A new synthesis route to enantiomerically pure jasmonoids

Article abstract of DOI:10.1002/1521-3773(20021104)41:21<4026::AID-ANIE4026>3.0.CO;2-E

An important class of phytohormones are jasmonoids. A variety of jasmonoids in the natural cis configuration are now accessible by a general strategy. Key building blocks are enantiomerically pure lactones of type A with a leaving group Y which can be pre

Full text of DOI:10.1002/1521-3773(20021104)41:21<4026::AID-ANIE4026>3.0.CO;2-E

COMMUNICATIONS
[21] Since metal complexation and dehydrogenation both take place at
elevated temperature in ethylene glycol, it is feasible to execute both
steps as a ™one-pot∫ transformation. Typical overall yields for the two-
step transformation (that is, metal coordination followed by dehydro-
genation) are approximately 50%.
[22] The removal of aromatic rings from the eilatin core, as in complexes 6
and 8, results in higher susceptibility of the complexes toward
oxidation. Products 6 and 8 have been isolated as a mixture of the
RuII and RuIII forms (see Supporting Information).
[23] J.-P. Sauvage, J.-P. Collin, J.-C. Chambron, S. Guillerez, C. Coudret, V.
Balzani, F. Barigelletti, L. De Cola, L. Flamigni, Chem. Rev. 1994, 94,
993 1019; V. Balzani, A. Juris, M. Venturi, S. Campagna, S. Serroni,
Chem. Rev. 1996, 96, 759 833; F. R. Keene, Coord. Chem. Rev. 1997,
166, 121 159; M. D. Ward, F. Barigelletti, Coord. Chem. Rev. 2001,
216 217, 127 154.
[24] The overall yield for the two steps is 30%.
[25] It is likely that a thermodynamic impetus to redirect the ™misdirected∫
metal ligand bonds in the unfused precursors contributes to the
driving force of these transformations. See ref. [9] for a discussion
regarding the bonding in the fluxional unfused complex 1.
Figure 1. a) Schematic representation of reversible polymers; b) an OM-
based reversible polymer. The spacer is extended for illustrative clarity
only.
Here we report that the reversible polymeric properties of a
system based on oligonucleotide base pairing are well-
behaved. The system is intrinsically modular and is therefore
amenable to ™physical organic chemistry of materials∫, that is,
systematically varying the structure of the components and
observing the concomitant changes in the properties of the
assemblies. The monomers (hereafter, oligonucleotide-based
monomers (OMs)) comprise oligonucleotide sequences that
are covalently linked directly or through a synthetic spacer
(Figure 1b). Duplex formation creates a linear, polymeric
assembly that resembles larger duplex DNA,[15] but in which
the main chain is defined by the reversible base pairing. The
specificity between complementary DNA strands is such that
monomers can be synthesized that associate head-to-tail or in
alternating patterns. DNA base pairing is a popular motif for
self-assembly,[16,17] and similar systems have been used to
characterize DNA curvature and ring-closure probabili-
ties,[18,19] to sequentially align synthetic moieties,[20,21] and to
fabricate linear DNA protein nanostructures.[22] Surprisingly,
their properties in the context of reversible polymerization
have not been previously reported. We find that OMs are
well-suited to systematic studies of reversible polymerization.
Representative OMs are reported in Table 1. OMs 1a d are
self-complementary and form single-component homopoly-
mers, while 2A:2B and 3A:3B are two-component hetero-
polymer systems. Melting curves give effective free energies
of dimerization[23] (DGdim) that are in line with empirically
derived expectations;[24,25] polymerization does not have a
significant impact on duplex formation. Polymer formation is
revealed in all cases by an increased viscosity in the OM
solutions relative to solutions of nonpolymerizing analogues.
For example, the viscosity of 2A:2B (3 mgmLꢀ1 or 0.29 mm in
each monomer, 1m NaCl/10 mm sodium phosphate buffer,
pH 7.0, 25.08C, Cannon Ubbellohde viscometer) is 1.25 times
that of the same concentration of 2B alone, and that of
3A:3B (5.8 mgmLꢀ1 or 0.22 mm) is 2.5 times that of 3A
alone. The molecular weight of the polymer can be easily
controlled by varying the ratios of 2A:2B and 3A:3B; an
excess of any monomer serves as an effective ™chain
Modular, Well-Behaved Reversible Polymers
from DNA-Based Monomers**
Elizabeth A. Fogleman, Wayne C. Yount, Jun Xu,
and Stephen L. Craig*
Reversibly formed linear polymers (Figure 1a) have re-
8]
ceived increasing attention in recent years.[1 Reversible
association of monomers leads to extended assemblies whose
structure and properties depend on the strength and specific-
ity of the association, the conformational flexibility of the
molecule, the concentration of the monomer, and the
chemical and physical environment of the system. These
dissipative polymers undergo conformational changes and
diffusion on much shorter timescales than their covalent
counterparts, assemble with minimal imperfections, and
repair themselves on useful timescales.[1,9] They encompass a
range of structural motifs, phase behaviors,[1,3,10] solution and
solid-state mechanical properties,[2,11,12] and environmental
responsiveness,[12] and offer promise as environmentally
benign materials as a result of the ease of processing and
recycling and the absence of a polymerization catalyst. Meijer
and co-workers[2,13,14] were the first to show that reversible
polymers may possess properties that are similar to traditional
covalent polymers despite the transient interaction (approx-
imately seconds) defining the main chain.
[*] Prof. S. L. Craig, E. A. Fogleman, W. C. Yount, J. Xu
Department of Chemistry
P.M. Gross Chemical Laboratory, Duke University
Durham, NC 27708-0346 (USA)
Fax : (þ 1)919-660-1605
E-mail: stephen.craig@duke.edu
[**] This work was supported by the Petroleum Research Fund of the
American Chemical Society and Duke University. Partial support was
provided by the North Carolina Biotechnology Center and Research
Corp. S.L.C. gratefully acknowledges a DuPont Young Professor
Award and a Camille and Henry Dreyfus New Faculty Award.
4026
¹ 2002 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
0044-8249/02/4121-4026 $ 20.00+.50/0
Angew. Chem. Int. Ed. 2002, 41, No. 21

COMMUNICATIONS
Table 1. Composition, complementarity, and free energies of dimerization of oligonucleotide-based monomers. Red and blue colors denote
complementarity within each OM system.
[21]
OM
Sequence
DGdim(298) [kcalmolꢀ1
]
1
(5’!3©)GGTATACC-X-GCTTAAGC
1a
1b
1c
1d
2A
2B
3A
3B
no spacer
ꢀ10.0
ꢀ8.5
ꢀ8.5
ꢀ9.2
ꢀ12.4
ꢀ ꢀ
X ¼
T
ꢀ
ꢀ
X ¼ CH2CH2CH2
ꢀ
ꢀ
X ¼ (CH2CH2O)6
(5’!3’)GGCTCCCTTCTACCAC
(5’!3’)AGGGAGCCGTGGTAGA
(5’!3’)GCCCGGGCTCTCAAAAACTCTCGGGCCCTAGAGGGGCCCTAGA
(5’!3’)CCCGGGCTCTAGGGCCCCTCTAGGGCCCGAGAGTTTTTGAGAG
ꢀ13.2
terminator∫ for the polymerization. Expected molecular
weights are calculated from the free energies of the duplexes
and monomer ratio, and the viscosity observed scales as
MW(1.2Æ0.1) for 2 and 3 (Figure 2). The exponents indicate
semirigid rod polymers, which is consistent with the known
structure of duplex DNA.
Figure 3. Denaturing polyacrylamide gel electrophoresis (PAGE) of OM
1a samples. Lane 1: 25-bp step ladder; lane 2: OM 1a; lane 3: ligated
polymer of 1a; lane 4: ligated and exonucleased 1a; Lane 5: exonucleased
1a.
interactions. In OMs, the interactions–reflected by the
Huggins constant (k’)–are largely electrostatic, and they
are mediated by the ionic strength of the buffer. Similar to the
results of Shruggs and Ross,[28] k’ varies from 0.49 to 0.84, and
passes through a maximum value at about 1m NaCl. The
nonlinear dependence on ionic strength can be ascribed to
screening effects,[29] and its consequence is that polymer -
polymer interactions can be varied from good solvent to
strongly interacting conditions. The variation is pseudo-
independent of duplex thermodynamics, thus providing
another handle for fundamental studies.
In conclusion, DNA-based modules appear to be generally
suitable systems for fundamental studies of reversible poly-
merizations. As such, they possess several attractive charac-
teristics. The thermodynamics and kinetics of association are
determined by the variable OM base sequence. The linear
density of the reversible interactions and the conformational
flexibility along the polymer backbone are each dependent on
a spacer in which much variation is possible. Inter- and
intrachain interactions may be tuned by the salt concentration
in the buffer. Finally, robust enzymology offers covalent
capture of transient structures and structural analyses of
cyclizations. Many properties of assembled materials directly
reflect the nature of the reversible interaction defining the
polymerization. An understanding of the relationship be-
tween the structural, mechanical, and dynamic properties of
the polymer and the structural, thermodynamic, and dynamic
properties of the molecular constituents might therefore
create an avenue for the rational synthesis of materials with
Figure 2. Specific viscosity hsp as a function of calculated molecular weight
ꢀ1
~
determined from chain-termination studies for 2AB ( , 3.0 mgmL
,
208C) and 3AB ( , 2.9 mgmLꢀ1, 208C).
*
The concentration dependence of the solution viscosity also
reveals the reversible nature of the system. The specific
viscosity of 1a scales with [1a]3.3Æ0.2, which is in good
agreement with theoretical expectations[26] and previous
observations for reversible systems.[2,12] Static multiangle
and dynamic light scattering studies on 1 mm solutions of 1a
confirm the expected average molecular weights of approx-
imately 200 kDa and the presence of semirigid rod structures
with persistence lengths of about 50 nm. The OM polymers
behave like true reversible counterparts of high MW duplex
DNA.
Enzymatic manipulations provide further insight. Quick T4
DNA ligase (New England Biolabs) covalently captures
polymers of 1a on the timescale of OM dissociation (approx-
imately minutes), and the ligated polymers can be charac-
terized by gel electrophoresis (Figure 3). All equilibrium
polymerizations are candidates for some degree of cycliza-
tion, and these can be characterized for 1a. Digestion by
Lambda exonuclease removes any linear polymers,[27] and the
remaining small band of cyclic structures (approximately 10%
of total) is clearly seen in the gel.
Polymeric properties are determined not only by primary
and secondary structure but also by inter- and intrachain
Angew. Chem. Int. Ed. 2002, 41, No. 21
¹ 2002 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
0044-8249/02/4121-4027 $ 20.00+.50/0
4027

COMMUNICATIONS
specific properties. Studies with OMs should therefore
provide insight into the molecular basis of novel properties
of reversible polymeric systems, for example, at surfaces and
interfaces.[8]
Molecular Clips that Undergo Heterochiral
Aggregation and Self-Sorting**
Anxin Wu, Arindam Chakraborty,
James C. Fettinger, Robert A. Flowers II,* and
Lyle Isaacs*
Received: June 4, 2002 [Z19455]
[1] J.-M. Lehn, Makromol. Chem. Macromol. Symp. 1993, 69, 1.
[2] R. P. Sijbesma, F. H. Beijer, L. Brunsveld, B. J. B. Folmer, J. H. K. K.
Hirschberg, R. F. M. Lange, J. K. L. Lowe, E. W. Meijer, Science 1997,
278, 1601 1604.
[3] R. K. Castellano, D. M. Rudkevich, J. Rebek, Jr.,Proc. Natl. Acad. Sci.
USA 1997, 94, 7132 7137.
Biological systems offer exquisite examples of the ways in
which spatially and temporally controlled self-processes–
self-organization, self-assembly, and self-recognition–can
lead to the creation of higher order functional structures.[1]
To approach the design of supramolecular systems that
display complex biomimetic behavior, chemists have devel-
oped metal coordination, donor-acceptor interaction, and
hydrogen-bond-driven self-assembly to a level of sophistica-
tion that has allowed these assemblies to be endowed with
desirable chemical or physical properties.[2] Within the area of
self-assembly driven by hydrogen bonds, these activities have
resulted in intriguing discoveries including quadruple hydro-
gen bonding modules[3] that form the basis of supramolecular
polymers,[4] molecular capsules,[5] systems that display enan-
tiomeric self-recognition,[6] and complete asymmetric induc-
tion.[7] The use of hydrogen bonding as a tool in these
applications depended on the design of robust, functionaliz-
able, and tightly associated H-bonding modules. The further
implementation of H-bonding modules as instructed compo-
nents[1] in self-organizing systems additionally requires sys-
tems capable of self-sorting.[8] Such systems display high levels
of discrimination between self and non-self species and
consequently operate simultaneously and orthogonally within
complex mixtures. One strategy to create robust H-bonding
modules relies on increasing the number of hydrogen bonds
and tailoring their geometrical arrangement. In this paper we
employ a strategy using molecular clips,[9,10] based on molec-
ular shape and chirality. We report that compounds 1a, 1b,
(Æ )-2a, and (Æ )-2b form tightly self-associated dimers in
CDCl3 driven by the simultaneous formation of p p inter-
actions and two hydrogen bonds. The dimers possess a
confluence of properties–tight binding, high levels of chiral
discrimination, and self-sorting–that make them prime
modules for use in advanced applications.
[4] N. Zimmerman, J. S. Moore, S. C. Zimmerman, Chem. Ind. 1998, 604
610.
[5] P. S. Corbin, S. C. Zimmerman in Supramolecular Polymers, Vol. 1
(Eds: A. Ciferri), Marcel Dekker, New York, NY, 2000, pp. 147 176.
[6] C. Alexander, C. P. Jariwala, C. M. Lee, A. C. Griffin, Polym. Prepr.
(Am. Chem. Soc. Div. Polym. Chem.) 1993, 34, 168 169.
[7] U. Michelsen, C. A. Hunter, Angew. Chem. 2000, 112, 780 783;
Angew. Chem. Int. Ed. 2000, 39, 764 767.
[8] J. van der Gucht, N. A. M. Bessling, M. A. C. Stuart, J. Am. Chem.
Soc. 2002, 124, 6202 6205.
[9] G. M. Whitesides, J. P. Mathias, C. T. Seto, Science 1991, 254, 1312
1319.
[10] R. K. Castellano, C. Nuckolls, S. H. Eichhorn, M. R. Wood, A. J.
Lovinger, J. Rebek, Jr., Angew. Chem. 1999, 111, 2764 2768; Angew.
Chem. Int. Ed. 1999, 38, 2603 2606.
[11] A. J. Canty, J. Patel, B. W. Skelton, A. H. While, J. Organomet. Chem.
2000, 599, 195 199.
[12] R. K. Castellano, R. Clark, S. L. Craig, C. Nuckolls, J. Rebek, Jr.,Proc.
Natl. Acad. Sci. USA 2000, 97, 12418 12421.
[13] B. J. B. Folmer, R. P. Sijbesma, E. W. Meijer, Polym. Mater. Sci. Eng.
1999, 80, 20 21.
[14] L. Brunsveld, B. J. B. Folmer, E. W. Meijer, MRS Bull. 2000, 25, 49
53.
[15] The spacers are only a small fraction of the reversible polymers and
their influence on the properties is largely limited to conformational
flexibility.
[16] N. C. Seeman, Nano Lett. 2001, 1, 22 26.
[17] J. J. Storhoff, C. A. Mirkin, Chem. Rev. 1999, 99, 1849 1862.
[18] D. Shore, J. Langowski, R. Baldwin, Proc. Natl. Acad. Sci. USA 1981,
78, 4833 4837.
[19] M. Dlakic, R. Harrington, J. Bio. Chem. 1995, 270, 29945 29952.
[20] S. M. Waybright, C. P. Singleton, K. Wachter, C. J. Murphy, U. H. F.
Bunz, J. Am. Chem. Soc. 2001, 123, 1828 1833.
[21] Y. Ohya, K. Yabuki, M. Komatsu, T. Ouchi, Polym. Adv. Technol.
2000, 11, 845 855.
[22] C. M. Niemeyer, M. Adler, B. Pignataro, S. Lenhert, S. Gao, L. Chi, H.
Fuchs, D. Blohm, Nucleic Acids Res. 1999, 27, 4553 4561.
[23] In each of 1a d and 2AB, there are two duplexes of comparable
calculated free energies (within 1 2 kcalmolꢀ1). The individual
transitions are not resolved in UV melting experiments, and the
experimental free energy reported is very close to an average of the
two. The free energy of 3AB is assigned to the weaker duplex; the
larger duplex is effectively permanently fixed in our experimental
conditions and serves as an effective ™duplex spacer∫: J. Xu, S. L.
Craig, unpublished results.
[24] K. J. Breslauer, R. Frank, H. Blocker, L. A. Marky, Proc. Natl. Acad.
Sci. USA 1986, 83, 3746.
[25] K. M. Guckian, B. A. Schweitzer, R. X.-F. Ren, C. J. Sheils, D. C.
Tahmassebi, E. T. Kool, J. Am. Chem. Soc. 2000, 122, 2213 2222.
[26] M. E. Cates, Macromolecules 1987, 20, 2289.
[*] Prof. L. Isaacs, Dr. A. Wu,+ Dr. A. Chakraborty, Dr. J. C. Fettinger
Department of Chemistry and Biochemistry
University of Maryland
College Park, MD 20742 (USA)
Fax : (þ 1)301-314-9121
E-mail: LI8@umail.umd.edu
Prof. R. A. Flowers II
Department of Chemistry and Biochemistry
Texas Tech University
Lubbock, TX 79409 (USA)
Fax : (þ 1)806-742-1289
E-mail: rflowers@ttu.edu
[27] R. I. Ma, N. R. Kallenbach, R. D. Sheardy, M. L. Petrillo, N. C.
Seeman, Nucleic Acids Res. 1986, 14, 9745 9753.
[28] R. L. Shruggs, P. D. Ross, Biopolymers 1964, 2, 593 609.
[29] M. Shibayama, M. Uesaka, S. Inamoto, H. Mihaua, M. Nomura,
Macromolecules 1996, 29, 885 891.
[þ] National Laboratory of Applied Organic Chemistry
Lanzhou University
Lanzhou 730000 (P. R. China)
[**] We thank the National Institutes of Health (GM61854) for generous
financial support. L.I. is a Cottrell Scholar of Research Corporation.
Supporting information for this article is available on the WWW under
http://www.angewandte.org or from the author.
4028
¹ 2002 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
0044-8249/02/4121-4028 $ 20.00+.50/0
Angew. Chem. Int. Ed. 2002, 41, No. 21