Development of MRSA and MRAB detection kit employing loop–mediated isothermal amplification and colorimetric indicator dye

Article abstract of DOI:10.1016/j.dyepig.2019.107618

Methicillin-resistant Staphylococcus aureus (MRSA) and Multidrug-resistant Acinetobacter baumannii (MRAB) are serious life-threating pathogens. The rapid detection of those pathogens is a challenge for the most clinical microbiology laboratories. A nuclei

Full text of DOI:10.1016/j.dyepig.2019.107618

Accepted Manuscript
Development of MRSA and MRAB detection kit employing loop–mediated isothermal
amplification and colorimetric indicator dye
Hyoungsu Kim, Jaesung Lee, Bongkyu Lee, Jaeho Choi, Kiwon Kim, Nakhyun Song,
Sang Yeul Lee, Sora Yun, Hyo-Sung Jeon, Jinwoo Park
PII:
S0143-7208(19)30615-1
DOI:
https://doi.org/10.1016/j.dyepig.2019.107618
Article Number: 107618
Reference:
DYPI 107618
To appear in: Dyes and Pigments
Received Date: 21 March 2019
Revised Date: 30 April 2019
Accepted Date: 3 June 2019
Please cite this article as: Kim H, Lee J, Lee B, Choi J, Kim K, Song N, Lee SY, Yun S, Jeon H-S, Park
J, Development of MRSA and MRAB detection kit employing loop–mediated isothermal amplification and
colorimetric indicator dye, Dyes and Pigments (2019), doi: https://doi.org/10.1016/j.dyepig.2019.107618.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT
Development of MRSA and MRAB detection kit employing loop–mediated isothermal
amplification and colorimetric indicator dye
Hyoungsu Kim1, Jaesung Lee1, Bongkyu Lee1, Jaeho Choi1, Kiwon Kim1, Nakhyun Song1, Sang Yeul Lee1, Sora
Yun2, Hyo-Sung Jeon2*, Jinwoo Park1*
(1) BioActs Co. Inc., Incheon, Republic of Korea.
(2) M monitor, Inc., Daegu, Republic of Korea.
*Co-corresponding authors. Tel: +82328189100, Fax: +82328188206
E-mail address: park@bioacts.com (Jinwoo Park), jeonh@mmoitor.com (Hyo-Sung Jeon)
Highlights
ò Novel LAMP detecting kits against both MRSA and MRAB were developed.
ò The positive reaction would be easily confirmed by the colorimetric change in naked eye.
ò Colorimetric Mg2+ ion indicator dye D-649 was synthesized.
ò New sets of primer for both MRSA and MRAB were designed.
ò The detection limits for DNA of both pathogens are 1 pg.
Abstract
Methicillin-resistant Staphylococcus aureus (MRSA) and Multidrug-resistant Acinetobacter
baumannii (MRAB) are serious life-threating pathogens. The rapid detection of those pathogens
is a challenge for the most clinical microbiology laboratories. A nucleic acid amplification
technique, loop-mediated isothermal amplification (LAMP) that enables to amplify target DNA
sequences in a short time period, is an excellent technique to detect the pathogens with high
efficiency. We developed LAMP detecting kits against both MRSA and MRAB that utilizing a
newly developed colorimetric Mg2+ ion indicator dye D-649 and novel sets of primers. An
aqueous soluble dye D-649 is stable over physiological pH range and displays clear color change
upon binding to Mg2+ ion. The addition of 0.12 mM of D-649 to LAMP solution did not disturb
the amplification process, and the positive reaction would be easily confirmed by the color
change of reaction mixture from ruby to purple in naked eye under ambient light. Each primer
set was designed to recognize mecA/femB gene of MRSA and blaOXA-23/blaOXA51–like gene
of MRAB, and the detection limits for both DNAs were shown as 1 pg. These LAMP detection
kits will be beneficial for the detection of MRSA and MRAB in clinical laboratories.
Keywords
Methicillin-resistant Staphylococcus aureus, Multidrug-resistant Acinetobacter baumannii,
Loop-mediated isothermal amplification method, LAMP detecting kits, Colorimetric Mg2+ ion
indicator dye
1

ACCEPTED MANUSCRIPT
1. Introduction
Methicillin-resistant Staphylococcus aureus (MRSA)1 and Multidrug-resistant
Acinetobacter baumannii (MRAB)2 are serious life-threating pathogens due to their
environmental resilience, antimicrobial resistance, and outbreak potential.3 Epidemic spread of
MRSA and MRAB is common among people in hospitals4,5, nursing homes6 and prisons7. The
detection of those pathogens, which requires implementation of strict protocols for active
screening,8 is a challenge for the most clinical microbiology laboratories. The rapid identification
of antimicrobial susceptibility patterns of bacterial isolates from positive blood cultures is an
imperative issue.
Whilst costly molecular techniques offer high sensitivity and rapid results, time-consuming
culture methods also provide reliable outcomes with lower price.9,10 Traditional cultural
techniques, including growth-based assays, colony morphology, and microdilution resistance
tests,11 take up to 48 h to confirm pathogens, thus they are mainly utilized as confirming methods
for molecular techniques.12 Polymerase chain reaction (PCR)-based assays have been
successfully established and utilized for the rapid detection of MRSA and MRAB directly from
various clinical specimens.13,14 However, these methods also have some complications such as
complex protocols, false positive and negative results, and the necessity to run multiplex PCR to
obtain reliable results.15 Loop-mediated isothermal amplification method (LAMP) is another
effective technique for rapid detection of target DNA sequences and is increasingly utilized in
biomedical field.16
LAMP method enables to rapidly amplify DNA strand under isothermal conditions (60–
65 °C) with high efficiency and sensitivity.17 Moreover, the specificity of LAMP is considered
extremely high because the primers must bind six distinct regions on the target DNA in order to
amplify. The sensitivity of LAMP does not appear to be affected by the presence of non-target
DNA in sample, and the method is well tolerant to known PCR inhibitors such as blood, serum
and food ingredients.18 Owing excellent features, LAMP has been utilized in various fields of
genetic analysis, including the detection of MRSA and MRAB.19,20
To obtain accurate analysis results, LAMP requires an efficient method to monitor the
amplification progress. A number of LAMP amplification monitoring methods have been
developed to date, including turbidity monitoring,21 gel electrophoresis,16 electrochemical
methods,22 lateral flow dipstick,23 naked eye monitoring with DNA binding dyes such as SYBR
green,24 using colorimetric indicators such as calcein or hydroxylnaphthol blue (HNB),25 and so
forth.26 In this work, we developed LAMP detecting kits against both MRSA and MRAB that
utilizing a newly developed colorimetric Mg2+ ion indicator dye and novel primer sets. Herein,
we disclose our effort to synthesize a novel indicator dye, to design sensitive primer sets, and to
consolidate them into MRSA and MRSA detection kits.
2. Materials and methods
2

ACCEPTED MANUSCRIPT
2.1. Materials and instruments
Reagents and building blocks for dye synthesis were purchased from Sigma-Aldrich and
Tokyo chemical industry (TCI) and used without further purification. Synthesis of aryl azo dyes
were followed from literature procedures.28,29 Oligonucleotide primers were designed using the
Primer Explorer V4 software (Fujitsu System Solutions, Ltd., Japan). Large fragment of Bst
DNA polymerase was purchased from New England Biolabs (Ipswich, MA, USA).
Electrophoresis was performed using Mupid-exu (Advance Co. Ltd., Japan). TLC analysis was
conducted on silica gel plates. Fluorescence spectra were recorded on a bioimaging instrument
1
13
(FOBI, NeoScience Co. Ltd., Korea). H NMR and C NMR spectra were measured on ECZR
500 MHz FT NMR spectrometer (JEOL Ltd., Tokyo, Japan) using tetetramethylsilane (TMS) as
an internal reference. The pH values were measured using Seven ComPact pH meter S 220
(Mettler Toledo, Ohio, USA). Genomic DNA strand of MRSA, ATCC® 33591, was purchased
from the American Type Culture Collection (ATCC, Manassas, VA, USA). Genomic DNA
strand of MRAB strain was obtained from Konyang University Hospital. Concentrations of DNA
strands were analyzed with Nanodrop 2000 spectrophotometer (Thermo Fisher scientific, USA).
Theoretical pKa values were calculated with ChemBioDraw program. High resolution mass
spectra were measured on a Q Exactive mass spectrometer (Thermo Fisher Scientific, USA).
2.2 Synthesis of D-649
Scheme 1. Synthetic scheme for D-649
A solution of 4-nitro-2-aminophenol-6-sulfonic acid (6.6 g, 25 mmol) in deionized water (100
mL) at 0 was slowly treated with concentrated HCl (7.5 mL) followed by a solution of sodium
nitrite (1.9 g, 26 mmol) in deionized water (1 mL). The reaction mixture was stirred at 0 ℃ for 1
h and treated with a solution of 1-naphthol-4-sulfonic acid (5.5 g, 25 mmol) in deionized water
(100 mL). The reaction mixture was stirred at room temperature for 2 h whilst pH of the reaction
mixture was adjusted to 7 with aqueous 2 N NaOH. The resulting mixture was filtered through a
fritted filter, and the filter cake was dried under reduced pressure to provide the crude product.
Flash chromatography (SiO2, iso-butanol/n-propanol/EtOAc/water: 2/4/1/3, rf 0.4) afforded 4-
hydroxy-3-((2-hydroxy-5-nitro-3-sulfophenyl)diazenyl) naphthalene-1-sulfonic acid (D-649) as a
pink solid (4.6 g, 38%): 1H NMR (500 MHz, DMSO-d6) δ 8.55 (d, J = 8.6 Hz, 1H), 8.35–8.28 (m,
3H), 7.70–7.64 (m, 1H), 7.61 (s, 1H), 7.50–7.44 (m, 1H), (O-H protons were not shown); 13C
NMR (125 MHz, DMSO-d6) δ 175.5, 166.7, 135.5, 134.6, 133.2, 132.0, 131.6, 131.0, 130.7,
128.4, 128.2, 126.5, 126.2, 125.9, 123.6, 110.7; HRMS ESI-TOF m/z C18H11N3O10S2, found: [M
+ H]+ 469.99564, requires: 469.99586.
3

ACCEPTED MANUSCRIPT
2.3 LAMP and electrophoresis processes
LAMP assays were carried out in 25 µL reaction mixture containing serially 10-fold diluted
MRSA or MRAB DNA, 0.2 µM each of F3 and B3, 1.6 µM each of FIP and BIP, 0.8 µM each
of LF and LB, 20 mM Tris-HCl (pH 8.8), 10 mM each of KCl, (NH4)2SO4 and 0.1% Triton X-
100, 8 mM MgSO4, 1.4 mM of each dNTP, 8 U of the large fragment of Bst DNA polymerase
(New England Biolabs, Ipswich, MA, USA), 0.12 mM of D-649 in LAMP buffer (for reaction
with dye only). Reaction mixtures without DNA were also prepared as negative controls. All
reaction mixtures were incubated at 63°C for 30 min and then heated up at 80°C for 5 min to
terminate the reaction in a heating block. Electrophoresis analysis was performed in 2% agarose
gels, and the visualization was realized with ethidium bromide staining followed by imaging
under 365 nm UV.
3. Results and discussion
3.1 Mg2+ ion indicator dye design and synthesis
For efficient monitoring of LAMP progress, we first decided to develop a novel colorimetric
Mg2+ ion indicator dye at the first. Several criteria for the ideal indicator were set: the dye would
has a clear color for naked-eye monitoring, would be aqueous soluble, would not be fluorescent
or luminescent under normal lighting, and displaying distinguishable color change upon binding
to Mg2+ ion. Due to their unique photochemical properties related to the facile cis-trans
isomerization of Ar–N=N–Ar moiety upon UV–vis irradiation that acts as an efficient
fluorescence quencher or molecular switcher, bis-aryl azo moiety was selected as dye scaffold.27
Mono- and di-sulfonic acid were chosen as main Mg2+ ion chelating groups due to their weakly
acidic, non-nucleophilic nature and bidentate binding ability. More than 70 aryl-azo dyes having
aromatic sulfonic acid were synthesized and subjected to aqueous solubility test.28,29 Among
them, eight compounds displayed good solubility (Figure 1).
Figure 1. Eight aqueous soluble azo-dyes.
3.2 Mg2+ ion binding test of eight aqueous soluble dyes
To find the colorimetric utility, eight aqueous soluble dyes were dissolved in deionized water
in two different concentrations (50 µM and 100 µM) and treated with varying amount of Mg2+
ion in comparison with known Mg2+ indicator HNB (Figure 2).25 The sufficient concentration of
4

ACCEPTED MANUSCRIPT
dyes for efficient colorimetric monitoring was shown as 100 µM. We expected that Mg2+ ion
would stoichiometrically react with a dye to cause color change, however excess amount of Mg2+
ion was required to achieve colorimetric change in deionized water. Five dyes, D-600, D-614, D-
649, D-653 and D-659, displayed distinguishable color change when treated with Mg2+ ion.
Theoretical pKa value of five dyes varied from 4 to 7 (D-653, 4.1; D-659, 4.2; D-600, 4.9; D-649,
6.0; D-614, 6.9), thus weak acidic nature of dyes might be a culprit for the excess amount of dye
input. These five dyes were evaluated for their stability in physiological pH range in order to
check their robustness.
Figure 2. Treatment of excess amount of Mg2+ ion to HNB and eight water-soluble compounds.
3.3 Stability test of five dyes in physiological pH
Due to the basicity (pH 8.8) of our LAMP reaction mixture, stability of the indicator dye in
the basic media is a critical issue. However, considering for the extendable usage, we would like
to develop the dye that would be stable over a wide range of pH. Thus, five Mg2+ ion-responsive
dyes were evaluated their color variation over physiological pH range in aqueous sodium
phosphate buffer (Figure 3). Two different stock solutions (100 mM in deionized water and
DMSO) were 2-fold diluted with deionized water, and pH values were adjusted with sodium
phosphate buffer. Results from both stock solutions were not clearly distinguishable except D-
653, which showed different color change patterns depending on initial stock solutions.
5

ACCEPTED MANUSCRIPT
Figure 3. Stability test of 5 dyes and HNB in physiological pH range.
*pH was adjusted with sodium phosphate mono- and dibasic buffer solution.
Concentration of dye solutions was 50 mM.
Surprisingly, the results indicated that HNB, which has been utilized as an indicator for Ca2+
and Mg2+ ion and as a colorimetric reagent for alkaline earth metal ions,25 was reacting with Na+
ion at pH above 6.5: it displayed different colors in deionized water and in pH 7.0 sodium
phosphate buffer. The color of HNB in sodium phosphate buffer above pH 7.0 was same as when
it was treated with excess of Mg2+ ion in deionized water as shown in figure 2. Since Na+ ion is a
common contaminant and an important buffer constituent in biological assays, using HNB in
LAMP process as an Mg2+ ion indicator might require caution. Three dyes, D-614, D-649 and D-
659, were maintained constant color over the range and not reacting with sodium ion.
3.4 Selection of D-649 as the Mg2+ ion indicator candidate
After contemplation of above test results, D-614 and D-649 were selected as final two
candidates and subjected to further experiments. Two dyes and HNB were dissolved in both
deionized water and pH 9 sodium phosphate buffer and treated with variable amount of
magnesium chloride, and then their colorimetric change was monitored (Figure 4, left). After
monitoring the color change, resulting mixtures were treated with sodium pyrophosphate (equal
molar amount to MgCl2) in order to check the recovery of original color (Figure 4, right).
6

ACCEPTED MANUSCRIPT
Figure 4. (left) Treatment of varying equivalent of MgCl2 to dye solutions; (right) addition of
Na4P2O7 [equivalent to MgCl2] to left wells. Concentrations of dye solution were 100 µM
.
pH was adjusted with sodium phosphate mono- and dibasic buffer solution.
HNB did not react with up to 10-fold excess of MgCl2 in deionized water, but it changed the
color from pink to sky blue in presence of Na+ ion regardless of Mg2+ ion input, witnessing its
relative selectivity for Na+ ion over Mg2+ ion. D-619 and D-649 both did not respond to Mg2+ ion
in deionized water, however, they gradually changed their color from dark pink to orange with
respect to increasing amount of Mg2+ ion in pH 9 buffer (Figure 4, left). When sodium
pyrophosphate (equal molar ratio to MgCl2) was added to Mg2+ ion–treated wells, the original
colors of D-619 and D-649 were recovered (Figure 4, right). The LAMP reaction liberates excess
amount of pyrophosphate ion byproduct that reacts with Mg2+ ion to form insoluble magnesium
pyrophosphate salt, thus monitoring of LAMP amplification with colorimetric Mg2+ indicator
dye relies on the observation of color change from dye–Mg2+ ion complex to free dye. Therefore,
recovery of original color upon treating with pyrophosphate ion is an essential issue. D-649 more
clearly recovered the original color than D-614 when treated by sodium pyrophosphate, thus it
was selected as the optimal indicator dye and incorporated into LAMP amplification process
(Figure 5).
7

ACCEPTED MANUSCRIPT
Figure 5. Effect of Mg2+ ion concentration on the absorption spectra of D-649 in pH 9 buffer.
Concentration of D-649 is 100 µM. More than 2 eq. of Mg2+ ion was required for clear colorimetric observation.
3.5 Design of novel primer sets for both MRSA and MRAB
We decided to develop new sets of LAMP primers against both MRSA and MRAB,
accordingly several primer sets of both MRSA and MRAB were designed and tested for LAMP
amplification process. After repeated trials, novel primer sets displaying the optimal efficiency
and sensitivity were selected (Table 1). Our oligonucleotide primers sets recognize mecA/femB
gene (Genbank No. AB505630.1/CP010300.1) of MRSA and blaOXA-23/blaOXA51-like gene
(Genbank No. KF305669.1/DQ385606.1) of MRAB. The primer sets consisted of forward outer
primer (F3), backward outer primer (B3), forward inner primer (FIP) backward inner primer
(BIP), loop forward primer (LF) and loop backward primer (LB). Both MRSA and MRAB
primer sets could afford successful isothermal amplifications with high efficiency and sensitivity.
MRSA primer set
Primer
F3
Oligonucleotide sequence
5’–ATGATTATGGCTCAGGTACTG–3’
5’–AACCCAATCATTGCTGTTAATATT–3’
B3
5’–TACATAAATGGATAGACGTCATCTATCCACCCTCAAACAGGTG–3’
5’–GGCATGAGTAACGAAGAATATAATCCTGGTGAAGTTGTAATCTGGAAC–3’
5’–ATGAAGGTGTGCTTACAAGTGC–3’
FIP
BIP
LF
5’–CCGAAGATAAAAAAGAACCTCTGCT–3’
LB
MRAB primer set
Oligonucleotide sequence
5’–AGAATATGTGCCAGCCTCTAC–3’
Primer
F3
8

ACCEPTED MANUSCRIPT
5’–CAGAAATTATCAACCTGCTGTCC–3’
B3
FIP
BIP
LF
5’–TGTCATGTCTTTTTCCCAAGCGGGGATTGGAGAACCAGAAAACGG–3’
5’–CCCAGTCTATCAGGAACTTGCGTCAGCATTACCGAAACCAATACG–3’
5’–ACCTTTTCTCGCCCTTCCATTT–3’
5’–GACGTATCG GTCTTGATCTCATGC–3’
LB
Table 1. Primer sets for MRSA (up) and MRAB (bottom).
3.6 Effect of D-649 in LAMP experiments
For checking the influence of D-649 in LAMP reaction, we prepared two sets of LAMP
mixtures having serially diluted MRSA and MRAB DNA. One set of reaction mixtures were
premixed with 0.12 mM of D-649 and other set consisted of reaction mixtures without the dye
(Figure 6).
Figure 6. Comparative sensitivity of LAMP assay with D-649 (left, MRSA; right, MRAB).
upper: D-649 contained LAMP mixture, bottom: LAMP mixture without dye.
After LAMP reaction, clear color changes were observed in both MRSA and MRAB reaction
mixture tubes containing D-649 except the negative controls. The positive LAMP reactions were
easily confirmed by naked eye under ambient light. The color of reaction tubes excluding
negative controls was changed from initial ruby to purple, witnessing the successful separation of
Mg2+ ion from the dye. Our novel primer sets were able to effectively amplify target DNA
sequence, and the detection limits for both bacteria were shown as 1 pg. The LAMP reaction
liberates pyrophosphate ion as a byproduct, which forms insoluble Mg2P2O7 salt, causing
turbidity in the reaction tube proportional to the amount of amplified DNA. Hence, we could
observe a slight turbidity in the reaction tubes after amplification except negative control. For
further confirming the effect of the dye in LAMP results, amplified products from both reaction
mixtures containing the dye and mixtures lacking the dye were analyzed using electrophoresis in
2% agarose gels, followed by the visualization under UV irradiation. (Figure 7).
9

ACCEPTED MANUSCRIPT
Figure 7. Electrophoretic analysis of LAMP products (left: MRSA; right: MRAB).
lane 1, marker; lane 2, dye + 100 pg DNA; lane 3, dye + 10 pg DNA; lane 4, dye + 1 pg DNA; lane 5,
dye in negative control; lane 6, marker; lane 7, 100 pg DNA; lane 8, 10 pg DNA; lane 9, 1 pg DNA;
lane 10, negative control.
Ethidium bromide-stained gel demonstrated the typical banding patterns observed with
MRSA and MRAB, indicating the production of both pathogens’ DNA with inverted repeats of
the target sequence. Comparison of outcomes from LAMP mixtures with premixed D-649 (lanes
2, 3, 4) and without the dye (lanes 7, 8, 9) showed the presence of D-649 did not disturb LAMP
reaction.
4. Conclusion
We developed new LAMP detecting kits, which utilizing a newly developed colorimetric
Mg2+ ion indicator dye D-649 and novel primer sets, for both MRSA and MRAB. An aqueous
soluble colorimetric Mg2+ indicator D-649 was synthesized, and novel sets of primer for both
MRSA and MRAB were designed for effective amplification. The positive LAMP reactions for
both MRSA and MRAB were easily confirmed by naked eye under ambient light. By analyzing
LAMP products with electrophoresis, the existence of D-649 did not disturb the results, and the
detection limits for both DNAs were shown as 1 pg. These LAMP detection kits would be
beneficial for the detection of MRSA and MRAB in clinical laboratories. Currently, MRSA
detection kit is being evaluated for clinical application.
Acknowledgement
This research was supported by a grant of the Korea Health Technology R&D Project
through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of
Health & Welfare, Republic of Korea (grant number: HI15C1948).
Declaration of interest
The authors are employee and shareholder of BioActs Co. Ltd., and M monitor, Inc.
BioActs Co. Ltd. holds on patents: MRSA, KP10-2017-0179022; MRAB, KP 10-2017-0179023.
References
10

ACCEPTED MANUSCRIPT
1. Hassoun H, Linden PK, Friedman B. Incidence prevalence, and management of MRSA
bacteremia across patient populations–a review of recent developments in MRSA
management and treatment. Critical Care 2017; 21: 211-220.
2. Perez F, Hujer AM, Hujer KM, Decker BK, Rather PN, Bonomo RA. Global challenge of
multidrug-resistant Acinetobacter baumannii. Antimicrob Agents Chemo 2007; 51: 3471-
3484.
3. Bernards AT, Frénay HME, Lim B, Hendriks WDH, Dijkshoorn L, van Boven CP.
Methicillin-resistant Staphylococcus aureus and Acinetobacter baumannii: an unexpected
difference in epidemiologic behavior. Am J Infect Control 1998; 26: 544-551.
4. Salge TO, Vera A, Antons D, Cimiotti JP. Fighting MRSA infections in hospital care: how
organizational factors matter. Health Serv Res 2017; 52: 959-983.
5. Dent LL, Marshall DR, Pratap S, Hulette RB. Multidrug resistant Acinetobacter baumannii:
a descriptive study in a city hospital. BMC Infect Dis 2010; 10: 196-202.
6. Hughes C, Tunney M, Bradley MC. Infection control strategies for preventing the
transmission of meticillin-resistant Staphylococcus aureus (MRSA) in nursing homes for
older people (Review). Cocharane Db Syst Rev 2013; 11: 1-25.
7. Moran GJ, Amii RN, Abrahamian FM, Talan DA. Staphylococcus aureus in community
acquired skin infections. Emerg Infect Dis 2005; 11: 928-930.
8. Ermenlieva NM, Todorova TT, Tsankova GS, Popova TK, Georgieva EP. Effectiveness of
MRSA detection methods in the laboratory practice–a brief review. J IMAB 2016; 22: 1157-
1159.
9. Palavecino EL. Rapid methods for detection of MRSA in clinical specimens. Methods Mol
Biol 2014; 1085: 71-83.
10. Rabaana AA, Saunarb J, Bazzib AM, Raslanc WF, Taylord DR, Al–Tawfiqe JA.
Epidemiology and detection of Acinetobacter using conventional culture and in-house
developed PCR based methods. J Infect Public Heal 2017; 10: 124-128.
11. Thornsberry C, McDougal LK. Successful use of broth microdilution in susceptibility tests
for methicillin-resistant (heteroresistant) staphylococci. J Clin Microbiol 1983; 18: 1084-
1091.
12. Hansen SL, Freedy PK. Variation in the abilities of automated, commercial, and reference
methods to detect methicillin-resistant (heteroresistant) staphylococcus aureus. J Clin
Microbiol 1984; 20: 494-499.
13. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N. Enzymatic
amplification of p-globin genomic sequences and restriction site analysis for diagnosis of
sickle cell anemia. Science 1985; 230: 1350-1354.
14. Kearns AM, Seiders PR, Wheeler J, Freeman R, Steward M. Rapid detection of methicillin–
resistant staphylococci by multiplex PCR. J Hosp Infect 1999; 43: 33-37.
15. Lin Y, Zhang J, Ji Y. PCR-based approaches for the detection of clinical methicillin–
resistant staphylococcus aureus. Open Microbiol J 2016; 10; 45-56.
16. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. Loop–
mediated isothermal amplification of DNA. Nucleic Acids Res 2000; 28: e63.
11

ACCEPTED MANUSCRIPT
17. Abdullahi UF, Naim R, Taib WRW, Saleh A, Muazu A, Aliyu S. Baig, AA. Loop-mediated
isothermal amplification (LAMP), an innovation in gene amplification: bridging the gap in
molecular diagnostics; a review. Indian J Sci Technol 2015; 8: 1-12.
18. Li Y, Fan P, Zhou S, Zhang Li. Loop-mediated isothermal amplification (LAMP): a novel
rapid detection platform for pathogens. Microb Pathogenesis 2017; 107: 54-61.
19. Misawa Y, Yoshida A, Saito R. Yoshida H, Okuzumi K, It N, Okada M, Moriya K, Koike K.
Application of loop-mediated isothermal amplification technique to rapid and direct
detection of methicillin-resistant staphylococcus aureus (MRSA) in blood cultures. J Infect
Chemother 2007; 13:134-140.
20. Li P, Niu W, Li H, Lei H, Liu W, Zhao X, Guo L, Zou D, Yuan X, Liu H, Yuan J, Bai C.
Rapid detection of Acinetobacter baumannii and molecular epidemiology of carbapenem-
resistant A. baumannii in two comprehensive hospitals of Beijing, China. Front Microbiol
2015; 6: article 997.
21. Goto M, Hayashidani H, Takatori K, Kudo YH. Rapid detection of enterotoxigenic
staphylococcus aureus harboring genes for four classical enterotoxins, SEA, SEB, SEC and
SED, by loop-mediated isothermal amplification assay. Lett Appl Microbiol 2007; 45: 100-
107.
22. Ahmed MU, Saito M, Hossain MB, Rao SR, Furui S, Hino A, Takamura Y, Takagia M,
Tamiya E. Electrochemical genosensor for the rapid detection of GMO using loop–
mediated isothermal amplification. Analyst 2009; 134: 966-972.
23. Wang X, Teng D, Guan Q, Tian F, Wang J. Detection of roundup ready soybean by loop–
mediated isothermal amplification combined with a lateral-flow dipstick. Food Control 2013;
29: 213-220.
24. Maeda H, Kokeguchi S, Fujimoto C, Tanimoto I, Yoshizumi W, Nishimura F, Takashiba S.
Detection of periodontal pathogen porphyromonas gingivalis by loop-mediated isothermal
amplification method. Fems. Immunol Med Mic 2005; 43: 233-239.
25. Goto M, Honda E, Ogura A, Nomoto A, Hanaki KI. Colorimetric detection of loopmediated
isothermal amplification reaction by using hydroxy naphthol blue. Bio Techniques 2009; 46:
167-172.
26. Zhang X, Lowe SB, Gooding JJ. Brief review of monitoring methods for loop-mediated
isothermal amplification (LAMP). Biosens Bioelectron 2014; 61: 491-499.
27. Beech WF. Azo dyes. J Gen Rev 1969; 54: 131-140.
28. Park JW, Choi JH, Lee BK, Kim HS, Kim KW, Lee JS, Jeon HS, Yun SR. Kit for detecting
MRSA by detecting divalent magnesium ions and use thereof. ROK patent 2017; 10-
1908869-0000.
29. Park JW, Choi JH, Lee BK, Kim HS, Kim KW, Lee JS, Jeon HS, Yun SR. Kit for detecting
MRAB by detecting divalent magnesium ions and use thereof. ROK patent 2017; 10-
1908870-0000.
12