Development of a universal colorimetric indicator for G-quadruplex structures by the fusion of thiazole orange and isaindigotone skeleton

Article abstract of DOI:10.1021/ac300207r

The rapid and convenient method for identification of all kinds of G-quadruplex is highly desirable. In the present study, a novel colorimetric indicator for a vast variety of G-quadruplex was designed and synthesized on the basis of thiazole orange and isaindigotone skeleton. Its distinct color change enables label-free visual detection of G-quadruplexes, which is due to the disassembly of dye H-aggregates to monomers. This specific detection of G-quadruplex arises from its end-stacking interaction with G-quartet. On the basis of this universal indicator, a facile approach for large-scale identification of G-quadruplex was developed.

Full text of DOI:10.1021/ac300207r

Letter
pubs.acs.org/ac
Development of a Universal Colorimetric Indicator for G‑Quadruplex
Structures by the Fusion of Thiazole Orange and Isaindigotone
Skeleton
Jin-Wu Yan, Wen-Jie Ye, Shuo-Bin Chen, Wei-Bin Wu, Jin-Qiang Hou, Tian-Miao Ou, Jia-Heng Tan,*
Ding Li, Lian-Quan Gu, and Zhi-Shu Huang*
School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006, China
S
* Supporting Information
ABSTRACT: The rapid and convenient method for identi-
fication of all kinds of G-quadruplex is highly desirable. In the
present study, a novel colorimetric indicator for a vast variety
of G-quadruplex was designed and synthesized on the basis of
thiazole orange and isaindigotone skeleton. Its distinct color
change enables label-free visual detection of G-quadruplexes,
which is due to the disassembly of dye H-aggregates to
monomers. This specific detection of G-quadruplex arises from
its end-stacking interaction with G-quartet. On the basis of this
universal indicator, a facile approach for large-scale identi-
fication of G-quadruplex was developed.
he selective and facile detection of nucleic acids is
important for basic research and many applied fields, such
A promising strategy for universal detection of a variety of G-
quadruplexes is to design a probe interacting through end-
stacking with G-quartet that is the common binding site for all
types of G-quadruplexes. Thiazole orange (TO, Figure 1), a
widely used probe for nucleic acids,23−27 is composed of a
quinoline ring linked to a benzothiazole ring through a methine
bridge. TO can stack on the G-quartet and has been used in G-
quadruplex fluorescent intercalator displacement assay to study
the interaction between G-quadruplex and its ligands.28,29 In
addition, TO tends to aggregate in aqueous medium due to its
T
as clinical diagnosis and gene therapy.1−3 G-Quadruplexes are
unique secondary structures formed by G-rich nucleic acid
sequences in many pivotal genomic regions, such as telomeric
DNA, promoter region of some oncogenes and RNA
sequences.4−7 G-Quadruplex structures are receiving great
attention as uncovering their important biological functions and
applications in supramolecular chemistry and nanotechnol-
ogy.8−14 Due to their significance in both biology and
supramolecular chemistry, the detection of G-quadruplex is
very important. In recent years, much effort has been made to
exploit the sensors including organic probes, metal complexes,
and nanoparticles, for the detection of G-quadruplexes.15−19
With the advantage of easy manipulation and low cost, the
colorimetric organic dyes with clear and rapid visual readouts
for G-quadruplexes are extremely attractive. Recently, some
cyanine dyes have been developed to achieve colorimetric
detection of certain kinds of intramolecular G-quadruplex
DNAs,20−22 but these methods are not suitable for broad-
spectrum identification of G-quadruplex. As we know, wide-
spread putative G-quadruplex-forming sequences exist, which
exhibit significant structural polymorphism depending on
different sequences and conditions, including parallel, anti-
parallel, and hybrid types. Thus, it is highly desirable to develop
a universal approach for the rapid, facile, and instrument-free
detection of all kinds of G-quadruplexes. To the best of our
knowledge, the application of organic dyes to colorimetric
detection of a vast variety of G-quadruplexes has not been
reported. In the present study, we designed and developed a
universal colorimetric dye, which could be applied for label-free
large-scale detection of a vast variety of G-quadruplexes.
Figure 1. Structures of thiazole orange, isaindigotone skeleton, and the
fusion dyes.
Received: January 19, 2012
Accepted: July 17, 2012
Published: July 17, 2012
© 2012 American Chemical Society
6288
dx.doi.org/10.1021/ac300207r | Anal. Chem. 2012, 84, 6288−6292

Analytical Chemistry
Letter
intermolecular van der Waals forces and transforms to its
monomers in the presence of G-quadruplexes, being accom-
panied with an indistinctive shift of their absorption peaks
(Figure S1, Supporting Information). Accordingly, the supra-
molecular assembly and end-stacking feature of TO could be
used in our design strategy. The application of TO for the
detection of G-quadruplexes is limited by its drawback of poor
selectivity for G-quadruplex from other forms of DNAs;
therefore, it is necessary to improve the selectivity of this dye
molecule. Isaindigotone (Figure 1) is a naturally occurring
alkaloid, which is commonly used in traditional Chinese
medicine. Isaindigotone derivatives developed in our lab have
shown excellent binding affinity and selectivity for G-
quadruplexes.30,31 Our previous studies have demonstrated
that their selectivity for G-quadruplexes can be partially
attributed to their adaptive styryl moiety and their five-member
aliphatic ring.
Inspired by these studies on isaindigotone derivatives with
high selectivity for G-quadruplex and the self-assembly of TO
with end-stacking on G-quartet, we attempted to assemble
isaindigotone and TO in a fusion scaffold (Figure 1), aiming to
optimize its photophysical property and selectivity for G-
quadruplex through its expanded π-conjugate aromatic system
and the effect of its tunable R group. The expanded aromatic
system with a positive charge ensures the appropriate end-
stacking interaction between the dyes and the G-quartet. The
five-member aliphatic ring and the free rotation of the single
bond may not only make this adaptive aromatic structure to
stack well on the G-quartet but also diminish its interaction
with the duplex DNAs.
alignment of the transition dipoles perpendicular to the axis of
stacking.32−34 A blue-shifted absorption band is typically
observed for H-aggregates. The UV−vis spectrum of
compound 3 showed that the absorption peak of H-aggregates
(535 nm) blue-shifted 63 nm as compared to its monomeric
species (Table S3, Supporting Information), which is the largest
shift among these three dyes. To clarify the unique assembly
properties of compound 3 and make a further comparison
among all three compounds and TO, the molecular geometry
optimization and calculation were carried out using HF/6-311+
+G(d,p) basis set by Gaussian 03 program. The results showed
that the dipole moments of compound 3 were much larger than
other compounds, and the molecular electrostatic potential
(ESP) charges were also evidently influenced by the electron-
withdrawing nitro group (Figure S2 and Table S4, Supporting
Information), and those of compounds 1 and 2 and TO were
close to each other. Such calculation results were in good
agreement with the experimental data. The large dipole
moment of compound 3 generated a strong intermolecular
dipole−dipole coupling interaction and the efficient formation
of compact aggregates at higher dye loading, consequently
giving the largest blue shift; thus, we selected 3 for further
studies.
The interactions of 3 with G-quadruplex were studied using
UV−vis spectroscopic titrations. As shown in Figure 2A, 3
exhibited a predominant H-aggregation band around 535 nm in
buffer; upon titration with G-quadruplex-forming oligonucleo-
tide (pu27), dramatic changes of the absorption peaks were
observed. The peak around 535 nm gradually decreased with
addition of G-quadruplex and eventually led to the appearance
of a new peak around 600 nm assigned to its monomeric state,
which is consistent with the disassembly of the H-aggregates of
3. Interestingly, the red shift for the disassembly of the H-
aggregates of 3 to its monomers gave rise to a clear and visible
color change from purplish red to blue (Figure 3A).
Meanwhile, we applied 3 for the detection of G-quadruplexes
with varying sequences and conformations, including parallel
and antiparallel, intramolecular and intermolecular structures.
The results showed that all these G-quadruplexes could be
detected colorimetrically through incubation with 3 (Figures S3
and S4, Supporting Information). Thus, 3 could be used as a
rapid and facile indicator for a variety of G-quadruplexes.
Besides, the selectivity of 3 in detection of G-quadruplexes
over single and duplex DNAs was studied with UV spectra.
Figure 2B showed the absorbance enhancement at 600 nm
against the ratio of [DNA]/[3]. Obviously, G-quadruplexes,
including pu27, c-kit1, HTG21, and tetramer could remarkably
increase the absorbance at 600 nm. In contrast, non-
quadruplexes, including single strands (dA21 and dT21), linear
duplex CT-DNA (calf thymus DNA), and self-complementary
duplex strand (ds15) could hardly affect the aggregation state of
3 under the same condition, with only slight decrease of the
absorbance (Figures S5 and S6, Supporting Information). Thus,
G-quadruplexes could be easily detected and differentiated from
other forms of DNA with just the naked eye (Figure 3A).
Moreover, the application of 3 for the detection of G-
quadruplex RNA was also investigated, and it was found that 3
could also differentiate G-quadruplex RNA from single/duplex
strand RNAs and total RNA in cell lysate (Figures 3B and S7,
Supporting Information). The above results indicated that 3
could be used for label-free visual detection of a variety of G-
quadruplexes with high specificity.
Three desired dyes with different R groups (Figure 1) were
prepared (Scheme 1), and their assembly properties in different
a
Scheme 1. Synthetic Route for Compounds 1−3
a
Reagents and conditions: (i) cyclopentanone, POCl3, reflux; (ii)
CH3I, tetramethylene sulfone, 50 °C; (iii) compound d, sodium
bicarbonate, methanol, room temperature then reflux; (iv) aromatic
aldehyde, piperidine, n-butanol, 80 °C; (v) CH3I, ethanol, 80 °C.
solvents were investigated using UV−vis absorption spectra. As
expected, all these three compounds exist mainly as a
monomeric state in organic solvents, and the blue-shifted
absorption band of aggregation could be observed in buffer,
which is assigned to H-aggregates (Figure S1, Supporting
Information). H-aggregates of dye molecules occur in the case
of a face-to-face stacking of the monomers and a parallel
6289
dx.doi.org/10.1021/ac300207r | Anal. Chem. 2012, 84, 6288−6292

Analytical Chemistry
Letter
Figure 3. (A) Photograph of 10 μM 3 H-aggregates (a) and 10 μM 3
with 20 μM dA21 (b); dT21 (c); CT-DNA (d); ds15 (e); pu27 (f); c-
kit1 (g); HTG21 (h); tetramer (i). (B) Photograph of 10 μM 3 H-
aggregates (a) and 10 μM 3 with 20 μM ssRNA (b); dsRNA (c); G-
quadruplex RNA (d); total RNA in cell lysate (e). (C) Photograph of
10 μM 3 H-aggregates (a) and 10 μM 3 with a 20 μM 1:1 mixture of
HTG21 and its complementary sequence (b); HTG21 only (c). (D)
Photograph of 10 μM 3 H-aggregates (a) and 10 μM 3 with 20 μM
STAT3 (b); STAT3-mut (c); hras-1 (d); hras-1-mut (e). (E)
Photograph of 10 μM 3 H-aggregates (a) and 10 μM 3 with 20 μM
HT-6 (b).
600 nm was significantly enhanced and that at 535 nm was
decreased. Thus, the value of A600/A535 could reflect the ability
of DNA to disassemble the H-aggregates. On the basis of the
above buffer conditions, the concentration and ratio of
compound 3 and DNA was optimized as follows (Figure
S8A,B, Supporting Information): the samples containing 10 μM
3 and 10 μM DNA with varying secondary structures were
dissolved in 150 μL of 10 mM Tris−HCl buffer containing 60
mM K+, which were then added to 96-well plates. After
incubation for 4 min at 25 °C, the absorbance at 535 and 600
nm for the samples was determined using a 96-well microplate
reader. As shown in Figure 4, the values of A600/A535 were
above 1.4 for all types of G-quadruplexes, while the values were
below 0.9 for nonquadruplexes. Therefore, it is possible and
reasonable to judge the secondary structures of DNA based on
Figure 2. (A) UV−vis spectra for titration of 5 μM 3 stepwise to G-
quadruplex-forming oligonucleotide (pu27). Conditions: [3] = 5 μM;
in 10 mM Tris−HCl buffer, 60 mM KCl, pH 7.4. The spectra were
recorded at 4 min intervals. (B) The absorbance enhancement of 5
μM 3 at 600 nm against the ratio of [DNA]/[3].
In order to examine whether the color change of 3 was due
to its interactions with G-quadruplex secondary structures or
simply just G-rich sequences, we mixed HTG21 and its
complementary sequence in a ratio of 1:1 to form a G-rich
duplex structure.35 In contrast with the HTG21 G-quadruplex,
the G-rich duplex structure could not induce clear color change
(Figure 3C), which demonstrated that 3 indeed interacts with
G-quadruplex secondary structures instead of simple G-rich
sequences to generate color change.
To study the practical usage of 3 in detecting G-
quadruplexes, we used 3 in testing two newly reported G-
quadruplexes: hras-1, STAT3, and their mutant sequences.36,37
As we expected, the wild-type G-quadruplexes hras-1 and
STAT3 could be easily detected and differentiated from their
mutant sequences with the naked eye (Figure 3D), which
further indicated that this method could be developed as an
easy and reliable approach for rapid detection of G-
quadruplexes.
On the basis of the above universal colorimetric detection of
a variety of G-quadruplexes with 3, a rapid and convenient
method for large-scale identification of G-quadruplexes was
developed. The absorbance at 535 and 600 nm represents the
content of H-aggregates and monomers, respectively. The
specific interaction of 3 with G-quadruplexes can disassemble
the H-aggregates; as shown in the spectra, the absorbance at
Figure 4. Distribution for the values of the A600/A535 for all the tested
oligonucleotides. Conditions: [3] = 10 μM, [DNA] = 10 μM, in 10
mM Tris−HCl buffer, 60 mM KCl, pH 7.4. The absorbance of the
samples was determined using a 96-well microplate reader.
6290
dx.doi.org/10.1021/ac300207r | Anal. Chem. 2012, 84, 6288−6292

Analytical Chemistry
Letter
the values of A600/A535. To obtain the optimal discrepancy of
A600/A535 between G-quadruplexes and nonG-quadruplexes, we
further screened the buffer conditions, including pH,
concentration of K+, and different types of buffer solutions.
We found that the values of A600/A535 were only slightly
influenced by the buffer conditions (Figure S8C,E, Supporting
Information), which indicated that this facile method is reliable
and widely applicable.
EXPERIMENTAL SECTION
■
Chemicals. All oligonucleotides were purchased from
Invitrogen (Shanghai, China) and Sangon (Shanghai, China).
Calf thymus DNA (CT-DNA) was purchased from Sigma-
Aldrich (Singapore). All the oligonucleotides were dissolved in
Tris−HCl buffer (10 mM, containing 60 mM KCl, pH 7.4),
and the concentration of oligonucleotides was determined from
their absorbance at 260 nm using NanoDrop 1000 (Thermo).
The samples were prepared through heating at 95 °C for 10
min followed with slow cooling to room temperature.
UV−Visible and Fluorescence Measurements. UV−vis
spectra were obtained with a Shimadzu 2450 Spectropho-
tometer. The labeled oligonucleotides were used as the FRET
probes. Fluorescence melting curves were determined with a
Roche LightCycler 2 real-time PCR machine, using a total
reaction volume of 20 mL, with 0.2 μM of labeled
oligonucleotide in 10 mM Tris−HCl buffer, pH 7.4, 60 mM
KCl. Fluorescence readings with excitation at 470 nm and
detection at 530 nm were taken at intervals of 1 °C over the
range of 37−99 °C, with a constant temperature being
maintained for 30 s prior to each reading to ensure a stable
value. The melting of the G-quadruplex was monitored alone or
in the presence of 3. Final analysis of the data was carried out
using Origin 8.0 (OriginLab Corp.). Emission of 6-carboxy-
fluorescein was normalized between 0 and 1, and T1/2 was
defined as the temperature for which the normalized emission
is 0.5. ΔT1/2 values were derived from the mean of three
experimental data.
SPR Assays. SPR measurements were performed on a
ProteOn XPR36 Protein Interaction Array system (Bio-Rad
Laboratories, Hercules, CA) using a Neutravidin-coated GLH
sensor chip. Biotinylated oligonucleotides (HTG:
( G T T A G G ) 5 ; c - m y c : A C G T A C G T G G G G -
(AGGGTGGGG)2 AAGGTGGGG; c-kit1: AGG-
GAGGGCGCTGGGAGGAGGG; single strand: (AGTTAG)5;
hairpin duplex DNA: TTCGCGCGCGTTTTCGCGCGCG)
were attached to a streptavidin-coated sensor chip. In a typical
experiment, biotinylated DNA was folded in filtered and
degassed running buffer (50 mM Tris−HCl, pH 7.2, 100 mM
KCl). The DNA samples were then captured (∼1000 RU) in
flow cells 1−3, leaving the fourth flow cell as a blank. Ligand
solutions were prepared with running buffer through serial
dilutions of stock solution. Five concentrations were injected
simultaneously at a flow rate of 50 mL·min−1 for 400 s of
association phase, followed with 400 s of dissociation phase at
25 °C. The GLH sensor chip was regenerated with short
injection of 50 mM NaOH between consecutive measurements.
The final graphs were obtained by subtracting blank sensor-
grams from quadruplex and duplex sensorgrams.
To further clarify and rationalize the application of 3 for the
specific detection of G-quadruplexes, FRET-melting assay,
surface plasma resonance (SPR) and nuclear magnetic
resonance (NMR) studies were performed. The FRET results
(Figure S9 and Table S5, Supporting Information) showed that
3 could stabilize G-quadruplexes without effect on Tm value of
the hairpin duplex DNA (F10T), suggesting its excellent
selectivity to G-quadruplexes. In addition, the binding affinity
and selectivity for G-quadruplexes of 3 and TO were assessed
by SPR experiments. The binding constants of 3 to G-
quadruplexes fell into a range (KD, 0.429−0.735 μM), while no
specific interaction between 3 and single/duplex strands was
observed (Figure S10 and Table S6, Supporting Information).
The binding affinity indicated that 3 exhibited high selectivity
for G-quadruplexes over single and duplex strands, which was
much better than TO. In the NMR study, the tetramolecular
parallel G-quadruplex HT-6 [d(T2AG3)]4 derived from human
telomeric DNA was used as a template, which could also induce
the color change of 3 (Figure 3E).38 An NMR titration
experiment showed that most 1H NMR signals exhibited
progressive shifts and line broadening at increasing concen-
tration of 3, which were slightly more obvious for imino proton
signals of G4 (Figure S11, Supporting Information).
Furthermore, with increasing concentration of 3, the imino
proton signals of A3H2, A3H8, and G4H8 exhibited significant
line broadening. These results and previous NMR studies
suggested that 3 preferred to stack on the G4 G-quartet
plane.39,40
On the basis of these results, we believe that the external-
stacking mode should be the main reason for the successful
application of 3 in the detection of a vast variety of G-
quadruplexes, because G-quartet is the common building block
of all kinds of G-quadruplexes. The binding affinity between 3
and G-quadruplex is higher than the intermolecular affinity of
H-aggregates of 3, and consequently, 3 is attracted to the G-
quartet in the form of monomer. In contrast, there is no such
specific and strong interaction between 3 and nonquadruplex
structures; thus, 3 is likely to remain in the form of H-
aggregates.
NMR Study. NMR experiments were performed on a
Bruker 600 MHz spectrometer. All of the titration experiments
were carried out at 25 °C in a 90% H2O/10% D2O solution
containing 150 mM KCl and 25 mM potassium phosphate
buffer (pH 7.2). The oligonucleotide HT-6 was purified using
HPLC, and the concentration of intermolecular G-quadruplex
[d(TTAGGG)]4 was 0.5 mM for the NMR measurements.
CONCLUSIONS
■
In summary, three novel dyes were rationally designed and
synthesized, and compound 3 can be used for visual detection
and differentiation of G-quadruplexes from single and duplex
DNA structures. The transformation for H-aggregates of 3 to
its monomer induced by its end-stacking interaction with G-
quartet gave rise to a distinct color change, which make it
become a rapid and facile detection method for G-
quadruplexes. On the basis of this universal colorimetric
indicator, a simple and reliable approach for large-scale
identification of G-quadruplexes was developed, which should
have promising application in the field of G-quadruplex
research.
ASSOCIATED CONTENT
■
S
* Supporting Information
1
Synthetic procedures and characterization data, including H
NMR, 13C NMR, NOESY NMR, HRMS, and HPLC spectra
for compounds (1−3); photophysical properties of compounds
6291
dx.doi.org/10.1021/ac300207r | Anal. Chem. 2012, 84, 6288−6292

Analytical Chemistry
Letter
(24) Menacher, F.; Rubner, M.; Berndl, S.; Wagenknecht, H. A. J.
Org. Chem. 2008, 73, 4263−4266.
(1−3); UV−vis spectra and photographs of 3 with different
nucleic acid motifs; stabilization of DNA G-quadruplexes and
duplex by 3 determined by FRET melting assays; binding
constants (KD) of 3 for its binding to G-quadruplexes measured
with SPR assays; NMR study on binding of 3 with the
tetramolecular parallel G-quadruplex. This material is available
free of charge via the Internet at http://pubs.acs.org.
(25) Berndl, S.; Wagenknecht, H. A. Angew. Chem., Int. Ed. 2009, 48,
2418−2421.
(26) Lubitz, I.; Zikich, D.; Kotlyar, A. Biochemistry 2010, 49, 3567−
3574.
(27) Lu, Y. J.; Yan, S. C.; Chan, F. Y.; Zou, L.; Chung, W. H.; Wong,
W. L.; Qiu, B.; Sun, N.; Chan, P. H.; Huang, Z. S.; Gu, L. Q.; Wong, K.
Y. Chem. Commun. 2011, 47, 4971−4973.
(28) Monchaud, D.; Allain, C.; Teulade-Fichou, M. P. Bioorg. Med.
Chem. Lett. 2006, 16, 4842−4845.
AUTHOR INFORMATION
■
Corresponding Author
(29) Largy, E.; Hamon, F.; Teulade-Fichou, M. P. Anal. Bioanal.
Chem. 2011, 400, 3419−3427.
*E-mail: ceshzs@mail.sysu.edu.cn (Z.-S.H.); tanjiah@mail.sysu.
edu.cn (J.-H.T.). Fax: 8620-39943056 (Z.-S.H.). Phone: 8620-
39943056 (Z.-S.H.); 8620-39943053 (J.-H.T.).
(30) Tan, J. H.; Ou, T. M.; Hou, J. Q.; Lu, Y. J.; Huang, S. L.; Luo, H.
B.; Wu, J. Y.; Huang, Z. S.; Wong, K. Y.; Gu, L. Q. J. Med. Chem. 2009,
52, 2825−2835.
Notes
(31) Hou, J. Q.; Tan, J. H.; Wang, X. X.; Chen, S. B.; Huang, S. Y.;
Yan, J. W.; Chen, S. H.; Ou, T. M.; Luo, H. B.; Li, D.; Gu, L. Q.;
Huang, Z. S. Org. Biomol. Chem. 2011, 9, 6422−6436.
(32) Mishra, A.; Behera, R. K.; Behera, P. K.; Mishra, B. K.; Behera,
G. B. Chem. Rev. 2000, 100, 1973−2012.
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
This work was supported by National Natural Science
Foundation of China (Nos. 90813011, 21172272, 81001400)
and the International S&T Cooperation Program of China
(No. 2010DFA34630).
(33) West, W.; Pearce, S. J. Phys. Chem. 1965, 69, 1894−903.
(34) Rosch, U.; Yao, S.; Wortmann, R.; Wurthner, F. Angew. Chem.,
̈
̈
Int. Ed. 2006, 45, 7026−7030.
(35) Phan, A. T.; Mergny, J. L. Nucleic Acids Res. 2002, 30, 4618−
4625.
(36) Lin, S.; Li, S.; Chen, Z.; He, X.; Zhang, Y.; Xu, X.; Xu, M.; Yuan,
G. Bioorg. Med. Chem. Lett. 2011, 21, 5987−5991.
(37) Membrino, A.; Cogoi, S.; Pedersen, E. B.; Xodo, L. E. PLoS One
2011, 6, e24421.
(38) Hounsou, C.; Guittat, L.; Monchaud, D.; Jourdan, M.; Saettel,
N.; Mergny, J. L.; Teulade-Fichou, M. P. ChemMedChem 2007, 2,
655−666.
(39) Fedoroff, O. Y.; Salazar, M.; Han, H.; Chemeris, V. V.; Kerwin,
S. M.; Hurley, L. H. Biochemistry 1998, 37, 12367−12374.
(40) Lu, Y. J.; Ou, T. M.; Tan, J. H.; Hou, J. Q.; Shao, W. Y.; Peng,
D.; Sun, N.; Wang, X. D.; Wu, W. B.; Bu, X. Z.; Huang, Z. S.; Ma, D.
L.; Wong, K. Y.; Gu, L. Q. J. Med. Chem. 2008, 51, 6381−6392.
REFERENCES
■
(1) Rosi, N. L.; Giljohann, D. A.; Thaxton, C. S.; Lytton-Jean, A. K.;
Han, M. S.; Mirkin, C. A. Science 2006, 312, 1027−1030.
(2) Fu, R.; Li, T.; Park, H. G. Chem. Commun. 2009, 39, 5838−5840.
(3) Robertson, K. L.; Thach, D. C. Anal. Biochem. 2009, 390, 109−
114.
(4) Parkinson, G. N.; Lee, M. P.; Neidle, S. Nature 2002, 417, 876−
880.
(5) Siddiqui-Jain, A.; Grand, C. L.; Bearss, D. J.; Hurley, L. H. Proc.
Natl. Acad. Sci. U. S. A. 2002, 99, 11593−11598.
(6) Dexheimer, T. S.; Sun, D.; Hurley, L. H. J. Am. Chem. Soc. 2006,
128, 5404−5415.
(7) Morris, M. J.; Negishi, Y.; Pazsint, C.; Schonhoft, J. D.; Basu, S. J.
Am. Chem. Soc. 2010, 132, 17831−17839.
(8) Balasubramanian, S.; Hurley, L. H.; Neidle, S. Nat. Rev. Drug
Discovery 2011, 10, 261−275.
(9) Brooks, T. A.; Hurley, L. H. Nat. Rev. Cancer 2009, 9, 849−861.
(10) Ou, T. M.; Lu, Y. J.; Tan, J. H.; Huang, Z. S.; Wong, K. Y.; Gu,
L. Q. ChemMedChem 2008, 3, 690−713.
(11) Neidle, S. Curr. Opin. Struct. Biol. 2009, 19, 239−250.
(12) Balasubramanian, S.; Neidle, S. Curr. Opin. Chem. Biol. 2009, 13,
345−353.
(13) Mathad, R. I.; Yang, D. Methods Mol. Biol. 2011, 735, 77−96.
(14) Davis, J. T. Angew. Chem., Int. Ed. 2004, 43, 668−698.
(15) Gonzalez, V.; Wilson, T.; Kurihara, I.; Imai, A.; Thomas, J. A.;
Otsuki, J. Chem. Commun. 2008, 16, 1868−1870.
(16) Yang, P.; De Cian, A.; Teulade-Fichou, M. P.; Mergny, J. L.;
Monchaud, D. Angew. Chem., Int. Ed. 2009, 48, 2188−2191.
(17) Meguellati, K.; Koripelly, G.; Ladame, S. Angew. Chem., Int. Ed.
2010, 49, 2738−2742.
(18) Xu, L.; Zhang, D.; Huang, J.; Deng, M.; Zhang, M.; Zhou, X.
Chem. Commun. 2010, 46, 743−745.
(19) Jian, J. W.; Huang, C. C. Chem.Eur. J. 2011, 17, 2374−2380.
(20) Yang, Q.; Xiang, J.; Yang, S.; Zhou, Q.; Li, Q.; Tang, Y.; Xu, G.
Chem. Commun. 2009, 1103−1105.
(21) Yang, Q.; Xiang, J. F.; Yang, S.; Li, Q.; Zhou, Q.; Guan, A.; Li,
L.; Zhang, Y.; Zhang, X.; Zhang, H.; Tang, Y.; Xu, G. Anal. Chem.
2010, 82, 9135−9137.
(22) Yang, Q.; Xiang, J.; Yang, S.; Li, Q.; Zhou, Q.; Guan, A.; Zhang,
X.; Zhang, H.; Tang, Y.; Xu, G. Nucleic Acids Res. 2010, 38, 1022−
1033.
(23) Monchaud, D.; Allain, C.; Teulade-Fichou, M. P. Nucleosides,
Nucleotides Nucleic Acids 2007, 26, 1585−1588.
6292
dx.doi.org/10.1021/ac300207r | Anal. Chem. 2012, 84, 6288−6292