Syntheses of RNAs with up to 100 nucleotides containing site-specific 2′-methylseleno labels for use in X-ray crystallography

Article abstract of DOI:10.1021/ja051694k

The derivatization of nucleic acids with selenium is a new and highly promising approach to facilitate their three-dimensional structure determination by X-ray crystallography. Here, we report a comprehensive study on the chemical and enzymatic syntheses

Full text of DOI:10.1021/ja051694k

Published on Web 07/29/2005
Syntheses of RNAs with up to 100 Nucleotides Containing
Site-Specific 2′-Methylseleno Labels for Use in
X-ray Crystallography
Claudia Ho¨bartner,† Renate Rieder,† Christoph Kreutz,† Barbara Puffer,†
Kathrin Lang,† Anna Polonskaia,‡ Alexander Serganov,‡ and Ronald Micura*,†
Contribution from the Institute of Organic Chemistry, Center for Molecular Biosciences (CMBI),
Leopold-Franzens UniVersity, 6020 Innsbruck, Austria, and Structural Biology Program,
Memorial Sloan-Kettering Cancer Center, New York, New York 10021
Received March 17, 2005; E-mail: ronald.micura@uibk.ac.at
Abstract: The derivatization of nucleic acids with selenium is a new and highly promising approach to
facilitate their three-dimensional structure determination by X-ray crystallography. Here, we report a
comprehensive study on the chemical and enzymatic syntheses of RNAs containing 2′-methylseleno (2′-
Se-methyl) nucleoside labels. Our approach includes the first synthesis of an appropriate purine nucleoside
phosphoramidite building block. Most importantly, a substantially changed RNA solid-phase synthesis cycle,
comprising treatment with threo-1,4-dimercapto-2,3-butanediol (DTT) after the oxidation step, is required
for a reliable strand elongation. This novel operation allows for the chemical syntheses of multiple Se-
labeled RNAs in sizes that can typically be achieved only for nonmodified RNAs. In combination with
enzymatic ligation, biologically important RNA targets become accessible for crystallography. Exemplarily,
this has been demonstrated for the Diels-Alder ribozyme and the add adenine riboswitch sequences. We
point out that the approach documented here has been the chemical basis for the very recent structure
determination of the Diels-Alder ribozyme which represents the first novel RNA fold that has been solved
via its Se-derivatives.
Introduction
the norm primarily by the simplicity of the in vivo seleno-
methionine incorporation into recombinant proteins.4,5 Sele-
The most powerful approach for the three-dimensional
structure determination of biomolecules is X-ray crystallography.
Thereby, the extraction of structural information from X-ray
diffraction patterns of a crystallized biomolecule is a complex
process which demands phase determination. Phase information
can be obtained by the classical multiple isomorphous replace-
ment method (MIR) which requires at least three isomorphous
crystals, one native and two heavy atom derivatives. Due to
difficulties in finding such derivatized isomorphous crystals, new
techniques taking advantage of anomalous scattering properties
of some atoms have been developed.1-3 These methods, termed
multiwavelength anomalous dispersion (MAD) and single-
wavelength anomalous diffraction (SAD), require only a single
crystal for collecting a data set that is sufficient to calculate the
phases and determine the three-dimensional structure. A pre-
requisite is that the crystal contains anomalous scattering centers
such as selenium atoms (Figure 1a).
nomethionine replaces the natural methionine, yielding protein
derivatives that are largely unperturbed with respect to the native
structure.
In nucleic acid crystallography, Se-labeling is just beginning
to emerge, and the high potential of selenium nucleic acid
derivatives for phasing has not been generally recognized. Three
years ago, pioneering work by Egli, Huang, and co-workers led
to the successful MAD phasing of a short Z-form DNA duplex
via phosphoroselenoate backbone modifications and of an
A-form DNA duplex via 2′-methylseleno (2′-Se-methyl) uridine
modifications.6,7 Soon thereafter, our laboratory has been able
to establish the first protocols for the preparation of short 2′-
Se-methyluridine and 2′-Se-methylcytidine modified oligoribo-
nucleotides.8
Extending this approach to larger, biologically attractive RNA
targets, we now report an advanced methodology that allows
for the preparation of high-purity RNAs with up to 100
nucleotides containing site-specifically incorporated, multiple
Se-labels for use in X-ray crystallography. The first successful
The majority of new protein crystal structures has been
determined via the selenomethionyl-modified derivatives.3 Se-
lenomethionine incorporation and MAD phasing have become
(4) Doublie´, S. Methods Enzymol. 1997, 276, 523-530.
(5) Strub, M. P.; Hoh, F.; Sanchez, J. F.; Strub, J. M.; Bock, A.; Aumelas, A.;
Dumas, C. Structure 2003, 11, 1359-1367.
† Leopold-Franzens University.
‡ Memorial Sloan-Kettering Cancer Center.
(1) Hendrickson, W. A.; Ogata, C. M. Methods Enzymol. 1997, 276, 494-
523.
(6) Du, Q.; Carrasco, N.; Teplova, M.; Wilds, C. J.; Egli, M.; Huang, Z. J.
Am. Chem. Soc. 2002, 124, 24-25.
(2) Podjarny, A.; Schneider, T. R.; Cachau, R. E.; Joachimiak A. Methods
Enzymol. 2003, 374, 321-341.
(3) Hendrickson, W. A. Trends Biochem. Sci. 2000, 25, 637-643.
(7) Wilds, C. J.; Pattanayek R.; Pan C.; Wawrzak Z.; Egli, M. J. Am. Chem.
Soc. 2002, 124, 14910-14916.
(8) Ho¨bartner, C.; Micura, R. J. Am. Chem. Soc. 2004, 126, 1141-1149.
9
10.1021/ja051694k CCC: $30.25 © 2005 American Chemical Society
J. AM. CHEM. SOC. 2005, 127, 12035-12045
12035

A R T I C L E S
Ho¨bartner et al.
quences larger than 25 to 30 nucleotides. The goal of our study
was to develop an alternative, namely a selenium modification
method, that permits overcoming this size limitation and allows
placing the anomalous scattering labels at both pyrimidine and
purine nucleosides.
Results
Ribose 2′-Se-Methyl Modification. Three categories for the
replacement of oxygen by selenium atoms are chemically
reasonable in the nucleotide repetition unit of RNA. These
concern phosphoroselenoates, selenonucleobases, and 2′-Se-
modified ribose derivatives (Figure 1b,c). With respect to steric
constraints, phosphoroselenoates and selenonucleobases are
comparable to their natural counterparts, but they suffer from
decreased stability toward hydrolysis and altered base-pairing
properties, respectively. Predominantly for these reasons, we
gave priority to the third category, namely to 2′-Se-methyl-
modified nucleosides with structural features that are closely
related to the naturally occurring 2′-O-methylated nucleosides.
Incorporated within an A-form nucleic acid duplex, they support
the C3′-endo type ribose puckering. The 2′-Se-methyl groups
are directed toward the minor groove, hardly perturbing the
overall duplex structure.22 Therefore, these modifications are
ideal for nucleotide replacements within the double helical
regions of large and complex RNA folds.
Figure 1. Se-modified RNA for X-ray crystallography using novel
techniques for phase determination, such as MAD, SAD, or SIRAS (single
isomorphous replacement with anomalous scattering). (a) In MAD data
collection, for instance, the differences in intensity necessary for phasing
are obtained from a single crystal containing anomalous scattering centers
by varying the wavelength of the X-ray beam, indicated by different arrow-
styles. The wavelengths chosen for diffraction measurements are marked
in the schematic diagram of anomalous scattering (imaginary component
f ′′) around the K-edge of selenium and are designated at the inflection
point (i), the peak (p), and a remote (r) wavelength of higher energy.2 (b)
Chemical structure of an RNA nucleoside repetition unit and the promoted
2′-Se-methyl-modified counterpart. (c) General structural formula of a 2′-
Se-methyl nucleoside phosphoramidite building block suitable for chemical
RNA solid-phase synthesis; protecting group (PG).
Phosphoramidite Building Blocks. To guarantee maximal
flexibility for positioning the Se-label within a double helical
region of RNA, not only the previously reported 2′-Se-
methylpyrimidine nucleosides8 but also the corresponding 2′-
Se-methylpurine counterparts are required. Here, we present the
first chemical synthesis of a 2′-Se-methyladenosine building
block for RNA solid-phase synthesis (Scheme 1). The precursor
1 was readily available as this nucleoside derivative accumulates
during the preparation of standard 2′-O-[(triisopropylsilyl)oxy]-
methyl (TOM) adenosine phosphoramidite building blocks.23
Triflation of the ribose 2′-OH furnished intermediate 2 which
was isolated and converted into the corresponding arabino
nucleoside 3 by treatment with potassium trifluoroacetate. After
triflation of the arabinose 2′-OH, compound 4 was reacted with
sodium methylselenide, yielding key compound 5, followed by
cleavage of the 3′-O-TOM protecting group to give derivative
6. By subsequent phosphitylation, the final building block 7
was obtained in good overall yield. This synthesis also provides
a solid foundation for the synthesis of the corresponding
guanosine building block that is currently in progress in our
laboratory.
applications of the Se-derivatized RNAs developed in the course
of this project have been documented recently and refer to the
X-ray structure of the group I intron with both exons9 and to
the recent structure determination of the Diels-Alder ribozyme
solved by the SAD-technique via the corresponding 2′-Se-
methylpyrimidine derivatives synthesized in our laboratory.10
Striking discoveries on the functional importance of small
RNAs and specialized RNA domains have been made in recent
years.11 The investigations of phenomena such as RNA interfer-
ence12 or riboswitches,13 are accompanied by a growing demand
for X-ray structure analysis of the RNA molecules involved. If
RNA is crystallized without proteins, the selenomethionine
approach is excluded a priori. In addition, small RNAs do not
always possess specific, noncovalent heavy metal ion binding
sites appropriate for cocrystallization or soaking of the crystals
in the relevant ion solutions.14 Moreover, derivatization of
pyrimidine nucleosides with 5-halogen atoms, being the com-
mon way to covalently attach anomalous scattering centers to
short oligonucleotides,15-21 is hardly reported for RNA se-
Chemical Synthesis and Deprotection of Se-Derivatized
RNA. The preparation of RNA with 2′-Se-methyl-modified
nucleosides relies on the 2′-O-TOM-methodology for strand
assembly.23,24 Importantly, the solid-phase synthesis cycle was
substantially changed from standard RNA synthesis. We inserted
(9) Adams, P. L.; Stahley, M. R.; Kosek, A. B.; Wang, J.; Strobel, S. A. Nature
2004, 430, 45-50.
(10) Serganov, A.; Keiper, S.; Malinina, L.; Tereshko, V.; Skripkin, E.;
Ho¨bartner, C.; Polonskaia, A.; Phan, A. T.; Wombacher, R.; Micura, R.;
Dauter, Z.; Ja¨schke, A.; Patel, D. J. Nat. Struct. Mol. Biol. 2005, 12, 218-
224.
(18) Zhang, L.; Doudna, J. A. Science 2002, 295, 2084-2088.
(19) Ennifar, E.; Carpentier, P.; Ferrer, J. L.; Walter, P.; Dumas, P. Acta
Crystallogr., Sect. D 2002, 58, 1262-1268.
(11) Couzin, J. Science 2002, 298, 2296-2297.
(12) Mello, C. C.; Conte, D., Jr. Nature 2004, 431, 338-342.
(13) Mandal, M.; Breaker, R. R. Nat. ReV. Mol. Cell Biol. 2004, 5, 451-463.
(14) Ennifar, E.; Walter, P.; Dumas, P. Acta Crystallogr. 2001, D57, 330-332.
(15) Shui, X.; Peek, M. E.; Lipscomb, L. A.; Gao, Q.; Ogata, C.; Roques, B.
P.; Garbay-Jaureguiberry, C.; Wilkinson, A. P.; Williams, L. D. Curr. Med.
Chem. 2000, 7, 59-71.
(20) Nowakowski, J.; Shim, P. J.; Stout, D.; Joyce, G. F. J. Mol. Biol. 2000,
300, 93-102.
(21) Correll, C. C.; Freeborn, B.; Moore, P. B.; Steitz, T. A. Cell 1997, 91,
705-712.
(22) Teplova, M.; Wilds, C. J.; Wawrzak Z.; Tereshko V.; Du Q.; Carrasco,
N.; Huang, Z.; Egli, M. Biochimie 2002, 84, 849-858.
(23) Pitsch, S.; Weiss, P. A.; Jenny, L.; Stutz, A.; Wu, X. HelV. Chim. Acta
2001, 84, 3773-3795.
(16) Deng, J.; Xiong, Y.; Sundaralingam, M. Proc. Natl. Acad. Sci. U.S.A. 2001,
98, 13665-13670.
(17) Wing, R.; Drew, H.; Takano, T.; Broka, C.; Tanaka, S.; Itakura, K.;
Dickerson, R. E. Nature 1980, 287, 755-758.
(24) Micura, R. Angew. Chem., Int. Ed. 2002, 41, 2265-2267.
9
12036 J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005

Selenium-Derivatized RNA for X-ray Crystallography
A R T I C L E S
Scheme 1. Synthesis of the 2′-Se-Methyladenosine
Phosphoramidite 7a
After the deprotection, DTT was removed by size exclusion
chromatography on a Sephadex G10 column. RNAs with up to
50 nucleotides were then directly purified by anion-exchange
chromatography under strong denaturating conditions (6 M urea,
80 °C). Larger RNAs were prepurified on a reversed-phase
column prior to ion-exchange chromatography. The molecular
weights of the purified RNAs have been confirmed by liquid
chromatography (LC) electrospray-ionization (ESI) mass spec-
trometry (MS); this analysis also revealed that the purified
products were not contaminated by N-1 strands.
Table 1 lists the chemically synthesized RNAs (8-18)
containing up to seven Se-labels. Sequence 8 is an ASe-derivative
of the 22 nt CSe RNA/DNA hybrid8 that was crystallized in a
ternary complex of the group I intron with both exons.9
Sequence 13 with four Se-pyrimidine nucleosides and a total
of 38 nucleotides was the basis for the very recent structure
determination of the Diels-Alder ribozyme.10 Sequences 9-12,
and 14-17 represent the Se-modified RNAs used for the
enzymatic ligations described below. Finally, sequence 18 with
four Se-labels and a total of 71 nucleotides demonstrates the
upper limit of our solid-phase synthesis approach with respect
to facile deprotection and purification.
a Reagents and conditions: (a) 1.5 equiv trifluoromethanesulfonyl
chloride, 1.5 equiv DMAP, 2.5 equiv NEt3, in CH2Cl2, room temperature,
20 min; (b) 8.3 equiv CF3COO-K+, 2.5 equiv (iPr)2NEt, 3.3 equiv 18-
crown-6-ether, in toluene, 80°C, 11 h (54% over (a) and (b)); (c) 6 equiv
NaBH4, 2 equiv CH3SeSeCH3, in THF, 30 min (47% over (a) and (c)); (d)
1 M TBAF, 0.5 M acetic acid, in THF, room temperature, 2.5 h, 84%; (e)
1.5 equiv (2-cyanoethyl)-N,N-diisopropylchlorophosphoramidite, 10 equiv
CH3CH2N(CH3)2, in CH2Cl2, room temperature, 2 h, 91%; (DMT dimethoxy-
trityl, DMAP 4-(dimethylamino)pyridine; TBAF tetrabutylammonium
fluoride).
Enzymatic Ligation of Se-Derivatized RNA. The develop-
ment of high-yield enzymatic ligations of Se-containing RNAs
has been a further aim of this project as this allows overcoming
size limitations of a purely chemical approach, and consequently,
the range of accessible, biologically important targets can be
increased significantly.
Exemplarily, we have focused on the aptamer domain of the
adenine deaminase (add) adenine-riboswitch26,27 from Vibrio
Vulnificus and aimed at the preparation of the relevant Se-
modified sequences based on single-stranded ligation via T4
RNA ligase and on splinted ligation via T4 DNA ligase,
respectively. We considered two potential ligation sites for the
71 nt RNA 24 as indicated by arrows in Figure 3a (see also
Table 2, Supporting Information Table 1 online; Supporting
Information Figures 1-6 online). These sites were chosen
because among donors (providing the 5′-phosphate terminus),
5′-terminal pyrimidines are preferred slightly over purines by
the T4 RNA ligase. Among acceptors, 3′-terminal adenosines
are the best acceptors, cytidines and guanosines show intermedi-
ate reactivity, and terminal uridines are poor substrates.28 The
two ligation sites chosen for the riboswitch motif27 meet these
requirements.
an additional step after the capping-oxidation-capping opera-
tion, namely the treatment with a chemical reducing reagent
(Figure 2). Such a step was lacking in our original protocols
for short RNA sequences.8 Here, we found that the repeated
exposure of the growing chain to DTT was an absolute
requirement for the reliable synthesis of longer RNAs containing
multiple Se-labels (Table 1). The treatment was reflected in
continuously high coupling yields (>98%) monitored via the
UV-trityl assay. We speculate that selenium moieties that
become oxidized during the phosphite-phosphate transforma-
tion by iodine (or tert-butylhydroperoxide) are regenerated in
the presence of DTT. Follow-up reactions, such as syn-
elimination of the seleniumoxide moiety by abstracting the
ribose 1′-hydrogen, subsequent nucleobase elimination, and
strand breakage are then minimized.25
For ligations using T4 RNA ligase, the donor strands
represented by either 31 nt or 48 nt RNAs were provided as
5′,3′-bisphosphates (9, 11, 12, 20: Figure 3b; 16, 17: Figure
3d) to avoid cyclization and oligomerization of the donor and
byproducts from repeated ligation of the donor with already
formed ligation products. The acceptor strands (40 nt and 23
nt, respectively) were either supplied with 5′,3′-hydroxyl termini
(14, 19: Figure 3b; 21: Figure 3d) or 5′-phosphate/3′-hydroxyl
termini (15: Figure 3b; 22: Figure 3d) obtained by chemical
Cleavage from the solid support and deprotection of the Se-
modified RNAs was also performed in the presence of DTT,
added in millimolar amounts to the deprotection solutions of
CH3NH2 in ethanol/H2O and of tetrabutylammonium fluoride
(TBAF) in tetrahydrofurane (THF). The influence of DTT during
the two-step deprotection of short Se-modified oligoribonucleo-
tides has been studied in detail and documented previously.8
Here, we stress the fact that the DTT treatment already during
strand elongation increases the quality of the crude seleno-RNA
products significantly (Figure 2). Note that this newly introduced
operation does not replace the DTT treatment during RNA
deprotection but has to be performed in a combined manner to
give optimal results.
(26) Mandal, M.; Breaker, R. R. Nat. Struct. Mol. Biol. 2004, 11, 29-35.
(27) Serganov, A.; Yuan, Y. R.; Pikovskaya, O.; Polonskaia, A.; Malinina, L.;
Phan, A. T.; Ho¨bartner, C.; Micura, R.; Breaker, R. R.; Patel, D. J. Chem.
Biol. 2004, 11, 1729-1741.
(28) Arn, E. A.; Abelson, J. In RNA Structure and Function; Simons, R. W.;
Grunberg-Manago, M., Eds.; CSHL Press: New York, 1998; pp 695-
726.
(25) Chen, T.; Greenberg, M. M. J. Am. Chem. Soc. 1998, 120, 3815-3816.
9
J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005 12037

A R T I C L E S
Ho¨bartner et al.
Figure 2. Chemical synthesis of Se-modified RNA. (a) Organization of the RNA solid-phase synthesis cycle with the newly introduced step of threo-1,4-
dimercapto-2,3-butanediol (DTT) treatment. (b-d) HPLC-traces of crude, deprotected 2′-Se-modified RNAs; deprotection procedures included three steps:
(1) 150 mM DTT in EtOH/H2O, 1-3 h, room temperature; (2) CH3NH2 in EtOH/H2O, 150 mM DTT, 4-6 h, room temperature; (3) 1 M TBAF in THF,
150 mM DTT, 12-16 h, room temperature. (b) Comparison of crude 9, prepared with (bottom) and without (top) the DTT solid-phase synthesis cycle step.
(c,d) Crude and purified (inset) 16 and 17, prepared with the DTT solid-phase synthesis cycle step. Anion-exchange HPLC: Dionex DNAPac (4 × 250
mm), 80°C, 1 mL/min, 0-60% B in 45 min; A: 25 mM Tris-HCl, 6 M urea, pH 8.0; B: same as A + 0.5 M NaClO4.
synthesis or with 5′-triphosphate/3′-hydroxyl termini (23; Figure
3d) obtained by in vitro transcription with T7 RNA poly-
merase.29
of the riboswitch target using T4 DNA ligase and the 2′-O-
methyl RNA splint 25.
Optimized ligation conditions (as applied for the ligation of
24c, Figure 4b) account for strand concentrations of 10 µM
(donor/acceptor/splint ) 1/1/1) and 0.25 U/µL T4 DNA ligase
in Tris buffer (pH 7.8) in the presence of PEG 4000, MgCl2,
DTT, and ATP, at 37°C. The yields using T4 DNA ligase
reached up to 70% (Table 2, Supporting Information Table 1
online, and Supporting Information Figures 2-6 online). Note
that only minor ligation yields were observed when we used
the corresponding 15 nt DNA or the chimeric splint 2′-O-Me-
(CUCUU)d(GGTA)2′-O-Me(GAAAC)dT.33,34
Optimized ligation conditions (as applied for the ligation of
24a and 24b, Figure 4a, Supporting Information Figure 1 online)
account for strand concentrations of 40 µM (donor/acceptor )
1/1) and 0.20 U/µL T4 RNA ligase in Tris buffer (pH 7.8) in
the presence of MgCl2, DTT, and ATP, at 21°C. In general, T4
RNA ligation yields were 50-70% for ligation site S2 (31 nt
+ 40 nt) and higher (70-80%) for ligation site S1 (48 nt + 23
nt) (Table 2, Supporting Information Table 1 online, and
Supporting Information Figures 1-6 online).
With respect to ligation site S2, we also elaborated splinted
ligations using T4 DNA ligase (Figure 3a,c).30,31 For this, the
applicability of 2′-O-methyl RNA splints instead of DNA splints
has been considered advantageous for proper annealing of the
ternary ligation complex.32 Competitive intramolecular base-
pairing interactions of the two ligation fragments are more easily
broken up with a 2′-O-methyl RNA oligonucleotide compared
with a DNA oligonucleotide of the same length. Figure 3c
displays the various combinations of RNA fragments for ligation
The general procedure for workup of the ligation reactions
included phenol-chloroform-isoamyl alcohol extraction and
analysis of the reaction mixture by anion-exchange (IE) HPLC
and PAGE. Subsequent purification of the desired ligation
products was performed by IE-HPLC under strong denaturating
conditions (6 M urea, 50-80°C). This chromatography typically
gave higher yields than PAGE purification. The molecular
weights of the ligation products were found virtually identical
to the predicted values by LC-ESI-MS (Table 2, Supporting
(29) Kao, C.; Rudisser, S.; Zheng, M. Methods 2001, 23, 201-205.
(30) Moore, M. J.; Query, C. C. Methods Enzymol. 2000, 317, 109-123.
(31) Ke, A.; Doudna, J. A. Methods 2004, 34, 408-414.
(33) Earnshaw, D. J.; Gait, M. J. Biopolymers 1998, 48, 39-55.
(34) Shibahara, S.; Mukai, S.; Nishihara, T.; Inoue, H.; Ohtsuka, E.; Morisawa,
H. Nucl. Acids Res. 1987, 15, 4403-4415.
(32) Stutz, A. Ph.D. Thesis ETH Nr. 15141, Zu¨rich, 2003.
9
12038 J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005

Selenium-Derivatized RNA for X-ray Crystallography
A R T I C L E S
Table 1. RNAs Containing 2′-Se-Methyl Nucleosides Prepared by Solid-Phase Synthesisa
isolated yield
OD
molecular weight
scale
calcd
amu
foundb
amu
no.
sequencea
Se nt
length nt
µmol
260 nm
nmol
8
5′-AAGCCACASeCAAACC(dA)
(dG)(dA)CGGCC-3′
5′-p-CCAAGAGCCUUAAACUSe
CUSeUGAUUAUSeGAAGUC-p-3′
5′-p-CCAAGAGCCUUAAACUSeCUSe
USeGAUUSeAUSeGAAGUSeC-p-3′
5′-p-CCASeAGASe
1
22
1
30
118
7057.4
10238.9
10469.8
10238.9
7056.3
10238.0
10468.8
10238.3
9
10
11
3
6
3
31
31
31
0.5
1
19
29
9
54
80
24
0.5
GCCUUAAACUCUUGAUUASe
UGAAGUC-p-3′
12
13
14
15
16
5′-p-CCSeAAGAGCCUUAAACSe
UCSeUUSeGAUUAUSeGAAGUSe
C-p-3′
6
4
3
4
6
31
38
40
40
48
0.5
1
14
20
7
41
49
16
42
62
10469.8
12569.4
12992.6
13149.5
15954.0
10468.6
12568.5
12991.0
13148.0
15953.3
5′-GGGCSeGAGGCSe
CGUGCCGGCUSeCUUSe
CGGAGCAAUACUCGGC-3′
5′-GGCUSeUCAUSe
AUAAUCCUAAUGAUAUGGUUSe
UGGGAGUUUCUA-3′
5′-p-GGCSeUUSeCAUAUAAUCCSe
UAAUGAUAUGGUUSe
UGGGAGUUUCUA-3′
0.5
1
19
33
5′-p-UGGUUSe
1
UGGGAGUUUCUACCAASe
GAGCCUUAAACUSeCUUSe
GAUUAUSeGASeAGUC-p-3′
5′-p-UGGUUSeUSe
GGGAGUUUCUACCASeAGASe
GCCUUAAACUCUSeUGAUUAUSe
GAASeGUC-p-3′
5′-p-GGCUSeUCASeUAUAAUCSe
CUAAUGAUAUGGUUSe
UGGGAGUUUCUACCAAGAGCCUUA
AACUCUUGAUUAUGAAGUC-p-3′
17
18
7
4
48
71
1
1
42
7
76
8
16031.1
23139.5
16030.8
23138.3
a ASe, 2′-Se-methyladenosine; CSe, 2′-Se-methylcytidine; USe, 2′-Se-methyluridine; dA, 2′-deoxy adenosine; dG, 2′-deoxy guanosine. b LC-ESI-MS.
Information Table 1 online, and Supporting Information Figures
1, 3, 4 online). Only when the acceptor strands were applied as
5′-monophosphates in T4 RNA ligation (15; Figure 3b), were
significant amounts of adenylated 24 (5′-App-71mer) obtained
as byproduct (Supporting Information Figure 4 online).
either 5′-triphosphate or 5′-hydroxyl moieties (24a, 24b; Figure
4a, Supporting Information Figure 1 online). If products with
5′-phosphate and 3′-phosphate termini are requested (such as
24c), ligations based on T4 DNA ligase with a splint are
preferable (Figure 4b) as demonstrated by the ligation of
acceptor 15 and donor 20 with either T4 RNA or T4 DNA ligase
(Figure 4 in Supporting Information online). We note here that
particular chemical groups at the 5′- and 3′-termini of an RNA
sequence may be critical for the crystallization behavior. One
such example refers to sequence 13 involved in the structure
determination of the Diels-Alder ribozyme.10 The ribozyme
crystals grew only when the RNA had 5′- and 3′-hydroxyl
groups (Figure 5), and not 5′-triphosphate and 2′,3′-cyclophos-
phate moieties.
Crystallization of Se-Derivatized RNA. To elucidate effects
of the Se-derivatization on RNA crystallization, we performed
systematic crystallization trials with the 49 nt Diels-Alder
ribozyme complexed with the reaction product. Since the
ribozyme consisted of two oligonucleotides (Figure 5a), we
synthesized the corresponding 11-mer with two Se-labels (29),8
and the 38-mer with three and four Se-labels (27, 13; Figure
5a). The reaction product was covalently attached to the 5′-end
of the 11-mer via a hexaethyleneglycol linker.10 Annealing of
various combinations of oligonucleotides resulted in the ri-
bozyme carrying up to six Se-atoms. All of these variants were
crystallized in the same conditions and produced crystals of
similar shape and size (Figure 5b) diffracting at about 3 Å
The wide range of ligation conditions tested for sequence 24
revealed the advantages and disadvantages of T4 RNA and DNA
ligation approaches. Although both methodologies are amenable
for large scales, T4 RNA ligations were preferred because of
higher overall yields, less enzyme required, and no need for an
external splint (Supporting Information Table 1 online, and
Supporting Information Figures 4-6 online). For general
applications, however, T4 RNA ligation encounters some
restrictions. Beside the intolerance of T4 RNA ligase against
ribose 2′-Se-methyl modifications within the last three nucle-
otides of the acceptor strand,8 different nucleobase specificities
of T4 RNA ligase for donor and acceptor strands are observed8,28
(Figure 3a; S1 slightly preferred over S2). Moreover, proper
annealing of the two strands to be ligated is required. In this
respect, ligation of target 24 at the site S1 is ideal because the
acceptor and donor strands are strongly bound to each other by
formation of helices P1 and P2, thereby positioning the 3′- and
5′-ends in close proximity for reaction (Figure 3a,d; Figure 4a).
Ligations with T4 RNA ligase are further confined if specific
5′- and 3′-termini are demanded in the ligation product. To avoid
byproducts, the acceptor strands must be provided as 5′,3′-
bisphosphates in combination with donor strands that do possess
9
J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005 12039

A R T I C L E S
Ho¨bartner et al.
Figure 3. Enzymatic ligation of Se-modified RNA. (a) add adenine riboswitch target sequence 24 and potential sites S1 and S2 for ligation with T4 RNA
ligase and T4 DNA ligase, respectively. Nucleotide numbering refers to ref 26. (b-d) Conception of the different ligation experiments: (b) T4 RNA ligations
of 31 nt donor (5′-phosphate) and 40 nt acceptor (3′-OH) strands (for 3-10 Se-labels); (c) T4 DNA ligations of 31 nt donor and 40 nt acceptor strands with
a 15 nt 2′-O-methyl RNA splint (for 3-10 Se-labels); (d) T4 RNA ligations of 48 nt donor and 23 nt acceptor strands (for 6-7 Se-labels).
Table 2. Selected Ligation Experiments of the Add Adenine Riboswitch Aptamer Domain with Multiple Se-Labels
isolated yield
molecular weight
ligation
product
acceptor, donor,
splint (ratio)
scaleb
nmol
ligation
conditionsc
yield
calcd
founde
amu
d
product sequencea
ligase
%
OD 260 nm
nmol
%
amu
24a
5′-ppp-GGCUU CAUAU
AAUCC UAAUG AUAUG
GUUSeUSeG GGAGU UUCUA
CCASeAG ASeGCCU UAAAC
UCUSeUG AUUAUSe GAASeGU
C-p-3′
23, 17
(1/1)
0.3
T4 RNA
40 µM;
0.2 U/µL;
1.0 mM
ATP; 21°C;
3 h
80
0.16
0.2
66
23530.4
23530.1
24b
24c
5′-GGCUU CAUAU AAUCC
UAAUG AUAUG GUUSeUG
GGAGU UUCUA CCAASeG
AGCCU UAAAC USeCUUSeG
AUUAUSe GASeAGU C-p-3′
5′-p-GGCSeUUSe CAUAU
AAUCCSe UAAUG AUAUG
GUUSeUG GGAGU UUCUA
CCAAG AGCCU UAAAC
USeCUSeUG AUUAUSe GAAGU
C-p-3′
21, 16
(1/1)
40
20
T4 RNA
T4 DNA
40 µM;
0.2 U/µL;
1.0 mM
ATP; 21°C;
2 h
10 µM;
0.25 U/µL;
0.5 mM
ATP; 37°C;
5 h
80
65
17.7
22.0
5.5
55
27
23213.4
23370.4
23212.9
23369.6
15, 9, 25
(1/1/1)
4.43
a ASe, 2′-Se-methyladenosine; CSe, 2′-Se-methylcytidine; USe, 2′-Se-methyluridine. b Amount of each strand. c Concentrations of each ligation fragment
and of T4 RNA/T4 DNA ligase in ligation buffer (50/40 mM Tris.HCl, pH 7.8, 10 mM MgCl2, 10 mM DTT); ATP concentration; reaction temperature;
reaction time; in case of T4 DNA ligase: 5% w/v PEG. d Yield calculated from peak areas of HPLC-traces (UV absorbance at 260 nm). e ESI-MS.
resolution (Figure 5c) and belonging to the same P21 space
group with similar cell unit parameters. Therefore, incorporation
of even multiple Se modifications does not affect crystallization
of RNA, does not change crystal quality, and requires, at most,
adjustment of RNA concentration for production of large single
crystals.
in heavy atom salt solutions is the established way to obtain
crystals with anomalous scattering centers, we consider the
modification with covalent 2′-Se-methyl groups most competi-
tive for structure analysis of RNAs comprising between 30 and
about 80 nucleotides. Heavy atom search is a time-consuming
process which requires soaking the RNA crystals with dozens
of compounds at various concentrations, therefore requesting
many reasonably good crystals. This can be a serious obstacle.
During the efforts of crystallizing the 49 nt Diels-Alder
ribozyme, neither suitable heavy atom derivatives nor 5-halogen-
pyrimidine derivatives could be identified. Finally, crystals of
the Se-modified RNAs developed here (Figure 5) were respon-
Discussion
The high potential and the usefulness of selenium with respect
to nucleic acid X-ray structure analysis have been recognized
at least by some research groups during recent years.6-10
Although heavy-metal ion derivatization by soaking the crystals
9
12040 J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005

Selenium-Derivatized RNA for X-ray Crystallography
A R T I C L E S
Figure 4. Representative enzymatic ligations of the add adenine riboswitch target sequence 24 with different 2′-Se-methyl nucleoside pattern. Analysis of
the ligation experiments was performed by anion-exchange HPLC, denaturating PAGE, and LC-ESI-MS. (a) Ligation of 24b with T4 RNA ligase (0.20
U/µL; cRNA ) 40 µM each strand; donor/acceptor ) 1/1) at 21°C. (b) Ligation of 24c with T4 DNA ligase (0.25 U/µL; cRNA ) 10 µM each strand;
donor/acceptor/splint ) 1/1/1) at 37 °C; (*slight degradation of the product at 37°C was accepted for higher reaction rates).
9
J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005 12041

A R T I C L E S
Ho¨bartner et al.
ment with 2′-Se-methyl groups cannot be ruled out a priori, but
it is drastically reduced by this selection concept.
Asking for the number of Se-atoms that are needed for
phasing of RNA diffraction data, one selenium should be
sufficient for 20-40 nucleotides, based on estimation from
phasing of Se-methionine protein derivatives. In the case of the
Diels-Alder ribozyme, rapid radiation-induced decay of the
crystals deteriorate quality of the inflection and remote data sets
and did not allow MAD phasing. Therefore, the structure was
solved by the SAD technique requiring a total of six selenium
atoms.10 More data on various Se-RNA targets will be needed
for a general statement on this particular issue.
For several reasons, the Se-approach presented here is
promising to gain a higher impact in nucleic acid crystallography
than derivatization with 5-halogen pyrimidines. Because of the
principal availability of all four 2′-Se-methyl nucleoside phos-
phoramidites a greater flexibility for adequate positioning within
an RNA target is attained. In addition, nucleobase stacking
interactions can be severely perturbed by 5-halogen-substituted
pyrimidines.22 Moreover, in contrast to 2′-Se-methyl nucleosides,
5-halogen pyrimidine derivatives are highly photoreactive
species,36-38 and inherent radiation damage of 5-halogen-
modified nucleic acids during MAD data collection has been
documented as a limitation.19
We believe that the recent success on the Diels-Alder
structure determination based on 2′-Se-methyl nucleoside modi-
fications not only demonstrates the power of this approach to
solve particularly tricky problems in RNA structural biology10
but may also initiate a more general interest and broader
application of Se-derivatization in the field of nucleic acid
crystallography.
Experimental Section
Figure 5. Crystallization of the Se-derivatized Diels-Alder ribozyme. (a)
Sequences and secondary structure of the ribozyme. (b) Photographs of
the typical crystals. Note that despite the different number of Se-
modifications all crystals have a similar shape. (c) Diffraction patterns of
the ribozyme crystals prepared either nonmodified or modified with six
Se-atoms RNAs. Rotation images (oscillation 0.5°) were collected using
in-house Rigaku X-ray generator (top) and beamline X25 at Brookhaven
National Synchrotron Light Source (NSLS) (bottom). Note similar quality
and resolution limits for both crystals.
Synthesis of 2′-Se-Methyladenosine Phosphoramidite (7). Gen-
1
eral. H, 13C, and 31P NMR spectra were recorded on a Bruker DRX
300 MHz, or Varian Unity 500 MHz instrument. The chemical shifts
are reported relative to TMS and referenced to the residual proton signal
of the deuterated solvents: CDCl3 (7.26 ppm), d6-DMSO (2.49 ppm)
1
for H NMR spectra; CDCl3 (77.0 ppm) or d6-DMSO (39.5 ppm) for
13C NMR spectra. 31P-shifts are relative to external 85% phosphoric
acid. 1H- and 13C-assignments were based on COSY and HSQC
experiments. UV-spectra were recorded on a Varian Cary 100 spec-
trophotometer. Analytical thin-layer chromatography (TLC) was carried
out on silica 60F-254 plates. Flash column chromatography was carried
out on silica gel 60 (230-400 mesh). Packing of silica gel columns
was performed with 1% Et3N added to the corresponding starting eluent.
All reactions were carried out under Ar atmosphere. Chemical reagents
and solvents were purchased from commercial suppliers and used
without further purification. Organic solvents for reactions were dried
overnight over freshly activated molecular sieves (4 Å).
sible for the structure determination.10 Interestingly, the Se-
modified ribozyme did not demand significant changes of the
crystallization conditions compared to the ones of the native
RNA. This implies that the 2′-Se-methyl moieties were ideally
“hidden” within the minor grooves of the double helical
segments. Thus far, we have experienced that positioning of
the labels is most successful when the co-variant, nonconserved
nucleosides within the double helices of an RNA fold are
replaced by the corresponding Se-modified counterparts. This
information on the secondary structure level is usually available
by biochemical mutation experiments or by phylogenetic
comparison of the RNA of interest. Such a strategy was
successful for the Diels-Alder ribozyme,10 and although we
came up too late with the Se-modified derivatives of riboswitch
RNAs, their recently determined structures27,35 validate the
positions we have chosen for Se-labeling as most promising
for proper crystallization, in retrospect. Clearly, the risk to
disrupt structurally important 2′-O-hydrogen bonds by replace-
N6-Acetyl-5′-O-(4,4′-dimethoxytrityl)-2′-O-trifluoromethanesulfo-
nyl-3′-O-{[(triisopropylsilyl)oxy]methyl}adenosine (2). A mixture of
123 (1.46 g; 1.82 mmol), DMAP (334 mg; 2.74 mmol), and triethylamine
(635 µL; 4.56 mmol) in 35 mL of dry dichloromethane was cooled to
0°C under argon atmosphere and treated with trifluoromethanesulfonyl
chloride (289 µL; 2.74 mmol). The solution was stirred for 20 min at
room temperature. The reaction mixture was diluted with dichlo-
romethane, extracted with saturated sodium bicarbonate solution, dried
over Na2SO4, and evaporated. The crude product was purified by
(36) Gott, J. M.; Wu, H.; Koch, T. H.; Uhlenbeck, O. C. Biochemistry 1991,
30, 6290-6295.
(37) Xu, Y.; Sugiyama, H. J. Am. Chem. Soc. 2004, 126, 6274-6279.
(38) Zeng, Y., Wang, Y. J. Am. Chem. Soc. 2004, 126, 6552-6553.
(35) Batey, R. T., Gilbert, S. D.; Montange, R. K. Nature 2004, 432, 411-415.
9
12042 J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005

Selenium-Derivatized RNA for X-ray Crystallography
A R T I C L E S
column chromatography on SiO2 (CH2Cl2/MeOH, 99.5/0.5 v/v).
Yield: 1.02 g of 2 as slightly yellow foam (60%). TLC (CH2Cl2/MeOH,
94/6): Rf ) 0.51; 1H NMR (300 MHz, CDCl3): δ 1.02 (m, 21H,
(iPr)3Si); 2.65 (s, 3H, COCH3); 3.40 (dd, J ) 3.9, 10.8 Hz, 1H, H1-
C(5′)); 3.62 (dd, J ) 2.7, 10.8 Hz, 1H, H2-C(5′)); 3.79 (s, 6H, 2×
OCH3); 4.51 (m, 1H, H-C(4′)); 4.89 (m, 1H, H-C(3′)); 4.96 (d, J )
5.0 Hz, 1H, OCH2O); 5.11 (d, J ) 5.0 Hz, 1H, OCH2O); 6.21 (m, 1H,
H-C(2′)); 6.36 (d, J ) 5.1 Hz, 1H, H-C(1′)); 6.80 (d, J ) 8.7 Hz,
4H, H-C(ar)); 7.28 (m, 7H, H-C(ar)); 7.40 (m, 2H, H-C(ar)); 8.10
135.53, (C(ar)); 141.07 (C(2)); 144.38, 149.20, 150.47 (C(ar)); 152.64
(C(8)); 158.66 (C(ar)); 170.24 (COCH3) ppm; UV/vis: λmax ) 270 nm;
ESI-MS (m/z): [M+H]+ calcd for C44H54F3N5O10SSi, 930.07; found
929.5.
N6-Acetyl-5′-O-(4,4′-dimethoxytrityl)-2′-deoxy-2′-methylseleno-
3′-O-{[(triisopropylsilyl)oxy]methyl}adenosine (5). Sodium borohy-
dride (64 mg; 1.70 mmol) was placed in a sealed 25 mL two necked
round-bottom flask, dried on high vacuum for 15 min to deplete oxygen,
kept under argon, and suspended in dry THF (2.3 mL). Dimethyl
diselenide (55 µL; 0.57 mmol) was slowly injected to this suspension,
followed by drop wise addition of anhydrous ethanol; 0.4 mL was
required until gas bubbles started to occur in the yellow mixture. The
solution was stirred at room temperature for 1 h, and the almost colorless
solution was injected into a solution of 4 (255 mg; 0.27 mmol) in dry
THF (2.7 mL). The reaction mixture was stirred at room temperature
for 20 min. Then, aqueous 0.2 M triethylammonium acetate buffer (5
mL, pH 7) was added, and the solution was reduced to half volume by
evaporation. Dichloromethane was added, and the organic layer was
washed twice with 0.2 M triethylammonium acetate buffer and finally
with saturated sodium chloride solution. The organic layer was dried
over Na2SO4, and the solvent was evaporated. The crude product was
purified by column chromatography on SiO2 (CH2Cl2/MeOH, 99.8/
0.2-99.0/1.0 v/v). Yield: 116 mg of 5 as colorless foam (49%). TLC
(s, 1H, H-C(8)); 8.57 (s, 1H, H-C(2)); 8.68 (s, 1H, H-N6) ppm; 13
C
NMR (75 MHz, CDCl3): δ 11.80 (SiCH(CH3)2); 17.71 (SiCH(CH3)2);
25.62 (COCH3); 55.14 (2× OCH3); 62.56 (C(5′)); 74.40 (C(3′)); 83.33
(C(4′)); 84.21 (C(2′)); 85.61 (C(1′)); 86.94; 89.91 (OCH2O); 113.17,
121.97, 127.00, 127.84, 128.10, 130.03, 130.05, 135.22, 135.31, (C(ar));
141.37 (C(2)); 144.16, 149.37, 150.83 (C(ar)); 152.65 (C(8)); 158.66
(C(ar)); 170.29 (COCH3) ppm; ESI-MS (m/z): [M+H]+ calcd for
C44H54F3N5O10SSi, 930.07; found 929.5.
N6-Acetyl-5′-O-(4,4′-dimethoxytrityl)-3′-O-{[(triisopropylsilyl)-
oxy]methyl}(â-D-arabinofuranosyl)adenine (3). To a mixture of 2
(1.02 g; 1.10 mmol) dissolved in 50 mL of toluene were added
ethyldiisopropylamine (470 µL; 2.74 mmol), potassium trifluoroacetate
(1.39 g; 9.12 mmol), and 18-crown-6-ether (965 mg; 3.65 mmol). The
reaction mixture was stirred at 80°C for 11 h. After evaporation, the
residue was dissolved in dichloromethane, extracted with half-saturated
sodium bicarbonate solution, dried over Na2SO4, and again evaporated.
The crude product was purified by column chromatography on SiO2
(CH2Cl2/MeOH, 99.8/0.2-99/1 v/v). Yield: 785 mg of 3 as slightly
yellow foam (89%). TLC (CH2Cl2/MeOH, 92/8): Rf ) 0.50; 1H NMR
(300 MHz, CDCl3): δ 1.09 (m, 21H, (iPr)3Si); 2.63 (s, 3H, COCH3);
3.42 (dd, J ) 3.5, 10.7 Hz, 1H, H1-C(5′)); 3.66 (dd, J ) 2.6, 10.7
Hz, 1H, H2-C(5′)); 3.80 (s, 6H, 2× OCH3); 4.25 (m, 1H, H-C(4′));
4.41 (m, 2H, H-C(3′), HO-C(2′)); 4.48 (m, 1H, H-C(2′)); 4.96 (d,
J ) 5.3 Hz, 1H, OCH2O); 5.05 (d, J ) 5.3 Hz, 1H, OCH2O); 6.42 (d,
J ) 3.9 Hz, 1H, H-C(1′)); 6.84 (d, J ) 8.4 Hz, 4H, H-C(ar)); 7.27
(m, 7H, H-C(ar)); 7.42 (d, J ) 6.9 Hz, 2H, H-C(ar)); 8.43 (s, 1H,
H-C(8)); 8.66 (s, 1H, H-C(2)); 8.71 (s, 1H, H-N6) ppm; 13C NMR
(75 MHz, CDCl3): δ 11.86 (SiCH(CH3)2); 17.74 (SiCH(CH3)2); 25.53
(COCH3); 55.18 (2× OCH3); 63.16 (C(5′)); 74.78 (C(2′)); 81.95 (C(4′));
82.85 (C(3′)); 84.86 (C(1′)); 87.62; 89.58 (OCH2O); 113.28, 121.38,
127.14, 127.96, 128.21, 130.07, 130.12, 135.01, 135.16 (C(ar)); 142.66
(C(2)); 143.81, 148.98, 151.20 (C(ar)); 152.17 (C(8)); 158.73 (C(ar));
170.34 (COCH3) ppm; UV/vis: λmax ) 271 nm; ESI-MS (m/z):
[M+H]+ calcd for C43H55N5O8Si, 798.01; found 797.5.
N6-Acetyl-5′-O-(4,4′-dimethoxytrityl)-2′-O-trifluoromethane-
sulfonyl-3′-O-{[(triisopropylsilyl)oxy]methyl}(â-D-arabinofuranos-
yl)adenine (4). A mixture of 3 (226 mg; 0.28 mmol), DMAP (52 mg;
0.43 mmol), and triethylamine (98 µL; 0.71 mmol) in 6 mL of dry
dichloromethane was cooled to 0°C under argon atmosphere and treated
with trifluoromethanesulfonyl chloride (45 µL; 0.43 mmol). The
solution was stirred for 20 min at room temperature. The reaction
mixture was diluted with dichloromethane, extracted with saturated
sodium bicarbonate solution, dried over Na2SO4, and evaporated. The
product can be used without further purification for the next step.
Yield: 255 mg of 4 as slightly yellow foam (98%). For analysis, the
product was purified by column chromatography on SiO2 (CH2Cl2/
MeOH, 99.9/0.1-99.4/0.6 v/v). TLC (CH2Cl2/MeOH, 94/6): Rf ) 0.51;
1H NMR (300 MHz, CDCl3): δ 1.07 (m, 21H, (iPr)3Si); 2.65 (s, 3H,
COCH3); 3.52 (m, 2H, H2-C(5′)); 3.81 (s, 6H, 2× OCH3); 4.34 (m,
1H, H-C(4′)); 4.72 (m, 1H, H-C(3′)); 5.04 (s, 2H, OCH2O); 5.53
(m, 1H, H-C(2′)); 6.60 (d, J ) 3.3 Hz, 1H, H-C(1′)); 6.85 (d, J )
8.7 Hz, 4H, H-C(ar)); 7.29 (m, 7H, H-C(ar)); 7.48 (d, J ) 7.2 Hz,
2H, H-C(ar)); 8.10 (s, 1H, H-C(8)); 8.62 (s, 1H, H-N6); 8.67 (s,
1H, H-C(2)) ppm; 13C NMR (75 MHz, CDCl3): δ 11.79 (SiCH(CH3)2);
17.67 (SiCH(CH3)2); 25.62 (COCH3); 55.16 (2× OCH3); 62.67 (C(5′));
80.47 (C(4′)); 82.89 (C(3′)); 83.20 (C(1′)); 86.29 (C(2′)); 86.62; 89.47
(OCH2O); 113.23, 121.22, 126.94, 127.88, 128.01, 129.96, 135.49,
1
(CH2Cl2/MeOH, 94/6): Rf ) 0.45; H NMR (300 MHz, CDCl3): δ
1.08 (m, 21H, (iPr)3Si); 1.69 (s, 3H, SeCH3); 2.64 (s, 3H, COCH3);
3.44 (dd, J ) 4.4, 10.4 Hz, 1H, H1-C(5′)); 3.50 (dd, J ) 4.2, 10.4
Hz, 1H, H2-C(5′)); 3.80 (s, 6H, 2x OCH3); 4.38 (m, 1H, H-C(2′));
4.51 (m, 1H, H-C(4′)); 4.56 (m, 1H, H-C(3′)); 5.01 (d, J ) 5.1 Hz,
1H, OCH2O); 5.09 (d, J ) 5.1 Hz, 1H, OCH2O); 6.36 (d, J ) 8.4 Hz,
1H, H-C(1′)); 6.81 (d, J ) 8.4 Hz, 4H, H-C(ar)); 7.28 (m, 7H,
H-C(ar)); 7.46 (d, J ) 6.6 Hz, 2H, H-C(ar)); 8.11 (s, 1H, H-C(8));
8.56 (s, 1H, H-C(2)); 8.62 (s, 1H, H-N6) ppm; 13C NMR (75 MHz,
CDCl3): δ 3.53 (SeCH3); 11.88 (SiCH(CH3)2); 17.81 (SiCH(CH3)2);
25.58 (COCH3); 44.96 (C(2′)); 55.15 (2× OCH3); 63.58 (C(5′)); 79.77
(C(3′)); 84.48 (C(4′)); 86.61; 89.79 (OCH2O); 91.06 (C(1′)); 113.11,
122.24, 126.89, 127.77, 128.19, 130.07, 130.10, 135.66, 135.70 (C(ar));
142.03 (C(2)); 144.59, 149.23, 151.31 (C(ar)); 152.29 (C(8)); 158.59
(C(ar)); 170.32 (COCH3) ppm; UV/vis: λmax ) 276 nm; ESI-MS (m/
z): [M+H]+ calcd for C44H57N5O7SeSi, 875.00; found 875.5.
N6-Acetyl-5′-O-(4,4′-dimethoxytrityl)-2′-deoxy-2′-methylselenoad-
enosine (6). Compound 5 (340 mg; 0.39 mmol) was treated with 1.7
mL of 1 M TBAF/0.5 M AcOH in THF. The solution was stirred at
room temperature for 2.5 h. The solvent was evaporated, and the product
was isolated by column chromatography on SiO2 (CH2Cl2/MeOH, 99.5/
0.5-98.0/2.0 v/v). Yield: 224 mg of 6 as colorless foam (84%). TLC
1
(CH2Cl2/MeOH, 92/8): Rf ) 0.49; H NMR (300 MHz, CDCl3): δ
1.95 (s, 3H, SeCH3); 2.63 (s, 3H, COCH3); 2.90 (s, br, 1H, HO-C(3′));
3.45 (dd, J ) 4.2, 10.5 Hz, 1H, H1-C(5′)); 3.53 (dd, J ) 4.4, 10.5
Hz, 1H, H2-C(5′)); 3.80 (s, 6H, 2× OCH3); 4.34 (m, 1H, H-C(4′));
4.41 (m, 1H, H-C(2′)); 4.50 (m, 1H, H-C(3′)); 6.22 (d, J ) 8.7 Hz,
1H, H-C(1′)); 6.82 (d, J ) 8.7 Hz, 4H, H-C(ar)); 7.28 (m, 7H,
H-C(ar)); 7.45 (d, J ) 1.5 Hz, 2H, H-C(ar)); 8.12 (s, 1H, H-C(8));
8.58 (s, 1H, H-C(2)); 8.79 (s, 1H, H-N6) ppm; 13C NMR (75 MHz,
CDCl3): δ 4.53 (SeCH3); 25.60 (COCH3); 48.80 (C(2′)); 55.20 (2×
OCH3); 63.63 (C(5′)); 72.59 (C(3′)); 85.06 (C(4′)); 86.71; 88.78 (C(1′));
113.17, 122.19, 126.97, 127.84, 128.14, 130.04, 135.66 (C(ar)); 141.93
(C(2)); 144.47, 149.22, 151.27 (C(ar)); 152.32 (C(8)); 158.62 (C(ar));
170.38 (COCH3) ppm; UV/vis: λmax ) 271 nm; FT-ICR-ESI-MS (m/
z): [M+H]+ calcd for C34H35N5O6Se, 690.18341; found 690.18238.
N6-Acetyl-5′-O-(4,4′-dimethoxytrityl)-2′-deoxy-2′-methylselenoad-
enosine 3′-(2-Cyanoethyl)-N,N-diisopropylphosphoramidite (7). Com-
pound 6 (150 mg; 0.22 mmol) was dissolved in a mixture of
ethyldimethylamine (242 µL, 2.24 mmol) in dry dichloromethane (7
mL) under argon. After 15 min at room temperature, (2-cyanoethyl)-
N,N-diisopropylchlorophosphoramidite (80 mg; 0.33 mmol) was slowly
added, and the solution was stirred at room temperature for 2 h. The
9
J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005 12043

A R T I C L E S
Ho¨bartner et al.
reaction was quenched by the addition of methanol (0.1 mL). The
reaction mixture was diluted with dichloromethane, extracted with
saturated sodium bicarbonate solution, and dried over Na2SO4, and the
solvent was evaporated. The crude product was purified by column
chromatography on SiO2 (ethyl acetate/hexanes, 1/1-7/3 v/v (+1%
NEt3)). Yield: 178 mg of 7 (mixture of diastereoisomers) as colorless
Analysis of crude RNA products after deprotection was performed
by anion-exchange chromatography on a Dionex DNAPac100 column
(4 mm × 250 mm) at 80°C. Flow rate: 1 mL/min; eluant A: 25 mM
Tris-HCl (pH 8.0), 6 M urea; eluant B: 25 mM Tris-HCl (pH 8.0), 0.5
M NaClO4, 6 M urea; gradient: 0-60% B in A within 45 min; UV-
detection at 265 nm. Crude RNA products (trityl-off) were purified on
a semipreparative Dionex DNAPac100 column (9 mm × 250 mm).
Flow rate: 2 mL/min; gradient: ∆5-10% B in A within 20 min.
Fractions containing RNA were loaded on a C18 SepPak cartridge
(Waters/Millipore), washed with 0.1-0.2 M (Et3NH)HCO3, H2O, and
eluted with H2O/CH3CN (6/4). RNA containing fractions were lyoph-
ilized.
1
foam (91%). TLC (CH2Cl2/MeOH, 94/6): Rf ) 0.44; H NMR (500
MHz, CDCl3): δ 1.09-1.29 (m, 24H, 2× ((CH3)2CH)2N); 1.61 (s, 3H,
SeCH3); 1.69 (s, 3H, SeCH3); 2.34 (m, 2H, CH2CN); 2.66 (m, 8H,
COCH3, CH2CN); 3.38 (m, 2H, H1-C(5′)); 3.47-3.75 (m, 4H, ((CH3)2-
CH)2N, 2H, H2-C(5′), 2H, POCH2); 3.78, 3.79 (2s, 12H, OCH3);
3.90-3.99, 4.09-4.22 (2m, 2H, POCH2); 4.41 (m, 4H, H-C(2′),
H-C(4′)); 4.67, 4.73 (2m, 2H, H-C(3′)); 6.31 (m, 2H, H-C(1′)); 6.80,
7.22-7.45 (m, 26H, trityl-H); 8.11 (s, 1H, H-C(8)); 8.15 (s, 1H,
H-C(8)); 8.49 (s, br, 2H, H-N6); 8.54, 8.55 (2s, 2H, H-C(2)) ppm;
31P NMR (121 MHz, CDCl3): δ 150.8, 152.4; UV/vis (MeOH): λmax
) 271 nm; FT-ICR-ESI-MS (m/z): [M+H]+ calcd for C43H52N7O7-
PSe, 890.29147; found 890.29005.
RNAs synthesized trityl-on were purified by RP-HPLC prior to
anion-exchange chromatography on an Amersham Resource-RPC
column (6.4 mm × 30 mm) at 35°C. Flow rate: 1.5 mL/min; eluant
A: 100 mM TEA in H2O, pH 7.5, eluant B: 20 mM TEA in
acetonitrile/H2O 4/1; gradient: 25-35% B in A within 15 min.
Enzymatic Ligations. T4 RNA Ligase. Aliquots from aqueous stock
solutions of the oligonucleotides to be ligated were mixed in equimolar
amount, diluted with water to a concentration of 50-80 µM, heated to
90°C for 3 min, and allowed to cool to room temperature within 15
min. Ligation buffer (500 mM Tris-HCl, 100 mM MgCl2, 100 mM
DTT, 10 mM ATP, pH 7.8 (at 25°C); 1/10 of reaction volume) was
added, and the volume was adjusted by the addition of water to give
a final RNA concentration of 40 µM for each oligonucleotide fragment
and a final ligation buffer concentration of 50 mM Tris-HCl, 10 mM
MgCl2, 10 mM DTT, 1 mM ATP, pH 7.8 (at 25°C). Then T4 RNA
ligase (New England Biolabs, 20000 U/mL in 50 mM KCl, 10 mM
Tris-HCl, 0.1 mM EDTA, 1 mM DTT, 50% glycerol; storage solution
diluted with 1× ligation buffer) was added to give a final T4 RNA
ligase concentration of 0.2 U/µL. The reaction solution was incubated
at 21°C for 2 h.
Solid-Phase Synthesis of 2′-Se-Methyl Nucleoside Containing
RNAs. 2′-O-TOM standard nucleoside phosphoramidites and the
corresponding CPG-supports (1000 Å) were obtained from GlenRe-
search. The phosphoramidite reagent used for 5′-phosphate labeling
was prepared according to the literature.39 Oligonucleotides with 3′-
phosphates were synthesized on Amersham Custom Primer Support
3′-phosphate (Primer Support 200 at 100 µmol/g; No. 17-5214-49) or
on an oximate-derivatized CPG solid support (1000 Å) according to
the literature.40
All oligoribonucleotides containing 2′-Se-methyl nucleosides were
synthesized on Pharmacia instrumentation (Gene Assembler Plus or
Special) following modified DNA/RNA standard methods containing
an additional cycle step of treatment with DTT; detritylation (2.0
min): dichloroacetic acid/1,2-dichloroethane (4/96); coupling (3.0
min): phosphoramidites/acetonitrile (0.1 M × 120 µL) were activated
by benzylthiotetrazole/acetonitrile (0.35 M × 360 µL); capping (3 ×
0.4 min): A: Ac2O/sym-collidine/acetonitrile (20/30/50), B: 4-(dimeth-
ylamino)pyridine/acetonitrile (0.5 M), A/B ) 1/1; oxidation (1.0
min): I2 (10 mM) in acetonitrile/sym-collidine/H2O (10/1/5); DTT
treatment (2.0 min): DTT (100 mM) in ethanol/H2O (2/3). A ready-
to-use synthesis method file is documented in the Supporting Informa-
tion online.
T4 DNA Ligase. Aliquots from aqueous stock solutions of the
oligonucleotides to be ligated and the 2′-O-methyl RNA template
oligonucleotide were mixed in equimolar amount, diluted with water
to a concentration of 20-40 µM, heated to 90°C for 3 min, and allowed
to cool to room temperature within 15 min. Ligation buffer (400 mM
Tris-HCl, 100 mM MgCl2, 100 mM DTT, 5 mM ATP, pH 7.8 (at 25°C);
1/10 of reaction volume) and PEG 4000 (50% w/v; 1/10 of reaction
volume) were added, and the volume was adjusted by the addition of
water to give a final RNA concentration of 10 µM for each oligo-
nucleotide fragment and a final ligation buffer concentration of 40 mM
Tris-HCl, 10 mM MgCl2, 10 mM DTT, 0.5 mM ATP, pH 7.8 (at 25°C).
Then T4 DNA ligase (Fermentas, 1 U/µL in 50 mM KCl, 20 mM Tris-
HCl, 0.1 mM EDTA, 1 mM DTT, 50% glycerol) was added to give a
final T4 RNA ligase concentration of 0.25 U/µL. The reaction solution
was incubated at 37°C for 3-5 h.
Workup and isolation of ligation products: The reaction solutions
were heated to 90°C for 3 min, extracted twice with an equal amount
of phenol (water saturated)/chloroform/isoamyl alcohol (25/24/1) and
once with chloroform/isoamyl alcohol (24/1). Ligation products were
isolated by anion-exchange HPLC (Dionex DNAPac column, 4 × 250
mm; conditions as above). For analytical purposes, aliquots of the
reaction solutions (3.5 µL in case of T4 RNA ligation; 10 µL in case
of T4 DNA ligation) were diluted with 150 µL of water and treated as
above. Analysis was performed by anion-exchange HPLC (conditions
as above) and denaturating polyacrylamide gel electrophoresis (12%
polyacrylamide, 7 M urea, 200 V, 50 min). Gels were developed by
silver staining.41
Solutions of standard amidites, tetrazole solutions, and acetonitrile
were dried over activated molecular sieves overnight. Importantly,
solutions of 2′-Se-methyl nucleoside phosphoramidites were only dried
for 4-6 h over activated molecular sieves before consumption.
Deprotection and Purification of 2′-Se-Methyl Nucleoside Con-
taining RNAs. Prior to deprotection and cleavage from the solid support
the Se-containing RNAs were treated with DTT in ethanol/H2O 1/1
(150 mM, 200 µL) for 1-3 h at room temperature. Then, MeNH2 in
EtOH (8 M, 0.60 mL), MeNH2 in H2O (40%, 0.60 mL), and DTT in
EtOH/H2O 1/1 (2 M, 95 µL; final DTT concentration 150 mM) were
added, and deprotection was continued for 5-6 h. After the solution
was evaporated to dryness, the 2′-O-silyl ethers were removed by
treatment with tetrabutylammonium fluoride trihydrate (TBAF‚3H2O)
in THF (1 M, 0.95 mL) for at least 12 h at room temperature. The
reaction was quenched by the addition of triethylammonium acetate
(TEAA) (1 M, pH 7.4, 0.95 mL). The volume of the solution was
reduced to 1 mL, and the solution was loaded on a Sephadex G10
column (30 cm × 1.5 cm). The crude RNA was eluted with H2O and
evaporated to dryness. In contrast, deprotection solutions of RNA
synthesized trityl-on were quenched by the addition of triethylammo-
nium bicarbonate (1 M, pH 8.5, 0.95 mL), and the RNA products were
eluted with 25 mM (Et3NH)HCO3 (pH 8.5).
Mass Spectrometry of 2′-Se-Methyl Nucleoside Containing
RNAs. All experiments were performed on a Finnigan LCQ Advantage
MAX ion trap instrumentation connected to an Amersham Ettan micro
(39) Horn, T.; Urdea, M. S. Tetrahedron Lett. 1986, 27, 4705-4708.
(40) Langenegger, S. M.; Moesch, L.; Natt, F.; Hall, J.; Ha¨ner, R. HelV. Chim.
Acta 2003, 86, 3476-3481.
(41) Westermeier, R. Electrophoresis in Practice, 3rd ed.; Wiley-VCH: Wein-
heim, 2001; p 272.
9
12044 J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005

Selenium-Derivatized RNA for X-ray Crystallography
A R T I C L E S
LC system. RNAs were analyzed in the negative-ion mode with a
potential of -4 kV applied to the spray needle. LC: Sample (250 pmol
RNA dissolved in 20 µL of 20 mM EDTA solution; average injection
volume: 10-20 µL); column (Amersham µRPC C2/C18; 2.1 × 100
mm) at 21°C; flow rate: 100 µL/min; eluant A: 8.6 mM triethylamine,
100 mM 1,1,1,3,3,3-hexafluoro-2-propanol in H2O (pH 8.0); eluant B:
methanol; gradient: 0-100% B in A within 30 min; UV-detection at
254 nm.
RNA Crystallization. The Diels-Alder ribozyme was prepared by
annealing of 11-mer and 38-mer RNAs (0.2 mM). The oligonucleotide
mixture was heated in 5 mM Tris-HCl (pH 8.0), 30 mM NaCl, 5 mM
MgCl2 at 95 °C for 2 min and then cooled on ice. The RNA sample
was combined with the same volume of the reservoir solution, and
crystals were grown by the hanging-drop vapor diffusion method.
Reservoir solution was: 30% (v/v) PEG400, 10% (v/v) 2-methyl-2,4-
pentadiol, 70 mM Na-HEPES (pH 7.5), 200 mM MgCl2, 200 mM NaCl,
50 mM RbCl. Crystals grew to a maximal size in approximately 20
days at +4 °C. X-ray data were collected at beamline X25 at NSLS or
using in-house Rigaku X-ray generator from single crystals cooled at
100 K.
Acknowledgment. This paper is dedicated to Prof. Albert
Eschenmoser on the occasion of his 80th birthday. We thank
Dinshaw Patel (MSKCC, NY) for generous support, Andres
Ja¨schke and Sonja Keiper for Diels-Alder ribozyme transfor-
mation of the Se-labeled 11-mer. We gratefully acknowledge
the Austrian Science Fund FWF (P15042 and P17864) and the
Tiroler Wissenschaftsfonds (GZ UNI-404/39) for funding.
Holger Moroder (University of Innsbruck) is thanked for
synthetic contributions, Kathrin Breuker (Cornell University and
University of Innsbruck) for FT-ICR mass spectra. R.M. thanks
Prof. Stefan Pitsch (ETH Lausanne) for the information on using
T4 DNA ligase in combination with 2′-O-methyl RNA splints.32
Supporting Information Available: MS and NMR spectra
of compound 7, HPLC traces and PAGE of selected ligation
experiments. This material is available free of charge via the
Internet at http://pubs.acs.org.
JA051694K
9
J. AM. CHEM. SOC. VOL. 127, NO. 34, 2005 12045