Design, synthesis, biological evaluation of 3,5-diaryl-4,5-dihydro-1H-pyrazole carbaldehydes as non-purine xanthine oxidase inhibitors: Tracing the anticancer mechanism via xanthine oxidase inhibition

Article abstract of DOI:10.1016/j.bioorg.2020.104620

Xanthine oxidase (XO) has been primarily targeted for the development of anti-hyperuriciemic /anti-gout agents as it catalyzes the conversion of xanthine and hypoxanthine into uric acid. XO overexpression in various cancer is very well correlated due to r

Full text of DOI:10.1016/j.bioorg.2020.104620

Bioorganic Chemistry 107 (2021) 104620
Contents lists available at ScienceDirect
Bioorganic Chemistry
journal homepage: www.elsevier.com/locate/bioorg
Design, synthesis, biological evaluation of 3,5-diaryl-4,5-dihydro-1H-pyra-
zole carbaldehydes as non-purine xanthine oxidase inhibitors: Tracing the
anticancer mechanism via xanthine oxidase inhibition
,
,**
Gaurav Joshia, Manisha Sharmaa, Sourav Kalrab, Navnath S. Gavandec **, Sandeep Singhb
,
,
*
Raj Kumara
a Laboratory for Drug Design and Synthesis, Department of Pharmaceutical Sciences and Natural Products, School of Health Sciences, Central University of Punjab,
Bathinda 151 001, India
b Department of Human Genetics and Molecular Medicine, Central University of Punjab, Bathinda 151 001, India
c Department of Pharmaceutical Sciences, Wayne State University College of Pharmacy and Health Sciences, Detroit, MI 48201, USA
A R T I C L E I N F O
A B S T R A C T
Keywords:
Xanthine oxidase (XO) has been primarily targeted for the development of anti-hyperuriciemic /anti-gout agents
as it catalyzes the conversion of xanthine and hypoxanthine into uric acid. XO overexpression in various cancer is
very well correlated due to reactive oxygen species (ROS) production and metabolic activation of carcinogenic
substances during the catalysis. Herein, we report the design and synthesis of a series of 3,5-diaryl-4,5-dihydro-
1H-pyrazole carbaldehyde derivatives (2a-2x) as xanthine oxidase inhibitors (XOIs). A docking model was
developed for the prediction of XO inhibitory activity of our novel compounds. Furthermore, our compounds
anticancer activity results in low XO expression and XO-harboring cancer cells both in 2D and 3D-culture models
are presented and discussed. Among the array of synthesized compounds, 2b and 2m emerged as potent XO
inhibitors having IC50 values of 9.32 ± 0.45 µM and 10.03 ± 0.43 µM, respectively. Both compounds induced
apoptosis, halted the cell cycle progression at the G1 phase, elevated ROS levels, altered mitochondrial mem-
brane potential, and inhibited antioxidant enzymes. The levels of miRNA and expression of redox sensors in cells
were also altered due to increase oxidative stress induced by our compounds. Compounds 2b and 2m hold a great
promise for further development of XOIs for the treatment of XO-harboring tumors.
Xanthine oxidase
2-pyrazolines
2D-QSAR docking model
Reactive oxygen species
Redox sensor
Mitochondrial membrane permeability
1. Introduction
However, the indirect tumorigenic properties of its products, ROS (e.g.
oxygen free radicals and H2O2)[14] and uric acid are also thought to be
Xanthine oxidase (XO), a molybdoflavoenzyme catalyzes the con-
version of purines such as xanthine and hypoxanthine into uric acid
along with the production of reactive oxygen and nitrogen species (ROS
and RNS) [1–5]. Under the pathophysiological condition, the serum uric
acid level increases above the normal levels due to the excessive pro-
duction of XO and leads to hyperuricemia and gout (Fig. 1A) [6,7].
Besides, higher XO activity-induced free radicals are considered to be
involved in other diseases including metabolic disorders, diabetes, [8]
cardiovascular disorders, [9] inflammation, [10] and oxidative damage
[3,11,12].
noteworthy in the stimulation of anti-apoptotic, and angiogenic genes
(via NF-kB and HIF-1α upregulation), initiation of inflammation, cell
proliferation, and metastasis by COX-2 upregulation [3,15–17]. In
clinical findings, increase uric acid levels are well correlated with a
decrease in survival time of cancer patients [15,18]. Furthermore, uric
acid concentration in cancer patients was also observed to elevate with
staging and is also used as a diagnostic and prognostic marker [19].
Thus, inhibition of XO could be hypothesized to yield broad-spectrum
therapeutics, including cancer. However, only three XO inhibitors
(XOI; Fig. 1B), allopurinol, febuxostat and topiroxostat (approved in
Japan only),[7,20] are available in the clinic till date and that to, for the
treatment of hyperuricemia and gout only. Allopurinol, due to purine
In cancer progression, the direct role of XO is considered significant
as it catalyzes the metabolic activation of carcinogenic substances [13].
* Corresponding author.
** Co-corresponding authors.
E-mail addresses: ngavande@wayne.edu (N.S. Gavande), sandeepsingh82@gmail.com (S. Singh), raj.khunger@cup.edu.in (R. Kumar).
https://doi.org/10.1016/j.bioorg.2020.104620
Received 17 October 2020; Received in revised form 26 December 2020; Accepted 29 December 2020
Available online 5 January 2021
0045-2068/© 2021 Elsevier Inc. All rights reserved.

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
like scaffold, has been associated with adverse side effects especially
serious cutaneous adverse events owing to the inhibition of other purine
metabolizing enzymes such as guanine deaminase, orotidine-5-
monophosphate decarboxylase, orotate phosphoribosyltransferase,
hypoxanthine–guanine phosphoribosyltransferase, and purine nucleo-
side phosphorylase [21]. Furthermore, non-purine XOIs such as
febuxostat and topiroxostat, although are more effective than allopu-
rinol, but hepatotoxicity & higher cardiovascular risks, and elevated
alanine aminotransferase associated with them limit their use and
warrant search for newer agents [22–24]. Several natural and synthetic
compounds such as xanthones,[25] chalcones,[26] flavonoids,[27] 1,3-
cyclohexanedione derivatives,[28] naphthoflavone,[29] azaflavones,
[30] pyrazoloquinazolines,[31] pyrazolines/pyrazoles,[32] amides,
[33] etc. are known to possess XO inhibitory activity. Thus, considering
the importance of XOIs and problems associated with existing XOI,
search for novel, more efficacious yet safer XOIs is further necessitated.
Despite the strong association between XO along with its products
and cancer, a few XOIs[34,35] have been studied for their development
as anticancer agents for the treatment of the XO overexpressing tumor
and interestingly none of the compound utilized as a chemical probe for
understanding the mechanistic aspects in cancer cell lines. Cancer cells
possess ROS approximately near to threshold and, low level of antioxi-
dant enzymes, which make them more susceptible towards oxidative
stress than normal cells [36]. This oxidative stress leads to hyper-
oxygenation (more H2O2 production)[37 14] and decreases the prolif-
eration of cancer cells, alters the redox potential, prevents cell migration
and invasion, increases p53 activity along with affecting major onco-
genic proteins leading to cell death (Fig. 1A)[38–40]. More interest-
ingly, tumors cells have decreased ability to metabolize ROS (especially
H2O2) which makes therapy more effective. [41]
Available XOIs do not induce much increase in ROS levels although
they inhibit Mo-co site competitively or non-competitively and spare
FAD site of XO for ROS production. [1,16,42]. Thus, a XOI which, in (a)
cancerous tissue can induce oxidative stress-mediated anticancer effect
via XO-dependent or independent mechanism, modulates redox state of
the cells, limits level of XO-mediated carcinogenic metabolites along
with anti-hyperuricemic action and in (b) normal tissue can cause
antihyperuricemic/anti-gout effect without initiating cytotoxicity to
normal cells (due to higher level of antioxidant enzymes), is highly
desirable. With our previous expertise in the field of xanthine oxidase
inhibitors [4,32,33] and anticancer research,[43–45] we thought to
design and synthesize 3,5-diaryl-4,5-dihydro-1H-pyrazole-1-carbalde-
hyde derivatives (2; Fig. 2) as XOIs and study their effect on cancer cells
that either express XO in high (liver, breast, colon, and kidney) or low
(skin and lung) levels, respectively [13]. Initial molecular docking with
2 into XO site revealed that compounds have a high predicted affinity for
XO. Further, 2 is structurally modified from our previously reported
non-purine XOIs, i.e. N-(1,3-diaryl-3-oxopropyl)amides[33] (4), N-
acetyl pyrazolines (5)[32] and clinically approved XOI (topiroxostat),
showed similar or some additional interactions as follows: (i) favorable
arene–arene interactions with PHE914 and PHE1009 with any one or
two of the aryl/heteroaryl rings (mostly joined by three atoms); (ii) H-
Fig. 1. (A). The illustration depicts Mo-co and FAD site of XO and key reactions catalyzed via this pathway(s), and (B). Clinically approved xanthine oxidase in-
hibitors.
The Mo-co site assists in catalyzing hypoxanthine conversion to uric acid via xanthine. The Xanthine Oxidase Inhibitors (XOIs) bind to Mo-co sites, halt the formation of uric
acid. During this process, water and molecular oxygen combine to form H2O2 that further facilitates in numerous reactions. In normal cells (in contrast to cancer cells) an-
tioxidants like superoxide dismutase (SOD), glutathione peroxidase (GPx) including glutathione reductase (GR) and catalase are highly expressed, and they scavenge the
superoxide radicals and H2O2. Catalase is known to decompose H2O2 to H2O. However, SOD is involved in dismutation of superoxide radical forming H2O2 which rapidly forms
•OH radicals via Fenton reaction. Lately, GPx also neutralizes H2O2 resulting in the formation of two H2O molecules along with one molecule of GSSG which is further re-
generated to GSH via GR. These all catalytic cycles are profoundly altered in case of cancer and other hypoxic condition leading to the formation of H2O2 via XO or other known
canonical and non-canonical pathways leading to a selective upsurge in oxidative stress inside cancer cells. This mechanism of inducing oxidative stress selectively inside the
cancer cells is called hyperoxygenation therapy which upon utility leads to a decrease in cancer cell proliferation, cell migration and cell invasion. This pathway also increases
apoptosis and p53 activity and alters the signaling of key oncogenic proteins and transcriptional machinery, ultimately leading to selective cancer cell death.
2

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
Fig. 2. A rational approach for the design of target compounds (2) as xanthine oxidase inhibitors.
bond interaction with amide hydrogen of ASN768 and –CHO of 2
leading to better binding, in addition, to increment in aqueous solubil-
ity. N-formyl in 2-pyrazolines was reported to be critical to probe the
anticancer effects[46] and; (iii) a site for hydroxylation near molybde-
num metal. We were also interested to develop a robust 2D-quantitaive
structure activity relationship (QSAR) model based on correlation of XO
inhibitory data and molecular docking model for the prediction of XO
inhibitory activity.
respectively, compared to allopurinol (13.03 ± 0.53 µM). Lineweaver-
Burk plot analysis revealed that compound 2b presented a non-
competitive mode, while 2m showed the competitive mode of XO in-
hibition (Fig. 3). The careful observation of the graph revealed that
traversing lines on graph encounter to the left of the y-axis (2b) and
above the x-axis (2m). The graph also revealed that values of Km
(Michaelis constant) increased while Vmax was reduced, and slope (Km/
V
max) was thus increased. The value of α, i.e., a constant which attributes
to the degree at which inhibitor binding effects, the enzyme-substrate
formation was found to be higher than 1, that further confirms the se-
lective binding of inhibitors toward free enzyme rather than enzyme-
substrate complex[48].
2. Results and discussion
2.1. Synthesis
The outcome of biological results was further correlated with the
chemical space to generate Structural Activity Relationship (SAR). In
general, compounds having substituted phenyl at ring A were observed
to possess better XO inhibitory activity as compared to compounds
bearing naphthalene (compare 2s with 2k), thiophene (2c, 2j and 2r) or
pyridine (2p) rings (compare 2s with 2r and 2p) except 2d and 2f. In the
series of compounds bearing 3,4,5-trimethoxy phenyl at ring B, the
introduction of a methoxy group at position-4 of ring A did not much
alter the activity (compare 2e with 2g), however, it was favorable at
position-3 (compare 2a with 2b). Dichloro substituted compounds were
less active than corresponding dimethoxy compounds (compare 2h with
2b). Furthermore, the substitution of hydrogen or methoxy at position-3
with iodo group potentiated the activity in a series of 5-hydroxy-2-nitro-
phenyl substituted (ring B) compounds (compare 2m with 2n and 2o).
Substituents such as hydroxyl and nitro at phenyl ring (ring B) were
tolerable towards XO activity.
Intermediates, 1,3-diarylpropenones (1a-1x) were synthesized via
acid-catalyzed Clasien-Schmidt condensation reaction of aryl/hetero-
aryl aldehydes (3) with aryl/heteroaryl ketones (4) (Scheme 1) [43,47].
Further, heating of 1a-1x (1 equiv), with formic acid and hydrazine
hydrate afforded the ring cyclized product N-formyl pyrazolines (2a-2x)
in good to excellent yields as the target compounds. All the compounds
were fully characterized by NMR, Mass Spectrometry, mp, IR and
elemental analysis.
2.2. Biology and molecular docking
2.2.1. Xanthine oxidase inhibition
The assessment of XO inhibitory activity (2a-2x) was performed by
spectrophotometrically measuring the uric acid formation at 290 nm as
per our previously standardized protocol [31,33]. Allopurinol was used
as a positive control. The results indicated that 2b and 2m exhibited
significant XO inhibition (Table 1 and see SI, Figure S1) and reduction
in the levels of uric acid at IC50 of 9.32 ± 0.45 µM and 10.03 ± 0.43 µM,
2.2.2. Molecular docking and generation of a docking model
In order to delineate the key interactions and molecular recognition
3

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
Scheme 1. Reagents and conditions (a) CH3COOH, H2SO4, rt, 10 h; (b) NH2NH2⋅H2O (80%), HCOOH, reflux, 3–4 h.
containing aromatic ring (2b) and PHE1013. The distance between the
oxo groups attached to the molybdenum of molybdopterin was observed
to be 2.7 Å for 2b. The docking scores for R isomers of 2b and 2m were
found to ꢀ 7.133 Kcal/mol (S isomer = -3.59 Kcal/mol) and ꢀ 6.734
Kcal/mol (S isomer = -4.701 Kcal/mol), respectively. This could explain
the reason behind differences in their mode of inhibition of XO. Allo-
purinol occupied the active site with a docking score of ꢀ 4.86 Kcal/mol.
Furthermore, we developed a docking model based on docking re-
sults to predict the XO inhibitory activity of compounds bearing the
same scaffold. All the final twenty-four compounds (2a-2x; R and S
forms) were docked into the XO binding site, and their results were
correlated with XO inhibitory data (Table 1). There were mainly two
factors considered while developing a docking model. The first was the
correlation factor, which was higher for R form (0.569) than for S form
(0.256) indicating that R form of the compounds was active against XO.
The second factor was the binding pattern of the R and S forms to each
other, which was similar for R form and dissimilar for S isomers of many
compounds. Due to the lower correlation of activity to the docking score
(0.256) and binding pattern dissimilarity, the S isomers were not
considered to build the docking model.
Table 1
In vitro XO inhibition by compounds (2a-2x).
Cd
IC50 (µM)a
Cd
IC50 (µM)a
Cd
IC50 (µM)a
2a
2b
2c
2d
2e
2f
14.01 ± 0.68
9.32 ± 0.45
25.69 ± 0.58
37.56 ± 0.62
12.65 ± 0.72
30.35 ± 0.32
11.12 ± 0.42
13.09 ± 0.58
2i
27.78 ± 0.43
27.65 ± 0.41
17.24 ± 0.63
21.32 ± 0.65
10.03 ± 0.43
13.56 ± 0.28
12.98 ± 0.42
19.09 ± 0.52
2q
2r
15.65 ± 0.35
19.32 ± 0.48
13.43 ± 0.69
16.76 ± 0.62
14.96 ± 0.46
21.67 ± 0.37
13.85 ± 0.47
13.38 ± 0.38
2j
2k
2l
2s
2t
2m
2n
2o
2p
2u
2v
2w
2x
2g
2h
Allopurinol 13.03 ± 0.53 µM
a
Data is expressed as mean values ± SD of three independent experiments.
of our two best compounds, compound 2b and 2m, were flexibly docked
(R and S isomers) mainly directing on the Mo-co site of XO (PDB ID:
1FIQ)[49]. It was observed that the R isomers were more active and
fitted best into the XO active site. The molecular interactions of 2b and
2m (Fig. 4) are ascribed as (i) π-π interactions between a planar ring
containing one methoxy group of 2b and 2m and the PHE914 ring, and
perpendicular to the PHE1009. A similar type of interaction was
The following equation was considered for the construction of the
model.
π-π
observed in the xanthine oxidase active site with allopurinol and sali-
cylic acid;[50] (ii) H-bonding was observed between the formyl oxygen
(2b; 2.3 Å and 2m; 2.6 Å) and amide hydrogen of ASN768 amino acid
residue. Although 2b and 2m appeared to have similar docking poses
but possessed different binding modes e.g., (i) an additional H-bonding
interaction was seen between the ARG880 and oxygen of methoxy
containing an aromatic ring in case of 2m, however, (ii) a perpendicular
pIC50 = m * Docking Score (R form) + C, where m and C are constants
Based on the poses of R isomers of 2a-2x, seventeen compounds out
of twenty-four compounds were divided into the two categories based
on their activities, i.e. active and intermediate active (see SI, Table S1).
It was observed that seven compounds with the similar activity showed a
disfavourable binding pattern. The functional groups present on the
aromatic ring system might have altered the binding pattern of the
π-π stacking interaction was observed between the trimethoxy
4

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
Fig. 3. Lineweaver-Burk plots of the inhibition of XO by (A). compound 2b (non-competitive) and, (B). 2m (competitive).
compounds and led to disfavourable binding, which brings out a
discrepancy between the docking scores and experimental data. These
seven compounds with the disfavorable binding pattern were removed
from the study. The compounds were then divided into test and training
set based on the hierarchal clustering (see SI, Figure S2). Thereafter a
docking model was obtained based on the docking score and pIC50
(Equation (1)) using the linear regression model.
0.689, F = 40.07
Where N is the number of compounds included in the model, se is the
standard error of estimate,
R1/R2 is the square of the correlation coefficient of the predicted test
set, F is the Fisher ratio.
Two ways of validation techniques, internal (training set) and
external validation (test set) were utilized for the model. The internal
validation was done by R2, which has a value of around 0.658, higher
than 0.5 that predicts the model to be the robust one. Other internal
validation parameters included were the standard error of estimation
(SEE), R2 adjusted, the predictive sum of square (PRESS) and Fisher
pIC50 = 3.72662 ( ± 0.16593)
ꢀ 0.1737( ± 0.02744) Docking score ofRisomer
(1)
N = 17, R1 = 0.769, R2T = 0.89, se = 0.075, R2adj = 0.7503, q2
=
(loo)
5

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
Fig. 4. The binding pattern and the essential molecular interactions of the active molecules (A). 2b (pink) and (B). 2m (cyan) with the residual amino acids of
xanthine oxidase active site. Hydrogen atoms are not shown for better clarity and presentation. (For interpretation of the references to color in this figure legend, the
reader is referred to the web version of this article.)
ratio, F values which were 0.075, 0.7503, 0.067, and 40.07, respec-
Table 2
tively. The best method for the validation of models is by external
Results of predicted XO inhibitory activity (logarithm of the inverse of IC50) of
validation. The proposed models were validated through the test set.
compounds obtained through 2D-QSAR model.
The R2 value of 0.769 was>0.6, and Q2 value of 0.689 was>0.5 for the
Entry
Compound
Observed activity (pIC50
)
Predicted activity (pIC50)
predicted test set. The other external validation parameters such as R20,
R’20 and Root mean square error of prediction (RMSEP) were of the value
0.846, 0.712, and 0.1688, respectively, and describes the decent pre-
dictability of the models. The error-based parameters such as Mean
Absolute Error (MAE) is 0.142, Standard Deviation of Absolute Error
(SD) is 0.064. Based on Model Quality based on MAE-based criteria, the
model was predicted to be ’GOOD’. The second vital criterion was R2
which had a threshold value of 0.892, and in the case of the predicted
model, its Q2 was 0.689 and passed the criteria of robust model. The
third essential criterion is |R02-R’20|, value 0.0135, which is predicted to
be good as the threshold value of |R20-R’02| should be less 0.3. The last and
essential criteria for the robust model are k value and [(R2-R02)/R2]. The
k value is predicted to be 1.03 comparable to the threshold value 0.85 <
k < 1.15 whereas [(R2-R02)/R2] is 0.052 ([(R2-R20)/R2] should be<0.1),
which predicts the model to be a decent model for the prediction of
activity. The predictive ability of the best fit models was further evalu-
ated by calculating their overall metric values. The rm2 values express the
prediction quality of the model [51,52] (Y-range). The value of rm2 was
found to be 0.584 which was found to be>0.5 which predicts the model
as the docking model for the prediction of XO inhibitory activity.
A stability test assessed further evaluation of the significance of the
developed model. For this, calculation of some more properties such as
reverse rm2 , average rm2 and delta rm2 was performed. These enlisted pa-
rameters had specific cut-off values such as reverse rm2 and average
rm2 should be > 0.5 whereas delta rm2 should be < 0.2. The calculated
values for the properties mentioned above for the dataset were found to
be 0.584 for reverse rm2 , 0.584 for average rm2 and 0.162 for delta rm2 ,
respectively and were within limits. So the developed model was pre-
dicted to be the robust one for the prediction of XO inhibitory activity
using the docking scores of the compounds (Table 2).
1
2a
2b
2c
4.85
5.03
4.59
4.52
4.95
4.56
4.76
4.67
4.81
4.89
4.81
4.62
4.67
4.78
4.83
4.67
4.86
4.93
4.96
4.63
4.61
4.90
4.57
4.84
4.73
4.81
4.81
4.81
4.62
4.67
4.70
4.71
4.59
4.89
2
3
4
2f
5
2 g
2i
6
7
2k
2l
8
9
2ma
2o
2q
2ra
2sa
2 t
2u
2v
2w
10
11
12
13
14
15
16
17
a
Test set compounds.
using mainly two cancer cell lines A549 (lung; low XO expression) and
MDA-MB-231 (breast; high XO expression) [13]. Allopurinol was also
included in the study for comparing the results[53] (Table 3).
As expected, both compounds 2b and 2m inhibited the growth of XO-
harboring breast cancer cell line (MDA-MB-231) at IC50 values of 1.22 ±
0.79 µM and 1.01 ± 0.62 µM, respectively. However, the IC50 values of
2b and 2m were 2–4 folds higher when tested against low expressing
lung cancer cells (A549). A similar trend was observed in case of
Table 3
Anticancer potential of 2b and 2m in comparison with allopurinol in A549
(lung) and MDA-MB-231 (breast) cancer cells.
Compound
Code
IC50 (µM)a
3. Antiproliferative activity, and apoptotic mode of cell death by
increasing the redox state of cancer cells to the condition of
oxidative stress
A549 (Lung) Cancer
cells
MDA-MB-231 (Breast) Cancer
cells
2b
4.31 ± 0.75
2.82 ± 0.92
2.94 ± 1.23
1.22 ± 0.79
1.01 ± 0.62
< 1
2m
Simultaneously, we determined the anticancer potential of newly
Allopurinol
emerged XOIs, i.e. 2b and 2m, by MTT based antiproliferative assay
a
Data is expressed as mean values ± SD of three independent.
6

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
allopurinol, indicating the XO-inhibition as one of the major pathways in
inducing cytotoxicity. Furthermore, both lead compounds did not
induce any significant toxicity when tested against normal control cells,
i.e. Human Peripheral Blood Mononuclear Cells (hPBMCs) and HBL-100
(normal breast cells) (Fig. 5A and 5B).
73.1% by allopurinol and 2b and 2m, respectively thus, further proving
their effectiveness in inducing the apoptosis beside depleting the XO
levels.
To assess our 2b and 2m compounds for their effect on intracellular
and extracellular ROS, we performed a flow cytometry-based study
using three dyes, viz., H2DCFDA, Cell Rox red, and DHE for detection of
peroxyl, and hydroxyl type ROS species level within the cell. The results
suggested (Fig. 8 A-C) that the compounds were able to elevate ROS
levels in breast cancer cells at sub IC50 concentration.
Cell distribution inside tissue is very different, and especially in
cancer, cells are very densely packed, which renders most of the drugs
inefficient. To understand the potency of these compounds in tissues, we
created a 3D culture model using breast cancer cells (MDA-MB-231).
[54] After achieving the 3D growth, we began with the treatment of the
cell mass with our synthesized compounds 2b and 2m at sub-IC50 con-
centration. The treatment was given every third day for 17 days. The end
of the experiment was deduced by comparing the diameter of the 3D
sphere. The results revealed that there was a slight decrease of 6% (0.11
mm) on treatment with 2b. In comparison, 2m was found to reduce the
sphere diameter by 51% effectively (0.55 mm), indicating profound and
better cytotoxicity as compared to 2b in the 3D model (Fig. 6) while,
allopurinol reduced the size by 39%. Altogether, our results revealed
that 2m showed significant toxicity that could be due to (i) unintended
drug targets mediated by XO signaling; (ii) anticancer drug metabolite
(s) of 2m produced owing to its cellular nitro bio-reduction by re-
ductases overexpressed in the solid and hypoxic tumors.
This upsurge in ROS was corroborated using antioxidants assays
performed against MDA-MB-231 cells pre-treated with compounds 2b
and 2m at their sub-IC50 concentration for 48 h. The results advocated a
substantial decrease in SOD (superoxide dismutase) and GR (glutathione
reductase) activity by our compounds [55]. SOD was found to be
inhibited by 43% with 2b, 60% by 2m and 48% by allopurinol. GR
activity was found to be inhibited by 33% by 2b, 45% by 2 m and 31%
by allopurinol. Interestingly, catalase, which is a known H2O2 detoxi-
fying enzyme, was found to be inhibited only by the compound 2b
(33%) probably via oxidation by H2O2 [56]. Whereas, 2m and allopu-
rinol did not alter the catalase activity significantly (See SI, Figure S3).
The results seem interesting since it has been reported earlier that
elevated oxidative stress inside cancer cells is close to the lethal
threshold concentration which makes them more susceptible for ROS
accumulation than normal cells[36,57]. Further, any approach
including H2O2 elevation, capable of sufficiently up surging the cellular
levels of ROS may be therapeutically useful.
We further used Annexin-V/PI assay to investigate the mode of cell
death mediated by our two compounds. The results suggested that
compounds induced cell death via apoptosis (Fig. 7). The results signi-
fied the profound apoptosis of MDA-MB-231 cells with 71.1, 63.3, and
Fig. 5. The graph suggests the percentage of survival of (A). normal hPBMCs and (B). HBL-100 (normal breast cells) after treatment with compounds 2b and 2m for
48 h.
7

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
Fig. 6. Percentage change in diameter of the sphere by the compounds 2b and 2m along with allopurinol as compared with control in 3D-cell culture assay.
Fig. 7. Annexin V vs PI assay illustrating the mode of cell death induced by 2b, 2m and allopurinol. The assay was conducted using MDA-MB-231 cells previously
incubated with compounds for 48 h at their sub-IC50 concentration.
Furthermore, JC-1 assay was performed to investigate the alteration
in mitochondrial membrane permeability (MMP) against MDA-MB-231
cells induced by our compounds. Results revealed that 2b and 2m (at
sub-IC50 concentration) significantly altered the red/green ratio sug-
gesting the plausible role of mitochondrial-dependent (2b) or indepen-
dent (2m) cell death pathway (Fig. 9A-B). The stimulation of the
mitochondrial apoptotic pathway by oxidative stress is well known, and
so we observed similar activity in this study [58]. Furthermore,
following the elevated oxidative stress and MMP alteration, compounds
2b and 2m were able to halt the cell cycle progression at G1 phase arrest
by 69% and 74%, respectively (Fig. 9C).
and its loss of function is well correlated in the progression of higher-
grade carcinomas[59]. Further, reports also point c-Fos, to be a
component of the AP-1 transcription factor, which is induced transiently
by oxidative stress[60,61]. Similarly, Zeb, a transcriptional factor
involved in EMT (epithelial-to-mesenchymal transition) leading to
increased aggressiveness and metastasis of human carcinomas[62]
expression, was reduced mainly by compound 2m. Negative regulation
of Zeb by oxidative stress is well understood in the literature[63].
The compound 2m reduced expression of DDR2 (Discoidin Domain
Receptor 2). DDR2, a member of the tyrosine kinase family, is involved
in regulating cancer growth and assist in wound repair[64]. Similarly,
expression analysis revealed that let7a was significantly elevated on
exposure to either of the compounds. Whereas, miR494 expression was
reduced only by compound 2m. Let7a is one of the well-known tumor
suppressor miRNA[65], while mir494 is known to act as an oncomiR,
which is involved not only in cancer progression and metastasis but also
confers resistance to anticancer drugs[66]. These findings were also
previously reported by others[67–69].
4. Investigational compounds 2b and 2m affected major
oncogenic miRNAs and redox sensors
Next, we were interested in investigating the effect of compounds on
specific genes and miRNAs in MDA-MB-231 cancer cells, which are
regulated by oxidative stress. Real-time PCR studies revealed that
compounds 2b and 2m increased c-Fos expression in MDA-MB-231
cancer cells (Fig. 10A). The results were in agreement with the litera-
ture that claims the tumors suppress the pro-apoptotic function of c-Fos,
As miRNAs modulate the expression of redox sensors in response to
ROS., which include transcript factors such as p53 and p21, we per-
formed western blot analysis using the compounds 2b and 2m. The
8

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
Fig. 8. (A). Relative fluorescence altered by investigational compounds 2b and 2m under the influence of ROS generation by them in MDA-MB-231 cells as conferred
by A. Cell Rox red assay; (B). DHE based assay; C) H2DCFDA based assay. The assay was conducted using MDA-MB-231 cells previously incubated with 2b, 2m and
allopurinol for 48 h at their sub-IC50 concentration. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of
this article.)
results (Fig. 10B) indicated that p53, as well as p21 expression, were
significantly elevated by 2b. Interestingly, 2m had little or no effect.
However, pro-apoptotic proteins Bax and APAF-1 expressions were
significantly elevated, thus consolidating apoptosis as the mode of cell
death. ROS are known to upregulate p53 and induce p53-dependent
apoptosis in cancer cells [69] that would further lead to Bax activa-
tion[70]. Results with compound 2m may be explained through litera-
ture, which suggests that during extensive DNA damage, p53 and p21
expressions are down-regulated. In the present studies, it is anticipated
that reactive metabolites produced as a result of nitro bio-reduction of
2m would lead to extensive DNA damage[40,71–74].
of XO inhibitor activity of similar scaffold.
Furthermore, our lead compounds inhibited the growth of XO-
harboring cancer cells both in 2D and a 3D-tissue like a model of
MDA-MB-231 cells. The results were more impressive with 2m. Both the
compounds exhibited apoptotic mode of cell death and induced the cell
cycle arrest at the G1 phase. We concluded a ROS mediated apoptosis in
MDA-MB-231 cells due to increased oxidative stress, alteration of MMP
and inhibition of antioxidant enzymes (SOD, GR) caused by the com-
pounds 2b and 2m. After that, we examined the levels of miRNA and
expression of redox sensors in cells altered due to increase oxidative
stress induced by our compounds.
In a nutshell, we developed new XOIs rationally and explored the
strategy of inhibiting XO to develop potent anti-hyperuricemic/anti-
gout agents. The same XOIs can be exploited for their anticancer ther-
apeutics in XO-harboring tumors by targeting XO, enhancing ROS pro-
duction (either via XO dependent or some other pathways), and
inhibiting cellular antioxidants. In vivo studies are undergoing for 2b
and 2m in XO dependent and independent cancer models and will be
published in due course. 2b and 2m can also serve as chemical probes to
study XO-mediated carcinogenesis.
5. Conclusion
We designed and synthesized a series of non-purine XOIs derived
from 3,5-diaryl-4,5-dihydro-1H-pyrazole-carbaldehydes. Compounds
2b and 2m inhibited XO with higher potency. Compounds being non-
purine in nature, are less likely to alter the levels of other purine
metabolizing enzymes[4,75] and would be devoid of side effects as
associated with allopurinol. Molecular docking studies and XO inhibi-
tory data were correlated to develop a docking model for the prediction
9

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
Fig. 9. (A) Mitochondrial membrane permeability detected by JC-1 based mitochondrial permeability along with relative ratio (B) of change in red/green (J-ag-
gregates Vs. Monomers), higher red/green ratio suggests the healthy condition of mitochondria, whereas lower red/green ratio suggests reduced mitochondrial
potential; (C) Cell cycle analysis using propidium iodide suggesting percent cell count (DNA) at various stages of the cell cycle. The assays were conducted using
MDA-MB-231 cells previously incubated with 2b, 2m and allopurinol for 48 h at their sub-IC50 concentration. (For interpretation of the references to color in this
figure legend, the reader is referred to the web version of this article.)
6. Experimental section
6.1.3. Representative procedure for the synthesis of target compounds (2a-
2x)
6.1. Synthesis
To a 10 mL round bottom flask, were added an appropriate chalcone
(1 mmol), 1 mL of formic acid and hydrazine hydrate 80% (1.5 mmol).
The resulting mixture was refluxed further for 3–4 h. The reaction
mixture was quenched at its completion (TLC) by pouring cold water.
The resulting precipitates were washed with excess water and dried to
obtain the crude product that was further purified by crystallization
using ethyl acetate. All the target compounds (2a-2x) were synthesized
using a similar procedure. Further, the SciFinder search revealed com-
pound 2a, 2b, 2e, 2f, 2 k, 2o, 2p, 2q, 2r, 2 s, 2 t, 2u, 2v, and 2x were
reported and their physical data (mp, NMR, IR and HRMS) were in
accordance with their stated values in the literature[76–81]. Remaining
unreported compounds are duly characterized, and their physical data
are reported below.
6.1.1. Representative procedure for the synthesis of chalcones (1a-1x)
An equivalent mixture of appropriate aryl/heteroaryl ketone (1
mmol) and an appropriate aryl/heteroaryl aldehyde was dissolved in 1
mL of acetic acid in a 10 mL RBF. The mixture was further charged with
sulfuric acid (1–3 drops) and continuously stirred for next 10 h at room
temperature. The reaction mixture was quenched at its completion
(TLC) by pouring cold water. The resulting precipitates were washed
with excess water and dried to obtain the crude product that was further
purified by recrystallization in methanol. A similar procedure[43,76]
was utilized for the synthesis of all the chalcones (1a-1x). Character-
ization of representative compound 1a is given below.
6.1.2. (E)-1-(4-methoxyphenyl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-
6.1.4. 3-(4-Bromophenyl)-5-(thiophen-2-yl)-4,5-dihydro-1H-pyrazole-1-
carbaldehyde (2c)
one (1a)
Yield: 82%; Brown color solid; mp: 120–122 ◦C; IR (KBr cmꢀ 1):1655
Yield: 75%; White solid; mp: 150–152 ◦C; 1H NMR (CDCl3, 400 MHz,
δ with TMS = 0): 8.90 (1H, s), 7.62–7.58 (4H, m), 7.26–7.21 (1H, m),
7.06 (1H, d, J = 4.54 Hz), 6.96 (1H, m), 5.86–5.84 (1H, m), 3.76 (1H,
dd, J34 = 5.21 Hz), 3.38 (1H, dd, J34 = 5.28 Hz); 13C NMR (CDCl3, 100
MHz, δ with TMS = 0): 160.17, 154.65, 142.86, 132.19, 129.79, 128.22,
127.08, 125.45, 125.20, 54.65, 42.34; Anal. calcd for C14H11BrN2OS: C,
1
–
–
(C O), 1419 (C H). H NMR (CDCl3, 400 MHz, δ with TMS = 0): 8.02
–
(2H, d, J = 8 Hz), 7.69 (1H, d, J = 16 Hz), 7.41 (1H, d, J = 16 Hz), 6.97
(2H, d, J = 8 Hz), 6.84 (2H, s), 3.91 (6H, s), 3.88 (6H, s); MS (EI): m/z =
328 [M]+
10

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
Fig. 10. (A) qPCR analysis of using compounds 2b, 2m towards MDA-MB-231 cancer cell and their influence on c-Fos, Zeb, Ddr2 and MiRNA (Mir494, let7a); (B)
Western blot analysis of APAF-1, Bax, p21 and p53 protein level on MDA-MB-231 cells after treatment with investigational compounds 2b, 2m and allopurinol. The
assay was conducted using MDA-MB-231 cells previously incubated with our investigational compounds for 48 h at their sub-IC50 concentration.
50.16; H, 3.31; N, 8.36; S, 9.56. Found: C, 50.08; H, 3.22; N, 8.31; S,
9.49;
7.13–7.11 (1H, m), 6.46 (2H, s), 5.52–5.46 (1H, dd, J34 = 4 Hz),
3.87–3.83 (1H, m, overlapped with OCH3 signals), 3.86 (6H, s), 3.81
(3H, s), 3.25–3.20 (1H, dd, J34 = 4 Hz); 13C NMR (CDCl3, 100 MHz, δ
with TMS = 0): 160.01, 153.80, 151.53, 137.58, 136.08, 134.21,
129.36, 129.32, 127.81, 102.24, 60.80, 59.34, 56.17, 43.56; Anal. calcd
for C19H18Cl2N2O4: C, 55.76; H, 4.43; N, 6.84; Found: C, 55.69; H, 4.35;
N, 6.78; MS (EI): m/z = 408 [M]+
6.1.5. 3-(3-Nitrophenyl)-5-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1H-
pyrazole-1-carbaldehyde (2d)
Yield: 72%; Light brown solid; mp: 145–147 ◦C; IR (KBr, cmꢀ 1): 1650
1
–
–
–
–
(C O), 1591 (C N), 1323 (C N), 708 (C-Br); H NMR (CDCl3, 400
–
MHz, δ with TMS = 0): 9.01 (1H, s), 8.52 (1H, m), 8.28 (1H, m), 8.08
(1H, d, J = 8 Hz), 7.63 (1H, m), 6.41 (2H, s), 5.54 (1H, m), 3.24 (1H, m),
3.82–3.81 (1H, overlapped with OCH3 signals, m), 3.81 (6H, s), 3.89
(3H, s); 13C NMR (CDCl3, 100 MHz, δ with TMS = 0): 160.42, 153.92,
153.63 148.64, 137.75, 135.83, 132.71, 132.19, 130.10, 125.09,
121.65, 102.22, 60.87, 59.78, 56.25, 42.79; Anal. calcd for C19H19N3O6:
C, 59.22; H, 4.97; N, 10.90; Found: C, 59.16; H, 4.82; N, 10.83; MS (EI):
m/z = 385 [M]+
6.1.8. 3-(2-Fluorophenyl)-5-(3-nitrophenyl)-4,5-dihydro-1H-pyrazole-1-
carbaldehyde (2i)
Yield: 70%; Brown solid; mp: 130–132 ◦C; IR; (KBr, cmꢀ 1): 1676
1
–
–
–
–
–
(C O), 1598 (C N), 1350 (N O), 1318 (C N); H NMR (CDCl3, 400
–
–
MHz, δ with TMS = 0): 9.03 (1H, s), 8.56 (1H, s), 8.31 (1H, d, J = 4 Hz),
8.12 (1H, d, J = 8 Hz), 7.66 (1H, t, J = 6.4 Hz), 7.33–7.16 (4H, m),
5.84–5.80 (1H, m), 3.90 (1H, dd, J34 = 9.6 Hz), 3. 29 (1H, dd, J34 = 4.4
Hz); 13C NMR (CDCl3, 100 MHz, δ with TMS = 0): 160.90, 160.22,
158.94, 153.76, 148.57, 144.12, 132.69, 130.05, 129.98, 127.46,
126.73, 124.98, 121.56, 116.19, 54.63, 41.39; Anal. calcd for
6.1.6. 5-(2,5-Dimethoxyphenyl)-3-(4-methoxyphenyl)-4,5-dihydro-1H-
pyrazole-1-carbaldehyde (2g)
Yield: 80%; White solid, mp: 167–170 ◦C; IR (KBr, cmꢀ 1): 1671
C16H12FN3O3: C, 61.34; H, 3.86; N, 13.41; Found: C, 61.29; H, 3.81; N,
1
(C O), 1517 (C N), 1361 (C H), 1325 (C N); H NMR (CDCl3, 400
13.35; MS (EI): m/z = 313 [M]+
–
–
–
–
–
–
MHz, δ with TMS = 0): 8.97 (1H, s) 7.64 (2H, d, J = 8 Hz), 6.90 (2H, d, J
= 8 Hz), 6.82 (1H, s), 6.80 (1H, s), 6.64 (1H, d, J = 4 Hz), 5.73 (1H, m),
3.05 (1H, m), 3.84–3.83 (1H, m, overlapped with OCH3 signals), 3.83
(3H, s), 3.80 (3H, s) 3.76 (3H, s); 13C NMR (CDCl3, 100 MHz, δ with TMS
= 0): 160.02, 156.38, 153.82, 150.27, 130.57, 129.29, 128.36, 123.78,
114.20, 112.87, 111.96, 56.08, 55.80, 55.48, 54.61, 41.99; Anal. calcd
for C19H20N2O4: C, 67.05; H, 5.92; N, 8.23. Found: C, 66.98; H, 5.86; N,
8.18; MS (EI): m/z = 340 [M]+
6.1.9. 5-(Thiophen-2-yl)-3-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1H-
pyrazole-1-carbaldehyde (2j)
Yield: 73%; Orange solid; mp: 162–164 C; IR; (KBr, cmꢀ 1): 1671
◦
1
–
–
–
–
(C O), 1508 (C N), 1320 (C N); H NMR (CDCl3, 400 MHz, δ with
–
TMS = 0): 8.96 (1H, s), 7.70 (1H, d, J = 4 Hz), 7.44 (1H, m), 7.32–7.31
(1H, m), 6.43 (2H, s), 5.50 (1H, m), 3.99–3.88 (1H, m), 3.86 (6H, s),
3.79 (3H, s), 3.22 (1H, dd, J34 = 4 Hz); 13C NMR (CDCl3, 100 MHz, δ
with TMS = 0): 160.43, 154.80, 153.81, 136.03, 131.15, 130.86,
127.68, 102.37, 60.87, 59.74, 56.19, 45.52; Anal. calcd for
6.1.7. 3-(2,4-Dichlorophenyl)-5-(3,4,5-trimethoxyphenyl)-4,5-dihydro-
1H-pyrazole-1-carbaldehyde (2h)
C17H18N2O4S: C, 58.95; H, 5.24; N, 8.09; S, 9.26. Found: C, 58.87; H,
Yield: 73%; White solid; mp: 122–124 ◦C; IR; (KBr cmꢀ 1): 1677
5.26; N, 8.05; S, 9.24; MS (EI): m/z = 346 [M]+
1
–
–
–
–
(C O), 1591 (C N), 1328 (C N); H NMR (CDCl3, 400 MHz, δ with
–
TMS = 0): 8.98 (1H, s), 7.50 (1H, d, J = 4 Hz) 7.27 (1H, d, J = 6 Hz),
11

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
6.1.10. 3-(4-Hydroxyphenyl)-5-(2-nitrophenyl)-4,5-dihydro-1H-pyrazole-
inhibition of XO was quantified using the following formula:
1-carbaldehyde (2l)
% Inhibition = [(Ac-As)/Ac] × 100where Ac represent absorbance of
the control sample, As is the absorbance of the treated sample. Where A
is the absorbance of the control and investigational.
Yield: 84%, dull orange solid, mp: 98–100 ◦C; IR (KBr, cmꢀ 1): 3318
1
–
–
–
–
(C-OH), 1656 (C O), 1510 (N O), 1451 (N O); H NMR (CDCl + d -
–
–
3
DMSO, 400 MHz, δ with TMS = 0): 9.99 (1H, brs, D2O exchangeable6),
8.86 (1H, s), 8.10 (1H, d, J = 2.9 Hz), 7.72–7.68 (1H, m), 7.60–7.75 (3H,
m), 7.33 (1H, d, J = 7.52 Hz), 6.82 (2H, d, J = 8.64 Hz), 5.92 – 5.88 (1H,
m), 4.03 (1H, dd, J34 = 11.8 Hz,), 3.23 (1H, dd, J34 = 5.28 Hz). 13C NMR
(CDCl3 + d6-DMSO, 100 MHz, δ with TMS = 0): 160.03, 159.41, 156.19,
146.88, 135.66, 134.40, 128.66, 128.35, 126.80, 125.18, 121.35,
115.75, 55.47, 42.64; Anal. calcd for C16H13N3O4: C, 61.73; H, 4.21; N,
13.50; Found: C, 61.62; H, 4.13; N, 13.42.
6.3. Docking
The X-ray crystallographic structure of XO (PDB ID: 1FIQ) was pro-
cured from Protein Data Bank (PDB) (www.rcsb.org). The identification
of the binding sites was made on the basis of the co-crystallized ligand
(salicylic acid) present in the binding cavity of the XO. The protein
preparation is done using the Protein preparation wizard which was
used to achieve the minimum energy (stable conformation) of the
protein-ligand complex (adding hydrogen to energy minimization). The
receptor grid generation module is used to generate a grid by picking the
co-crystallized ligand in a prepared protein. Structures (in SDF format)
of the compounds were generated using ChemDraw Professional. The
optimized geometries of the compounds were generated by using
OPLS3e force field using LIGPREP module in Schrodinger (2020–1). The
ligands were docked at the binding site of XO using the extra precision
6.1.11. 5-(5-Hydroxy-2-nitrophenyl)-3-(3-iodo-4-methoxyphenyl)-4,5-
dihydro-1H-pyrazole-1-carbaldehyde (2m)
Yield: 93%, yellow solid, mp: 116–118 ◦C; IR (KBr, cmꢀ 1): 3318
1
–
–
–
–
(OH), 1656 (C O), 1510 (N O), 1451 (N O), 841 (C-I); H NMR (d -
–
–
DMSO, 400 MHz, δ with TMS = 0): 10.3 (1H, brs, D2O exchangeable6),
8.92 (1H, s), 8.16 – 8.01 (2H, m), 7.76 (1H, d, J = 4.8 Hz), 7.08 (1H, d, J
= 7.2 Hz), 6.88 – 6.86 (1H, dd, J34 = 3.32 Hz), 6.00 – 5.97 (1H, dd, J =
3.6 Hz), 4.03 – 3.99 (1H, m), 3.87 (3H, s), 3.33 – 3.29 (2H, m). 13C NMR
(d6-DMSO, 100 MHz, δ with TMS = 0): 163.73, 160.21, 160.04, 159.64,
155.64, 139.40, 138.62, 137.56, 129.24, 125.35, 115.71, 112.84,
111.94, 96.95, 57.15, 56.28, 42.23. HRMS (ESI) cald for C17H14IN3O5,
466.9978 [M]+; observed: 467.9949 [M + H]+; 489.9764 [M + Na]+;
HPLC: tR = 7.38 min.
¨
(XP) method in GLIDE module of Schrodinger software (Schrodinger
¨
Release 2020–3: Maestro, Schrodinger, LLC, New York, NY).
6.4. Docking model generation
The docking model was generated by correlating the docking score
with the pIC50 of the compounds. The docking score was taken as a
descriptor that describes the binding of the ligand to a receptor and
effects the activity of the compounds. The docking model equation is
generated as
6.1.12. 5-(5-Hydroxy-2-nitrophenyl)-3-(4-methoxyphenyl)-4,5-dihydro-
1H-pyrazole-1-carbaldehyde (2n)
Yield: 86%, dull yellow solid, mp: 112–114 ◦C; 1H NMR (d6-DMSO +
CDCl3, 400 MHz, δ with TMS = 0): 10.28 (1H, brs, D2O exchangeable),
8.91 (1H, s), 8.07 (1H, d, J = 3.92 Hz), 7.66 (2H, d, J = 2.76 Hz), 6.96
(2H, d, J = 2.68 Hz), 6.94 (1H, d, J = 2.6 Hz), 6.64 (1H, s), 7.09 – 6.98
(1H, dd, J34 = 2.6 Hz,), 4.04 – 3.97 (1H, m), 3.88 (3H, s), 3.23 – 3.17
(1H, dd, J34 = 5 Hz). 13C NMR (d6-DMSO + CDCl3, 100 MHz, δ with
TMS = 0): 162.73, 159.37, 148.34, 142.12, 139.30, 127.65, 126.79,
125.44, 114.37, 113.62, 59.51, 54.89, 40.85. Anal. calcd for
pIC50 = m * Docking Score + Cwhile m and C are constants.
The correlation was made between the pIC50 values and docking
scores and the compounds were divided into test set and training set.
The robust model was generated that helps in finding out the formylated
compounds with better activity. The validation of the generated docking
model was done using internal validation (training set) and external
validation (test set). The internal validation is done by R2 (>0.5) pre-
dicts the model to be the robust model. The best method for the vali-
dation of models is by external validation (test set). The R2 (>0.6), and
Q2 (>0.5) of test set are signatures of a robust model. Other values |R20-
R’20| (<0.3), k value (0.85 < k < 1.15) and [(R2-R02)/R2] (<0.1), predicts
a decent model for the prediction of activity.
C
17H15N3O5: C, 59.82; H, 4.43; N, 12.31. Found: C, 59.77; H, 4.75; N,
12.36; MS (EI): m/z = 341 [M]+.
6.1.13. 5-(2,4-Dinitrophenyl)-3-(4-iodo-3-methoxyphenyl)-4,5-dihydro-
1H-pyrazole-1-carbaldehyde (2w)
Yield: 81%, Yellow solid, mp: 172 – 174 ◦C. 1H NMR (d6-DMSO, 400
MHz, δ with TMS = 0): 8.92 (1H, s), 8.82 (1H, d, J = 4 Hz), 8.50 (1H, m),
8.16 (1H, s), 7.76 (1H, d, J = 4 Hz), 7.64 (1H, d, J = 8 Hz), 7.09 (1H, J =
8 Hz), 5.96 (1H, dd, J34 = 4 Hz), 4.05 (1H, dd, J34 = 4 Hz), 3.88 (3H, s),
3.44 (1H, m) . 13C NMR (100 MHz, d6-DMSO, TMS = 0): 159.94, 159.70,
155.19, 147.17, 146.90, 141.44, 137.23, 129.33, 128.83, 128.56,
124.76, 120.53, 111.55, 86.69, 56.77, 56.33, 39.72. Anal. calcd for
The predictive ability of the best fit models was further evaluated by
metric values (rm2 ):
√̅̅̅̅̅̅̅̅̅̅̅̅̅̅
2
rm2 = r2(1ꢀ r2 ꢀ ro2
here r2and ro2 are correlations between the observed and predicted
values [51,52] (aptsoftware.co.in/rmsquare). The value of rm2 (>0.5)
and properties such as reverse rm2 (>0.5), average rm2 (>0.5) and delta rm2
(<0.2) denotes stabilty of developed docking model.
C
17H13IN4O6: C, 41.15; H, 2.64; N, 11.29; Found: C, 41.09; H, 2.58; N,
11.22.
6.2. Xanthine oxidase assay
6.5. Cell culturing and maintenance
All the investigational compounds were assessed for their XO inhi-
bition by analyzing and measuring the uric acid concentration spectro-
photometrically at 292 nm. The reaction mixture was comprised of
potassium phosphate buffer (1.5 mL of 50 mM; pH 7.4), test sample
solution (1 mL at a concentration of 1, 5, 25 µM), freshly prepared XO
enzyme solution (0.5 mL). The mixture was pre-incubated for 15 min to
allow the formation of enzyme-drug complex, which was further
quantified using substrate solution (1 mL of 0.10 mM of xanthine) fol-
lowed by its incubation for next 30 min. The reaction was stopped by
adding 1 M HCl (1 mL). For the control experiment, blank samples were
made by replacing xanthine with phosphate buffer. Readings were taken
in triplicate and represented as IC50 ± SD during the experiment. The
All the cells used during experiments were purchased from NCCS
Pune, India and were used standard conditions as per our previously
published methodology[82,83] Cells were grown in culture flasks/petri
dishes using DMEM media, complemented with 10% fetal bovine serum
(FBS) and1X penicillin–streptomycin antibiotic solution. The cells were
incubated at 37˚C in a humidified atmosphere containing 5% CO2. Sub-
culturing of cells was done when the cancer cell lines have attained
70–80% growth. All the sterile conditions were maintained during the
culturing and handling of cells used herein. Work on blood cells
(HPBMCs) was conducted as per protocol no. CUPB/cc/14/IEC/4483
approved by the Institutional Ethics Committee of Central University of
12

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
Punjab, Bathinda and recommended according to guidelines issued by
the Indian Council of Medical Research (ICMR), Govt. of India.
stipulated time cells were centrifuged at 2500 rpm and further washed
with 1 X PBS. After that, 50 µL of Ribonuclease A was added to avoid any
false positive quantification due to the presence of RNA. After approx-
imately 15 min PI was added (as per manufacturer protocol) to each tube
before analysis using flow cytometer at channel FL-2 after 30 min.
[82,83]
6.5.1. MTT based antiproliferative assay
After growing cells as per discussed above, approximately 10,000
cells (analyzed via trypan blue using automated cell counter) were
seeded in 96 well plates. The plates were incubated at 37˚C with 5% CO2
for 24 h, followed by serum starvation for 8 h for synchronization and
replenishing with complete media. The treatment was given to the cells
in triplicate concentrations of 1, 5 and 25 µM and incubated for 48 h. The
formation of formazan, as a consequence, was read spectrometrically at
570 nm, which was expressed as % inhibition (Mean ± S.D) [82,83].
6.5.7. Antioxidant enzyme assays
In order to assess the effect of synthetics on the antioxidant enzymes
following assays were conducted.
6.5.7.1. Superoxide dismutase (SOD) assay. The assay principle relies on
the inhibition of auto-oxidation ability of pyrogallol catalyzed by SOD.
Briefly, the assay mixture includes sodium phosphate (0.1 mM) buffer
maintained at pH 8, EDTA solution (3 mM) and pyrogallol (8.1 mM)
along with cellular samples treated with investigational drugs. The re-
action mixture was prepared by addition of buffers and EDTA solution
(except pyrogallol) to the reaction plate and incubated for 15 min at rt.
The reaction was initiated by adding pyrogallol and absorbance of
autooxidation of pyragallol was quantified spectrophotometrically at
420 nm and was expressed as U/mg of protein correlating with enzyme
amount that causes half-maximal inhibition of auto-oxidation of pyro-
gallol [87,88].
6.5.2. 3D cell culture
The 3D culturing was done as per the modified manufacturer pro-
tocol (Invitrogen). Cells (MDAMB-231; 4 X 105) were suspended in the
scaffold fixed on a 6 well plate with 1 mL media. The standard culturing
conditions were followed, and media was replaced after until 21 days to
ensure the 3D growth. The developed scaffolds were further treated and
incubated with investigational compounds at sub-IC50 dose. The inhi-
bition was analyzed quantitatively by measuring the thickness of treated
scaffold with control using a digital Vernier calliper [82,83].
6.5.3. Annexin V vs PI assay
The following formula was used to calculate the percent of inhibi-
tion.
The assay was used to predict the mode of cell death. PI annexin-V kit
(Thermo Fisher: V13242) was used for the experiment. Briefly after
culturing the cells in petri plates as per methodology as mentioned
earlier and appropriate treatment with investigational synthetics at sub-
IC50 dose were incubated for 48 h. Cellular samples were further tryp-
sinized and harvested and prepared for analysis. Briefly, the preparation
of samples was done by centrifuging the suspension at 1200 rpm for 5
min and washed with 1X PBS. The suspended cells were stained using
the dye as per manufacturer protocol and incubated for 30 min at room
temperature in the dark before analysis using a BD C6 flow cytometer at
FL-1 vs. FL2 channel[82–84].
Control ꢀ Treatment
%Inhibition =
× 100
Control]
6.5.7.2. Catalase. Cell organelle, such as peroxisome, have an enzyme
named catalase that helps in catalyzation of hydrogen peroxide to water
and oxygen. 1-unit catalase decomposes 1 µM of H2O2 per minute at
25 ◦C (pH 7.0). To the treated lysed cells and residual media, the
disappearance of peroxide was read spectrophotometrically. Briefly, cell
lysate, Hydrogen peroxide (H2O2) (39 mM), was diluted in 50 mM So-
dium Phosphate buffer. A decrease in absorbance was measured after 2
min spectrophotometrically at 240 nm [89]. % reduction in H2O2 was
measured in minꢀ 1 mg protein-1.
The remaining assays, including ROS, JC-1 and PI were performed
using similar protocols, by replacing the dye with appropriate one after
sample preparation as discussed.
6.5.7.3. Glutathione reductase. Glutathione can reduce hydrogen
peroxide levels with the help of glutathione peroxidase enzyme. After
cellular treatment for 48 h at a sub-IC50 concentration of investigational
samples, media was removed, and the cellular lysate was made that was
further precipitated using 25% trichloroacetic acid and supernatant was
extracted by centrifugation at 8,000 rpm for 10 min. The supernatant
was mixed with GSSG (oxidized Glutathione) and incubated (dark for
15 min), which was further quantified for GSH inhibition spectropho-
tometrically at 412 nm using microplate reader [90,91].
6.5.4. ROS assay
The analysis of oxidative stress generated in response to treatment
with investigational samples was done using three redox dyes (pur-
chased from Molecular Probes), namely, H2DCFDA (2′,7′-dichlorodihy-
drofluorescein diacetate) dye (H2O2 Detection); Cell rox red (detects
superoxide or nitrite peroxidase); DHE (Dihydroethidium; detects
Mitochondrial peroxidase) and the results (fluorescence intensity) were
measured using BD C6 flow cytometer. After using the above method-
ology (section 7.6.3), cells were stained with appropriate redox dye and
kept at dark for 15–30 min before analysis using flow cytometer in Count
vs. FL-1 region [82,83,85].
6.5.8. Real Time-PCR
Gene expression, in terms of mRNA level, was measured using real-
time PCR. Specific primers for the genes were designed and used to
understand how dual inhibitors regulate the expression of critical genes
involved in carcinogenesis. TRIZOL reagent (Invitrogen) was used for
RNA isolation from MDAMB-231 cell pre-treated with approximate 200
ng of total RNA was transcribed to cDNA using a cDNA synthesis kit
(Biorad), and then 3 µL of cDNA template was used to perform RT-qPCR
using SYBR green mix. Relative expression was normalized to β-actin
and calculated using 2 (-ΔΔT) as described previously [82,83,92].
The list of primer used for RT and real-time PCR is given below:
6.5.5. JC-1 assay
The mitochondrial membrane potential (△ψm) altered by investi-
gational molecules, was deducted using JC-1 dye (Sigma Aldrich). The
dye is chemically 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetrabenzimidazolo-
carbocyanine iodide which a cationic carbocyanine. After using the
above methodology (section 7.6.3) JC-1 dye was added, and the cellular
suspensions were incubated further for 30 min before analyzing Δψm
using flow cytometer (BD Accuri) in FL-2 vs. FL-1 region. [82,83,86]
c-Fos (Fwd):
c-Fos (Rev):
ZEB 1 (Fwd):
ZEB 1 (Rev):
DDR2 (Fwd):
5′ AAGGAGAATCCGAAGGGAAA
5′ AGGGCCCTTATGCTCAATCT
5′ ACCTCTTCACAGGTTGCTCCT
5′ AGTGCAGGAGCTGAGAGTCA
5′ CTCCCAGAATTTGCTCCAG
6.5.6. PI-based cell cycle assay
The PI (propidium iodide) assay was used to quantify the effect of
investigational samples on the progression of the cell cycle. After using
above methodology, (treatment only) (section 7.6.3) cells were addi-
tionally fixed using chilled ethanol to allow dye passage to the nucleus of
cells and were further incubated for 3 h at ꢀ 20 ◦C. After incubation of
(continued on next page)
13

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
(continued)
DDR2 (Rev):
Actin (Fwd):
Actin (Rev):
´
´
[8] M.-C. Desco, M. Asensi, R. Marquez, J. Martínez-Valls, M. Vento, F.V. Pallardo,
˜
J. Sastre, J. Vina, Xanthine oxidase is involved in free radical production in type 1
5′ GCCACATCTTTTCCTGAGA
5′ AGAGCTACGAGCTGCCTGAC
5′ AGCACTGTGTTGGCGTACAG
diabetes: protection by allopurinol, Diabetes 51 (4) (2002) 1118–1124.
[9] C. Borghi, G. Desideri, Urate-lowering drugs and prevention of cardiovascular
disease: the emerging role of xanthine oxidase inhibition, Am Heart Assoc (2016)
496–498.
[10] A. Meneshian, G.B. Bulkley, The physiology of endothelial xanthine oxidase: from
urate catabolism to reperfusion injury to inflammatory signal transduction,
Microcirculation 9 (3) (2002) 161–175, https://doi.org/10.1038/sj.mn.7800136.
6.5.9. Western blotting
ˇ
ˇ
ˇ
ˇ
´
´
´
´
´
ˇ ˇ
[11] A. Smelcerovic, K. Tomovic, Z. Smelcerovic, Z. Petronijevic, G. Kocic, T. Tomasic,
The western blotting was performed as per our previously published
work. [82,83] MDA-MB-231 cells were treated with investigational
compounds for 48 h and after that lysed using RIPA buffer and were
quantified using Bradford assay. Oncoproteins (p53, p21, PCNA,
phospho-p53) were used for the study. Proteins were resolved in elec-
trophoresis assembly using 10% SDS-PAGE. After completely running
the sample, the gel was transferred using nitrocellulose membranes
(Biorad). The blocking was done for 4 h at 4˚C using non-fat dry milk
(prepared using 50 mM Tris-HCl (pH 7.4) 0.05% Tween 20 (TBST)).
Blocked membrane was washed thoroughly (1X PBS) and incubated
with respective primary antibody for overnight at 4˚C and then incubated
with the respective secondary antibody for 3 h. β-Actin served as control
during analysis. The bands were detected using ECL and visualized using
a gel documentation system.
ˇ
Z. Jakopin, M. Anderluh, Xanthine oxidase inhibitors beyond allopurinol and
febuxostat; an overview and selection of potential leads based on in silico
calculated physico-chemical properties, predicted pharmacokinetics and toxicity,
Eur. J. Med. Chem. 135 (2017) 491–516.
[12] H.Y. Chung, B.S. Baek, S.H. Song, M.S. Kim, J.I. Huh, K.H. Shim, K.W. Kim, K.
H. Lee, Xanthine dehydrogenase/xanthine oxidase and oxidative stress, Age
(Omaha) 20 (3) (1997) 127–140, https://doi.org/10.1007/s11357-997-0012-2.
[13] M.G. Battelli, L. Polito, M. Bortolotti, A. Bolognesi, Xanthine oxidoreductase in
cancer: more than a differentiation marker, Cancer Medicine 5 (3) (2016) 546–557.
[14] E.E. Kelley, N.K. Khoo, N.J. Hundley, U.Z. Malik, B.A. Freeman, M.M. Tarpey,
Hydrogen peroxide is the major oxidant product of xanthine oxidase, Free Radical
Biol. Med. 48 (4) (2010) 493–498.
[15] M.A. Fini, A. Elias, R.J. Johnson, R.M. Wright, Contribution of uric acid to cancer
risk, recurrence, and mortality, Clin Transl Med 1 (1) (2012) 16, https://doi.org/
10.1186/2001-1326-1-16.
[16] M.G. Battelli, L. Polito, M. Bortolotti, A. Bolognesi, Xanthine Oxidoreductase-
Derived Reactive Species: Physiological and Pathological Effects, Oxid Med Cell
Longev 2016 (2016) 3527579, https://doi.org/10.1155/2016/3527579.
[17] M.G. Battelli, M. Bortolotti, L. Polito, A. Bolognesi, Metabolic syndrome and cancer
risk: The role of xanthine oxidoreductase, Redox Biol. 21 (2019), 101070, https://
doi.org/10.1016/j.redox.2018.101070.
Author Contributions
[18] H.-S. Shin, H.-R. Lee, D.-C. Lee, J.-Y. Shim, K.-H. Cho, S.-Y. Suh, Uric acid as a
prognostic factor for survival time: a prospective cohort study of terminally ill
cancer patients, J. Pain Symptom Manage. 31 (6) (2006) 493–501.
[19] R. Dhankhar, K. Dahiya, T.K. Sharma, V.S. Ghalaut, R. Atri, V. Kaushal, Diagnostic
significance of adenosine deaminase, uric acid and C-reactive protein levels in
patients of head and neck carcinoma, Clin Lab 57 (9–10) (2011) 795–798.
[20] M. Giulia Battelli, L. Polito, M. Bortolotti, A. Bolognesi, Xanthine oxidoreductase in
drug metabolism: beyond a role as a detoxifying enzyme, Curr. Med. Chem. 23 (35)
(2016) 4027–4036.
The manuscript was written through the contributions of all authors.
All authors have approved the final version of the manuscript.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
[21] M.A. Becker, H.R. Schumacher Jr., R.L. Wortmann, P.A. MacDonald, D. Eustace, W.
A. Palo, J. Streit, N. Joseph-Ridge, Febuxostat compared with allopurinol in
patients with hyperuricemia and gout, N. Engl. J. Med. 353 (23) (2005)
2450–2461, https://doi.org/10.1056/NEJMoa050373.
[22] N.L. Edwards, Febuxostat: a new treatment for hyperuricaemia in gout,
Rheumatology (Oxford) 48 (2009) ii15-ii19, https://doi.org/10.1093/
rheumatology/kep088.
Acknowledgements
[23] A. Jordan, U. Gresser, Side Effects and Interactions of the Xanthine Oxidase
Inhibitor Febuxostat, Pharmaceuticals (Basel) 11 (2) (2018) 51, https://doi.org/
10.3390/ph11020051.
This work was supported by DST-SERB grant, New Delhi (EMR/
2017/002702). The authors are thankful to Vice-Chancellor, Professor
R. P. Tiwari and Dean In-charge, Professor Wrusika, Central University
of Punjab, Bathinda for providing the funds to support the present work.
The authors also acknowledge CIL and funding provided by DST-FIST to
the department.
[24] P. Ten Thije, M. Janssen, Hammett and Taft-Ingold relations in heterocyclic
compounds, Recl. Trav. Chim. Pays-Bas 84 (9) (1965) 1169–1176.
[25] L. Hu, H. Hu, W. Wu, X. Chai, J. Luo, Q. Wu, Discovery of novel xanthone
derivatives as xanthine oxidase inhibitors, Bioorg. Med. Chem. Lett. 21 (13) (2011)
4013–4015.
[26] K. Husain, L.K. Wai, F. Jamaluddin, J.A. Jamal, N. Ummah Abu, Xanthine oxidase
inhibitory activity of selected chalcone derivatives, The Open Conference
Proceedings J. (2013).
Appendix A. Supplementary data
[27] J.M. Beiler, G.J. Martin, The inhibition of xanthine oxidase by flavonoids and
related compounds, J. Biol. Chem. 192 (2) (1951) 831–834.
[28] S. Arora, G. Joshi, S. Kalra, A.A. Wani, P.V. Bharatam, P. Kumar, R. Kumar,
Knoevenagel/tandem knoevenagel and michael adducts of cyclohexane-1, 3-dione
and aryl aldehydes: synthesis DFT studies, xanthine oxidase inhibitory potential,
and molecular modelling, ACS omega 4 (3) (2019) 4604–4614.
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.bioorg.2020.104620.
[29] H. Singh, S. Sharma, R. Ojha, M.K. Gupta, K. Nepali, P. Bedi, Synthesis and
evaluation of naphthoflavones as a new class of non purine xanthine oxidase
inhibitors, Bioorg. Med. Chem. Lett. 24 (17) (2014) 4192–4197.
References
[1] I. Fridovich, P. Handler, Xanthine oxidase V. Differential inhibition of the
reduction of various electron acceptors, J. Biol. Chem. 237 (3) (1962) 916–921.
[2] R. Hille, T. Nishino, Flavoprotein structure and mechanism. 4. Xanthine oxidase
and xanthine dehydrogenase, FASEB J. 9 (11) (1995) 995–1003.
[30] R. Dhiman, S. Sharma, G. Singh, K. Nepali, P.M. Singh Bedi, Design and Synthesis
of Aza-Flavones as a New Class of Xanthine Oxidase Inhibitors, Arch. Pharm. 346
(1) (2013) 7–16.
[31] D. Kumar, G. Kaur, A. Negi, S. Kumar, S. Singh, R. Kumar, Synthesis and xanthine
oxidase inhibitory activity of 5,6-dihydropyrazolo/pyrazolo[1,5-c]quinazoline
derivatives, Bioorg. Chem. 57 (2014) 57–64, https://doi.org/10.1016/j.
bioorg.2014.08.007.
[3] P. Pacher, A. Nivorozhkin, C. Szabo, Therapeutic effects of xanthine oxidase
inhibitors: renaissance half a century after the discovery of allopurinol, Pharmacol.
Rev. 58 (1) (2006) 87–114, https://doi.org/10.1124/pr.58.1.6.
[4] R. Kumar, G. Joshi, H. Kler, S. Kalra, M. Kaur, R. Arya, Toward an understanding of
structural insights of xanthine and aldehyde oxidases: An overview of their
inhibitors and role in various diseases, Med. Res. Rev. 38 (4) (2017) 1073–1125.
[5] R. Kumar, Darpan, S. Sharma, R. Singh, Xanthine oxidase inhibitors: a patent
survey, Expert Opin Ther Pat 21(7) (2011) 1071-108. Doi: 10.1517/
13543776.2011.577417.
[32] K. Nepali, G. Singh, A. Turan, A. Agarwal, S. Sapra, R. Kumar, U.C. Banerjee, P.
K. Verma, N.K. Satti, M.K. Gupta, A rational approach for the design and synthesis
of 1-acetyl-3, 5-diaryl-4, 5-dihydro (1H) pyrazoles as a new class of potential non-
purine xanthine oxidase inhibitors, Bioorg. Med. Chem. 19 (6) (2011) 1950–1958.
[33] K. Nepali, A. Agarwal, S. Sapra, V. Mittal, R. Kumar, U.C. Banerjee, M.K. Gupta, N.
K. Satti, O.P. Suri, K.L. Dhar, N-(1, 3-Diaryl-3-oxopropyl) amides as a new template
for xanthine oxidase inhibitors, Bioorg. Med. Chem. 19 (18) (2011) 5569–5576.
[34] M. Puntoni, D. Branchi, A. Argusti, S. Zanardi, C. Crosta, E. Meroni, F. Munizzi,
P. Michetti, G. Coccia, G. De Roberto, R. Bandelloni, L. Turbino, E. Minetti,
M. Mori, S. Salvi, S. Boccardo, B. Gatteschi, R. Benelli, A. Sonzogni, A. DeCensi,
A randomized, placebo-controlled, preoperative trial of allopurinol in subjects with
[6] R. Ojha, J. Singh, A. Ojha, H. Singh, S. Sharma, K. Nepali, An updated patent
review: xanthine oxidase inhibitors for the treatment of hyperuricemia and gout
(2011–2015), Expert Opin. Ther. Pat. 27 (3) (2017) 311–345, https://doi.org/
10.1080/13543776.2017.1261111.
[7] G. Luna, A.V. Dolzhenko, R.L. Mancera, Inhibitors of Xanthine Oxidase: Scaffold
Diversity and Structure-Based Drug Design, ChemMedChem 14 (7) (2019)
714–743, https://doi.org/10.1002/cmdc.201900034.
14

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
colorectal adenoma, Cancer Prev Res (Phila) 6 (2) (2013) 74–81, https://doi.org/
[61] M. Karin, E. Shaulian, AP-1: linking hydrogen peroxide and oxidative stress to the
control of cell proliferation and death, IUBMB Life 52 (1–2) (2001) 17–24, https://
doi.org/10.1080/15216540252774711.
10.1158/1940-6207.CAPR-12-0249.
[35] J. Springer, A. Tschirner, K. Hartman, S. von Haehling, S.D. Anker, W. Doehner,
The xanthine oxidase inhibitor oxypurinol reduces cancer cachexia-induced
cardiomyopathy, Int. J. Cardiol. 168 (4) (2013) 3527–3531, https://doi.org/
10.1016/j.ijcard.2013.05.063.
´
´
[62] E. Sanchez-Tillo, L. Siles, O. De Barrios, M. Cuatrecasas, E.C. Vaquero, A. Castells,
A. Postigo, Expanding roles of ZEB factors in tumorigenesis and tumor progression,
Am. J. Cancer Res. 1 (7) (2011) 897.
[36] P.T. Schumacker, Reactive oxygen species in cancer cells: live by the sword, die by
the sword, Cancer Cell 10 (3) (2006) 175–176, https://doi.org/10.1016/j.
ccr.2006.08.015.
[63] S. Luanpitpong, J. Poohadsuan, P. Samart, C. Kiratipaiboon, Y. Rojanasakul,
S. Issaragrisil, Reactive oxygen species mediate cancer stem-like cells and
determine bortezomib sensitivity via Mcl-1 and Zeb-1 in mantle cell lymphoma,
Biochim. Biophys. Acta, Mol. Basis Dis. 1864 (11) (2018) 3739–3753, https://doi.
org/10.1016/j.bbadis.2018.09.010.
[37] J.M. Mast, P. Kuppusamy, Hyperoxygenation as a therapeutic supplement for
treatment of triple negative breast cancer, Front. Oncol. 8 (2018) 527.
[38] G. Vilema-Enríquez, A. Arroyo, M. Grijalva, R.I. Amador-Zafra, J. Camacho,
Molecular and cellular effects of hydrogen peroxide on human lung cancer cells:
potential therapeutic implications, Oxid. Med. Cell. Longevity 2016 (2016).
[39] C.F. Nathan, Z.A. Cohn, Antitumor effects of hydrogen peroxide in vivo, J. Exp.
Med. 154 (5) (1981) 1539–1553, https://doi.org/10.1084/jem.154.5.1539.
[40] M. Farnebo, V.J. Bykov, K.G. Wiman, The p53 tumor suppressor: a master regulator
of diverse cellular processes and therapeutic target in cancer, Biochem. Biophys.
Res. Commun. 396 (1) (2010) 85–89, https://doi.org/10.1016/j.
[64] R.R. Valiathan, M. Marco, B. Leitinger, C.G. Kleer, R. Fridman, Discoidin domain
receptor tyrosine kinases: new players in cancer progression, Cancer Metastasis
Rev. 31 (1–2) (2012) 295–321, https://doi.org/10.1007/s10555-012-9346-z.
[65] N. Nadiminty, R. Tummala, W. Lou, Y. Zhu, X.-B. Shi, J.X. Zou, H. Chen, J. Zhang,
X. Chen, J. Luo, MicroRNA let-7c is downregulated in prostate cancer and
suppresses prostate cancer growth, PLoS ONE 7 (3) (2012), e32832.
[66] K. Liu, S. Liu, W. Zhang, B. Jia, L. Tan, Z. Jin, Y. Liu, miR-494 promotes cell
proliferation, migration and invasion, and increased sorafenib resistance in
hepatocellular carcinoma by targeting PTEN, Oncol. Rep. 34 (2) (2015)
1003–1010, https://doi.org/10.3892/or.2015.4030.
bbrc.2010.02.152.
[41] C.M. Doskey, V. Buranasudja, B.A. Wagner, J.G. Wilkes, J. Du, J.J. Cullen, G.
R. Buettner, Tumor cells have decreased ability to metabolize H2O2: Implications
for pharmacological ascorbate in cancer therapy, Redox Biol. 10 (2016) 274–284.
[42] R. Harrison, Structure and function of xanthine oxidoreductase: where are we
now? Free Radical Biol. Med. 33 (6) (2002) 774–797.
[67] D. Wang, Y. Jiang, D.X. Sun-Waterhouse, H. Zhai, H. Guan, X. Rong, F. Li, J.C. Yu,
D.P. Li, MicroRNA-based regulatory mechanisms underlying the synergistic
antioxidant action of quercetin and catechin in H2O2-stimulated HepG2 cells:
Roles of BACH1 in Nrf2-dependent pathways, Free Radical Biol. Med. 153 (2020)
122–131, https://doi.org/10.1016/j.freeradbiomed.2020.04.018.
[43] G. Joshi, S.M. Amrutkar, A.T. Baviskar, H. Kler, S. Singh, U.C. Banerjee, R. Kumar,
Synthesis and biological evaluation of new 2, 5-dimethylthiophene/furan based N-
acetyl pyrazolines as selective topoisomerase II inhibitors, RSC Adv. 6 (18) (2016)
14880–14892.
[68] R. Wilson, C. Espinosa-Diez, N. Kanner, N. Chatterjee, R. Ruhl, C. Hipfinger, S.
J. Advani, J. Li, O.F. Khan, A. Franovic, S.M. Weis, S. Kumar, L.M. Coussens, D.
G. Anderson, C.C. Chen, D.A. Cheresh, S. Anand, MicroRNA regulation of
endothelial TREX1 reprograms the tumour microenvironment, Nat. Commun. 7 (1)
(2016) 13597, https://doi.org/10.1038/ncomms13597.
[44] D.M. Sawant, S. Sharma, R.S. Pathare, G. Joshi, S. Kalra, S. Sukanya, A.K. Maurya,
R.K. Metre, V.K. Agnihotri, S. Khan, Relay tricyclic Pd (ii)/Ag (i) catalysis: design
of a four-component reaction driven by nitrene-transfer on isocyanide yields
inhibitors of EGFR, Chem. Comm. 54 (82) (2018) 11530–11533.
[69] Y.H. Lin, MicroRNA Networks Modulate Oxidative Stress in Cancer, Int. J. Mol. Sci.
20 (18) (2019) 4497, https://doi.org/10.3390/ijms20184497.
[45] G. Kaur, R.P. Cholia, A.K. Mantha, R. Kumar, DNA repair and redox activities and
inhibitors of apurinic/apyrimidinic endonuclease 1/redox effector factor 1 (APE1/
Ref-1): a comparative analysis and their scope and limitations toward anticancer
drug development: Miniperspective, J. Med. Chem. 57 (24) (2014) 10241–10256.
[46] D. Matiadis, M. Sagnou, Pyrazoline Hybrids as Promising Anticancer Agents: An
Up-to-Date Overview, Int. J. Mol. Sci. 21 (15) (2020) 5507.
[70] M. Sadidi, S.I. Lentz, E.L. Feldman, Hydrogen peroxide-induced Akt
phosphorylation regulates Bax activation, Biochimie 91 (5) (2009) 577–585,
https://doi.org/10.1016/j.biochi.2009.01.010.
[71] Y. Cao, Z.X. Jin, X.P. Tong, S. Yue, T. Sakai, T. Kawanami, T. Sawaki, M. Miki,
H. Iwao, A. Nakajima, Y. Masaki, Y. Fukushima, Y. Fujita, H. Nakajima, T. Okazaki,
H. Umehara, Synergistic effects of topoisomerase I inhibitor, SN38, on Fas-
mediated apoptosis, Anticancer Res. 30 (10) (2010) 3911–3917.
[47] G. Kaur, R.P. Cholia, G. Joshi, S.M. Amrutkar, S. Kalra, A.K. Mantha, U.C. Banerjee,
R. Kumar, Anticancer activity of dihydropyrazolo[1,5-c]quinazolines against rat
C6 glioma cells via inhibition of topoisomerase II, Arch Pharm (Weinheim) 351 (6)
(2018), e1800023, https://doi.org/10.1002/ardp.201800023.
[72] E. Garner, K. Raj, Protective mechanisms of p53–p21-pRb proteins against DNA
damage-induced cell death, Cell Cycle 7 (3) (2008) 277–282, https://doi.org/
10.4161/cc.7.3.5328.
[48] R.A. Copeland, Evaluation of enzyme inhibitors in drug discovery: a guide for
medicinal chemists and pharmacologists, John Wiley & Sons, 2013.
[49] C. Enroth, B.T. Eger, K. Okamoto, T. Nishino, T. Nishino, E.F. Pai, Crystal structures
of bovine milk xanthine dehydrogenase and xanthine oxidase: structure-based
mechanism of conversion, Proc Natl Acad Sci U S A 97 (20) (2000) 10723–10728,
https://doi.org/10.1073/pnas.97.20.10723.
[73] L. Brown, S. Boswell, L. Raj, S.W. Lee, Transcriptional targets of p53 that regulate
cellular proliferation, Crit. Rev. Eukar. Gene Exp. 17 (1) (2007).
[74] K.H. Vousden, D.P. Lane, p53 in health and disease, Nat. Rev. Mol. Cell Biol. 8 (4)
(2007) 275–283, https://doi.org/10.1038/nrm2147.
[75] M. Chauhan, R. Kumar, A comprehensive review on bioactive fused heterocycles as
purine-utilizing enzymes inhibitors, Med. Chem. Res. 24 (6) (2015) 2259–2282.
[76] G. Joshi, A.A. Wani, S. Sharma, P. Bhutani, P.V. Bharatam, A.T. Paul, R. Kumar,
Unanticipated Cleavage of 2-Nitrophenyl-Substituted N-Formyl Pyrazolines under
Bechamp Conditions: Unveiling the Synthesis of 2-Aryl Quinolines and Their
Mechanistic Exploration via DFT Studies, ACS Omega 3 (12) (2018) 18783–18790.
[77] N. Raghav, S. Garg, N-formylpyrazolines and N-benzoylpyrazolines as novel
inhibitors of mammalian cathepsin B and cathepsin H, Bioorg. Chem. 57 (2014)
43–50.
[50] K. Okamoto, T. Kusano, T. Nishino, Chemical nature and reaction mechanisms of
the molybdenum cofactor of xanthine oxidoreductase, Curr. Pharm. Des. 19 (14)
(2013) 2606–2614, https://doi.org/10.2174/1381612811319140010.
´
´
[51] J. Galvez, R. García-Domenech, C. de Gregorio Alapont, J. de Julian-Ortiz, L. Popa,
Pharmacological distribution diagrams: a tool for de novo drug design, J. Mol.
Graph. 14 (5) (1996) 272–276.
[52] R. Soler, Charge indexes New topological descriptors, J. Chem. Inf. Comput. Sci 34
(1994) 520–525.
[78] V. Monga, K. Goyal, M. Steindel, M. Malhotra, D.P. Rajani, S.D. Rajani, Synthesis
and evaluation of new chalcones, derived pyrazoline and cyclohexenone
derivatives as potent antimicrobial, antitubercular and antileishmanial agents,
Med. Chem. Res. 23 (4) (2014) 2019–2032.
[53] J.S. Cameron, H.A. Simmonds, Use and abuse of allopurinol, British Medical J.
(Clinical research ed.) 294 (6586) (1987) 1504.
[54] K. Takayama, K. Kawabata, Y. Nagamoto, K. Kishimoto, K. Tashiro, F. Sakurai,
M. Tachibana, K. Kanda, T. Hayakawa, M.K. Furue, H. Mizuguchi, 3D spheroid
culture of hESC/hiPSC-derived hepatocyte-like cells for drug toxicity testing,
Biomaterials 34 (7) (2013) 1781–1789, https://doi.org/10.1016/j.
biomaterials.2012.11.029.
[79] S. Mohamed, M. Khalile, A. Ismail, M. Kadh, Synthesis and biological activity of
some new pyrazole derivatives, J. Indian Chem. Soc. 82 (9) (2005) 833–837.
[80] S.A. Rostom, M.H. Badr, H.A. Abd El Razik, H.M. Ashour, A.E. Abdel Wahab,
Synthesis of some pyrazolines and pyrimidines derived from polymethoxy
chalcones as anticancer and antimicrobial agents, Arch. Pharm. 344 (9) (2011)
572–587.
[55] E. Pigeolet, P. Corbisier, A. Houbion, D. Lambert, C. Michiels, M. Raes, M.
D. Zachary, J. Remacle, Glutathione peroxidase, superoxide dismutase, and
catalase inactivation by peroxides and oxygen derived free radicals, Mech. Ageing
Dev. 51 (3) (1990) 283–297, https://doi.org/10.1016/0047-6374(90)90078-t.
[56] D. Keilin, E. Hartree, On the mechanism of the decomposition of hydrogen
peroxide by catalase, Proceedings of the Royal Society of London. Series B-
Biological Sciences 124(837) (1938) 397-405.
[81] D. Kumar, R. Kumar, Microwave-assisted synthesis of pyrazolo [1, 5-c]
quinazolines and their derivatives, Tetrahedron Lett. 55 (16) (2014) 2679–2683.
[82] G. Joshi, S. Kalra, U.P. Yadav, P. Sharma, P.K. Singh, S. Amrutkar, A.J. Ansari,
S. Kumar, A. Sharon, S. Sharma, E-pharmacophore guided discovery of pyrazolo [1,
5-c] quinazolines as dual inhibitors of topoisomerase-I and histone deacetylase,
Bioorg. Chem. 94 (2020), 103409.
[57] M. Schieber, N.S. Chandel, ROS function in redox signaling and oxidative stress,
Curr. Biol. 24 (10) (2014) R453–R462, https://doi.org/10.1016/j.
cub.2014.03.034.
[83] A.J. Ansari, G. Joshi, U.P. Yadav, A.K. Maurya, V.K. Agnihotri, S. Kalra, R. Kumar,
S. Singh, D.M. Sawant, Exploration of Pd-catalysed four-component tandem
reaction for one-pot assembly of pyrazolo [1, 5-c] quinazolines as potential EGFR
inhibitors, Bioorg. Chem. 93 (2019), 103314.
[58] P. Chen, Y.-F. Hu, L. Wang, W.-F. Xiao, X.-Y. Bao, C. Pan, H.-S. Yi, X.-Y. Chen, M.-
H. Pan, C. Lu, Mitochondrial apoptotic pathway is activated by H 2 O 2-mediated
oxidative stress in BmN-SWU1 cells from bombyx mori ovary, PLoS ONE 10 (7)
(2015), e0134694.
[84] A.M. Rieger, K.L. Nelson, J.D. Konowalchuk, D.R. Barreda, Modified annexin V/
propidium iodide apoptosis assay for accurate assessment of cell death, J. Vis. Exp.
(50) (2011) e2597, https://doi.org/10.3791/2597.
¨
¨
[59] S. Mahner, C. Baasch, J. Schwarz, S. Hein, L. Wolber, F. Janicke, K. Milde-
Langosch, C-Fos expression is a molecular predictor of progression and survival in
epithelial ovarian carcinoma, Br. J. Cancer 99 (8) (2008) 1269.
[85] D. Wu, P. Yotnda, Production and detection of reactive oxygen species (ROS) in
cancers, J. Vis. Exp. (57) (2011), e3357, https://doi.org/10.3791/3357.
[86] A. Cossarizza, S. Salvioli, Flow cytometric analysis of mitochondrial membrane
potential using JC-1, Current protocols in cytometry 13(1) (2000) 9.14. 1-9.14. 7.
[87] I. Gill, S. Kaur, N. Kaur, M. Dhiman, A.K. Mantha, Phytochemical ginkgolide B
attenuates amyloid-β 1–42 induced oxidative damage and altered cellular
[60] J. Coronella-Wood, J. Terrand, H. Sun, Q.M. Chen, c-Fos phosphorylation induced
by H2O2 prevents proteasomal degradation of c-Fos in cardiomyocytes, J. Biol.
Chem. 279 (32) (2004) 33567–33574, https://doi.org/10.1074/jbc.M404013200.
15

G. Joshi et al.
Bioorganic Chemistry 107 (2021) 104620
responses in human neuroblastoma SH-SY5Y cells, J. Alzheimers Dis. 60 (s1)
[90] G. Kaur, N. Dogra, S. Singh, Health Risk Assessment of Occupationally Pesticide-
Exposed Population of Cancer Prone Area of Punjab, Toxicol. Sci. 165 (1) (2018)
157–169, https://doi.org/10.1093/toxsci/kfy140.
(2017) S25–S40.
[88] Y. Sun, L.W. Oberley, Y. Li, A simple method for clinical assay of superoxide
dismutase, Clin. Chem. 34 (3) (1988) 497–500.
[91] I. Carlberg, B. Mannervik, Glutathione reductase, Methods in enzymology, Elsevier
(1985) 484–490.
[89] A.K. Sinha, Colorimetric assay of catalase, Anal. Biochem. 47 (2) (1972) 389–394,
https://doi.org/10.1016/0003-2697(72)90132-7.
[92] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative PCR and the 2ꢀ ΔΔCT method, Methods 25 (4) (2001) 402–408.
16