Ester Synthesis in Water: Mycobacterium smegmatis Acyl Transferase for Kinetic Resolutions

Article abstract of DOI:10.1002/adsc.201701282

The acyl transferase from Mycobacterium smegmatis (MsAcT) catalyses transesterification reactions in aqueous media because of its hydrophobic active site. Aliphatic cyanohydrin and alkyne esters can be synthesised in water with excellent and strikingly opposite enantioselectivity [(R);E>37 and (S);E>100, respectively]. When using this enzyme, the undesired hydrolysis of the acyl donor is an important factor to take into account. Finally, the choice of acyl donor can significantly influence the obtained enantiomeric excesses. (Figure presented.).

Full text of DOI:10.1002/adsc.201701282

Title: Ester Synthesis in Water: Mycobacterium smegmatis Acyl
Transferase for Kinetic Resolutions
Authors: Nicolas de Leeuw, Guzman Torrelo, Carolin Bisterfeld,
Verena Resch, Luuk Mestrom, Laura Koekkoek van der Weel,
and Ulf Hanefeld
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: Adv. Synth. Catal. 10.1002/adsc.201701282
Link to VoR: http://dx.doi.org/10.1002/adsc.201701282

10.1002/adsc.201701282
Advanced Synthesis & Catalysis
COMMUNICATION
DOI: 10.1002/adsc.201((will be filled in by the editorial staff))
Ester Synthesis in Water: Mycobacterium smegmatis Acyl
Transferase for Kinetic Resolutions
Nicolas de Leeuwa,†, Guzman Torreloa,†, Carolin Bisterfelda, Verena Rescha, Luuk
Mestroma, Emanuele Straulinoa, Laura Van der Weela and Ulf Hanefelda*
a
Biokatalyse, Afdeling Biotechnologie, Technische Universiteit Delft, Van der Maasweg 9, 2629 HZ Delft (The
Netherlands)
Fax: (+31) 15 278 1415; phone: +31 15 27 89304; e-mail: U.Hanefeld@tudelft.nl
†
both authors contributed equally
Received: ((will be filled in by the editorial staff))
Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/adsc.201######.((Please
delete if not appropriate))
Abstract. The acyl transferase from Mycobacterium and also those that build the tunnel to the active site
smegmatis (MsAcT) catalyses transesterification reactions
in aqueous media because of its hydrophobic active site.
Aliphatic cyanohydrin and alkyne esters can be synthesised
in water with excellent and strikingly opposite
enantioselectivity [(R);E>50 and (S);E>100, respectively].
When using this enzyme, the undesired hydrolysis of the
acyl donor is an important factor to take into account.
Finally, the choice of acyl donor can significantly influence
the obtained enantiomeric excesses.
are mainly of hydrophobic character. In figure 1, the
active-site tunnel is shown, highlighting hydrophobic
amino acids. A hydrophobic tunnel might act water-
repelling and reduces the likelihood of water
molecules entering the active site. This phenomenon
has earlier been observed for the highly substrate
specific thioesterases involved in polyketide
biosynthesis.[3]
Keywords: Acyl transferase; Hydrolase; Kinetic
resolution; Mycobacterium smegmatis; Transesterification;
Water
Common sense has it that esters are hydrolysed in
water and synthesised in organic solvents, removing
water if necessary. Hydrolases such as lipases and
esterases are known for catalysing hydrolysis
reactions in aqueous media. They catalyse
transesterification and condensation reactions in non-
aqueous solutions.[1] Interestingly, the recent
characterisation of an acyl transferase from
Mycobacterium smegmatis (MsAcT)[2] revealed this
enzyme to catalyse acyl transfer reactions in aqueous
solutions. This is to say, an ester is formed while
thermodynamics dictate that hydrolysis should take
place. The reason for this remarkable feature of
Figure 1. Tunnel leading to the active site of MsAcT.
Active site Ser11 (derivatised as carbamate) is shown as
stick model. The amino acids are coloured according to
their hydrophobicity following the Kyte and Doolittle
scale.[4] The picture was generated with chimera (PDB
2Q0S).[5]
MsAcT
seems
to
be
the
hydrophobic
microenvironment around the active site [protein data
bank (PDB): 2Q0Q, 2Q0S]. Due to this limited
access of water to the active site “non-aqueous”
synthetic reactions may proceed even in buffer
solutions.[2] Indeed, as seen in the structure of MsAcT,
not only the architecture of the active-site tunnel but
also the hydrophobic surface environment seems to
be crucial for the acylation reaction to proceed in
water. The amino acid residues that flank the entrance
The first proof-of-concept for MsAcT-catalysed ester
synthesis in aqueous buffer was reported by
Matthews et al.[2], followed by an exploration of the
application by Wiermans et al.[6] Working with
extremely low enzyme concentrations and long
reaction times, Wiermans et al. applied MsAcT on
the secondary alcohol 2-octanol, demonstrating
enantioselectivity enabling asymmetric synthesis of
esters in water. However, conversions never reached
1
This article is protected by copyright. All rights reserved.

10.1002/adsc.201701282
Advanced Synthesis & Catalysis
Table 1. MsAcT-catalysed transesterification of primary
(S)-enantiomer of the secondary alcohols tested,
opposite to the rule of Kazlauskas.[1]
and secondary alcohols with ethyl acetate in buffer.[a]
To firmly establish that MsAcT is employable for
ester synthesis in water a large scale experiment was
performed with benzyl alcohol as substrate. In order
to avoid chromatography, the more reactive vinyl
acetate was used as acyl donor. Extraction followed
by evaporation under reduced pressure resulted in
84% isolated yield (102 mg) of benzyl acetate.
It should not go unmentioned, that even when
MsAcT does prefer acylation over hydrolysis, the
enzyme displays hydrolysis activity towards the
formed ester as well as the acyl donor resulting in the
formation of acid as by-product.[7] Since the enzyme
displays a low activity at low pH values,[2,6] this
observation needs to be taken into account.
Depending on the enzyme loading, a fast decrease in
pH of the reaction mixture can occur. With the
highest lyophilised CFE loading used in this study
(2 mg·mL-1), the pH could drop from 7.5 to 4 within
2 hours, even when a 200 mM potassium phosphate
buffer was used. Furthermore, hydrolysis of the acyl
donor produces an imbalance in the molar ratio of the
substrates. Possibly this prevented further conversion
at prolonged reaction times.
With the ability of MsAcT to catalyse synthesis of
esters in aqueous solutions firmly established, the
scope of this reaction was further studied. Thus,
cyanohydrin esters with high optical purity were
chosen as the next target due to their synthetic
importance.[8] Here, it was observed, that aromatic
cyanohydrins 10-14 were not converted (Table 2).
However, the conversion of sterically less demanding
aliphatic cyanohydrins 15 and 16 was catalysed by
MsAcT. The very reactive vinyl acetate was used as
acyl donor. With ethyl acetate and similar esters as
acyldonors, lower conversions were observed (results
not shown). At high pH values vinyl acetate can react
[a] Conditions: 1 mL potassium phosphate buffer (200 mM,
pH 7.5), 100 µL ethyl acetate, substrate 100 mM, dodecane
8 mM (internal standard), lyophilised CFE (cell free
extract, activity: 47.1 U neopentylglycol· mg lyophilised
CFE-1), 21 °C.
[b] Enantiomeric excess of the corresponding acetate.
[c] Based on eep and conversion.
[d] Absolute stereochemistry was determined by
comparison with commercially available reference material.
spontaneously
with
cyanohydrins
to
the
corresponding acetate, thereby negatively influencing
the E value. Control reactions at pH 7.5 and below
were conducted to detect these pH dependent
spontaneous reactions or acid-catalysed hydrolysis of
the acyl donor. By using buffers with different pH
values it was shown that the spontaneous formation
was suppressed at approximately pH 5.5. Therefore, a
lower pH was used for the kinetic resolutions of the
cyanohydrins although this was less favourable for
the MsAcT (Table 2).[9] Considering these
challenging reaction conditions, a moderate E of 17
and 14 was obtained with cyanohydrin 15 and 16,
respectively. During reaction a pH drop to 4 was
25% even after 96 h, seemingly ruling out the
application of MsAcT in kinetic resolutions (KRs).[6]
Here we describe the successful synthesis of a
range of esters in water. Catalysed by MsAcT,
several primary, secondary, and tertiary alcohols
were screened, utilising ethyl acetate and vinyl
acetate as acyl donor, including kinetic resolutions.
In a preliminary screening the range of alcohols as
well as the possibility to reach good conversions, i.e.
>90% for achiral substrates was evaluated (Table 1).
Gratifyingly, after one hour the tested primary
alcohols were almost completely esterified. The
secondary alcohols were converted, however,
reactions were slow. The tertiary alcohol 9 was not
converted. As previously reported for 2-octanol,
MsAcT displayed enantioselectivity for the
observed. For both substrates 15 and 16
a
stereopreference for the (R)-enantiomer was observed.
For substrate 16, the significantly lower conversion
was probably due to steric hindrance. The substrate
scope of MsAcT for asymmetric synthesis in water
2
This article is protected by copyright. All rights reserved.

10.1002/adsc.201701282
Advanced Synthesis & Catalysis
Table 2. MsAcT-catalysed kinetic resolution of
the (S)-acetate was formed preferentially. In order to
cyanohydrins by transesterification in buffer.[a]
further
establish
this
remarkable
opposite
stereopreference, we chose two substrates just
differing in the nitril and alkyne group. Thus,
cyanohydrin 23 and alkynol 24 were converted by
MsAcT. To exclude any side reactions possibly
originating from other enzymes in the cell free extract
(CFE), the reactions were performed with purified
MsAcT and compared to a negative control without
enzyme. The reactions were performed on analytical
scale (100 mM substrate concentration) under
identical conditions with the sole difference of the pH,
which was adjusted to pH 5 in the case of the
cyanohydrin reaction. Both reactions were stopped
after 3 h. For cyanohydrin 23 a conversion of 14%
was observed, while the (R)-enantiomer of the
corresponding acetate 25 was formed with an high ee
of 94% and an E value of 37. 30% of the alkynol 24
was converted to the (S)-configured acetate (S)-26
with an ee of 85% resulting in an E value of 18. It has
to be mentioned that the performed negative controls
do show partial degradation of the substrates. The
conversion mentioned above for substrate 23 and 24
Table 3. MsAcT-catalysed kinetic resolution of secondary
[a] Conditions: 1 mL potassium phosphate buffer (200 mM,
pH 7.5), 15 µL AcOH (overall pH 5), 100 µL vinyl acetate,
cyanohydrin 100 mM, dodecane 50 mM (internal standard),
alkynols by transesterification in buffer.[a]
2 mg
lyophilised
CFE·mL-1
(activity:
24.6 U
neopentylglycol·mg lyophilised CFE-1), 21 °C, 3 h.
[b] pH after 3 h reaction time.
[c] Absolute stereochemistry determined by independent
synthesis of the products with PaHNL and MeHNL and
subsequent chemical acylation.
[d] Based on eep and conversion.
was extended with aliphatic secondary alkynols as
substrates (Table 3). Secondary alkynols have similar
steric demands as cyanohydrins, yet due to an alkyne
rather than a cyanide group, different electronic
properties. Like aromatic cyanohydrins, the
secondary aromatic alkynol 17 was not converted by
MsAcT even after 5 h reaction time. This supports
the previous suggestion that these substrates are not
converted for sterical reasons. Aliphatic secondary
alkynols were converted with moderate to excellent E
values (Table 3). Control reactions at pH 7.5 showed
negligible amounts of spontaneously formed alkynol
ester with vinyl acetate as acyl donor. Therefore, the
more favourable pH 7.5 could again be used.
Substrates with long aliphatic chains, like 21 or 22,
have greatly reduced E values.
[a] Conditions: 900 µL potassium phosphate buffer
(200 mM, pH 7.5), 100 µL vinyl acetate, aliphatic or
aromatic alkynol 100 mM, dodecane 50 mM (internal
standard),
lyophilised
CFE
(activity:
24.6 U
The combined results (Table 1-3) reveal that
MsAcT is a catalyst for compact secondary alcohols
with a small substituent in α position, such as an
alkyne or nitrile. Strikingly, the enzyme showed a
clear preference for the (R)-enantiomer of the tested
cyanohydrins 15 and 16, whereas for alkynols 18-22
neopentylglycol·mg lyophilised CFE-1), 21 °C.
[b] Conversion based on enantiomeric excesses eep and ees.
[c] pH after 3 h of reaction time.
[d] Based on enantiomeric excesses eep and ees.
[e] Absolute stereochemistry was determined by
comparison with commercially available reference material.
3
This article is protected by copyright. All rights reserved.

10.1002/adsc.201701282
Advanced Synthesis & Catalysis
is therefore corrected. However, it cannot be ruled
out completely, that partial degradation also takes
place for the substrates of Table 2 and 3. The
observed opposite stereopreference for the (R)-
configured cyanohydrin 23 and the (S)-configured
alkynol 24 matches that of the investigated
cyanohydrins (Table 2) and alkynols (Table 3).
Testing a substrate with a similar structure allows the
conclusion that the absence of the more polar nitrile
group causes the switch in stereo preference of
MsAcT from (R) to (S). This reveals that the switch
in enantioselectivity is solely based on the difference
in electronic properties between these substrates.
To further establish the synthetic applicability of
the transesterification catalysed by purified MsAcT
substrate 23 and 24 were used in larger scale
(3.5 mmol substrate) experiments, the corresponding
acetates purified and the absolute stereochemistry
determined by measurement of the optical rotation
(Scheme 1). A preparative kinetic resolution of 23
after purification by column chromatography gave a
16% isolated yield (83 mg) of (R)-1-cyanobutyl
acetate (R-25, ee 94%). A scaled kinetic resolution of
24 was stopped after 2 h resulting after purification
by column chromatography in 38% isolated yield
(184 mg) of (S)-hex-1-yn-3-yl acetate (S-26, ee 90%).
In both reactions a drop in pH was observed,
confirming that it is MsAcT that hydrolyses the acyl
donor.
hydrophobic amino acids of the active site (Figure 1)
and
reduce
its
size,
thereby
improving
enantioselectivity. Phenyl acetate as acyl donor
liberates hydrophobic phenol with the desired
properties. Substrate 20, which showed the highest E
value in preliminary tests, and alkynol 24 were tested
in combination with different acyl donors to see the
effect on the leaving group on the E value (Table 4).
When applying the different donors in control
reactions at pH 7.5 only negligible amounts of
product could be observed. Phenyl acetate gave one
of the highest conversion rates and the highest
selectivity in combination with both 20 and 24. Table
4 shows that the enantioselectivity of MsAcT can be
significantly influenced by the steric hindrance
caused by the leaving group of the acyl donor. An
increase in steric hindrance of the alcohol chain
Table 4. MsAcT-catalysed kinetic resolution of aliphatic
secondary alkynols using different acyl donors.[a]
Scheme 1. Preparative kinetic resolution of cyanohydrin
23 and alkynol 24 catalysed by MsAcT.
A study by Jacobsen et al.[10] revealed that the leaving
group of the acyl donor can have a significant
influence on the E value of the enzyme. In particular
2,2,2-trifluoroethyl acyldonors led to substantial
improvements of E value.[10,11] Gedey et al. converted
amines with CALB and proposed that the liberated
2,2,2-trifluoroethanol remains in proximity of the
active site and thus may have an influence on the
[a] Conditions: 900 µL potassium phosphate buffer
(200 mM, pH 7.5), 100 µL acyl donor, secondary alkynol
100 mM, dodecane 50 mM (internal standard), enzyme
loading 0.5 mg lyophilised CFE·mL-1 (activity: 34.3 U
neopentylglycol·mg lyophilised CFE-1), 21 °C, 3 h.
[b] pH after 3 h of reaction time.
transesterification reaction.[12] MsAcT has
a
hydrophobic microenvironment surrounding the
active site. We therefore hypothesised that bulky,
hydrophobic leaving groups might interact with the
[c] Based on enantiomeric excesses eep and ees.
4
This article is protected by copyright. All rights reserved.

10.1002/adsc.201701282
Advanced Synthesis & Catalysis
seems to be positively correlated with a higher E. The
observed final pH of the reaction was approximately
the same for all acyl donors, indicating that the
difference of hydrolysis rates between the acyl donors
are not of significance for this application.
The MsAcT-catalysed reactions were all
performed with a high excess of acyl donor, i.e. vinyl
acetate, leading to a bi-phasic system (the solubility
of vinyl acetate in water is about 230 mM). It was
previously shown, that the lipase Candida antarctica
(Pseudozyma antarctica, CAL-A) is indeed able to
catalyse ester synthesis in presence of water or even
in a purely aqueous system.[13] Here, it should be
tested if CAL-A is able to perform the above
Figure 2. NMR monitored reaction of purified MsAcT
with isobutanol and vinyl acetate.
described
MsAcT-catalysed
transesterification
reaction under the same bi-phasic conditions. To
compare the catalytic capabilities of both enzymes,
analytical scale reactions were carried out with
purified MsAcT as well as CAL-A as catalyst using
lactonitrile (15) and butynol (18) as racemic
Experimental Section
CAUTION: All procedures involving cyanohydrins were
performed in a well-ventilated fume hood equipped with a
HCN detector. HCN-containing wastes were neutralised
using commercial bleach and stored independently over a
large excess of bleach for disposal.
substrates (detailed
reaction conditions
in
Experimental Section). These experiments showed
that CAL-A did not catalyse the conversion of
lactonitrile (15) or butynol (18). In contrast MsAcT
did show a conversion of 23% for lactonitrile (15)
yielding in E value of 25 for the (R)-enantiomer.
Applying butynol (18) as a substrate a conversion of
40% with an enantioselectivity (E = 17) for the
(S)-alcohol was observed. These values are in
accordance with the above described results obtained
with cell free extract.
It was described earlier that MsAcT does catalyse
transesterification in water.[2,9] To confirm these
results, and exclude that the reaction took place due
to the bi-phasic reaction conditions, we performed the
acylation of 11 mM isobutanol (5) with 212 mM
vinyl acetate under monophasic conditions. To keep
an excess of the acyl donor, a lower substrate
concentration was applied. Controls with CAL-A as
well as without catalyst were carried out under the
same reaction conditions. Quantitative conversion
was monitored by in situ NMR. While the purified
MsAcT-catalysed reaction went to completion
(Figure 2), no conversion could be observed with
CAL-A nor for the negative control.
General
1H and 13C NMR spectra were recorded on a Varian 400
(400 MHz) spectrometer in CDCl3 (buffer for the NMR-
monitored reaction). The chemical shifts are given in ppm
relative to the solvent signal [1H: δ (CHCl3) = 7.26 ppm]
and [13C: δ (CDCl3) = 77.16 ppm, for centerline of CDCl3
triplet]. Flash column chromatography was performed on
silica gel 60, particle size 40–63 μm (230–240 mesh) with
mixtures of n-pentane and diethyl ether as eluent. Optical
rotations were measured on
a Perkin Elmer 341
polarimeter at the sodium-ᴅ-line using a cell with 100 mm
path length.
GC analysis
See supporting info.
Chemicals
Butyraldehyde, isovaleraldehyde, acetone cyanohydrin,
potassium cyanide, lactonitrile, isopropenyl acetate, phenyl
acetate, methyl acrylate, acetic anhydride, ethyl acetate,
vinyl acetate, methyl butyrate, ethyl propionate, dodecane,
pyruvonitrile, 1-phenylethanol, 2-phenylethanol, 1-
pentanol, 2-pentanol, 1-phenyl-propan-2-ol, 2-methyl-2-
pentanol, 2,2-dimethyl-1,3-propanediol (NPG), (S)-butyn-
2-ol, butyn-2-ol, pentyn-3-ol, heptyn-3-ol, (S)-octyn-3-ol,
octyn-3-ol, 4-methyl-1-pentyn-3-ol, hexyn-3-ol, 1-phenyl-
propyn-1-ol, and acetonitrile were purchased from Sigma-
Aldrich. Diethyl ether was purchased from VWR
international. Chloroform was purchased from J.T. Baker.
3-methyl-butanal, 4-dimethylaminopyridine (DMAP),
methyl-tert-butylether (MTBE), dichloromethane, styrallyl
To conclude, MsAcT catalyses complete
esterification of primary alcohols in aqueous buffer.
It can be highly (R)-selective towards aliphatic
cyanohydrins. For aliphatic secondary alkynols, it is
(S)-selective and kinetic resolutions can be
successfully
performed.
Experiments
using
structurally related substrates indicate that the switch
in stereopreference is based on a difference in
electronic properties of the substrates. Finally, the
choice of acyl donor can significantly influence the
obtained enantiomeric excesses.
5
This article is protected by copyright. All rights reserved.

10.1002/adsc.201701282
Advanced Synthesis & Catalysis
acetate were purchased from Acros. Aldehydes and acyl
donors were distilled prior to use.
MgSO4, and the solvent was evaporated under reduced
pressure. The colourless liquid obtained was dried under
high vacuum.
Cloning, overexpression, and purification of
MsAcT
1
2-hydroxypentanenitrile (23) Yield: 95%; liquid; H NMR
(400 MHz, CDCl3): δ 0.99 (t, J = 7.3 Hz, 3H), 1.53 (m,
2H), 1.82 (m, 2H), 2.93 (s, OH), 4.48 (t, J = 7.3 Hz, 1H).
See supporting info.
A
synthetic gene encoding for MsAcT (GenBank
accession: ABK70783) from Mycobacterium smegmatis str.
MC2 155, including a C-terminal his-tag, was ordered
from BaseClear. The gene was cloned into vector pET16b
(Novagen) with 25 of additional amino acid after the his6-
tag. A PCR with GAGATATACCATGGCCAAGC as
forward and ATTTAGTGGTGATGGTGATG as reverse
primer was performed to remove the 25 additional amino
acids. The PCR product was cloned into the expression
vector pET16b by using NcoI and BamHI (for details see
supporting information.). The resulting vector pET16b-
MsAcT-stop was afterwards transformed into chemically
2-hydroxy-4-methylpentanenitrile (16) Yield: 90%; liquid;
1H NMR (400 MHz, CDCl3): δ 0.97 (d, J = 6.6 Hz, 6H),
1.67–2.19 (m, 3H), 2.77 (br s, 1H), 4.50 (t, J = 7.3 Hz, 1H).
See supporting info.
Derivatisation of cyanohydrins and alkynols
Cyanohydrin or alkynol (4.42 mmol), acetic anhydride
(7.35 mmol) and DMAP (0.82 mmol) were dissolved in
competent E. coli BL21 (DE3) for heterologous expression. chloroform or diethyl ether (5 mL). The mixture was left
overnight at rt. The reaction conversions were checked by
TLC (9:1, petroleum ether: EtOAc). Demineralised water
(5 mL) was added to the mixture to stop the reaction. The
organic layer was filtered and dried over MgSO4. Acetates
were purified using column chromatography, solvent was
evaporated under reduced pressure. Yields ranged from 33-
93% depending on the purified compound. For NMR’s, see
supporting info.
E. coli BL21 (DE3) pET16b-MsAcT was grown at 25 ºC
in lysogeny broth (LB) medium containing ampicillin
(0.1 mg·L-1) to an optical density of 0.5 (OD600). The
expression of MsAcT was induced by the addition of
Isopropyl -D-1-thiogalactopyranoside (IPTG; 1 mM), and
the culture was further incubated for 16 h at 25 ºC. The
cells were harvested by centrifugation for 20 min at
8000 rpm at 4 ºC. Pellets were washed in 20 mM
phosphate buffer pH 7.5 and resuspended in 50 mL buffer.
DNase, lysozyme and 20 mM imidazole were added and
incubation was done for 15 min on ice. Cell free extract
(CFE) was obtained by cell disruption (Constant Cell
disruption systems) and centrifugation for 10 min,
15000 rpm at 4 °C. For purification a 10 mL Ni-NTA
column (GE-Healthcare) was used and the protein was
eluted by imidazole. Details and SDS-gel picture are in
supporting information. Note: For initial experiments a
protein version with the 25 additional amino acids was
used. However, after comparision with the corrected
protein version no changes in reactivity could be observed.
Enzymatic alcohol transesterification reactions
MsAcT lyophilised CFE (0.25-2 mg, activity: 47.1 U
neopentylglycol·mg lyophilised CFE-1) was added to 1 mL
of 200 mM KH2PO4 buffer pH 7.5 containing 0.1 mmol of
aromatic or aliphatic alcohols and 0.01 mmol dodecane (as
internal standard) previously mixed under a nitrogen
atmosphere. 100 μL of acyldonor were added and the
biphasic reaction mixture was shaken at 1000 rpm and
21 °C. Results see table 1.
For larger (7.5 mL) reaction: MsAcT lyophilised CFE
(1.33 mg, activity: 47.1 U neopentylglycol·mg lyophilised
CFE-1) was added to 6.75 mL of 200 mM KH2PO4 buffer
pH 7.5 containing 0.75 mmol of benzyl alcohol. 675 μL of
vinyl acetate was added, the reaction mixture was shaken
at 1000 rpm and 21 °C for 0.5 h. Reaction mixture was
extracted twice with 2.5 mL diethyl ether. The organic
layer was removed, filtered, and dried over MgSO4.
Solvent was evaporated under reduced pressure. This
yielded 84% benzyl acetate as a colourless liquid; 1H NMR
(400 MHz, CDCl3) δ 2.10 (2, 3H), 5.11 (s, 2H), 7.35 (m,
5H). See supporting info.
MsAcT activity assay[2]
Reactions (0, 2, 4, 6, and 8 min) were conducted in single
phase conditions of 200 mM pH 8 potassium phosphate
buffer (25 μL) dissolved in ethyl acetate (975 μL). The
final concentration of MsAcT CFE was 0.05 mg·mL-1.
Reactions were shaken (1000 rpm) at 21 °C. The reaction
was quenched by addition of MgSO4. The product NPG
monoacetate was quantified by GC. Dodecane was used as
internal standard. Activity is reported as micromoles of
NPG monoacetate produced per minute per milligram of
lyophilised MsAcT CFE.
Kinetic resolution of cyanohydrins
Synthesis of 2-hydroxypentanenitrile and 2-
hydroxy-4-methylpentanenitrile[14]
MsAcT lyophilised CFE (2 mg, activity: 34.3 U
neopentylglycol·mg lyophilised CFE-1) was added to 1 mL
of 200 mM pH 7.5 potassium phosphate buffer with 15 μL
AcOH (overall pH 5), containing 0.1 mmol of aromatic or
aliphatic cyanohydrins and 0.01 mmol dodecane (as
internal standard) previously mixed under a nitrogen
atmosphere. 100 μL of vinyl acetate was added and the
biphasic reaction mixture was shaken at 1000 rpm and
NaHSO3 (0.1 mol) was dissolved in water (50 mL) and the
corresponding aldehyde (0.05 mol) was added at 0 °C.
Then, KCN (0.2 mol) in water (100 mL) was added
dropwise over 30 min, and the mixture was stirred for 1 h
at 0 °C. The mixture was extracted three times with
chloroform, combined organic layers were dried over
6
This article is protected by copyright. All rights reserved.

10.1002/adsc.201701282
Advanced Synthesis & Catalysis
21 °C for 3 h. pH changes at the end of the reaction were
measured with pH paper. Results see table 2. Similar
results were obtained when a Na acetate buffer (pH 5,
200 mM) was utilised (Table S1).
organic phases were dried over Na2SO4 and concentrated
carefully under reduced pressure (max. temperature 40 °C).
The crude product was purified by column
chromatography (n-pentane:diethyl ether 98:2). 184 mg
[1.3 mmol, 38%, ee (S) 90%] of the product 26 could be
1
isolated as colourless liquid. H NMR (400 MHz, CDCl3):
Purified MsAcT (32 µL, 105 U) was added to 1 mL
200 mM pH 7.5 potassium phosphate buffer with 15 μL
AcOH (overall pH 5), containing 0.1 mmol of
2-hydroxypentanenitrile (23). 100 μL of vinyl acetate were
added and the biphasic reaction mixture was shaken at
1000 rpm and 21 °C for 3 h. The reactions were stopped by
extraction with 3x550 µL ethyl acetate (containing 10 mM
dodecane). The combined organic phases were dried over
Na2SO4 and measured by GC.
δ 0.95 (t, J = 7.4 Hz, 3H), 1.48 (m, 2H), 1.76 (m, 2H), 2.08
(s, 3H), 2.44 (s, 1H), 5.35 (dt, J = 2.3 Hz, J = 6.8 Hz, 1H).
See supporting info.
[훼퐷23] = -55.9 (c 1.0, CHCl3, ee 90%) Lit. [αD] = -110.8 (c
1, CHCl3, ee 96%)[16]
Kinetic resolution of lactonitrile (15) and butynol
(18) with MsAcT and CAL-A
(R)-1-cyanobutyl acetate (25): 380 µL acetic acid were
added to 35 mL KPi buffer (200 mM, pH 7.5) resulting in a
final pH of 5.5. 347 mg (3.5 mmol) of 2-hydroxy-
pentanenitrile (23) and 3.5 mL vinyl acetate were added.
1120 µL (3679 U) of purified MsAcT were added. The
reaction was shaken at room temperature, 1000 rpm. The
reaction was stopped after 3 h by extracting with pentane
(3x). The combined organic phases were dried over
Na2SO4 and concentrated in vacuo. The crude product was
purified by column chromatography (n-pentane:diethyl
ether 96:4 to 80:20) and 83 mg (0.58 mmol, 16%, ee 94%)
of (R)-1-cyanobutyl acetate (25) could be isolated as
Lactonitrile (15): 80 μg lyophilised purified MsAcT
(activity: 2.44 U butyric acid·mg lyophilised purified
MsAcT-1) or 160 μg CALA (activity: 1.95 U butyric
acid·mg CAL-A-1) were added to 1 mL potassium
phosphate buffer (200 mM, pH 8) with 20 µL AcOH
(overall pH 5), 100 mM lactonitirle (15), and 100 µL vinyl
acetate. The reaction was shaken for 180 min at 21 °C.
Butynol (18): 20 μg lyophilised purified MsAcT (activity:
2.44 U butyric acid·mg lyophilised purified MsAcT-1) or
40 μg CAL-A (activity: 1.95 U butyric acid·mg CAL-A-1)
were added to 900 µL potassium phosphate buffer
(200 mM, pH 8) with 100 mM butynol (18) and 100 µL
vinyl acetate. The reaction was shaken for 35 min at 21 °C.
1
colourless liquid. H NMR (400 MHz, CDCl3): δ 0.99 (t, J
= 6.3 Hz, 3H), 1.53 (m, 2H), 1.88 (m, 2H), 2.14 (s, 3H),
5.33 (t, J = 6 Hz, 1H). See supporting info.
[훼퐷20] = +44.2 (c 1.0, CHCl3, ee 94%) Lit. [훼퐷 ] +76 (c~2,
benzene, ee 81%)[15]
The activity was measured following the protocol of
Mateos-Díaz et al. applying tributyrin as substrate.[17] The
enzyme (MsAcT with 1.3 μg·mL-1 and CAL-A with
5.2 μg·mL-1) was dissolved in MOPS buffer (pH 7.2,
2.5 mM). Activity is reported as micromoles of butyric
acid formed per minute per milligram of lyophilised
MsAcT or CAL-A.
Kinetic resolution of secondary alkynols
MsAcT lyophilised CFE (0.5-2 mg, activity: 34.3 U
neopentylglycol·mg lyophilised CFE-1) was added to
900 μL of 200 mM KH2PO4 buffer pH 7.5 containing
0.1 mmol of aromatic or aliphatic secondary alkynol and
0.01 mmol dodecane or decane (as internal standard)
previously mixed under a nitrogen atmosphere. 100 μL of
acyldonor was added, starting pH was 7.5, the biphasic
reaction mixture was shaken at 21 °C for the required
reaction time. pH changes at the end of the reaction were
measured with pH paper. Results see table 3 and 4.
NMR monitored reaction
Purified MsAcT (25 μL, 0.5 μg mL-1) was added to a stock
solution of 975 μL [11 mM isobutanol (5), 212 mM vinyl
acetate, 200 mM KPi pH 7.5]. The solution was
resuspended vigorously during addition for 1-3 sec and
1
measured immediately with H-NMR. NMR spectra were
recorded using an Agilent 400 MHz (1H, 9.4 Tesla)
1
Purified MsAcT (32 µL, 105 U) was added to 1 mL
200 mM pH 7.5 potassium phosphate buffer containing
0.1 mmol of 1-hexyn-3-ol (21). 100 μL of vinyl acetate
were added and the biphasic reaction mixture was shaken
at 1000 rpm and 21 °C for 3 h. The reactions were stopped
by extraction with 3x550 µL ethyl acetate (containing
10 mM dodecane). The combined organic phases were
dried over Na2SO4 and measured by GC.
spectrometer operating at 399.67 MHz for H at 298 K.
Chloroform CDCl3 (with 0.03 vol-% TMS) was used for
external locking during water suppression with the
PRESAT-PURGE pulse sequence.
Acknowledgements
A fellowship by the University of Trieste and the region
Friuli Venezia Giulia to E. S. is gratefully acknowledged.
V. Resch thanks the Austrian Science Fund (FWF) for an
“Erwin-Schroedinger” Fellowship (J3292). This work is
part of the Open Technology Programme with project
number 14170, which is (partly) financed by the
Netherlands Organisation for Scientific Research (NWO).
(S)-hex-1-yn-3-yl acetate (26): 343 mg 1-hexyn-3-ol (21,
3.5 mmol) were added to 31.5 mL KPi buffer (200 mM, pH
7.5). 3.5 mL vinyl acetate and 1120 µL purified MsAcT
(3679 U) were added. The reaction was shaken at room
temperature at 1000 rpm for 1 h. The reaction was stopped
by extracting with diethyl ether (3x). The combined
7
This article is protected by copyright. All rights reserved.

10.1002/adsc.201701282
Advanced Synthesis & Catalysis
We thank Jord Claessen for his dedicated support of our
project.
Rønstad, T. Anthonsen, J. Mol. Catal. B: Enzym. 2000, 8,
51-60.
[11] T. M. Stokes, A. C. Oehlschlager, Tetrahedron Lett.,
1987, 28, 2091-2094.
References
[1] a) U. T. Bornscheuer, R. J. Kazlauskas, Hydrolases in
Organic Synthesis, 2nd Ed. Wiley-VCH, Weinheim, 2006;
b) K. Faber, Biotransformations in Organic Chemistry, 6th
revised Ed. Springer, Berlin, 2011; c) M. Paravidino, P.
Böhm, H. Gröger, U. Hanefeld in Enzyme Catalysis in
Organic Synthesis (Eds.: K. Drauz, H. Gröger, O. May),
3rd ed., Wiley-VCH, Weinheim, 2012, pp. 249– 362.
[12] S. Gedey, A. Liljeblad, F. Fülöp, L. T. Kanerva.
Tetrahedron: Asymmetry 1999, 10, 2573-2581.
[13] a) J. Müller, M. A. Sowa, M. Dörr, U. T.
Bornscheuer, Eur. J. Lipid Sci. Technol. 2015, 117, 1903-
1907; b) S. Schmidt, C. Scherkus, J. Muschiol, U. Menyes,
T. Winkler, W. Hummel, H. Gröger, A. Liese, H.-G. Herz,
U. T. Bornscheuer, Angew. Chem. Int. Ed. 2015, 54, 2784-
2787; c) S. Schmidt, H. C. Büchsenschütz, C. Scherkus, A.
Liese, H. Gröger, U. T. Bornscheuer, ChemCatChem 2015,
7, 3951-3955.
[2] I. Mathews, M. Soltis, M. Saldajeno, G. Ganshaw, R.
Sala, W. Weyler, M. A. Cervin, G. Whited, R. Bott,
Biochemistry 2007, 46, 8969-8979.
[3] a) S.-C. Tsai, L. J. W. Miercke, J. Krucinski, R.
Gokhale, J. C.-H. Chen, P. G. Foster, D. E. Cane, C.
Khosla, R. M. Stroud, Proc. Natl Acad. Sci. U. S. A. 2001,
98, 14808-14813; b) K. J. Weissman, C. J. Smith, U.
Hanefeld, R. Aggarwal, M. Bycroft, J. Staunton, P. F.
Leadlay, Angew. Chem., Int. Ed. 1998, 37, 1437-1440; c)
K. J. Weissman, Nat. Prod. Rep. 2015, 32, 436-453.
[14] N. P. Chandia, J. C. Canales, I. Azocar, S. Vanlaer, V.
G. Pawar, W. M. De Borggraeve, J. Costamagna, W.
Dehaen, Synth. Commun. 2009, 39, 927-939.
[15] H. Ohta, S. Hiraga, K. Miyamoto, G. Tsuchihashi,
Agric. Biol. Chem. 1988, 52, 3023-3027.
[4] J. Kyte, R. F. Doolittle, J. Mol. Biol. 1982, 157, 105-
132.
[16] J.-L. Abad, F. Camps, G. Fabrias, J. Am. Chem. Soc.
2007, 129, 15007-15012.
[5] E. F. Pettersen, T. D. Goddard, C. C. Huang, G. S.
Couch, D. M. Greenblatt, E. C. Meng, T. E. Ferrin, J.
Comput. Chem. 2004, 25, 1605-1612.
[17] E. Mateos-Díaz, J. A. Rodríguez, M. de los Ángeles
Camacho-Ruiz, J. C. Mateos-Díaz in Lipases and
Phospholipases: Methods and Protocols (Ed.: G. Sandoval),
Humana Press, Totowa, NJ, 2012, pp. 89-100.
[6] L. Wiermans, S. Hofzumahaus, C. Schotten, L.
Weigand, M. Schallmey, A. Schallmey, P. Domínguez de
María, ChemCatChem 2013, 5, 3719-3724.
[7] a) K. Szymanska, K. Odrozek, A. Zniszczol, G.
Torrelo, V. Resch, U. Hanefeld, A. B. Jarzebski, Catal. Sci.
Technol. 2016, 6, 4882-4888; b) A. Drożdż, U. Hanefeld,
K. Szymańska, A. Jarzębski, A. Chrobok, Catal. Commun.
2016, 81, 37-40.
[8] a) M. Dadashipour, Y. Asano, ACS Catal. 2011, 1,
1121-1149; b) J. Holt, U. Hanefeld, Curr. Org. Synth. 2009,
6, 15-37; c) K. Steiner, A. Glieder, M. Gruber-Khadjawi in
Biocatalysis in Organic Synthesis 2 (Eds.: K. Faber, W.-D.
Fessner, N. J. Turner), Thieme, Stuttgart, 2015, Chapter
2.1.1.; d) C. Paizs, P. Tähtinen, M. Toşa, C. Majdik, F.-D.
Irimie, L. T. Kanerva, Tetrahedron 2004, 60, 10533-
10540; e) L. Veum, U. Hanefeld, Tetrahedron: Asymmetry
2004, 15, 3707-3709; f) T. Sakai, K. Wang, T. Ema,
Tetrahedron 2008, 64, 2178-2183; g) L. Veum, L. T.
Kanerva, P. J. Halling, T. Maschmeyer, U. Hanefeld, Adv.
Synth. Catal. 2005, 347, 1015 –1021; h) M. North, D. L.
Usanov, C. Young, Chem. Rev. 2008, 108, 5146–5226; i)
P. Bracco, H. Busch, J. von Langermann, U. Hanefeld,
Org. Biomol. Chem. 2016, 14, 6375-6389.
[9] H. Land, P. Hendil-Forssell, M. Martinelle, P.
Berglund, Catal. Sci. Technol. 2016, 6, 2897-2900.
[10] a) E. E. Jacobsen, B. H. Hoff, T. Anthonsen,
Chirality. 2000, 12, 654-659; b) B. H. Hoff, L. Ljones, A.
8
This article is protected by copyright. All rights reserved.

10.1002/adsc.201701282
Advanced Synthesis & Catalysis
COMMUNICATION
Ester Synthesis in Water: Mycobacterium
smegmatis Acyl Transferase for Kinetic
Resolutions
Adv. Synth. Catal. Year, Volume, Page – Page
Nicolas de Leeuw, Guzman Torrelo, Carolin
Bisterfeld, Verena Resch, Luuk Mestrom,
Emanuele Straulino, Laura Koekkoek and Ulf
Hanefeld
9
This article is protected by copyright. All rights reserved.