH]ꢁ. Anal. calcd. for
C
21H17N3O3$0.3H2O: C, 69.14; H, 4.86; N, 11.52. Found C, 68.85; H,
5.02; N, 11.66.
d
12.16 (s, 1H), 10.40 (s, 1H), 8.43 (dd, J ¼ 7.2, 2.0 Hz, 1H), 8.01 (dd,
4.1.8.11. 1-(4-Chlorophenyl)-2-oxo-N-(2-oxoindolin-6-yl)-1,2-
dihydropyridine-3-carboxamide (20e). 6-Aminoindolin-2-one
J ¼ 6.8, 2.0 Hz, 1H), 7.51 (d, J ¼ 1.6 Hz, 1H), 7.14 (d, J ¼ 8.0 Hz, 1H),
6.98 (dd, J ¼ 8.0, 1.6 Hz, 1H), 6.59 (dd, J ¼ 7.2, 6.8 Hz, 1H), 4.94 (t,
J ¼ 5.2 Hz,1H), 4.14 (t, J ¼ 5.2 Hz, 2H), 3.72 (q, J ¼ 5.2 Hz, 2H), 3.42 (s,
(148.0 mg, 1.0 mmol) was reacted with 16e (254.0 mg, 1.0 mmol)
in the presence of TBTU (487.0 mg, 1.5 mmol) and TEA (0.42 mL,
3.0 mmol) in dry DMF/acetonitrile (1:3, 6 mL) to afford crude 20e.
Yield: 110.0 mg, 56%; mp > 300 ꢀC. 1H NMR (200 MHz, DMSO-d6)
2H); 13C NMR (100 MHz, DMSO-d6)
d 177.3, 162.3, 161.9, 145.4,
144.8, 144.1, 138.4, 125.2, 121.4, 119.9, 112.6, 106.7, 101.7, 58.7, 53.0,
35.9; MS (ESI), m/z
C16H15N3O4$0.3H2O: C, 60.30; H, 4.93; N, 13.18. Found C, 60.11; H,
¼
311.9 [MꢁH]ꢁ. Anal. Calc. for
d
11.84 (s, 1H), 10.44 (s, 1H), 8.54 (dd, J ¼ 7.3, 2.2 Hz, 1H), 8.09 (dd,
J ¼ 6.6, 2.2 Hz,1H), 7.54e7.63 (m, 4H), 7.50 (d, J ¼ 1.6 Hz,1H), 7.13 (d,
J ¼ 7.8 Hz, 1H), 6.95 (dd, J ¼ 7.8, 1.6 Hz, 1H), 6.71 (dd, J ¼ 7.3, 6.6 Hz,
5.23; N, 13.34.
1H), 3.41 (s, 2H); 13C NMR (100 MHz, DMSO-d6)
d
177.3, 162.2, 161.5,
4.1.8.16. 5-(4-Fluorophenyl)-4-oxo-N-(2-oxoindolin-6-yl)-1,4-
dihydropyridine-3-carboxamide (30a). 6-Aminoindolin-2-one
(382.0 mg, 2.6 mmol) was reacted with 29a (671.0 mg, 2.9 mmol)
in the presence of TBTU (1.27 g, 3.9 mmol) and TEA (1.0 mL,
7.8 mmol) in dry DMF/acetonitrile (1:3, 16 mL) to afford crude 30a.
Yield: 687.0 mg, 64%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
145.2, 144.8, 144.0, 139.3, 138.2, 134.1, 129.7, 129.5, 125.2, 121.5,
121.1, 112.7, 107.6, 101.8, 35.9.
4.1.8.12. 2-Oxo-N-(2-oxoindolin-6-yl)-1-(4-(trifluoromethyl)
phenyl)-1,2-dihydropyridine-3-carboxamide (20f).
6-Aminoindolin-2-one (80.0 mg, 0.5 mmol) was reacted with 16f
(240.0 mg, 0.5 mmol) in the presence of TBTU (250.0 mg, 0.8 mmol)
and TEA (0.23 mL, 1.6 mmol) in dry DMF/acetonitrile (1:3, 3.2 mL)
to afford 20f. Yield: 157.6 mg, 51%; mp > 300 ꢀC. 1H NMR (400 MHz,
d
12.93 (s, 1H), 12.58 (br s, 1H), 10.39 (s, 1H), 8.57 (d, J ¼ 1.4 Hz, 1H),
8.06 (d, J ¼ 1.4 Hz, 1H), 7.69 (dd, J ¼ 8.9, 8.9 Hz, 2H), 7.49 (d,
J ¼ 1.5 Hz, 1H), 7.24 (dd, J ¼ 8.9, 8.9 Hz, 2H), 7.13 (d, J ¼ 7.9 Hz, 1H),
7.00 (dd, J ¼ 7.9, 1.5 Hz,1H), 3.45 (s, 2H); 13C NMR (100 MHz, DMSO-
DMSO-d6)
d
11.81 (s, 1H), 10.41 (s, 1H), 8.55 (dd, J ¼ 7.2, 2.0 Hz, 1H),
d6)
d
177.3, 176.1, 162.8, 162.2 (d, 1JCF ¼ 243.0 Hz), 144.7, 141.7, 138.6,
3
4
8.12 (dd, J ¼ 6.8, 2.0 Hz, 1H), 7.95 (dd, J ¼ 8.4, 8.4 Hz, 2H), 7.79 (dd,
J ¼ 8.4, 8.4 Hz, 2H), 7.50 (d, J ¼ 1.6 Hz, 1H), 7.12 (d, J ¼ 8.0 Hz, 1H),
6.95 (dd, J ¼ 8.0, 1.6 Hz, 1H), 6.73 (dd, J ¼ 7.2, 6.8 Hz, 1H), 3.40 (s,
137.3, 131.5 (d, JCF ¼ 8.0 Hz), 131.1 (d, JCF ¼ 3.0 Hz), 129.9, 125.2,
121.1, 118.7, 115.3 (d, 2JCF ¼ 21.2 Hz), 112.7, 101.8, 35.9; MS (ESI), m/
z ¼ 361.9 [MꢁH]ꢁ.
2H); 13C NMR (100 MHz, DMSO-d6)
d 177.2, 162.1, 161.4, 145.4,144.8,
143.9,143.7,138.2,128.8,126.9,126.8,125.2,121.6,121.3,112.7,107.7,
4.1.8.17. 5-(4-Methoxyphenyl)-4-oxo-N-(2-oxoindolin-6-yl)-1,4-
101.7, 35.9; MS (ESI), m/z ¼ 411.9 [MꢁH]ꢁ. Anal. calcd. for
dihydropyridine-3-carboxamide
(30b). 6-Aminoindolin-2-one
C
21H14N3O3F3$0.8H2O: C, 58.96; H, 3.68; N, 9.82. Found C, 58.94; H,
(80.5 mg, 0.5 mmol) was reacted with 29b (133.0 mg, 0.5 mmol)
in the presence of TBTU (250.0 mg, 0.8 mmol) and TEA (0.23 mL,
1.6 mmol) in dry DMF/acetonitrile (1:3, 3.2 mL) to afford 30b. Yield:
3.63; N, 9.93.
4.1.8.13. 1-(3-Chlorophenyl)-2-oxo-N-(2-oxoindolin-6-yl)-1,2-
130.0 mg, 65%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.02
dihydropyridine-3-carboxamide
(20g). 6-Aminoindolin-2-one
(s, 1H), 12.58 (br s, 1H), 10.39 (s, 1H), 8.54 (d, J ¼ 1.2 Hz, 1H), 7.99 (d,
J ¼ 1.2 Hz, 1H), 7.59 (dd, J ¼ 8.8, 8.8 Hz, 2H), 7.50 (d, J ¼ 1.2 Hz, 1H),
7.13 (d, J ¼ 8.0 Hz, 1H), 7.01e6.96 (m, 3H), 3.78 (s, 3H), 3.41 (s, 2H);
(80.5 mg, 0.5 mmol) was reacted with 16g (136.3, mg, 0.6 mmol)
in the presence of TBTU (250.0 mg, 0.8 mmol) and TEA (0.23 mL,
1.6 mmol) in dry DMF/acetonitrile (1:3, 3.2 mL) to afford crude 20g.
Yield: 80.5 mg, 39%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
13C NMR (100 MHz, DMSO-d6)
d 177.3, 176.3, 163.0, 159.4, 144.8,
141.3, 138.7, 136.6, 130.7, 127.0, 125.2, 121.1, 118.4, 113.9, 112.7, 101.8,
55.7, 35.9. Anal. Calc. for C21H17N3O4$0.6H2O: C, 65.31; H, 4.75; N,
10.88. Found C, 65.17; H, 4.63; N, 11.04.
d
11.83 (s, 1H), 10.41 (s, 1H), 8.53 (d, J ¼ 7.2 Hz, 1H), 8.08 (d,
J ¼ 6.8 Hz, 1H), 7.71 (s, 1H), 7.60 (s, 2H), 7.51 (s, 2H), 7.12 (d,

326
H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
4.1. 8 .18. 4 - O x o- N - ( 2 - o xo i n do li n- 6- yl) - 5 - p h e nyl - 1, 4 -
dihydropyridine-3-carboxamide (30c). 6-Aminoindolin-2-one
4.1.8.23. 5-(2-Fluorophenyl)-4-oxo-N-(2-oxoindolin-6-yl)-1,4-
dihydropyridine-3-carboxamide (30h). 6-Aminoindolin-2-one
(100.0 mg, 0.7 mmol) was reacted with 29c (143.0 mg, 0.7 mmol)
in the presence of TBTU (324.7 mg, 1.0 mmol) and TEA (0.30 mL,
2.1 mmol) in dry DMF/acetonitrile (1:3, 4.4 mL) to afford crude 30c.
Yield: 109.0 mg, 47%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
(148.0 mg, 1.0 mmol) was reacted with 29h (240.0 mg, 1.0 mmol)
in the presence of TBTU (487.0 mg, 1.5 mmol) and TEA (0.42 mL,
3.0 mmol) in dry DMF/acetonitrile (1:3, 6 mL) to afford 30h. Yield:
165.0 mg, 45%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 12.81
d
12.96 (s, 1H),12.52 (br s, 1H), 10.40 (s, 1H), 8.57 (s, 1H), 8.04 (s, 1H),
(s, 1H), 10.40 (s, 1H), 8.61 (d, J ¼ 1.6 Hz, 1H), 8.03 (d, J ¼ 1.6 Hz, 1H),
7.50 (d, J ¼ 1.6 Hz, 1H), 7.45e7.41 (m, 2H), 7.28e7.24 (m, 2H), 7.13 (d,
J ¼ 8.0 Hz, 1H), 6.97 (dd, J ¼ 8.0, 1.6 Hz, 1H), 3.41 (s, 2H); 13C NMR
7.63 (d, J ¼ 8 Hz, 2H), 7.50 (s,1H), 7.44e7.36 (m, 3H), 7.13 (d, J ¼ 8 Hz,
1H), 7.00 (d, J ¼ 8 Hz, 1H), 3.41 (s, 2H).
(100 MHz, DMSO-d6)
d
177.3, 175.8, 162.7, 160.3 (d, 1JCF ¼ 244.0 Hz),
4.1.8.19. 4-Oxo-N-(2-oxoindolin-6-yl)-5-p-tolyl-1,4-dihydropyridine-
3-carboxamide (30d). 6-Aminoindolin-2-one (80.5 mg, 0.5 mmol)
was reacted with 29d (124.0 mg, 0.5 mmol) in the presence of TBTU
(250.0 mg, 0.8 mmol) and TEA (0.23 mL, 1.6 mmol) in dry DMF/
acetonitrile (1:3, 3.2 mL) to afford 30d. Yield: 152.5 mg, 79%;
144.8, 142.2, 138.6, 132.6 (d, 3JCF ¼ 3.0 Hz), 130.5 (d, 3JCF ¼ 8.0 Hz),
126.7, 125.2, 124.6 (d, 4JCF ¼ 3.1 Hz), 122.7 (d, 2JCF ¼ 15.5 Hz), 121.2,
118.4, 115.9, 112.6, 101.8, 35.9. Anal. Calc. for C20H14FN3O3$0.8H2O:
C, 63.59; H, 4.16; N, 11.12. Found C, 63.52; H, 4.01; N, 11.21.
mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d
12.99 (s, 1H), 10.39 (s,
4.1. 8 . 24. 5-Methyl -4-o xo- N-(2 -ox oind ol in -6- yl )-1, 4-
1H), 8.55 (s, 1H), 7.99 (s, 1H), 7.54 (s, 1H), 7.51 (dd, J ¼ 7.6, 7.6 Hz,
2H), 7.21 (dd, J ¼ 7.6, 7.6 Hz, 2H), 7.13 (d, J ¼ 7.6 Hz, 1H), 7.00 (d,
J ¼ 7.6 Hz, 1H), 3.41 (s, 2H), 2.33 (s, 3H); 13C NMR (100 MHz, DMSO-
dihydropyridine-3-carboxamide
(30i). 6-Aminoindolin-2-one
(100.0 mg, 0.7 mmol) was reacted with 29i (107.0 mg, 0.7 mmol)
in the presence of TBTU (324.7 mg, 1.0 mmol) and TEA (0.30 mL,
2.1 mmol) in dry DMF/acetonitrile (1:3, 4.4 mL) to afford 30f. Yield:
d6)
d 177.3, 176.3, 162.9, 144.8, 141.5, 138.7, 137.4, 136.9, 131.9, 130.9,
129.3, 129.1, 125.2, 121.1, 118.5, 112.7, 101.8, 35.9, 21.4; MS (ESI), m/
z ¼ 358.0 [MꢁH]ꢁ. Anal. Calc. for C21H17N3O3$0.8H2O: C, 67.48; H,
5.02; N, 11.24. Found C, 67.27; H, 5.33; N, 11.42.
43.0 mg, 75%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.00 (s,
1H), 10.39 (br s, 1H), 8.49 (d, J ¼ 1.6 Hz, 1H), 7.84 (d, J ¼ 1.6 Hz, 1H),
7.49 (d, J ¼ 1.6 Hz, 1H), 7.13 (d, J ¼ 8.0 Hz, 1H), 6.99 (dd, J ¼ 8.0,
1.6 Hz, 1H), 3.41 (s, 2H), 1.99 (s, 3H); 13C NMR (100 MHz, DMSO-d6)
4.1.8.20. 5-(4-Chlorophenyl)-4-oxo-N-(2-oxoindolin-6-yl)-1,4-
d 177.8, 177.3, 163.2, 144.7, 141.3, 138.7, 136.0, 128.6, 125.2, 121.0,
dihydropyridine-3-carboxamide
(30e). 6-Aminoindolin-2-one
126.5, 112.6, 101.8, 35.9 (CH2), 13.8 (CH3); MS (ESI), m/z ¼ 281.9
[MꢁH]ꢁ. Anal. Calc. for C15H13N3O3$1H2O: C, 59.79; H, 5.02; N,
13.95. Found C, 59.82; H, 4.96; N, 13.68.
(100.0 mg, 0.7 mmol) was reacted with 29e (164.0 mg, 0.7 mmol)
in the presence of TBTU (324.7 mg, 1.0 mmol) and TEA (0.30 mL,
2.1 mmol) in dry DMF/acetonitrile (1:3, 4.4 mL) to afford crude 30e.
Yield: 86.1 mg, 34%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
4.1.9. Synthesis of compound 18
d
12.89 (s, 1H), 12.62 (br s, 1H), 10.39 (s, 1H), 8.57 (d, J ¼ 1.2 Hz, 1H),
SOCl2 (0.1 mL, 1.4 mmol) was added into a solution of 16a
(73.6 mg, 0.3 mmol) and DMF (cat) in DCM (10 mL). The resulting
reaction mixture was heated at reflux for 2 h. After evaporation, to
the residue was added 5-aminoindolin-2-one (60.0 mg, 0.4 mmol),
TEA (0.20 mL, 1.4 mmol), and dry DMF (5 mL). The mixture was
heated at 60 ꢀC for 1 h. The mixture was then diluted with water
(50 mL) and with EtOAc (3 ꢂ 50 mL). The organic layers were
combined, washed with brine, and concentrated in vacuo to afford
crude 18.
8.09 (d, J ¼ 1.2 Hz, 1H), 7.69 (dd, J ¼ 8.8, 8.8 Hz, 2H), 7.49e7.47 (m,
3H), 7.13 (d, J ¼ 8.0 Hz, 1H), 7.00 (dd, J ¼ 8.0, 1.6 Hz, 1H), 3.41 (s, 2H);
13C NMR (100 MHz, DMSO-d6)
d 177.2, 176.0, 162.8, 144.7, 141.8,
138.6, 137.5, 133.7, 132.8,131.2, 129.6,128.5, 125.2, 121.2, 118.8, 112.7,
101.8, 38.8, 35.9; MS (ESI), m/z ¼ 377.9 [MꢁH]ꢁ.
4.1.8.21. 4-Oxo-N-(2-oxoindolin-6-yl)-5-(4-(trifluoromethyl)
phenyl)-1,4-dihydropyridine-3-carboxamide (30f).
6-Aminoindolin-2-one (100.0 mg, 0.7 mmol) was reacted with 29f
(191.0 mg, 0.7 mmol) in the presence of TBTU (324.7 mg, 1.0 mmol)
and TEA (0.30 mL, 2.1 mmol) in dry DMF/acetonitrile (1:3, 4.4 mL)
to afford 30f. Yield: 148.0 mg, 53%; mp > 300 ꢀC. 1H NMR (400 MHz,
4.1.10. Syntheses of compounds 11e14, 21e25 and 31e36
A catalytic amount of pyrrolidine (0.001 equiv) was added into a
stirred ethanol solution (0.2 M) containing compound 9a/9b/10a/
10b/17e20/30 (1 equiv) and the appropriate pyrrole-2-
carbaldehyde (1.5 equiv). The reaction was irradiated with micro-
waves (CEM, Discover) at 100 ꢀC for 15 min. The crude product
precipitated with cooling.
DMSO-d6) d 12.84 (s, 1H), 10.39 (s, 1H), 8.59 (s, 1H), 8.16 (s, 1H), 7.88
(dd, J ¼ 8.0, 8.0 Hz, 2H), 7.77 (dd, J ¼ 8.0, 8.0 Hz, 2H), 7.48 (s,1H), 7.13
(d, J ¼ 8.0 Hz, 1H), 7.00 (d, J ¼ 8.0 Hz, 1H), 3.41 (s, 2H); 13C NMR
(100 MHz, DMSO-d6)
d 177.3, 175.9, 162.7, 144.8, 142.1, 139.1, 138.5,
138.2, 130.2, 129.4, 124.3 (m, CF3), 121.2, 118.9, 112.6, 101.8, 35.9; MS
(ESI), m/z ¼ 411.9 [MꢁH]ꢁ. Anal. (C21H14F3N3O3$1.1H2O) C, H, N. C,
58.23; H, 3.77; N, 9.70. Found C, 58.01; H, 3.69; N, 9.80.
4.1.10.1. (Z)-N1-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
N3-(4-fluorophenyl)malonamide
(11a). Condensation
of
9a
(80.0 mg, 0.2 mmol) with 1H-pyrrole-2-carbaldehyde (28.5 mg,
4.1.8.22. 5-(3-Chlorophenyl)-4-oxo-N-(2-oxoindolin-6-yl)-1,4-
0.3 mmol) afforded 11a. Yield: 42.5 mg, 44%; mp > 300 ꢀC. 1H NMR
dihydropyridine-3-carboxamide
(30g). 6-Aminoindolin-2-one
(400 MHz, DMSO-d6) d 13.22 (s, 1H), 10.87 (s, 1H), 10.21 (s, 1H),
(80.8 mg, 0.5 mmol) was reacted with and 29g (136.4 mg,
0.5 mmol) in the presence of TBTU (250.0 mg, 0.8 mmol) and TEA
(0.23 mL, 1.6 mmol) in dry DMF/acetonitrile (1:3, 3.2 mL) to afford
30g. Yield: 93.9 mg, 45%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-
10.20 (s, 1H), 7.62e7.60 (m, 3H), 7.54 (d, J ¼ 8.0 Hz, 1H), 7.45 (s, 1H),
7.31 (m, 1H), 7.17e7.13 (m, 2H), 7.09 (d, J ¼ 8.0 Hz, 1H), 6.77 (m, 1H),
6.33 (m, 1H), 3.46 (s, 2H); 13C NMR (100 MHz, DMSO-d6)
d 170.1,
1
165.9, 165.7, 158.6 (d, JCF ¼ 238.0 Hz), 139.9, 138.7, 135.9, 130.2,
3
d6)
d
12.87 (s, 1H), 10.41 (s, 1H), 8.58 (s, 1H), 8.12 (s, 1H), 7.75 (s, 1H),
125.7, 125.5, 121.4 (d, JCF ¼ 8.0 Hz), 120.9, 120.2, 119.4, 117.5, 115.9
2
7.59 (dd, J ¼ 7.2, 7.2 Hz, 2H), 7.51 (d, J ¼ 1.2 Hz, 1H), 7.47e7.40 (m,
(d, JCF ¼ 22.0 Hz), 112.5, 111.8, 101.5, 46.6 (CH2); MS (ESI), m/
2H), 7.13 (d, J ¼ 8.0 Hz, 1H), 7.01 (dd, J ¼ 8.0, 1.6 Hz, 1H), 3.41 (s, 2H);
z ¼ 402.9 [MꢁH]ꢁ. Anal. calcd. for C22H17FN4O3$0.2H2O: C, 64.76; H,
13C NMR (100 MHz, DMSO-d6)
d
177.3, 175.9, 162.7, 144.7, 141.9,
4.30; N, 13.73. Found C, 64.65; H, 4.29; N, 13.56.
138.6, 137.9, 133.1, 130.3, 129.3, 129.2, 128.0, 127.9, 125.2, 121.2,
118.9, 112.7, 101.9, 35.9; MS (ESI), m/z ¼ 377.9 [MꢁH]ꢁ. Anal. Calc.
for C20H14N3O3Cl$0.8H2O: C, 60.94; H, 3.99; N, 10.66. Found C,
60.75; H, 3.79; N, 11.09.
4.1.10.2. (Z)-N1-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
N3-(4-methoxyphenyl)malonamide (11b). Condensation of 9b
(80.0 mg, 0.2 mmol) with 1H-pyrrole-2-carbaldehyde (28.5 mg,

H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
327
0.3 mmol) afforded 11b. Yield: 70.0 mg, 70%; mp > 300 ꢀC. 1H NMR
(400 MHz, DMSO-d6) 13.22 (s, 1H), 10.88 (s, 1H), 10.20 (s, 1H),
(ESI), m/z ¼ 441.0 [MꢁH]ꢁ. Anal. calcd. for C25H22N4O4$0.2H2O: C,
d
67.31; H, 5.06; N, 12.56. Found C, 66.96; H, 5.08; N, 12.87.
10.02 (s, 1H), 7.60 (s, 1H), 7.55e7.50 (m, 3H), 7.46 (s, 1H), 7.31 (m,
1H), 7.09 (d, J ¼ 8.4 Hz, 1H), 6.88 (dd, J ¼ 9.2, 9.2 Hz, 2H), 6.77 (m,
1H), 6.33 (m, 1H), 3.71 (s, 3H), 3.44 (s, 2H); 13C NMR (100 MHz,
4.1.10.7. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-4-yl)-
1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide (21).
Condensation of 17 (92.0 mg, 0.3 mmol) with 1H-pyrrole-2-
carbaldehyde (42.7 mg, 0.45 mmol) afforded 21. Yield: 88.5 mg,
DMSO-d6) d 170.1,165.9,165.4,155.8,139.9,138.7, 132.7,130.2,125.7,
125.5, 121.2, 120.9, 120.2, 119.4, 117.5, 114.4, 112.5, 111.8, 101.5, 55.7,
46.4; MS (ESI), m/z ¼ 415.0 [MꢁH]ꢁ. Anal. calcd. for C23H20N4O4: C,
66.34; H, 4.84; N, 13.45. Found C, 65.69; H, 4.90; N, 13.35.
79%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.3 (s, 1H), 11.93
(s, 1H), 10.99 (s, 1H), 8.61 (dd, J ¼ 7.6, 1.6 Hz, 1H), 8.14e8.16 (m, 2H),
7.67e7.73 (m, 3H), 7.45 (m, 2H), 7.30 (m, 1H), 7.15 (dd, J ¼ 8.0,
8.0 Hz, 1H), 6.74 (dd, J ¼ 7.6, 7.2 Hz, 1H), 6.51 (m, 1H), 6.28 (m, 1H);
4 .1.10 . 3 . ( Z ) - 5 - ( ( 6 - ( 3 - ( 4 - m e t h o x y p h e n y l a m i n o ) - 3 -
oxopropanamido)-2-oxoindolin-3-ylidene)methyl)-2,4-dimethyl-1H-
pyrrole-3-carboxylic acid (12). Condensation of 9b (55.0 mg,
0.16 mmol) with 5-formyl-2,4-dimethyl-1H-pyrrole-3-carboxylic
acid (23.0 mg, 0.24 mmol) afforded 12. Yield: 57.1 mg, 65%;
13C NMR (100 MHz, DMSO-d6)
d
169.4, 162.5 (d, 1JCF ¼ 244.2 Hz),
162.7, 162.2, 145.6, 144.5, 140.6, 136.9, 131.9, 129.9, 129.9 (d,
3JCF ¼ 9.1 Hz), 128.8, 127.3, 126.3, 122.1, 121.2, 117.4, 116.6, 116.6 (d,
2JCF ¼ 23.0 Hz), 115.4, 111.8, 107.6, 106.9; MS (ESI), m/z ¼ 439
[MꢁH]ꢁ. Anal. Calc. for C25H17N4O3F$0.1H2O: C, 67.90; H, 3.92; N,
12.67. Found C, 67.57; H, 3.96; N, 12.39.
mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.68 (s, 1H), 10.92 (s,
1H), 10.19 (s, 1H), 10.01 (s, 1H), 7.70 (d, J ¼ 8.4 Hz, 1H), 7.50 (d,
J ¼ 8.8 Hz, 2H), 7.45 (d, J ¼ 1.2 Hz,1H), 7.10 (d, J ¼ 8.4 Hz,1H), 6.88 (d,
J ¼ 9.2 Hz, 2H), 3.71 (s, 3H), 3.43 (s, 2H), 2.51 (s, 3H), 2.46 (s, 3H); 13
C
4.1.10.8. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-5-yl)-
1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide (22).
Condensation of 18 (108.0 mg, 0.3 mmol) with 1H-pyrrole-2-
carbaldehyde (42.7 mg, 0.45 mmol) afforded 22. Yield: 41.6 mg,
NMR (100 MHz, DMSO-d6)
d 169.7, 165.9, 165.2, 164.7, 155.1, 139.7,
138.9, 137.9, 132.0, 131.3, 125.9, 121.8, 120.5, 120.4, 119.1, 116.2, 113.8,
113.7, 111.8, 100.8, 55.0 (OCH3), 45.7 (CH2), 14.34 (CH3), 11.30 (CH3).
Anal. calcd. for (C23H20N4O4$0.5H2O) C, 62.77; H, 5.07; N, 11.26.
Found C, 62.68; H, 4.95; N, 11.28.
30%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.30 (s, 1H),
11.92 (s, 1H), 10.84 (s, 1H), 8.56 (dd, J ¼ 7.2, 2.0 Hz, 1H), 8.07 (dd,
J ¼ 6.8, 2.0 Hz, 1H), 7.92 (d, J ¼ 1.6 Hz, 1H), 7.76 (s, 1H), 7.61e7.57 (m,
2H), 7.55 (dd, J ¼ 8.4, 1.6 Hz), 7.43 (dd, J ¼ 8.8, 8.8 Hz, 2H), 7.34 (m,
1H), 6.85e6.83 (m, 2H), 6.71 (dd, J ¼ 7.2, 6.8 Hz, 1H), 6.34 (m, 1H);
4.1.10.4. (Z)-N1-(3-((3,5-dimethyl-4-(2-(pyrrolidin-1-yl)ethyl-
carbamoyl)-1H-pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-N3-(4-
methoxyphenyl)malonamide (13). Condensation of 9b (60.0 mg,
0.17 mmol) with 5-formyl-2,4-dimethyl-N-(2-(pyrrolidin-1-yl)
ethyl)-1H-pyrrole-3-carboxamide (67.0 mg, 0.25 mmol), prepared
by the reaction of 5-formyl-2,4-dimethyl-1H-pyrrole-3-carboxylic
acid with 2-(pyrrolidin-1-yl)ethanamine (1.2 equiv) [47], afforded
13. Yield: 70.0 mg, 68%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
13C NMR (100 MHz, DMSO-d6)
d
169.8, 162.4 (d, 1JCF ¼ 244.4 Hz),
162.4, 162.3, 144.9, 144.0, 136.9, 136.8, 135.9, 133.1, 130.1, 129.8 (d,
3JCF ¼ 9.1 Hz), 127.3, 126.4, 126.2, 121.2, 119.1, 117.2, 116.6 (d,
2JCF ¼ 22.9 Hz), 112.0, 111.1, 110.2, 107.5; MS (ESI), m/z ¼ 439.0
[MꢁH]ꢁ. Anal. Calc. for C25H17N4O3F: C, 68.18; H, 3.89; N, 12.72.
Found C, 67.94; H, 3.88; N, 12.69.
d
13.47 (s, 1H), 10.86 (s, 1H), 10.17 (s, 1H), 10.00 (s, 1H), 7.67 (d,
J ¼ 8.4 Hz, 1H), 7.45e7.52 (m, 5H), 7.09 (dd, J ¼ 8.4, 1.6 Hz, 1H), 6.88
(d, J ¼ 8.8 Hz, 2H), 3.71 (s, 3H), 3.42 (s, 2H), 2.56 (t, J ¼ 6.8 Hz, 2H),
2.41 (s, 3H), 2.36 (s, 3H), 1.67 (br s, 4H); 13C NMR (100 MHz, DMSO-
4.1.10.9. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-7-yl)-
1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide (23).
Condensation of 19 (72.0 mg, 0.2 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 23. Yield: 79.6 mg,
d6) d 169.7, 165.2, 164.8, 164.5, 155.1, 138.7, 137.6, 135.0, 132.0, 128.2,
82%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.30 (s, 1H),
125.6, 121.9, 120.6, 120.5, 120.2, 118.8, 115.1, 113.7, 111.7, 100.7, 55.0,
54.6, 53.4, 45.7, 37.8, 23.0, 13.0, 10.3. Anal. (C23H20N4O4$0.3H2O) C,
65.07; H, 6.26; N, 14.23. Found C, 65.05; H, 6.17; N, 14.23.
11.35 (s, 1H), 10.58 (s, 1H), 8.55 (dd, J ¼ 7.2, 2.0 Hz, 1H), 8.09 (dd,
J ¼ 6.8, 2.0 Hz,1H), 7.78 (s,1H), 7.57e7.60 (m, 2H), 7.52 (d, J ¼ 7.6 Hz,
1H), 7.39e7.44 (m, 2H), 7.36 (m,1H), 7.16 (d, J ¼ 7.6 Hz,1H), 7.00 (dd,
J ¼ 7.6, 7.6 Hz, 1H), 6.86 (m, 1H), 6.71 (dd, J ¼ 7.2, 6.8 Hz, 1H),
4.1.10.5. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
N-(4-fluorophenyl)cyclopropane-1,1-dicarboxamide
(14a).
6.36 (m, 1H); 13C NMR (100 MHz, DMSO-d6)
d 169.4, 162.3 (d,
Condensation of 10a (50.0 mg, 0.1 mmol) with 1H-pyrrole-2-
carbaldehyde (14.25 mg, 0.15 mmol) afforded 14a. Yield: 32.0 mg,
1JCF ¼ 245.0 Hz), 162.2, 162.1, 145.2, 144.2, 136.8, 133.1, 130.1, 129.8
(d, 3JCF ¼ 9.0 Hz), 127.5, 127.1, 126.6, 123.1, 121.9, 121.3, 121.2, 120.7,
53%; mp 281e283 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d
13.20 (s, 1H),
117.1, 116.6 (d, JCF ¼ 23.0 Hz), 116.4, 112.1, 107.3; MS (ESI), m/
2
10.89 (s, 1H), 10.11 (s, 1H), 9.98 (s, 1H), 7.63e7.60 (m, 3H), 7.52 (d,
J ¼ 8.4 Hz, 1H), 7.42 (s, 1H), 7.31 (m, 1H), 7.16e7.11 (m, 3H), 6.77 (m,
z ¼ 439.0 [MꢁH]ꢁ. Anal. Calc. for C25H17N4O3F$0.3H2O: C, 67.35; H,
3.98; N, 12.57. Found C, 67.29; H, 3.94; N, 12.21.
1H), 6.33 (m,1H),1.45 (s, 4H); 13C NMR (100 MHz, DMSO-d6)
d
170.1,
1
168.9, 168.4, 158.8 (d, JCF ¼ 238.0 HZ), 139.7, 138.6, 135.7, 135.6,
4.1.10.10. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide (24a).
Condensation of 20a (65.8 mg, 0.2 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 24a. Yield: 67.0 mg,
3
130.1, 125.7, 125.6, 123.0 (d, JCF ¼ 8.0 Hz), 121.1, 120.2, 119.1, 117.5,
115.5 (d, 2JCF ¼ 22.0 Hz), 113.7, 111.8, 10.27, 32.1, 15.9 (CH2); MS (ESI),
m/z ¼ 429.0 [MꢁH]ꢁ. Anal. calcd. for C24H19FN4O3: C, 66.97; H, 4.45;
N, 13.02. Found C, 66.82; H, 4.39; N, 12.73.
84%; mp 295e296 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.23 (s, 1H),
12.01 (s, 1H), 10.93 (s, 1H), 8.56 (dd, J ¼ 7.2, 2.0 Hz, 1H), 8.09 (dd,
J ¼ 6.8, 2.0 Hz, 1H), 7.64 (s, 1H), 7.55e7.62 (m, 4H), 7.39e7.43 (m,
2H), 7.32 (m,1H), 7.04 (dd, J ¼ 8.2, 2.0 Hz,1H), 6.78 (m,1H), 6.71 (dd,
4.1.10.6. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
N-(4-methoxyphenyl)cyclopropane-1,1-dicarboxamide
(14b).
Condensation of 10b (60.0 mg, 0.2 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 14b. Yield: 38.0 mg,
J ¼ 7.2, 6.8 Hz, 1H); 13C NMR (100 MHz, DMSO-d6)
d 170.1, 162.4 (d,
1JCF ¼ 244.4 Hz), 162.4, 161.5, 145.1, 144.3, 140.1, 137.9, 136.8, 130.2,
129.8 (d, 3JCF ¼ 8.9 Hz), 125.9, 125.8, 121.4, 121.1, 120.4, 119.7, 117.3,
52%; mp 256 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.22 (s, 1H), 10.88
2
(s, 1H), 10.19 (s, 1H), 9.76 (s, 1H), 7.60 (s, 1H), 7.53e7.47 (m, 3H), 7.42
(s, 1H), 7.31 (m, 1H), 7.14 (dd, J ¼ 8.2, 1.6 Hz, 1H), 6.87 (dd, J ¼ 9.2,
9.2 Hz, 2H), 6.77 (m, 1H), 6.33 (m, 1H), 3.71 (s, 3H), 1.45 (s, 4H); MS
116.6 (d, JCF ¼ 22.9 Hz), 113.2, 111.9, 107.6, 101.9; MS (ESI), m/
z ¼ 439.0 [MꢁH]ꢁ. Anal. Calc. for C25H17N4O3F$0.5H2O: C, 66.81; H,
4.04; N, 12.47. Found C, 66.48; H, 3.82; N, 12.25.

328
H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
4.1.10.11. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
1-(4-methoxyphenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide
(24b). Condensation of 20b (78.2 mg, 0.2 mmol) with 1H-pyrrole-
2-carbaldehyde (28.5 mg, 0.3 mmol) afforded 24b. Yield: 65.2 mg,
8.0 Hz, 2H), 7.62 (s, 1H), 7.60 (s, 1H), 7.56 (d, J ¼ 8.4 Hz, 1H), 7.31 (m,
1H), 7.04 (d, J ¼ 8.0 Hz, 1H), 6.78 (m, 1H), 6.74 (dd, J ¼ 6.8, 6.8 Hz,
1H), 6.33 (m, 1H); 13C NMR (100 MHz, DMSO-d6)
d 170.1, 162.2,
161.3,145.3,143.9,143.7,140.1,137.8,130.2,130.1,128.8,126.9,126.8,
125.8, 125.7, 121.5, 121.3, 120.4, 119.7, 117.3, 113.1, 111.8, 107.8, 101.9;
MS (ESI), m/z ¼ 489.0 [MꢁH]ꢁ. Anal. Calc. for C26H17N4O3F3: C,
63.67; H, 3.49; N, 11.42. Found C, 63.28; H, 3.39; N, 11.45.
69%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.22 (s, 1H),
12.09 (s, 1H), 10.93 (s, 1H), 8.54 (dd, J ¼ 7.2, 2.0 Hz, 1H), 8.05 (dd,
J ¼ 6.8, 2.0 Hz, 1H), 7.63 (s, 1H), 7.62 (d, J ¼ 1.6 Hz, 1H), 7.58 (d,
J ¼ 8.4 Hz, 1H), 7.43 (dd, J ¼ 8.8, 8.8 Hz, 2H), 7.32 (m, 1H), 7.09 (dd,
J ¼ 8.8, 8.8 Hz, 2H), 7.04 (dd, J ¼ 8.4, 1.6 Hz, 1H), 6.78 (m, 1H), 6.68
(dd, J ¼ 7.2, 6.8 Hz, 1H), 6.32 (m, 1H), 3.83 (s, 3H); 13C NMR
4.1.10.16. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
1-(3-chlorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide (24g).
Condensation of 20g (62.3 mg, 0.2 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 24g. Yield: 63.2 mg,
(100 MHz, DMSO-d6)
d 170.1, 162.5, 161.6, 159.9, 144.9, 144.6, 140.1,
137.9, 133.4, 130.1, 128.6, 125.9, 125.7, 121.4, 120.9, 120.4, 119.7, 117.4,
114.8, 113.1, 111.8, 107.4, 101.9, 56.1; MS (FAB), m/z ¼ 452.5 [M]þ.
Anal. Calc. for C26H20N4O4$0.5H2O: C, 67.67; H, 4.59; N, 12.14. Found
C, 67.76; H, 4.50; N, 11.85.
84%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.22 (s, 1H, NH),
11.95 (s, 1H), 10.93 (s, 1H), 8.56 (dd, J ¼ 6.8, 2.0 Hz, 1H), 8.09 (dd,
J ¼ 6.8, 2.0 Hz,1H), 7.73 (s,1H), 7.59e7.60 (m, 3H), 7.56 (d, J ¼ 8.0 Hz,
1H), 7.53e7.50 (m, 1H), 7.31 (m, 1H), 7.05 (dd, J ¼ 8.0, 2.0 Hz, 1H),
6.78 (m, 1H), 6.72 (dd, J ¼ 6.8, 6.8 Hz, 1H), 6.33 (m, 1H); 13C NMR
4.1.10.12. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
2-oxo-1-phenyl-1,2-dihydropyridine-3-carboxamide
(24c).
(100 MHz, DMSO-d6) d 170.1, 162.2, 161.5, 145.3, 144.0, 141.7, 140.1,
Condensation of 20c (64.7 mg, 0.2 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 24c. Yield: 52.6 mg,
137.8, 133.8, 131.5, 130.2, 129.6, 127.8, 126.5, 125.9, 125.8, 121.5,
121.2, 120.5, 119.7, 117.3, 113.2, 111.9, 107.7, 101.9; MS (FAB), m/
z ¼ 456.4 [M]þ. Anal. Calc. for C25H17N4O3Cl$0.3H2O: C, 64.95; H,
3.84; N, 12.12. Found C, 64.75; H, 3.93; N, 12.46.
66%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.22 (s, 1H),
12.04 (s, 1H), 10.93 (s, 1H), 8.56 (dd, J ¼ 7.8, 2.0 Hz, 1H), 8.09 (dd,
J ¼ 6.8, 2.0 Hz, 1H), 7.51e7.63 (m, 8H), 7.31 (m, 1H), 7.04 (d,
J ¼ 8.0 Hz, 1H), 6.77 (m, 1H), 6.71 (dd, J ¼ 7.8, 6.8 Hz, 1H), 6.33 (m,
4.1.10.17. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
1H); 13C NMR (100 MHz, DMSO-d6)
d
170.1,162.3,151.5,145.0,144.3,
1-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide
(24h).
140.6, 140.1, 137.9, 130.2, 129.8, 130.2, 129.8, 129.5, 127.5, 125.9,
125.8, 121.4, 121.1, 120.4, 119.7, 117.4, 113.1, 111.8, 107.5, 101.9; MS
(ESI), m/z ¼ 421.0 [MꢁH]ꢁ. Anal. Calc. for C25H18N4O3F$H2O: C,
68.17; H, 4.58; N, 12.72. Found C, 68.36; H, 4.34; N, 12.51.
Condensation of 20h (80.8 mg, 0.3 mmol) with 1H-pyrrole-2-
carbaldehyde (42.75 mg, 0.45 mmol) afforded 24h. Yield:
67.0 mg, 65%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.20 (s,
1H),12.47 (s, 1H),10.92 (s,1H), 8.42 (dd, J ¼ 7.2, 2.0 Hz,1H), 8.12 (dd,
J ¼ 6.8, 2.0 Hz, 1H), 7.63 (s, 1H), 7.62 (d, J ¼ 1.6 Hz, 1H), 7.57 (d,
J ¼ 8.4 Hz, 1H), 7.32 (m, 1H), 7.06 (dd, J ¼ 8.4, 1.6 Hz, 1H), 6.78 (m,
1H), 6.58 (dd, J ¼ 7.2, 6.8 Hz, 1H), 6.33 (m, 1H), 3.32 (s, 3H); 13C NMR
4.1.10.13. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
2-oxo-1-(p-tolyl)-1,2-dihydropyridine-3-carboxamide
(24d).
Condensation of 20d (59.5 mg, 0.2 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 24d. Yield: 58.8 mg,
(100 MHz, DMSO-d6) d 170.1, 162.6, 161.8, 144.9, 143.9, 140.1, 138.0,
130.2, 125.8, 125.7, 121.3, 120.3, 119.8, 119.7, 117.4, 113.1, 111.8, 107.1,
101.9, 38.4.Anal. (C20H16N4O3$0.2H2O) C, H, N. C, 66.00; H, 4.54; N,
15.39. Found C, 65.82; H, 4.52; N, 15.30.
79%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.22 (s, 1H),
12.06 (s, 1H), 10.93 (s, 1H), 8.54 (d, J ¼ 6.8 Hz,1H), 8.04 (d, J ¼ 6.8 Hz,
1H), 7.55e7.62 (m, 3H), 7.31e7.37 (m, 5H), 7.03 (d, J ¼ 8.0 Hz, 1H),
6.77 (m, 1H), 6.68 (dd, J ¼ 6.8, 6.8 Hz, 1H), 6.33 (m, 1H), 2.34 (s, 3H);
4.1.10.18. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
1-(2-hydroxyethyl)-2-oxo-1,2-dihydropyridine-3-carboxamide (24i).
Condensation of 20i (94.0 mg, 0.3 mmol) with 1H-pyrrole-2-
carbaldehyde (42.75 mg, 0.45 mmol) afforded 24i. Yield:
102.0 mg, 87%; blackened at 298 ꢀC. 1H NMR (400 MHz, DMSO-d6)
13C NMR (100 MHz, DMSO-d6)
d 170.1, 162.4, 161.6, 144.9, 144.3,
140.1, 139.1,138.2,137.9, 130.2,127.2, 125.8,125.7, 121.4, 120.9,120.4,
119.7, 117.4, 113.1, 111.8, 107.5, 101.9, 21.2; MS (ESI), m/z ¼ 437.2
[MþH]þ. Anal. Calc. for C26H20N4O3$0.5H2O: C, 70.10; H, 4.75; N,
12.58. Found C, 70.23; H, 4.79; N, 12.47.
d
13.22 (s, 1H), 12.27 (s, 1H), 10.91 (s, 1H), 8.45 (dd, J ¼ 7.4, 2.0 Hz,
1H), 8.02 (dd, J ¼ 6.8, 2.0 Hz, 1H), 7.64 (s, 1H), 7.63 (d, J ¼ 1.6 Hz, 1H),
7.58 (d, J ¼ 8.2 Hz, 1H), 7.31 (m, 1H), 7.06 (dd, J ¼ 8.2, 1.6 Hz, 1H),
6.78 (m, 1H), 6.59 (dd, J ¼ 7.4, 6.8 Hz, 1H), 6.33 (m, 1H), 4.95 (t,
J ¼ 5.2 Hz, 1H), 4.15 (t, J ¼ 5.2 Hz, 2H), 3.72 (q, J ¼ 5.2 Hz, 2H); 13C
4.1.10.14. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
1-(4-chlorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide (24e).
Condensation of 20e (64.5 mg, 0.2 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 24e. Yield: 46.8 mg,
NMR (100 MHz, DMSO-d6)
d 170.1, 162.2, 161.8, 145.4, 144.1, 140.1,
60%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d
13.22 (s, 1H),
138.0, 130.2, 125.8, 125.7, 121.3, 120.3, 119.9, 119.7, 117.4, 113.1, 111.8,
106.8, 101.9, 58.7, 53.0; MS (ESI), m/z ¼ 389.0 [MꢁH]ꢁ. Anal.
(C21H18N4O4$0.25H2O) C, H, N. C, 63.87; H, 4.72; N, 14.19. Found C,
64.22; H, 4.96; N, 13.80.
11.97 (s, 1H), 10.93 (s, 1H), 8.55 (dd, J ¼ 7.2, 2.0 Hz, 1H), 8.08 (dd,
J ¼ 6.8, 2.0 Hz, 1H), 7.55e7.65 (m, 7H), 7.31 (m, 1H), 7.04 (dd, J ¼ 8.2,
1.2 Hz, 1H), 6.78 (m, 1H), 6.71 (dd, J ¼ 7.2, 6.8 Hz, 1H), 6.32 (m, 1H);
13C NMR (100 MHz, DMSO-d6)
d 170.1, 162.2, 161.4, 145.2, 144.1,
140.1, 139.4, 137.9, 134.1, 130.2,129.7, 129.5, 125.9, 125.8,121.5, 121.2,
120.4, 119.7, 117.4, 113.1, 111.8, 107.6, 101.9; MS (FAB), m/z ¼ 456.4
[M]þ. Anal. Calc. for C25H17N4O3Cl$0.8H2O: C, 63.71; H, 3.98; N,
11.89. Found C, 63.74; H, 3.84; N, 11.54.
4.1.10.19. (Z)-5-((6-(1-(4-Fluorophenyl)-2-oxo-1,2-dihydropyridine-
3-carboxamido)-2-oxoindolin-3-ylidene)methyl)-2,4-dimethyl-1H-
pyrrole-3-carboxylic acid (25a). Condensation of 20a (61.1 mg,
0.2 mmol) with 3,5-dimethyl-4-hydroxycarbonyl-1H-pyrrole-2-
carboxaldehyde (50.1 mg, 0.3 mmol) afforded 25a. Yield: 42.4 mg,
4.1.10.15. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
2-oxo-1-(4-(trifluoromethyl)phenyl)-1,2-dihydropyridine-3-
carboxamide (24f). Condensation of 20f (80.0 mg, 0.1 mmol) with
1H-pyrrole-2-carbaldehyde (28.5 mg, 0.3 mmol) afforded 24f.
Yield: 70.0 mg, 77%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
49%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.70 (s, 1H),
11.99 (s, 1H), 10.96 (s, 1H), 8.54 (dd, J ¼ 7.2, 2.0 Hz, 1H), 8.07 (dd,
J ¼ 6.8, 2.0 Hz,1H), 7.71 (d, J ¼ 8.4 Hz,1H), 7.62e7.58 (m, 3H), 7.54 (s,
1H), 7.41 (dd, J ¼ 8.8, 8.8 Hz, 2H), 7.00 (d, 1H, J ¼ 8.4 Hz), 6.69 (dd,
J ¼ 7.2, 6.8 Hz, 1H), 2.51 (s, 3H), 2.46 (s, 3H); 13C NMR (100 MHz,
1
d
13.32 (s,1H),11.91 (s, 1H),10.93 (s,1H), 8.57 (d, J ¼ 6.8 Hz,1H), 8.12
DMSO-d6)
d
170.4, 166.6, 162.4 (d, JCF ¼ 244.0 Hz), 162.3, 161.5,
(d, J ¼ 6.8 Hz, 1H), 7.96 (dd, J ¼ 8.0, 8.0 Hz, 2H), 7.79 (dd, J ¼ 8.0,
145.1, 144.2, 140.6, 139.7, 137.7, 136.8, 132.0, 129.8 (d, 3JCF ¼ 8.8 Hz),

H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
329
126.6, 122.7, 121.7, 121.0, 119.9, 116.6 (d, 2JCF ¼ 22.9 Hz),116.6, 114.4,
113.2, 107.6, 101.9, 14.9, 11.9; MS (ESI), m/z ¼ 511.0 [MꢁH]ꢁ. Anal.
Calc. for C28H21FN4O5$1H2O: C, 63.39; H, 4.37; N, 10.56. Found C,
63.45; H, 4.11; N, 10.82.
4.1.10.24. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
4-oxo-5-p-tolyl-1,4-dihydropyridine-3-carboxamide (31d).
Condensation of 30d (63.8 mg, 0.2 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 31d. Yield: 32.0 mg,
41%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.22 (s, 1H),
13.13 (s, 1H), 10.91 (s, 1H), 8.57 (d, J ¼ 1.2 Hz, 1H), 8.01 (d, J ¼ 1.2 Hz,
1H), 7.64 (s, 1H), 7.60 (d, J ¼ 1.4 Hz, 1H), 7.58e7.53 (m, 3H), 7.31 (m,
1H), 7.23 (d, J ¼ 7.9 Hz, 2H), 7.07 (dd, J ¼ 8.4, 1.4 Hz, 1H), 6.78 (m,
1H), 6.33 (m, 1H), 2.33 (s, 3H); 13C NMR (100 MHz, DMSO-d6)
4.1.10.20. (Z)-2,4-dimethyl-5-((6-(1-methyl-2-oxo-1,2-
dihydropyridine-3-carboxamido)-2-oxoindolin-3-ylidene)methyl)-
1H-pyrrole-3-carboxylic acid (25h). Condensation of 20h
(100.0 mg, 0.4 mmol) with 3,5-dimethyl-4-hydroxycarbonyl-1H-
pyrrole-2-carboxaldehyde (100.0 mg, 0.6 mmol) afforded 25h.
Yield: 105.0 mg, 69%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d
176.3, 170.1, 162.9, 141.5, 140.1, 138.3, 137.4, 137.0, 131.9, 130.9,
130.2, 129.3, 129.1, 125.7, 125.6, 121.1, 120.2, 119.7, 118.5, 117.5, 113.1,
111.8, 101.9, 21.4; MS (ESI), m/z ¼ 435.0 [MꢁH]ꢁ. Anal. Calc. for
d
13.65 (s, 1H), 12.24 (s, 1H), 10.93 (br s, 1H), 8.41 (dd, J ¼ 6.8, 1.6 Hz,
C26H20N4O3$0.8H2O: C, 69.26; H, 4.83; N, 12.43. Found C, 69.19; H,
1H), 8.10 (dd, J ¼ 6.8, 1.6 Hz, 1H), 7.71 (d, J ¼ 8.4 Hz, 1H), 7.60 (d,
J ¼ 1.6 Hz, 1H), 7.53 (s, 1H), 7.03 (dd, J ¼ 8.4, 1.6 Hz, 1H), 6.57 (dd,
J ¼ 6.8, 6.8 Hz, 1H), 3.61 (s, 3H), 2.51 (s, 3H), 2.46 (s, 3H); 13C NMR
5.02; N, 12.08.
4.1.10.25. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
5-(4-chlorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxamide (31e).
Condensation of 30e (63.0 mg, 0.2 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 31e. A reaction analo-
gous to that described for 21 was performed starting with. Yield:
(100 MHz, DMSO-d6) d 170.4, 166.6, 162.6, 161.7, 144.8, 143.9, 140.4,
139.7, 137.9, 132.1, 126.6, 122.5, 121.5, 120.0, 119.8, 116.8, 114.4, 113.0,
107.1, 101.8, 38.4 (CH3), 15.0 (CH3), 11.9 (CH3); MS (ESI), m/z ¼ 431.0
[MꢁH]ꢁ. Anal. Calc. for C23H20N4O5$0.5H2O: C, 62.58; H, 4.79; N,
12.69. Found C, 62.52; H, 4.88; N, 12.65.
52.0 mg, 69%; mp > 300 ꢀC. 1H NMR (200 MHz, DMSO-d6)
d 13.25 (s,
1H), 13.07 (s, 1H), 12.68 (br s, 1H), 10.96 (s, 1H), 8.60 (d, J ¼ 1.2 Hz,
1H), 8.12 (d, J ¼ 1.2, 1H), 7.72 (d, J ¼ 8.4 Hz, 2H), 7.66e7.57 (m, 3H),
7.50 (d, J ¼ 8.4 Hz, 2H), 7.33 (m, 1H), 7.09 (dd, J ¼ 8.0, 1.7 Hz, 1H),
4.1.10.21. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
5-(4-fluorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxamide (31a).
Condensation of (79.4 mg, 0.2 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 31a. Yield: 29.5 mg,
6.80 (m, 1H), 6.34 (m, 1H); 13C NMR (50 MHz, DMSO-d6)
d 178.8,
173.1, 166.0,146.0,144.3,142.5,141.9, 138.1,137.3, 135.8,134.8,134.2,
133.2, 130.3, 130.4, 126.1, 125.3, 124.7, 123.8, 122.6, 118.4, 117.2,
31%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.22 (s, 1H),
13.07 (s,1H),12.60 (s,1H),10.92 (s,1H), 8.58 (s,1H), 8.07 (s,1H), 7.70
(m, 2H), 7.63 (s, 1H), 7.61 (d, J ¼ 1.6 Hz, 1H), 7.57 (d, J ¼ 8.4 Hz, 1H),
7.31 (m, 1H), 7.25 (dd, J ¼ 8.4, 8.4 Hz, 2H), 7.08 (dd, J ¼ 8.4, 1.6 Hz,
107.6; MS (ESI), m/z
¼
455.0 [MꢁH]ꢁ. Anal. Calc. for
C25H17N4O3Cl$0.5H2O: C, 64.45; H, 3.89; N,12.03. Found C, 64.41; H,
3.81; N, 11.90.
1H), 6.78 (m, 1H), 6.33 (m, 1H); 13C NMR (100 MHz, DMSO-d6)
1
d
176.1, 170.1, 162.8, 162.3 (d, JCF ¼ 243.0 Hz), 141.7, 140.1, 138.3,
4.1.10.26. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
4-oxo-5-(4-(trifluoromethyl)phenyl)-1,4-dihydropyridine-3-
carboxamide (31f). Condensation of 30f (80.0 mg, 0.2 mmol) with
1H-pyrrole-2-carbaldehyde (28.5 mg, 0.3 mmol) afforded 31f.
Yield: 63.5 mg, 67%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
137.4, 131.6, 131.5, 130.2, 129.9, 125.8, 125.6, 121.1, 120.3, 119.7, 118.7,
2
117.5, 115.3 (d, JCF ¼ 21.1 Hz), 113.1, 111.8, 101.9; MS (ESI), m/
z ¼ 439.0 [MꢁH]ꢁ. Anal. Calc. for C25H17N4O3F$0.5H2O: C, 66.81; H,
4.04; N, 12.47. Found C, 66.68; H, 3.99; N, 12.25.
d
13.24 (s, 1H), 12.99 (s, 1H), 12.68 (br s, 1H), 10.91 (s, 1H), 8.62 (d,
J ¼ 1.2 Hz,1H), 8.18 (d, J ¼ 1.2 Hz,1H), 7.90 (d, J ¼ 8.0 Hz, 2H), 7.78 (d,
J ¼ 8.0 Hz, 2H), 7.63 (s, 1H), 7.60 (d, J ¼ 1.5 Hz,1H), 7.57 (d, J ¼ 8.2 Hz,
1H), 7.31 (m, 1H), 7.08 (dd, J ¼ 8.2, 1.5 Hz, 1H), 6.78 (m, 1H), 6.32 (m,
4.1.10.22. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
5-(4-methoxyphenyl)-4-oxo-1,4-dihydropyridine-3-carboxamide
(31b). Condensation of 30b (59.2 mg, 0.2 mmol) with 1H-pyrrole-
2-carbaldehyde (28.5 mg, 0.3 mmol) afforded 31b. Yield: 35.0 mg,
1H); 13C NMR (100 MHz, DMSO-d6)
d 175.9, 170.1, 162.6, 142.2, 140.1,
139.1, 138.2, 130.2, 130.1, 129.4, 125.8, 125.6, 125.3, 121.2, 120.3,
119.7, 118.9, 117.4, 113.1, 111.8, 101.9; MS (ESI), m/z ¼ 489.0 [MꢁH]ꢁ.
Anal. Calc. for C26H17N4O3F3$1H2O: C, 61.42; H, 3.77; N, 11.02. Found
C, 61.76; H, 3.40; N, 11.15.
49%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.22 (s, 1H),
13.15 (s, 1H), 10.92 (s, 1H), 8.55 (s, 1H), 8.00 (s, 1H), 7.63e7.56 (m,
5H), 7.31 (m, 1H), 7.08 (d, J ¼ 8.4 Hz, 1H), 6.98 (d, J ¼ 8.4 Hz, 2H),
6.78 (m, 1H), 6.33 (m, 1H), 3.79 (s, 3H); 13C NMR (100 MHz, DMSO-
d6) d 176.3, 170.2, 162.9, 159.4, 141.4, 140.1, 138.4, 136.7, 130.7, 130.2,
4.1.10.27. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
5-(3-chlorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxamide (31g).
Condensation of 30g (80.0 mg, 0.2 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 31g. Yield: 59.1 mg,
127.1, 125.7, 125.5, 121.1, 120.2, 119.7, 118.4, 117.5, 113.9, 113.1, 111.8,
101.9, 55.7; MS (ESI), m/z ¼ 451.0 [MꢁH]ꢁ. Anal. Calc. for
C
26H20N4O4$0.5H2O: C, 67.67; H, 4.59; N, 12.14. Found C, 67.51; H,
4.55; N, 11.86.
61%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.23 (s, 1H),
12.97 (s, 1H), 12.64 (br s, 1H), 10.91 (s, 1H), 8.59 (d, J ¼ 1.3 Hz, 1H),
8.13 (d, J ¼ 1.3 Hz, 1H), 7.77 (s, 1H), 7.63e7.56 (m, 4H), 7.48e7.41 (m,
2H), 7.30 (m, 1H), 7.09 (dd, J ¼ 8.2, 1.6 Hz, 1H), 6.78 (m, 1H), 6.34 (m,
4.1.10.23. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
4-oxo-5-phenyl-1,4-dihydropyridine-3-carboxamide
(31c).
Condensation of 30c (62.0 mg, 0.2 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 31c. Yield: 22.6 mg,
1H); 13C NMR (100 MHz, DMSO-d6)
d 175.9, 170.1, 162.7, 141.9, 140.1,
138.2, 138.1, 136.9, 133.1, 130.4, 130.2, 129.2, 129.2, 128.1, 127.9,
125.8, 125.6, 121.1, 120.3, 119.7, 118.7, 117.5, 113.2, 111.8, 101.1; MS
(ESI), m/z ¼ 455.0 [MꢁH]ꢁ. Anal. Calc. for C25H17N4O3Cl$0.5H2O: C,
64.45; H, 3.89; N, 12.03. Found C, 64.43; H, 3.79; N, 12.29.
30%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.25 (s, 1H),
13.10 (s, 1H), 10.92 (s, 1H), 8.58 (s, 1H), 8.05 (s, 1H), 7.65e7.62 (m,
4H), 7.57 (d, J ¼ 8.0 Hz, 1H), 7.44e7.36 (m, 3H), 7.31 (m, 1H), 7.08
(dd, J ¼ 8.0, 1.2 Hz, 1H), 6.78 (m, 1H), 6.32 (m, 1H); 13C NMR
(100 MHz, DMSO-d6)
d
176.2, 170.1, 162.9, 141.8, 140.1, 138.3, 137.5,
4.1.10.28. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
5-(2-fluorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxamide (31h).
Condensation of 30h (80.0 mg, 0.2 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 31h. Yield: 41.0 mg,
134.9, 130.9, 130.2, 129.5, 128.5, 128.1, 125.8, 125.6, 121.1, 120.3,
119.7, 118.6, 117.5, 113.1, 111.8, 101.9; MS (ESI), m/z ¼ 421.0 [MꢁH]ꢁ.
Anal. Calc. for C25H18N4O3$H2O: C, 68.17; H, 4.58; N, 12.72. Found C,
67.80; H, 4.44; N, 12.59.
42%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.23 (s, 1H),

330
H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
12.96 (s, 1H), 10.94 (s, 1H), 8.63 (s, 1H), 8.04 (s, 1H), 7.62 (s, 1H), 7.61
(d, J ¼ 1.6 Hz,1H), 7.56 (d, J ¼ 8.2 Hz,1H), 7.47e7.42 (m, 2H), 7.32 (m,
1H), 7.29e7.24 (m, 2H), 7.05 (dd, J ¼ 8.2, 1.6 Hz, 1H), 6.78 (m, 1H),
dimethyl-1H-pyrrol-3-yl)acetic acid (1 equiv) with 1-methylpipera
zine (1.2 equiv), afforded 34. Yield: 76.3 mg, 61%, mp > 300 ꢀC. 1H
NMR (400 MHz, DMSO-d6) d 13.28 (s,1H),13.00 (s,1H),10.78 (s,1H),
6.32 (m, 1H); 13C NMR (100 MHz, DMSO-d6)
d
175.8, 170.1, 162.7,
8.57 (d, J ¼ 1.2 Hz, 1H), 8.06 (d, J ¼ 1.2 Hz, 1H), 7.72e7.68 (m, 2H),
7.65 (d, J ¼ 8.4, 1H), 7.61 (d, J ¼ 1.6 Hz, 1H), 7.47 (s, 1H), 7.25 (dd,
J ¼ 8.8, 8.8 Hz, 1H), 7.03 (dd, J ¼ 8.4, 1.6 Hz, 1H), 3.49 (br s, 4H), 3.46
(s, 3H), 2.22 (br s, 7H), 2.17 (s, 3H), 2.16 (s, 3H); 13C NMR (100 MHz,
1
160.3 (d, JCF ¼ 245.0 Hz), 142.4, 140.1, 138.8, 138.3, 132.6 (d,
3
4JCF ¼ 3.3 Hz), 130.5 (d, JCF ¼ 8.1 Hz), 130.2, 126.7, 125.8, 125.6,
124.6, 122.8 (d, 3JCF ¼ 15.3 Hz), 121.1, 120.3, 119.7, 118.3, 117.4, 115.9
(d, 2JCF ¼ 21.9 Hz), 113.1, 111.8, 101.9; MS (ESI), m/z ¼ 439.0 [MꢁH]ꢁ.
Anal. Calc. for C25H17N4O3F$0.3H2O: C, 67.35; H, 3.98; N, 12.57.
Found C, 66.97; H, 3.89; N, 12.94.
DMSO-d6)
d
176.1,170.3,169.2,162.6,162.2 (d, 1JCF ¼ 242.9 Hz),141.7,
3
139.1, 137.5, 137.2, 134.5, 131.6 (d, JCF ¼ 8.2 Hz), 131.2, 131.1, 130.3,
129.8, 126.3, 122.8, 122.1, 119.1, 118.7, 118.0, 115.3 (d, 2JCF ¼ 21.0 Hz),
113.2, 112.8, 101.7, 55.3, 54.9, 46.2, 45.6, 41.8, 29.4, 12.6, 10.2; MS
(ESI), m/z ¼ 607.1 [MꢁH]ꢁ. Anal. Calc. for C34H33FN4O6$0.3H2O: C,
66.50; H, 5.52; N, 13.69. Found C, 66.21; H, 5.48; N, 13.46.
4.1.10.29. (Z)-N-(3-((1H-Pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-
5-methyl-4-oxo-1,4-dihydropyridine-3-carboxamide
(31i).
Condensation of 30i (71.4 mg, 0.3 mmol) with 1H-pyrrole-2-
carbaldehyde (28.5 mg, 0.3 mmol) afforded 31i. Yield: 62.4 mg,
4.1.10.33. (Z)-N-(3-((3,5-Dimethyl-4-(morpholine-4-carbonyl)-1H-
pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-5-(4-fluorophenyl)-4-
oxo-1,4-dihydropyridine-3-carboxamide (35). Condensation of 30a
(130.0 mg, 0.3 mmol) with 3,5-dimethyl-4-(morpholine-4-
carbonyl)-1H-pyrrole-2-carbaldehyde (106.3 mg, 0.45 mmol),
prepared by reaction of 5-formyl-2,4-dimethyl-1H-pyrrole-3-
carboxylic acid (1 equiv) with morpholine (1.2 equiv), afforded
35. Yield: 94 mg, 26%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
68%; mp > 300 ꢀC. 1H NMR (400 MHz, DMSO-d6)
d 13.22 (s, 1H),
13.12 (s, 1H), 10.91 (s, 1H), 8.51 (s, 1H), 7.84 (s, 1H), 7.62 (s, 1H), 7.61
(s, 1H), 7.57 (d, J ¼ 8.0 Hz, 1H), 7.31 (m, 1H), 7.07 (d, J ¼ 8.0 Hz, 1H),
6.78 (m, 1H), 6.33 (m, 1H), 1.99 (s, 3H); 13C NMR (100 MHz, DMSO-
d6)
d 177.8, 170.2, 163.1, 141.4, 140.2, 138.5, 136.1, 130.2, 128.5, 125.7,
125.5, 120.9, 120.2, 119.7, 117.5, 116.5, 113.0, 111.8, 101.9, 13.8; MS
(ESI), m/z ¼ 359.0 [MꢁH]ꢁ. Anal. (C20H16N4O3$0.7H2O) C, H, N. C,
64.40; H, 4.70; N, 15.02. Found C, 64.33; H, 4.64; N, 14.87.
d
13.45 (s, 1H), 13.05 (s, 1H), 12.60 (br s, 1H), 10.91 (s, 1H), 8.58 (d,
J ¼ 1.2 Hz, 1H), 8.07 (d, J ¼ 1.2 Hz, 1H), 7.73e7.68 (m, 3H), 7.64 (d,
J ¼ 1.6 Hz, 1H), 7.52 (s, 1H), 7.26 (dd, J ¼ 9.2, 8.8 Hz, 2H), 7.05 (dd,
J ¼ 8.4,1.6 Hz,1H), 3.57 (s, 4H), 3.46 (s, 4H), 2.28 (s, 3H), 2.24 (s, 3H);
4.1.10.30. (Z)-5-((6-(5-(4-Methoxyphenyl)-4-oxo-1,4-
dihydropyridine-3-carboxamido)-2-oxoindolin-3-ylidene)methyl)-
2,4-dimethyl-1H-pyrrole-3-carboxylic acid (32). Condensation of
30b (100.0 mg, 0.3 mmol) with 3,5-dimethyl-4-hydroxycarbonyl-
1H-pyrrole-2-carboxaldehyde (75.2 mg, 0.45 mmol) afforded 32.
Yield: 34.0 mg, 24%; blackened at 241 ꢀC. 1H NMR (400 MHz,
13C NMR (100 MHz, DMSO-d6)
d 176.1, 170.4, 166.2, 162.7, 162.2 (d,
1JCF ¼ 243.0 Hz), 141.7, 139.6, 137.9, 137.4, 133.7, 131.6, 131.5 (d,
3JCF ¼ 8.0 Hz), 131.1, 131.1, 129.9, 128.0, 126.6, 122.6, 121.5, 119.8,
2
118.7, 115.8, 115.2 (d, JCF ¼ 21.0 Hz),/113.0, 101.9, 66.9 (CH2), 12.9
(CH2), 10.5 (CH3); MS (ESI), m/z ¼ 580.1 [MꢁH]ꢁ. Anal. Calc. for
DMSO-d6)
d 13.70 (s, 1H), 13.10 (s, 1H), 12.54 (s, 1H), 10.96 (s, 1H),
8.54 (dd, J ¼ 6.0, 1.2 Hz, 1H), 7.99 (dd, J ¼ 6.0, 1.2 Hz, 1H), 7.74 (d,
J ¼ 8.0 Hz, 1H), 7.63 (d, J ¼ 1.6 Hz, 1H), 7.63 (dd, J ¼ 8.8, 8.4 Hz, 2H),
7.56 (s,1H), 7.06 (dd, J ¼ 8.0,1.6 Hz,1H), 6.98 (dd, J ¼ 8.8, 8.4 Hz, 2H),
3.79 (s, 3H), 2.51 (s, 3H), 2.30 (s, 3H); 13C NMR (100 MHz, DMSO-d6)
C32H28FN5O5$0.5H2O: C, 65.08; H, 4.95; N, 11.86. Found C, 64.75; H,
5.20; N, 11.80.
4.1.10.34. (Z)-N-(3-((3,5-Dimethyl-4-(2-morpholino-2-oxoethyl)-
1H-pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-5-(4-fluorophenyl)-4-
oxo-1,4-dihydropyridine-3-carboxamide (36). Condensation of
Compound 30a (109.0 mg, 0.3 mmol) with 3,5-dimethyl-4-(2-
morpholino-2-oxoethyl)-1H-pyrrole-2-carbaldehyde (112.6 mg,
0.45 mmol), prepared by reaction of 2-(5-formyl-2,4-dimethyl-1H-
pyrrol-3-yl)acetic acid (1 equiv) with morpholine (1.2 equiv),
afforded 36. Yield: 98.0 mg, 55%; mp > 300 ꢀC. 1H NMR (400 MHz,
d
176.3, 170.5, 166.6, 162.9, 159.4, 141.2, 140.4, 139.8, 138.3, 136.6,
132.1, 130.7, 126.9, 126.6, 122.5, 121.3, 120.1, 118.4, 116.9, 114.4, 113.9,
113.1, 101.9, 55.7, 14.9, 11.9; MS (ESI), m/z ¼ 523.0 [MꢁH]ꢁ. Anal.
Calc. for C29H24N4O6$0.8H2O: C, 64.63; H, 4.79; N, 10.40. Found C,
64.37; H, 5.07; N, 10.66.
4.1.10.31. (Z)-5-(4-Fluorophenyl)-N-(3-((4-(4-methylpiperazine-1-
carbonyl)-1H-pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-4-oxo-1,4-
dihydropyridine-3-carboxamide (33). Condensation of 30a (215.0 mg,
0.6 mmol) with 3,5-dimethyl-4-(4-methylpiperazine-1-carbonyl)-
1H-pyrrole-2-carbaldehyde (224.0 mg, 0.9 mmol), prepared by re-
action of 5-formyl-2,4-dimethyl-1H-pyrrole-3-carboxylic acid
(1 equiv) with 1-methylpiperazine (1.2 equiv) [47], afforded 33.
Yield: 114.0 mg, 35% blackened at ~283 ꢀC. 1H NMR (400 MHz,
DMSO-d6)
d 13.30 (s, 1H), 13.05 (s, 1H), 10.78 (s, 1H), 8.57 (s, 1H),
8.05 (s, 1H), 7.72e7.68 (m, 2H), 7.65 (d, J ¼ 8.4 Hz, 1H), 7.61 (s, 1H),
7.46 (s, 1H), 7.25 (dd, J ¼ 8.8, 8.8 Hz, 2H), 7.03 (d, J ¼ 8.4 Hz, 1H),
3.53e3.44 (br, 10H), 2.23 (s, 3H), 2.17 (s, 3H); 13C NMR (100 MHz,
1
DMSO-d6)
d
176.0, 170.3, 169.5, 162.7, 162.2 (d, JCF ¼ 242.9 Hz),
3
141.9, 139.1, 137.7, 137.3, 134.5, 131.6, 131.5 (d, JCF ¼ 8.0 Hz), 131.3,
130.3, 129.8, 126.3, 122.7, 122.0, 119.1, 118.7, 117.9, 115.3 (d,
2JCF ¼ 20.9 Hz), 113.2, 112.8, 101.8, 66.7, 46.2, 42.3, 29.2, 12.6, 10.2;
MS (ESI), m/z ¼ 594.1 [MꢁH]ꢁ. Anal. Calc. for C33H30N4O5F$1H2O: C,
64.59; H, 5.26; N, 11.41. Found C, 64.51; H, 5.11; N, 11.60.
DMSO-d6) d 13.46 (s, 1H), 13.05 (s, 1H), 10.91 (s, 1H), 8.58 (s, 1H), 8.06
(s, 1H), 7.70 (m, 3H), 7.63 (s, 1H), 7.51 (s, 1H), 7.25 (dd, J ¼ 9.2, 8.8 Hz,
2H), 7.05 (d, J ¼ 8.0 Hz,1H), 3.45 (br s, 4H), 2.27 (br s, 7H), 2.23 (s, 3H),
2.18 (s, 3H); 13C NMR (100 MHz, DMSO-d6)
d
176.1, 170.4,165.9, 162.7,
1
162.2 (d, JCF ¼ 242.0 Hz), 141.8, 139.6, 137.9, 137.4, 133.5, 131.6 (d,
3JCF ¼ 8.1 Hz),131.2,131.1, 129.9, 127.9,126.5, 122.6, 121.5,120.2, 119.8,
118.7, 115.8, 115.3 (d, 2JCF ¼ 21.2 Hz), 112.9, 101.9, 46.2, 12.9, 10.6; MS
(ESI), m/z ¼ 593.1 [MꢁH]ꢁ. Anal. Calc. for C33H31FN6O6$1.5H2O: C,
63.76; H, 5.51; N, 13.52. Found C, 63.59; H, 5.59; N, 13.29.
4.2. Biology
4.2.1. In vitro kinase, hERG-binding, and metabolic enzyme activity
assays
4.2.1.1. Kinase assay. Kinase inhibition assays were performed us-
ing a radioisotope-based P81 filter-binding assay at Reaction
Biology Corporation (Malvern). Compounds (10 mM stock DMSO
4.1.10.32. (Z)-N-(3-((3,5-Dimethyl-4-(2-(4-methylpiperazin-1-yl)-2-
oxoethyl)-1H-pyrrol-2-yl)methylene)-2-oxoindolin-6-yl)-5-(4-
fluorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxamide
(34).
solutions) were tested in the single-dose mode at 1
in the 10-dose IC50 mode with three-fold serial dilutions starting at
10 M with the final DMSO concentration of less than 1% (v/v). Each
enzyme and its specific substrate were diluted into 20 mM HEPES,
mM dilution or
Condensation of 30a (74.3 mg, 0.2 mmol) with 3,5-dimethyl-4-(2-
(4-methylpiperazin-1-yl)-2-oxoethyl)-1H-pyrrole-2-carbaldehyde
(79.0 mg, 0.3 mmol), prepared by reaction of 2-(5-formyl-2,4-
m

H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
331
pH 7.5, 10 mM MgCl2, 1 mM EGTA, 0.02% (v/v) Brij35, 0.02 mg/mL
BSA, 0.1 mM Na3VO4, 2 mM DTT, 1% (v/v) DMSO, and then a test
compound was delivered into the mixture. Each reaction was
initiated by adding radiolabeled [33P]ATP (final concentration,
acquired in at least five fields for at least three independent
experiments.
4.2.3. Assessment of phospho-signaling of Aurora B and the
apoptotic protein Fas by dot-blotting
10
onto P81 ion-exchange paper (Whatman #3698e915). Unreacted
33P]ATP was washed away with phosphoric acid (0.75% v/v) before
mM), held at rt, and stopped after 2 h by spotting the mixtures
GH Polypro membranes (0.2
AcroPrep, Pall) each in a well of a 96-well microplate were wet with
70% (v/v) ethanol (100 L) for 15 s and then with water (100 L)
while under vacuum using an Aurum Vacuum manifold (Bio-Rad).
Cell lysates (20 g protein equivalent in 50 L PBS), prepared as
mM hydrophilic polypropylene,
[
detection. Staurosporine served as the external control. IC50 values
are reported as the mean of two independent reactions with co-
efficients of variation <30%. Inhibition of kinase activity in the
m
m
m
m
presence of 1
m
M of a test compound is reported as the percentage
described below, were added into each of the wells and allowed to
stand for 10 min at rt. The microplate was then shaken on a plate
shaker (Thermo Scientific) at a lowspeed for 10 min at rt. Plateswere
then washed with PBS, and the membranes were blocked with 0.5%
BSA in PBS for 5 min while shaken. After suction removal of the
solvent, primary antibodies were added into each well and incu-
bated with the cell lysate while shaking at 4 ꢀC for 4 h. Anti-
inhibition, with that of the vehicle blank defined as 0%. Substrates
used were H-LRRASLG, poly[Glu:Tyr] (4:1), EAIYAAPFAKKK, and
KKKSPGEYVNIEFG for the Aurora kinases, VEGFR-2 and PDGFR
Flt-3, and c-Met, respectively.
a/b,
4.2.1.2. hERG-binding assay. The hERG-binding assay involved a
binding competition between the fluorescently labeled tracer
Predictor hERG Tracer Red (1 nM) and a test compound for
membrane-bound hERG (Predictor hERG Membrane). Each com-
pound was tested in the 10-dose IC50 mode with three-fold serial
phospho-Aurora B (Genetex, 50
H3 (Genetex, 50 L, 1:200), and anti-Fas (Santa Cruz Biotech-
nology, 50 L, 1:200) were used. Then samples were washed twice
with PBS (100 L). Goat anti-rabbit IgG-conjugated horseradish
peroxidase (Genetex, 50 L, 1:500) was added into to each well, and
the plates were incubated for 10 min with shaking. The samples
were again washed twice with PBS (100 L), and then 100 L of a
mL, 1:200), anti-phospho-histone
m
m
m
m
dilutions starting at 100 mM. Each solution containing a compound
was added into a membrane mixture by Acoustic Technologies,
followed by tracer addition, and gently mixed in the dark. Flores-
cence of each membrane preparation was measured after a 3-h, rt
incubation and reported as the millipolarization units (mP, excita-
tion, 531 nm; emission, 595 nm). The control compound, E-4031,
was tested under the same conditions but its initial concentration
was 30 mM. The assay mixture contained 25 mM HEPES, pH 7.5,
15 mM KCl, 1 mM MgCl2, 0.05% (v/v) PF-127 (Acronyms), and 1% (v/
v) DMSO.
m
m
diaminobenzidine solution (ImmPACT, Vector Laboratories) was
added into each well. After being incubated for a few minutes with
shaking, a brown color appeared as the result of oxidation and
polymerization of the diaminobenzidine. Plates were washed with
PBS and water, and then the blots in 96-well plate were scanned
from top by scanner (Epson) and the blotting images were analyzed
using Un-Scan-It gel software for quantification of the reactions.
Three independent experiments, each in triplicate, were performed.
To prepare the cell lysates, cells that had been treated with
4.2.1.3. Metabolic enzyme activity assay. For the cytochrome P450
inhibition assays, each compound was examined in the 10-dose
10 m
M of 31h or AZD1152 for 4 h at 37 ꢀC were lysed in 25 mM
TriseHCl, pH 7.6, 150 mM NaCl, 1% (v/v) NP-40, 1% sodium deoxy-
cholate, 0.1% SDS, supplemented with a final concentration of 1ꢂ
protease and phosphatase inhibitors (Roche Applied Science).
Samples were kept on ice for 5 min with intermittent swirling and
then centrifuged at 16,000 ꢂ g at 4 ꢀC for 15 min to remove cell
debris. The soluble portion of each cell lysate was stored at ꢁ20 ꢀC
IC50 mode with three-fold serial dilutions starting at 10 mM. Keto-
conazole and furafylline (for CYP1A2) served as controls and were
tested under the same conditions. 3-Cyano-7-ethoxycoumarin
served as the substrate for CYP1A2, CYP2C19, and CYP2D6. The
Vivid OOMR substrate was used for the CYP2C9 and CYP3A4 assays.
as 50 mL aliquots.
4.2.2. Cell culture, survival assay, and morphological examination
4.2.2.1. Cell culture and survival assay. A549 (BCRC 60074) and
HepG2 (BCRC 60025) cells were maintained at 37 ꢀC in a 5% CO2,
humidified incubator. The culture medium for the A549 cells was
RPMI-1640 and that for HepG2 cells was Dulbecco's Modified Ea-
gle's medium. Medium was supplemented with 10% (v/v) fetal
bovine serum, 1% w/v penicillin and 1% w/v streptomycin. Cells
were seeded at a density of 5 ꢂ 103 cells per well in 96-well plates
and incubated overnight in the appropriate medium that lacked
serum. A549 and HepG2 cell samples were then treated with one of
the compounds at various concentrations (final DMSO concentra-
tion, 5% (v/v)) for 120 h in medium containing 5% (v/v) fetal bovine
serum. Cell viability was determined as total protein using the
sulforhodamine B assay [48] (A515) for A549 and HepG2 cells. Cells
that were treated with only vehicle served as the controls (100%
viability). Viability is reported as the percentage decrease in the
OD515. IC50 values for SRB assay were determined according to the
relative viability of the cells after incubation with the compounds at
the different concentrations by regression analysis.
4.2.4. Cell survival and apoptosis assays
The ApoTox-Glo assay (Promega) was used to assess if apoptosis
was induced by 31h and AZD1152 in A549 cells. Three peptide
substrates, GF-AFC, bis-AAF-R110 and Caspase-Glo 3, for the cell
viability, cytotoxicity, and caspase activation assays, respectively,
were used. In the first part of the assay, cell permeable GF-AFC is
cleaved by proteases in living cells, and the membrane-
impermeable bis-AAF-R110 is cleaved only if cells loss their mem-
brane integrity and leak proteases. The two cleaved products have
different excitation and emission spectra, allowing them to be
detected simultaneously using the same cell sample. In the second
part of the assay, Caspase-Glo 3 reagent is added into the cell
sample in an “add-mix-measure” manner. It causes cell lysis, fol-
lowed by caspase cleavage of the substrate, and generation of a
“glow-type” luminescent signal produced by luciferase.
The cells, seeded at density of 5 ꢂ 103 cells per well in 96-well
plate were immediately treated with 0, 1, or 10
mM of 31h or
AZD1152 for 24 h in triplicate. Positive, vehicle, negative, and
background controls were performed. For the positive controls,
4.2.2.2. Morphological examination. A549 cells (5 ꢂ 103 cells/well
cells were treated with 5
without any treatment were taken as negative control. After
treatment, the Viability/Cytotoxicity reagent (20 L) containing GF-
AFC and bis-AAF-R110 was added into each well, mixed by orbital
mM etoposide to induce apoptosis. Cells
in 24-well plate) treated with 10 mM of 31h or AZD1152 for 20 h
were visualized by direct phase contrast-microscopy (Nikon, 40ꢂ)
m
to characterize any morphological changes. Images were randomly

332
H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
Table 8
Sequences of primers used for mRNA assessment.
Gene
Forward primer (50 / 30)
Reverse primer (50 / 30)
Fragment length
Fas
FasL
GCACAGAAGGGAAGGAGTAC
GTCTTCAGCAATTCTCGGGA
ATATTCCTGGTGCCCATGAT
TGACCACATCGAGCTTTAGCCAGTCA
AAGGCCATGCCAGTGAGCTTC
455 bp
940 bp
492 bp
483 bp
GAGAAGGAAACCCTTTCCTG
CGCACCTACGTGAGGAGCTTAGCC
CCATCACCATCTTCCAGGAGCG
Bid
GAPDHa
a
GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
shaking at 300e500 rpm for 30 s, and incubated at 37 ꢀC for
30e180 min. The fluorescence signal associated with cell viability
was detected at 505 nm (excitation, 400 nm). The fluorescence
signal associated with cytotoxicity was detected at 520 nm (exci-
tation, 485 nm) using a Fluorescent Plate Reader Series 4000 (Mtx
8e16 h. The wounds in five randomly chosen fields in each well
were measured. The percentage of inhibition of migration in the
presence of vehicle was taken as 0%. The concentration of a com-
pound required to inhibit migration by 50% was defined as the IC50
.
All assays were performed in triplicate.
Lab System, Inc.). Then Caspase-Glo 3 (100
m
L) was added into each
A549 cell invasion in the presence of 3% (v/v) DMSO (vehicle)
or an Aurora-B inhibitor was measured using Matrigel-coated
Transwell cell culture chambers as described [50]. Cells seeded
at 105 cells/well were held in serum-free medium for 24 h,
trypsinized, suspended in serum-free medium, and transferred
well, and the samples were mixed gently and incubated for
30e180 min. Luminescence was detected by an MD Paradigm
Microplate Reader (BioTek) using the manufacturer's 1-s lumines-
cence protocol.
into the upper chamber of a Transwell insert (8-
m
m pore size;
Costar) that was coated with Geltrex (30
mL/well) (Life Technol-
4.2.5. Caspase 8/9 activation
ogies) at a cell density of 5 ꢂ 104 cells per well. Culture medium
containing 10% (v/v) fetal bovine serum was placed into the lower
chamber. Cells were treated with vehicle or an Aurora-B inhibitor
A549 cells seeded at density of 5 ꢂ 103 cells/well in a 96-well
plate were cultured for 24 h, and then treated with 0, 1, or 10 mM
31h or AZD1152 at for 24 h. Caspase 8/9 activities were evaluated
using Caspase-Glo 8/9 assay kit reagents (Promega) according to
the manufacturer's protocols. Three independent experiments in
triplicate were performed.
(1, 10, or 25 mM) for 18 or 36 h in a humidified 5% CO2 atmosphere
at 37 ꢀC. Invasive cells were fixed with 4% (w/v) para-
formaldehyde in PBS at 4 ꢀC for 15 min, then treated with 0.05%
(w/v) Triton X-100 at 4 ꢀC for 10 min, and stained with propidium
iodide (50 mg/mL in PBS). Non-invasive cells in the upper chamber
4.2.6. Semi-quantitative analysis of apoptosis-associated signals
triggered by 31h and AZD1152 treatments
Total RNA was TRIZOL-extracted (Gibco-BRL) from A549 cells
that had been treated with 10 mM 31h or AZD1152 for 18 h ac-
cording to the manufacturer's instructions. After quantification and
purity assessment by measurement of the ODs at 260 and 280 nm,
reverse transcription (RT) of the RNA samples was performed. Each
were removed with cotton swabs. The percentage inhibition by
vehicle was set to 0%. The concentration of a compound that
inhibited invasion by 50% was defined as the IC50. All assays were
performed in triplicate.
4.2.8. In vivo pharmacokinetic and efficacy studies
RNA sample (5
DEPC-treated water (Invitrogen) (10
10 min. Next, 10 L containing 4
(250 mM TriseHCl, pH 8.3, 375 mM KCl, 15 mM MgCl2) and 10 pmol
of each dNTP, 0.2 pmol DTT, 20 U RNase Out, and 200 U Superscript
RT (Invitrogen) was added into each sample. Each mixture was
incubated at 37 ꢀC for 1.5 h, followed by incubation at 95 ꢀC for
m
g) and hexamers with random sequences (3
L) was heated to 72 ꢀC for
L of 5 ꢂ First Strand Buffer
mg) in
4.2.8.1. In vivo pharmacokinetics. The pharmacokinetic profile in
rats for 31h was investigated. The rats were randomly assigned into
cohorts each consisting of three animals. The rats were given a
single iv (2 mg/kg) dose of 31h in 10% (v/v) N-methyl-2-pyrrolidone
(SigmaeAldrich), 20% (v/v) Cremophor EL (SigmaeAldrich), and
70% (w/v) saline. Blood samples were collected 24-h post-
administration and subjected to LC/MS/MS. Pharmacokinetic pa-
rameters were assessed using the non-compartmental mode in
WinNonlin 5.2 (Pharsight).
m
m
m
5 min. The product cDNAs (1
mg) were PCR amplified in 50 mL
containing 1 U Taq DNA polymerase, 10 pmol of each dNTP, 20 pmol
of a forward and reverse primer (see below), and 1.25 mM MgCl2
using the following program: initiation at 95 ꢀC for 90 s; 35 cycles at
95 ꢀC for 30 s, 58 ꢀC for 1 min and 72 ꢀC for 1 min; a final extension
at 72 ꢀC for 10 min. (All PCR reagents were purchased from
Promega.) The primer sequences are shown in Table 8. The PCR
products in a 2% (w/v) agarose gel were UV-visualized after
ethidium bromide staining. Bands were quantified using Un-Scan-It
Gel ver. 6.1 (Silk Scientific Inc.).
4.2.8.2. In vivo efficacy studies. Efficacy of 31h was determined
using Huh7 cancer cell xenografts established in female SCID mice
(BioLASCO Taiwan Co.). Huh7 cells (3 ꢂ 106 cells) had been
implanted subcutaneously into the right flank region of 8-week-old
mice and allowed to grow until the tumor volumes were
100e200 mm3. Tumor-bearing mice received sorafenib (n ¼ 5), 31h
(n ¼ 4e5), or vehicle (n ¼ 3). Compound 31h (2.5 or 5 mg/kg) was iv
administrated once daily in 10% (w/v) N-methyl-2-pyrrolidone, 20%
(v/v) Cremophor EL, and 70% (w/v) saline for 14 days. Sorafenib
(30 mg/kg) in the same vehicle served as the reference and was
administrated orally each day for 14 days. Tumor sizes were
measured with calipers, and tumor volumes (mm3) were calculated
as: V ¼ LS2/2 [51]; where L is the longest diameter and S is the
shortest diameter.
4.2.7. In vitro anti-metastatic effects on migration and invasion by
31h
The scratch assay [49] was used to assess migration of A549 cells
in vitro cells (seeded at 5 ꢂ 105 cells/well in 6-well plates) were
cultured to 80e90% confluency. The monolayers were wounded by
scratching with a 200-
200 L PBS to remove floating cells. Subsequently, the cells were
treated with 3% (v/v) DMSO (vehicle) or 1, 10, or 25 M of an
mL pipette tip, then washed twice with
m
m
Body weight was measured twice weekly. Body weight, tumor
size, and clinical observations were obtained throughout the study.
Anti-tumor activity was defined as the percentage of TGI and
Aurora-B inhibitor for 8e24 h. Cell migration, defined as the width
of the wound, was measured using an inverted microscope at

H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
333
[22] S. Hauf, R.W. Cole, S. LaTerra, C. Zimmer, G. Schnapp, R. Walter, A. Heckel,
J. van Meel, C.L. Rieder, J.M. Peters, The small molecule Hesperadin reveals a
role for Aurora B in correcting kinetochore-microtubule attachment and in
maintaining the spindle assembly checkpoint, J. Cell Biol. 161 (2003)
281e294.
calculated as [1 ꢁ (final tumor volume ꢁ initial tumor volume for
treated group)/(final tumor volume ꢁ initial tumor volume for the
vehicle group)] ꢂ 100.
[23] K. Godl, O.J. Gruss, J. Eickhoff, J. Wissing, S. Blencke, M. Weber, H. Degen,
D. Brehmer, L. Orfi, Z. Horvath, G. Keri, S. Muller, M. Cotten, A. Ullrich, H. Daub,
Proteomic characterization of the angiogenesis inhibitor SU6668 reveals
multiple impacts on cellular kinase signaling, Cancer Res. 65 (2005)
6919e6926.
[24] C.-C. Chiang, Y.-H. Lin, S.F. Lin, C.-L. Lai, C. Liu, W.-Y. Wei, S.-C. Yang, R.-
W. Wang, L.-W. Teng, S.-H. Chuang, J.-M. Chang, T.-T. Yuan, Y.-S. Lee, P. Chen,
W.-K. Chi, J.-Y. Yang, H.-J. Huang, C.-B. Liao, J.-J. Huang, Discovery of pyrrole-
indoline-2-ones as Aurora kinase inhibitors with a different inhibition profile,
J. Med. Chem. 53 (2010) 5929e5941.
Acknowledgments
This work was supported by grants from the Industrial Tech-
nology Research Institute, No. 321, Section 2, Guangfu Road, Hsin-
chu 30011, Taiwan.
Appendix A. Supplementary data
[25] R.R. Khanwelkar, G.S. Chen, H.-C. Wang, C.-W. Yu, C.-H. Huang, O. Lee, C.-
H. Chen, C.-S. Hwang, C.-H. Ko, N.-T. Chou, M.-W. Lin, L.-M. Wang, Y.-C. Chen,
T.-H. Hseu, C.-N. Chang, H.-C. Hsu, H.-C. Lin, Y.-C. Shih, S.-H. Chou, H.-
W. Tseng, C.-P. Liu, C.-M. Tu, T.-L. Hu, Y.-J. Tsai, J.-W. Chern, Synthesis and
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.ejmech.2014.07.033.
structure-activity
relationship
of
6-arylureido-3-pyrrol-2-
References
ylmethylideneindolin-2-one derivatives as potent receptor tyrosine kinase
inhibitors, Bioorg. Med. Chem. 18 (2010) 4674e4686.
[26] A.D. Jagtap, P.-T. Chang, J.-R. Liu, H.-C. Wang, N.B. Kondekar, L.-J. Shen, H.-
W. Tseng, G.S. Chen, J.-W. Chern, Novel Acylureidoindolin-2-one Derivatives
as Dual Aurora B/FLT3 Inhibitors for the Treatment of Acute Myeloid Leukemia
(Under communication: EJMECH-D-14-01007), 2014.
[27] R. Borzilleri, L. Cornelius, R. Schmidt, G. Schroeder, K. Kim, Monocyclic Het-
erocycles as Kinase Inhibitors, in, US20050245530, 2005.
[1] G.H. Williams, K. Stoeber, The cell cycle and cancer, J. Pathol. 226 (2012)
352e364.
[2] S. Lapenna, A. Giordano, Cell cycle kinases as therapeutic targets for cancer,
Nat. Rev. Drug Discov. 8 (2009) 547e566.
[3] S. Blagden, J. de Bono, Drugging cell cycle kinases in cancer therapy, Curr. Drug
Targets 6 (2005) 325e335.
[28] T.L. Underiner, T. Herbertz, S.J. Miknyoczki, Discovery of small molecule c-Met
inhibitors: Evolution and profiles of clinical candidates, Anticancer Agents
Med. Chem. 10 (2010) 7e27.
[29] T. Matsushima, K. Takahashi, S. Funasaka, H. Obaishi, Novel Pyridine Deriva-
tive and Pyrimidine Derivative, in, US20050277652, 2005.
[30] T. Li, M.A. Pobanz, C. Shih, Z. Wu, W.J. Yang, B. Zhong, Amidophenoxyindazoles
Useful as Inhibitors of c-met, in, US20100022529, 2010.
[31] B. Rigo, D. Fasseur, P. Cauliez, D. Couturier, Reaction of trimethylsilyl de-
rivatives with Meldrum's acid: a new and easy monofunctionalization of
malonic acid, Tetrahedron Lett. 30 (1989) 3073e3076.
[32] L.C. Bannen, D.S.M. Chan, J. Chen, L.E. Dalrymple, T.P. Forsyth, T.P. Huynh, V.
Jammalamadaka, R.G. Khoury, J.W. Leahy, M.B. Mac, C-met Modulators and
Methods of Use, in, WO2005030140A2, 2005.
[33] O. Saavedra, S. Claridge, L. Zhan, F. Raeppel, A. Vaisburg, S. Raeppel, R. Deziel,
M. Mannion, N. Zhou, F. Gaudette, Inhibitors of VEGF Receptor and HGF Re-
ceptor Signaling, in, US20070004675, 2007.
[34] J. Becher, T. Johansen, M.A. Michael, Pyridinethiones. IX preparation of rici-
nidine, thioricinidine and other 2(1H)-pyridones and -thiones related to
nicotinic acid, J. Heterocycl. Chem. 21 (1984) 41e48.
[4] M. Carmena, W.C. Earnshaw, The cellular geography of aurora kinases, Nat.
Rev. Mol. Cell Biol. 4 (2003) 842e854.
[5] H.-T. Xu, L. Ma, F.-J. Qi, Y. Liu, J.-H. Yu, S.-D. Dai, J.-J. Zhu, E.-H. Wang,
Expression of serine threonine kinase 15 is associated with poor differentia-
tion in lung squamous cell carcinoma and adenocarcinoma, Pathol. Int. 56
(2006) 375e380.
[6] H. Zhou, J. Kuang, L. Zhong, W.-L. Kuo, J.W. Gray, A. Sahin, B.R. Brinkley, S. Sen,
Tumour amplified kinase STK15/BTAK induces centrosome amplification,
aneuploidy and transformation, Nat. Genet. 20 (1998) 189e193.
[7] N. Nishida, T. Nagasaka, K. Kashiwagi, C.R. Boland, A. Goel, High copy ampli-
fication of the Aurora-A gene is associated with chromosomal instability
phenotype in human colorectal cancers, Cancer Biol. Ther. 6 (2007) 525e533.
[8] S. Solinas-Toldo, C. Wallrapp, F. Muller-Pillasch, M. Bentz, T. Gress, P. Lichter,
Mapping of chromosomal imbalances in pancreatic carcinoma by comparative
genomic hybridization, Cancer Res. 56 (1996) 3803e3807.
[9] R. Reiter, P. Gais, U. Jutting, M.K. Steuer-Vogt, A. Pickhard, K. Bink, S. Rauser,
S. Lassmann, H. Hofler, M. Werner, A. Walch, Aurora kinase A messenger RNA
overexpression is correlated with tumor progression and shortened survival
in head and neck squamous cell carcinoma, Clin. Cancer Res. 12 (2006)
5136e5141.
ꢁ
ꢁ
[35] M. Balogh, I. Hermecz, Z. Meszaros, K. Simon, L. Pusztay, G. Horvath,
P. Dvortsak, Studies on chemotherapeutics I. Synthesis of 5-substituted-4-
oxo-1,4-dihydro-3-pyridinecarboxylic acid derivatives, J. Heterocycl. Chem.
17 (1980) 359e368.
[10] Y.-M. Jeng, S.-Y. Peng, C.-Y. Lin, H.-C. Hsu, Overexpression and amplification of
Aurora-A in hepatocellular carcinoma, Clin. Cancer Res. 10 (2004) 2065e2071.
[11] B. Vischioni, J.J. Oudejans, W. Vos, J.A. Rodriguez, G. Giaccone, Frequent
overexpression of aurora B kinase, a novel drug target, in non-small cell lung
carcinoma patients, Mol. Cancer Ther. 5 (2006) 2905e2913.
[12] W.F. Zeng, K. Navaratne, R.A. Prayson, R.J. Weil, Aurora B expression correlates
with aggressive behaviour in glioblastoma multiforme, J. Clin. Pathol. 60
(2007) 218e221.
[36] W.-R. Wang, S.-S. Yang, J.-X. Lin, Z.-Y. Zeng, D.-M. Liu, H.-T. Liu, Expression of
Aurora-B in non-small cell lung cancer and its clinical significance, J. South
Med. Univ. (Nan Fang Yi Ke Da Xue Xue Bao) 29 (2009) 1853e1856.
[37] W.J. Egan, G. Lauri, Prediction of intestinal permeability, Adv. Drug Deliv. Rev.
54 (2002) 273e289.
[38] R.W. Wilkinson, R. Odedra, S.P. Heaton, S.R. Wedge, N.J. Keen, C. Crafter,
J.R. Foster, M.C. Brady, A. Bigley, E. Brown, K.F. Byth, N.C. Barrass, K.E. Mundt,
K.M. Foote, N.M. Heron, F.H. Jung, A.A. Mortlock, F.T. Boyle, S. Green, AZD1152,
a selective inhibitor of Aurora B kinase, inhibits human tumor xenograft
growth by inducing apoptosis, Clin. Cancer Res. 13 (2007) 3682e3688.
[39] J. Li, M.G. Anderson, L.A. Tucker, Y. Shen, K.B. Glaser, O.J. Shah, Inhibition of
Aurora B kinase sensitizes a subset of human glioma cells to TRAIL concom-
itant with induction of TRAIL-R2, Cell Death Differ. 16 (2009) 498e511.
[40] M. Li, A. Jung, U. Ganswindt, P. Marini, A. Friedl, P.T. Daniel, K. Lauber,
V. Jendrossek, C. Belka, Aurora kinase inhibitor ZM447439 induces apoptosis
via mitochondrial pathways, Biochem. Pharmacol. 79 (2010) 122e129.
[41] Y.-R. Lee, W.-C. Wu, W.-T. Ji, J.Y.-F. Chen, Y.-P. Cheng, M.-K. Chiang, H.-R. Chen,
Reversine suppresses oral squamous cell carcinoma via cell cycle arrest and
concomitantly apoptosis and autophagy, J. Biomed. Sci. 19 (2012) 9.
[42] A. Aihara, S. Tanaka, M. Yasen, S. Matsumura, Y. Mitsunori, A. Murakata,
N. Noguchi, A. Kudo, N. Nakamura, K. Ito, S. Arii, The selective Aurora B kinase
[13] G. Qi, I. Ogawa, Y. Kudo, M. Miyauchi, B.S. Siriwardena, F. Shimamoto,
M. Tatsuka, T. Takata, Aurora-B expression and its correlation with cell pro-
liferation and metastasis in oral cancer, Virchows Arch. 450 (2007) 297e302.
[14] G. Pannone, S.A. Hindi, A. Santoro, F. Sanguedolce, C. Rubini, R.I. Cincione, S. De
Maria, S. Tortorella, R. Rocchetti, S. Cagiano, C. Pedicillo, R. Serpico, L. Lo
Muzio, P. Bufo, Aurora B expression as a prognostic indicator and possible
therapeutic target in oral squamous cell carcinoma, Int. J. Immunopathol.
Pharmacol. 24 (2011) 79e88.
[15] Z.-Z. Lin, Y.-M. Jeng, F.-C. Hu, H.-W. Pan, H.-W. Tsao, P.-L. Lai, P.-H. Lee, A.-
L. Cheng, H.-C. Hsu, Significance of Aurora B overexpression in hepatocellular
carcinoma. Aurora B overexpression in HCC, BMC Cancer 10 (2010) 461.
[16] E.A. Harrington, D. Bebbington, J. Moore, R.K. Rasmussen, A.O. Ajose-Adeogun,
T. Nakayama, J.A. Graham, C. Demur, T. Hercend, A. Diu-Hercend, M. Su,
J.M. Golec, K.M. Miller, VX-680, a potent and selective small-molecule in-
hibitor of the Aurora kinases, suppresses tumor growth in vivo, Nat. Med. 10
(2004) 262e267.
[17] F. Girdler, K.E. Gascoigne, P.A. Eyers, S. Hartmuth, C. Crafter, K.M. Foote,
N.J. Keen, S.S. Taylor, Validating Aurora B as an anti-cancer drug target, J. Cell
Sci. 119 (2006) 3664e3675.
[18] M. Atkins, C.A. Jones, P. Kirkpatrick, Sunitinib maleate, Nat. Rev. Drug Discov. 5
(2006) 279e280.
[19] A.M. Aronov, B. McClain, C.S. Moody, M.A. Murcko, Kinase-likeness and
kinase-privileged fragments: toward virtual polypharmacology, J. Med. Chem.
51 (2008) 1214e1222.
[20] A.K. Ghose, T. Herbertz, D.A. Pippin, J.M. Salvino, J.P. Mallamo, Knowledge
based prediction of ligand binding modes and rational inhibitor design for
kinase drug discovery, J. Med. Chem. 51 (2008) 5149e5171.
inhibitor AZD1152 as
a novel treatment for hepatocellular carcinoma,
J. Hepatol. 52 (2010) 63e71.
[43] D.L. Flynn, M.D. Kaufman, Pyridone Amides and Analogs Exhibiting Anti-
cancer and Anti-Proliferative Activities, in, WO2011139891A1, 2011.
[44] D. Chen, Y. Wang, Y. Ma, B. Xiong, J. Ai, Y. Chen, M. Geng, J. Shen, Discovery of
3H-Imidazo[4,5-b]pyridines as potent c-met kinase inhibitors: design, syn-
thesis, and biological evaluation, ChemMedChem 7 (2012) 1057e1070.
[45] L. Deady, Substituent effects in non-aromatic nitrogen heterocycles: alkaline
hydrolysis of methyl N-methyl (oxo)dihydropyridinecarboxylates and diaza
analogues, Aust. J. Chem. 38 (1985) 637e641.
[46] K.S. Kim, L. Zhang, R. Schmidt, Z.W. Cai, D. Wei, D.K. Williams, L.J. Lombardo,
G.L. Trainor, D. Xie, Y. Zhang, Y. An, J.S. Sack, J.S. Tokarski, C. Darienzo,
A. Kamath, P. Marathe, Y. Zhang, J. Lippy, R. Jeyaseelan Sr., B. Wautlet,
[21] C.R. Prakash, S. Raja, Indolinones as promising scaffold as kinase inhibitors: a
review, Mini Rev. Med. Chem. 12 (2012) 98e119.

334
H.-C. Wang et al. / European Journal of Medicinal Chemistry 84 (2014) 312e334
B. Henley, J. Gullo-Brown, V. Manne, J.T. Hunt, J. Fargnoli, R.M. Borzilleri,
[49] S. Saadoun, M.C. Papadopoulos, M. Hara-Chikuma, A.S. Verkman, Impairment
of angiogenesis and cell migration by targeted aquaporin-1 gene disruption,
Nature 434 (2005) 786e792.
[50] S.C. Hsu, C.L. Kuo, J.P. Lin, J.H. Lee, C.C. Lin, C.C. Su, M.D. Yang, J.G. Chung, Crude
extracts of Euchresta formosana radix inhibit invasion and migration of hu-
man hepatocellular carcinoma cells, Anticancer Res. 27 (2007) 2377e2384.
[51] H. Yao, S.S. Ng, L.-F. Huo, B.K. Chow, Z. Shen, M. Yang, J. Sze, O. Ko, M. Li,
A. Yue, L.-W. Lu, X.-W. Bian, H.-F. Kung, M.C. Lin, Effective melanoma
immunotherapy with interleukin-2 delivered by a novel polymeric nano-
particle, Mol. Cancer Ther. 10 (2011) 1082e1092.
Discovery of pyrrolopyridine-pyridone based inhibitors of Met kinase: syn-
thesis, X-ray crystallographic analysis, and biological activities, J. Med. Chem.
51 (2008) 5330e5341.
[47] C. Wu, Z. Tang, W. Fan, W. Zhu, C. Wang, E. Somoza, N. Owino, R. Li, P.C. Ma,
Y. Wang, In vivo positron emission tomography (PET) imaging of
mesenchymal-epithelial transition (MET) receptor, J. Med. Chem. 53 (2010)
139e146.
[48] V. Vichai, K. Kirtikara, Sulforhodamine B colorimetric assay for cytotoxicity
screening, Nat. Protoc. 1 (2006) 1112e1116.