Integrated Target-Based and Phenotypic Screening Approaches for the Identification of Anti-Tubercular Agents That Bind to the Mycobacterial Adenylating Enzyme MbtA

Article abstract of DOI:10.1002/cmdc.201900217

Iron is essential for the pathogenicity and virulence of Mycobacterium tuberculosis, which synthesises salicyl-capped siderophores (mycobactins) to acquire this element from the host. MbtA is the adenylating enzyme that catalyses the initial reaction of mycobactin biosynthesis and is solely expressed by mycobacteria. A 3200-member library comprised of lead-like, structurally diverse compounds was screened against M. tuberculosis for whole-cell inhibitory activity. A set of 846 compounds that inhibited the tubercle bacilli growth were then tested for their ability to bind to MbtA using a fluorescence-based thermal shift assay and NMR-based Water-LOGSY and saturation transfer difference (STD) experiments. We identified an attractive hit molecule, 5-hydroxyindol-3-ethylamino-(2-nitro-4-trifluoromethyl)benzene (5), that bound with high affinity to MbtA and produced a MIC₉₀ value of 13 μm. The ligand was docked into the MbtA crystal structure and displayed an excellent fit within the MbtA active pocket, adopting a binding mode different from that of the established MbtA inhibitor Sal-AMS.

Full text of DOI:10.1002/cmdc.201900217

Accepted Article
Title: Integrated target-based and phenotypic screening approaches
for the identification of anti-tubercular agents that bind to the
mycobacterial adenylating enzyme MbtA
Authors: Lindsay Ferguson, Geoff Wells, Sanjib Bhakta, James
Johnson, Junitta Guzman, Tanya Parish, Robin A. Prentice,
and Federico Brucoli
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: ChemMedChem 10.1002/cmdc.201900217
Link to VoR: http://dx.doi.org/10.1002/cmdc.201900217
A Journal of
www.chemmedchem.org

10.1002/cmdc.201900217
ChemMedChem
FULL PAPER
Integrated target-based and phenotypic screening approaches for
the identification of anti-tubercular agents that bind to the
mycobacterial adenylating enzyme MbtA
Lindsay Ferguson,[a] Dr Geoff Wells,[b] Prof. Sanjib Bhakta,[c] James Johnson,[d] Junitta Guzman,[d] Prof
Tanya Parish,[d] Dr Robin A. Prentice[e,f] and Dr Federico Brucoli[g]*
[a]
[b]
[c]
[d]
[e]
[f]
School of Science, University of the West of Scotland, Paisley, PA1 2BE, Scotland, UK
UCL School of Pharmacy, University College London, 29/39 Brunswick Square, London, WC1N 1AX, UK
Department of Biological Sciences, Institute of Structural and Molecular Biology, Birkbeck, University of London, London, WC1E 7HX, UK
TB Discovery Research, Infectious Disease Research Institute, 1616 Eastlake Avenue East, Seattle, WA 98102, USA
Seattle Structural Genomics Center for Infectious Disease, Seattle WA, USA
Center for Global Infectious Disease Research, Seattle Children’s Research Institute, 307 Westlake Avenue North, Suite 500, Seattle, USA
Leicester School of Pharmacy, De Montfort University, Leicester, LE1 9BH, UK
[g]
*Corresponding author: Dr F. Brucoli. E-mail:Federico.brucoli@dmu.ac.uk; orcid.org/ 0000-0001-8661-2910
Abstract: Iron is essential for the pathogenicity and virulence of
Mycobacterium tuberculosis, which synthesises salicyl-capped
siderophores (mycobactins) to acquire this element from the host.
MbtA is the adenylating enzyme that catalyses the initial reaction of
mycobactins’ biosynthesis and is solely expressed by mycobacteria.
A 3,200-member library comprised of lead-like, structurally-diverse
compounds was screened against M. tuberculosis for whole-cell
inhibitory activity. A set of 846 compounds that inhibited the tubercle
bacilli growth were then tested for their ability to bind to MbtA using a
fluorescence-based thermal shift assay and NMR-based Water-
LOGSY and Saturation Transfer Difference (STD) experiments. We
identified an attractive hit-molecule, 5-hydroxy-indol-3-ethylamino-(2-
nitro-4-trifluoromethyl)benzene (5), that bound with high affinity to
MbtA and produced a MIC90 of 13 µM. The ligand was docked into the
MbtA crystal structure and displayed an excellent fit within the MbtA
active pocket, adopting a different binding mode to the established
MbtA inhibitor Sal-AMS.
acid sidechain is more polar, is released into the extracellular
medium by the pathogen to chelate the precious iron
element.[7],[7b] The mycobactins core structures are comprised of
a 2-hydroxyphenyloxazolidine moiety linked to an acylated ε-N-
hydroxylysine residue esterified at the α-carboxyl with a 3-
hydroxybutyric acid. The latter forms an amide bond with a
second ε-N-hydroxylysine that is cyclised to give a seven-
membered lactam.[8]
Following the annotation of the M. tuberculosis genome
sequence,[9] a locus of 10 genes (mbtA-J) encoding for a non-
ribosomal peptide synthetase-polyketide synthase (NRPS-PKS)
system was identified to be responsible for the assembly of the
10]
mycobactin peptide core.[8,
The initial two-step reaction of
mycobactin biosynthesis is catalysed by the aryl-adenylating
enzyme MbtA (Figure 1). MbtA activates salicylic acid
(adenylation step) by forming Sal-AMP, which is then loaded
(acylation step) onto the phosphopantetheinylation domain of
MtbB, an aryl carrier protein that is also part of the NRPS-PKS
cluster.[11] MbtA has no homologues in humans and has been
chemically validated as a target for designing new anti-TB
drugs.[12] Strains of M. tuberculosis mutants unable to produce
mycobactins or import these siderophores with chelated iron have
been shown to have in vitro and in vivo attenuated virulence and
limited growth in the lung or macrophages.[6, 11, 13] Furthermore,
Introduction
Tuberculosis (TB) is an infectious disease caused by the slow-
growing Mycobacterium tuberculosis (Mtb). In 2017, 10.4 million
people contracted TB and 1.7 million died from this disease, with
over 95% of TB deaths occurring in developing countries.[1] The
alarming rise of multi-drug resistant (MDR)- and extensively-drug
resistant (XDR)-TB, particularly in Europe,[2] and the increased
rate of HIV-TB co-infection pose additional challenges for the
control of this disease that nowadays represents a global health
threat.[3] Therefore, new therapeutic agents with novel
mechanisms of action(s) are urgently needed to combat the TB
pandemic.
M. tuberculosis, similar to other pathogens, requires iron to
support its colonisation and growth.[4] Free iron is highly restricted
in human serum and body fluids, and M. tuberculosis produces
salicyl-capped siderophores, mycobactins (1), to chelate and
internalise this essential trace element from the host iron-binding
proteins (Figure 1).[5],[6] Mycobactin T (1a) is highly lipophilic and
remains associated with the cell wall of mycobacteria, whereas
carboxymycobactin (1b), which by virtue of its short carboxylic
nucleoside
antibiotics,
such
as
5′-O-[N-
(salicyl)sulfamoyl]adenosine (Sal-AMS), specifically designed to
inhibit MbtA enzymatic activity effectively arrested M. tuberculosis
growth and virulence (Figure 1).[14] Taken together these
observations show that targeting the mycobactin biosynthesis
pathway would prove successful in TB drug development.[15]
However, these MbtA inhibitors lack drug-like features, and
exhibit poor DMPK profiles and off-target biological activity.[14a]
Herein, we sought to identify novel anti-tubercular agents with
high-binding-affinity for MbtA by combining whole-cell screening
and target-based drug discovery approaches.[16] To this end, a
library of diverse, lead-like small molecules was tested for whole-
cell growth inhibition of M. tuberculosis (H37Rv) and robust
biochemical (fluorescence-based thermal shift) and biophysical
(NMR-based Water-LOGSY and STD) assays were employed to
test the ability of the H37Rv-active molecules to bind to MbtA.
1
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900217
ChemMedChem
FULL PAPER
Figure 1. Schematic representation of the initial two-step reaction in the biosynthesis of mycobactins 1a and 1b carried out by the bifunctional enzyme MbtA. The
first step involves adenylation of salicylic acid to form Sal-AMP, which is then loaded by MbtA on to the thiolation domain of MbtB. The nucleoside antibiotic Sal-
AMS, which is the sulfamoyl-linker containing derivative of Sal-AMP, inhibits the adenylation reaction catalysed by MbtA.14a,b
MbtA production and Fluorescent-based Thermal Shift
Assay (FTSA)
Results and Discussion
M. tuberculosis MbtA (salicyl-AMP ligase) showed a high level of
expression in Escherichia coli and was initially elected to be the
substrate for the FTSA. However, this enzyme proved to be
insoluble and difficult to purify after expression.
Primary HTS whole-cell screen
A library of 3200 lead-like, structurally-diverse compounds was
carefully selected from commercial sources and tested against M.
tuberculosis H37Rv at a single concentration of 20 μM using a
previously developed 384-well high-throughput screening
format.[17] We found that 846 library members exhibited M.
tuberculosis growth inhibitory activity ranging from 35% (302
compounds) to >98% (19 compounds). In order to explore the
MbtA enzyme chemical space as broadly as possible, it was
decided not to apply a percent-inhibition cutoff and all 846 H37Rv-
active molecules were investigated for their ability to bind to MbtA
using the fluorescent-based thermal shift assay (FTSA).
Focus was then directed towards the Mycobacterium smegmatis
MbtA (2,3-dihydroxybenzoate-AMP ligase) homologue, which
shares 69.2% sequence identity and 85.0% sequence similarity
with M. tuberculosis MbtA.[18a,b] M. smegmatis MbtA was
successfully cloned and heterologously expressed in E. coli to a
high yield (30 mg/mL). Purification by affinity chromatography
yielded a protein with an apparent mass of 58 kDa, as observed
by SDS-PAGE, which was consistent with the predicted
57,656.45 Da molecular mass for M. smegmatis MbtA.
Figure 2. Thermal unfolding of MbtA in the presence and absence of five chemically diverse scaffolds (2-6) identified through FTSA.
2
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900217
ChemMedChem
FULL PAPER
Table 1.a Minimum inhibitory concentrations (MICs) of 2 - 6 in M. tuberculosis H37Rv and cytotoxicity evaluation in HepG2 cells in presence of glucose (Glu) and
galactose (Gal). Activity of compounds 2 - 6 against intracellular M. tuberculosis H37Rv.
Minimum inhibitory concentrations (µM)
Intracellular assay (µM)
RAW 264.7 Intracellular Mtb
Compound
H37Rv
HepG2
HepG2
Ratio
(Glu/Gal)
[b]
[c]
[c]
[d]
[e]
MIC90
(Glu) IC50
(Gal) IC50
IC50
IC90
2
>20 (0)
>20 (0)
>20 (0)
13 (2.5)
>20 (0)
0.1 (0.6)
79 (0.6)
34 (1.1)
2.3
N/A
1.7
39 (4.6)
>100 (0)
8 (1.1)
29 (0.5)
2.6 (0.6)
NA
>33 (4.8)
>100 (0)
>3.7 (0)
9.3 (0.8)
>3.7 (1.1)
NA
3
>100 (0)
69 (1.2)
36 (0)
>100 (0)
41 (0.7)
29 (0.5)
22 (1.9)
NA
4
5
1.2
6
>100 (0)
>100 (0)
>4.5
NA
Rifampicin
[a] The experiments were conducted in triplicate and error values are reported in brackets as Standard Deviation (STDEV) values. [b] MIC90 was defined as the
concentration required to inhibit growth of M. tuberculosis in liquid medium by 90% after 5 days. [c] IC50 is the concentration required to reduce viability of HepG2
cells (cultured with either glucose or galactose) by 50% after 2 days. [d] IC50 is the concentration required to reduce viability of RAW 264.7 cells by 50% after 3
days. [e] IC90 is the concentration required to inhibit the growth of M. tuberculosis in liquid medium by 90% after 3 days. NA = not available.
Next, having obtained sufficient quantities of soluble MbtA, the
binding affinity of the 846 H37Rv-active molecules was evaluated
using real-time PCR-coupled FTSA. The latter is a well-
established method that enables accurate monitoring of protein
denaturation upon heating via fluorescent-based detection.[19]
The fluorescent probe binds with high affinity to the protein’s
hydrophobic regions, which are exposed during the course of the
experiment. Protein denaturation is visualised via a thermal
melting curve, whose mid-point (Tm) is the temperature at which
50% of the protein has denatured.[19] Upon ligand binding to the
protein, the protein Tm increases and the difference in melting
temperature (ΔTm) between the protein alone and the protein-
ligand adduct serves as a measure of the binding affinity of the
ligand.[20]
determined at five days. MbtA-binder 5 showed the highest anti-
tubercular activity with a MIC value of 13 µM, whereas
compounds 2, 3, 4 and 6 were considered as not H37Rv-active
(Table 1).
The cytotoxicity of the compounds was determined using HepG2
cells and mitochondrial toxicity was assessed by using either
high-galactose or glucose-containing media. Replacing glucose
with galactose in the media induces HepG2 cells to rely on
mitochondrial oxidative phosphorylation rather than glycolysis for
ATP production, and increases their susceptibility to
mitochondrial toxicants.[22] Compound 3 exhibited no cytotoxicity
and 2 - 5 showed mild to moderate cytotoxicity with IC50 values
ranging from 29-79 µM towards cells grown in both media.
Interestingly, 6 targeted mitochondrial respiration (Glu/Gal > 4.5).
In our experiments, all 846 H37Rv-active molecules were
screened at a concentration of 10 µM and a threshold of ΔTm >3°C
was applied for the selection of compounds to be progressed to
the NMR-based analysis. ATP and Sal-AMS, which was
synthesised according to published methods (Supporting
Information),[21] were used as positive controls showing ΔTm
values of 3.5 and 7.6°C (Figure S1 in Supporting Information),
respectively. The graph in Figure 2 illustrates the thermal melting
curves and the structures of the five hit-compounds (2-6)
identified through FTS screening. As can be noticed, these
H37Rv-active MbtA ligands bear diverse chemical scaffolds,
Measurement of compounds activity against intracellular
Mycobacterium tuberculosis
Compounds
2
-
6
intracellular activity in Mtb-infected
macrophages was evaluated using a live-cell fluorescence-based
screen.[23] The assay measured the compounds cytotoxicity and
anti-mycobacterial activity simultaneously and provided valuable
information about the ability of 2 - 6 to penetrate the macrophages,
where Mtb usually resides, and inhibit the growth of intracellular
Mtb. As there is evidence that macrophages’ environment is iron-
restricted with concentrations of free iron (Fe3+) ranging from 1 -
10 ng ml−1,[24,25] it is anticipated that the intracellular iron-limiting
conditions in mammalian macrophages might induce Mtb to
produce MbtA enzymes for the synthesis of Fe3+-chelating
mycobactins. The results (Table 1) showed that 5 was able to kill
intracellular M. tuberculosis at a concentration of 9.3 µM with
moderate cytotoxicity (29 µM) against the macrophages, thus
confirming the anti-tubercular and cytotoxic activities of this
compound. Interestingly, compounds 4 and 6 were found to be
more toxic against RAW 264.7 (8 and 2.6 µM, respectively)
compared to HepG2 cells and showed enhanced anti-tubercular
activity inside the macrophages (>3.7 µM), probably due to
which include tolyl-sulfoximine-benzamide 2 (ΔTm
dichloroimidazolyl-nitrobenzimidamide (ΔTm
=
4°C),
4.7°C),
3
=
phenyldiazenyl-pyridone 4 (ΔTm = 3.8°C), 5-hydroxy-indol-3-
ethylamino-(2-nitro-4-trifluoromethyl)benzene 5 (ΔTm = 3.1°C)
and 4,6-diphenylpyrimidin-hydrazono(methyl)(phenyl)(diazenyl)
benzoic acid 6 (ΔTm = 3°C).
Anti-tubercular activity and cytotoxicity of hit-compounds
At this stage, MbtA active-hits 2, 3, and 5 and non-binders 4, 6
were tested for whole-cell growth inhibition of M. tuberculosis
H37Rv and minimum inhibitory concentrations (MICs) were
3
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900217
ChemMedChem
FULL PAPER
intracellular metabolic modification, and additional experiments
will be required to investigated this further.
Water-LOGSY and STD NMR assays validates FTSA assay
hits
Target-based 1H-NMR spectroscopy experiments, i.e., Water-
Ligand Observed Gradient SpectroscopY (Water-LOGSY) and
Saturation Transfer Difference (STD),[26, 27] were used to confirm
binding of anti-tubercular compounds 5 to MbtA. Water-LOGSY
NMR spectra show positive signals for ligands that bind to a
protein target compared with negative signals for ligands that do
not bind. The STD experiment yields a set of signals for ligands
that bind to the target protein when the ligand/protein on/off
exchange rate is sufficiently fast to generate saturation transfer
effects. Ligands that do not bind do not show NMR responses in
the STD data. Both experiments are required to be run with ligand
only and ligand in the presence of protein target in order to
eliminate the possibility of false positive results.
Sal-AMS showed positive responses in both the STD and Water-
LOGSY experiments. Control Water-LOGSY experiments for
nitrophenyl-amino ethyl indole 5 carried out in the absence of
MbtA showed negative responses for the aromatic signals
indicating lack of ligand aggregation, an important prerequisite for
ensuring that the generated data were reliable and free from
artefacts. Compound 5 showed positive responses in both the
STD and Water-LOGSY experiments (Figures S2 and S3 in
Supporting Information). STD NMR data clearly indicated ligand
binding to MbtA at the on/off exchange rate associated with weak
interaction, when MbtA was loaded with the ligand. Buffer salts,
contained in the protein solution medium, and DMSO did not bind
to the protein, producing negative signals in the aliphatic proton
resonance region of the Water-LOGSY spectrum. This is an
encouraging result, and more experimental work is currently
underway to evaluate the biochemical and enzymatic activity of
the purified MbtA in the presence of compounds 5.
Figure 4. Structures of docked compounds (Sal-AMS and 5) within the M.
smegmatis MbtA active site derived from PDB Ref 5KEI: a. and b. Docked
conformation of Sal-AMS; c. and d. Docked conformation of compound 5. The
ligands are represented as sticks and the protein shown as a surface (a. and c.)
or selected residues shown as green sticks (c. and d.). Polar interactions are
shown as yellow dotted lines. Figures were constructed using The PyMOL
Molecular Graphics System, Version 1.7 Schrödinger, LLC.
Conclusions
Most of the current anti-TB drugs have been identified by or
derived from M. tuberculosis whole-cell screening.[28] However,
the lack of knowledge regarding endogenous targets represents
the main disadvantage of this approach, greatly limiting the
possibilities for improving the potency and selectivity of the active
hits. An alternative method to generate anti-tubercular lead-
compounds relies on target-based biochemical screens, although
so far there has been limited success in using this strategy, due
to the difficulty of translating potent target inhibition into whole-cell
anti-mycobacterial activity. To this end, we have applied an
integrated target-based and phenotypic screening method to
identify M. tuberculosis-active molecules that are also able to bind
to a well-defined target, i.e., MbtA.
In silico docking and binding energy calculations (Modelling)
The crystal structure of Mycobacterium smegmatis MbtA in its apo
form has been described recently (PDB Ref 5KEI).[18] We have
used this structure to dock the compounds Sal-AMS and 5 into
the proposed ligand binding pocket using Autodock Vina (Figure
4). The ligands are predicted to occupy different binding
orientations in the protein. The Sal-AMS is positioned with the
salicyl group occupying a deep pocket in the protein and stacking
with Phe237, and the purine ring lies adjacent to Arg426 near to
the protein surface.
With the aid of fluorescence-based thermal shift and NMR-based
Water-LOGSY and STD assays we have identified 5-hydroxy-
indol-3-ethylamino-(2-nitro-4-trifluoromethyl)benzene (5) as
a
The sulphonamide is predicted to form hydrogen bond
interactions with His235 and Gly325. Compound 5 is positioned
with its indole ring over Phe324, the phenyl nitro substituent
interacts with Gly192 and the amine NH of the ligand is predicted
to form a hydrogen bond with Gly325. The predicted binding
energies of the two compounds (Sal-AMS -9.3 Kcal/mol, 5 -8.2
Kcal/mol) are similar, but suggest that 5 may be more ligand
efficient due to its smaller size (32 and 26 non-H atoms for Sal-
AMS and 5 respectively). These observations will require
confirmation in future quantitative binding experiments and
structural studies, but may be useful to guide initial exploration of
structure-activity relationships.
promising MbtA-ligand that inhibited M. tuberculosis growth, with
a MIC90 of 13 µM, and showed relatively low cytotoxicity in HepG2
cells. Compound 5 exhibited one of a TB drug’s crucial
characteristics, which is the ability to kill intracellular M.
tuberculosis and permeate the mycobacterial cell envelope to
exert bactericidal activity, and, most importantly, was found to
strongly interact with the tubercular enzyme MbtA, a newly
emerging TB target that catalyses the first two-step reaction of
mycobactins’ biosynthesis.In summary, a strong correlation was
established between the anti-tubercular activity of the hit-
molecule 5 and its ability to bind to the TB-target MbtA. This would
provide a suitable biological and chemical starting point for lead-
optimisation experiments and MbtA-inhibition activity assays.
4
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900217
ChemMedChem
FULL PAPER
(H2O:D2O/90:10) in a final sample volume of 650 µL. NMR experiments
were carried out using a Jeol JNM-ECZR 600 MHz NMR spectrometer
equipped with a ROYAL probe operating at a proton resonance frequency
of 600.13 MHz. Standard 1D 1H NMR spectra acquired on protein-free and
protein-loaded ligand samples were acquired with presaturation of the
water signal using a composite read pulse and crusher gradients to yield
clean solvent suppression according to the Jeol pulse program ROBUST.
Data were acquired over a frequency width equivalent to 15.0 ppm into
16K data points (acquisition time = 1.44 s) for each of typically 16 (ligand
only) or 1024 (with added protein) transients using a presaturation delay
of 5.0 s between transients. The offset was centred at the largest solvent
signal. Saturation Transfer Difference NMR spectra were prepared from
data acquired using the Jeol pulse program STD. Gaussian-shaped
saturation pulses of 60 ms duration cycled over a total duration of 6.0 s
were applied interleaved both on and off resonance. The total recycle
delay was set to 7.0 s. Difference spectra were generated by subtraction
of the off-resonance reference data from the on-resonance irradiation data.
In STD experiments, the irradiation frequencies corresponded to the
following chemical shifts: Off Resonance [Control] = -200.00 ppm (minus
two hundred parts per million); On Resonance [Protein Irradiation] = 0.7
ppm (zero point seven parts per million). Water-LOGSY NMR spectra were
generated using the Jeol pulse program Water-LOGSY_ES. Water
suppression was achieved using excitation sculpting with gradients. A
mixing time of 1.6 s was used to allow for magnetization transfer build-up
from solvent to ligand in the presence or absence of protein.
Experimental Section
A 3,200-member library (BioAscent Ltd.) of lead-like, structurally-diverse
compounds was selected using the following criteria: 3 out of 5 Lipinski
rules, i.e., MW<500, HBD<5, HBA<10; rotatable bonds<10; PSA<120 Å.
Filters applied to avoid unstable/chemically reactive/toxic fragments, bio-
reactive or known pan assay interference compounds (PAINS).
Cloning expression and purification of MbtA (2,3-dihydroxybenzoate-
AMP ligase). Cloning, expression and purification were conducted as part
of the Seattle Structural Genomics Center for Infectious Disease
(SSGCID)[29] following standard protocols described previously.[30]
Genomic DNA from Mycobacterium smegmatis ATCC 700084/mc(2)155
was obtained from the ATCC Global Bioresource Center (cat.nr. ATCC
700084D-5). The full-length protein (UniProt: A0R0V0) encoding amino
acids 24-558 was PCR amplified from genomic DNA using the primers
FWD
5’-
CTCACCACCACCACCACCATATGGGATTCACGCCGTTTCCGG and
REV 3’-ATCCTATCTTACTCACTTACCCGCCGAGCTGACGCACG. The
gene was cloned into the ligation independent cloning (LIC)[31] expression
vector pBG1861[30b] encoding
a non-cleavable 6xHis fusion tag
(MAHHHHHH-ORF). Plasmid DNA was transformed into chemically
competent E. coli BL21(DE3)R3 Rosetta cells. Cells were expression
tested and 2 litres of culture were grown using auto-induction media[32] in
a LEX Bioreactor (Epiphyte Three Inc.) as previously described.[30a] The
expression clone was assigned the SSGCID target identifier
Fluorescent-based Thermal Shift Assay (FTSA) was carried out using
a 96-well plate format on a BioRad CFX Connect RT-PCR instrument.
Each well contained 3 µg of purified MbtA, 5 nL 5000X Sypro Orange
(Invitrogen) in 10 µL volume (buffer: 100 mM Hepes, pH 7.5, 500 mM
NaCl) with a resultant protein concentration of 5.17 µM. The ligand final
concentrations were 10 µM in 1% DMSO. Following the addition of protein
and compounds, the PCR plates were sealed with optical seal, shaken,
and centrifuged for 30 min. Thermal scanning (10 to 90°C with a heating
rate of 1°C/ min increment) was performed using a real-time PCR setup
and fluorescence intensity was measured after every 10 seconds. Curve
fitting, melting temperature calculation and report generation on the raw
FTS data were performed using software developed by Biorad
Laboratories and adapted by us. The screening of the 3200 compounds
was carried out in an individual fashion with each well containing only one
compound. Compounds exhibiting positive Tm shift >3°C were considered
as hits.
MysmA.00629.c.B2.GE39512
https://ssgcid.org/available-materials/expression-clones/.
and
is
available
at
MysmA.00629.c.B2 protein was purified in a two-step protocol consisting
of an Ni2+-affinity chromatography (IMAC) step and size-exclusion
chromatography (SEC). All chromatography runs were performed on an
ÄKTApurifier 10 (GE) using automated IMAC and SEC programs
according to previously described procedures.[30a] The final SEC was
performed on a HiLoad 26/600 Superdex 75 (GE Healthcare) using a
mobile phase of 25 mM HEPES pH 7.0, 500 mM NaCl, 5% Glycerol , 2
mM DTT, and 0.025% Azide. Peak fractions eluted as a single peak of
approximately 58 kDa. Peak fractions were pooled and analyzed for the
presence of the protein of interest using SDS–PAGE. The peak fractions
were concentrated to 30 mg/mL using an Amicon purification system
(Millipore). Aliquots of 200 µL were flash-frozen in liquid nitrogen and
stored at −80°C until use.
HTS and MICs were determined against M. tuberculosis (H37Rv)
according to published methods. [17] Briefly, M. tuberculosis was grown in
Middlebrook 7H9 broth medium containing 10% OADC (oleic acid, albumin,
dextrose, catalase) supplement (Becton Dickinson) and 0.05% w/v Tween
80 (7H9-Tw-OADC) under aerobic conditions. Bacterial growth was
Modelling studies. The MbtA protein structure was obtained from the
Protein Data Bank (PDB Ref: 5KEI).[18] The protein pdb file was opened in
Autodock Tools (ADT), [35] the solvent and ions were removed and the
resulting structure was saved as a pdbqt file for use in Autodock Vina. [36]
The small molecule ligands were prepared by constructing the 2D
structures in ChemBioDraw Ultra 14.0 which were saved in sdf format. The
2D representations were converted into 3D structures using ChemBio3D
Ultra 14.0 and energy minimised using the integrated MM2 and GAMESS
AM1 protocols with default settings. The compounds were saved in mol2
file format and converted to the pdbqt format using Openbabel 2.3.2.[37]
Autodock Vina was run using an Exhaustiveness setting of 40 and a
binding site box centred on the nucleotide binding pocket (by analogy with
the related structure PDB Ref: 1MDB)[38] that was 24 × 24 × 24 Å in size.
All other parameters were set to their default values. The lowest energy
conformation of each docked ligand was extracted from the results file
using a custom script and analysed in Pymol (The PyMOL Molecular
Graphics System, Version 1.7 Schrödinger, LLC).
measured by OD
after 5 days of incubation at 37°C. Curves were fitted
590
using the Levenberg–Marquardt algorithm. MIC was defined as the
90
minimum concentration required to inhibit growth of M. tuberculosis by
90%.
HepG2 cytotoxicity. Cytotoxicity was assessed using the HepG2 cell line
under replicating conditions.[17] HepG2 cells were grown in DMEM,
GlutaMAX™ (Invitrogen), 10% fetal bovine serum (FBS), and 1X penicillin-
streptomycin solution (100 U/mL) using either glucose or galactose as
carbon source. Cells were incubated with compounds for 2 days at 37 °C
(final DMSO concentration of 1%), 5% CO2. CellTiter-Glo® Reagent
(Promega) was added and relative luminescent units (RLU) measured to
assess cell viability. Inhibition curves were fitted using the Levenberg–
Marquardt algorithm. IC50 is the concentration required to reduce cell
viability after 2 days by 50%.[33]
NMR-based Water-LOGSY (Water-Ligand Observed via Gradient
Spectroscopy) and Saturation Transfer Difference (STD) assays were
carried out according to published methods.[26, 27] A typical sample solution
with protein present contained 44.2 µM of MbtA with ligand at a final
concentration of 0.75 mM in 16.5:83.5
/
DMSO-d6:H2O-D2O
5
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900217
ChemMedChem
FULL PAPER
[11] J. J. De Voss, K. Rutter, B. G. Schroeder, H. Su, Y. Zhu,
C. E. Barry, 3rd, Proc Natl Acad Sci U S A 2000, 97, 1252-1257.
Acknowledgements
We thank Aaron Korkegian, Yulia Ovechkina, Megha Gupta,
Douglas Joerss, Lindsay Flint and Gary Litherland (FTSA set-up)
for technical assistance. This project has been funded in part with
the University of the West of Scotland PhD studentship scheme
(L. F.) and Federal funds from the U.S. National Institute of Allergy
and Infectious Diseases, National Institutes of Health,
Department of Health and Human Services, under Contract Nos.:
HHSN272201200025C and HHSN272201700059C. S.B. is a
Cipla distinguished Fellow and would like to acknowledge a
Global Challenges Research Fund support.
[12] S. Lun, H. Guo, J. Adamson, J. S. Cisar, T. D. Davis, S. S.
Chavadi, J. D. Warren, L. E. Quadri, D. S. Tan, W. R. Bishai,
Antimicrob Agents Chemother 2013, 57, 5138-5140.
[13] P. V. Reddy, R. V. Puri, P. Chauhan, R. Kar, A. Rohilla, A.
Khera, A. K. Tyagi, J Infect Dis 2013, 208, 1255-1265.
[14] a) K. M. Nelson, K. Viswanathan, S. Dawadi, B. P.
Duckworth, H. I. Boshoff, C. E. Barry, 3rd, C. C. Aldrich, J Med
Chem 2015, 58, 5459-5475; b) S. Dawadi, H. I. M. Boshoff, S.
W. Park, D. Schnappinger, C. C. Aldrich ACS Med. Chem. Lett.
2018, 9, 386–391; c) R. V. Somu, D. J. Wilson, E. M. Bennett,
H. I. Boshoff, L. Celia, B. J. Beck, C. E. Barry, 3rd, C. C. Aldrich,
J Med Chem 2006, 49, 7623-7635; d) J. A. Ferreras, J. S. Ryu,
F. Di Lello, D. S. Tan, L. E. Quadri, Nat Chem Biol 2005, 1, 29-
32.
Supporting Information
Supporting Information associated with this article can be found
at http://
[15] B. P. Duckworth, K. M. Nelson, C. C. Aldrich, Curr Top
Med Chem 2012, 12, 766-796.
Keywords: Tuberculosis drug discovery • phenotypic and
target-based screening • mycobactins / siderophores •
mycobacterial iron homeostasis • NMR Water-LOGSY •
Saturation Transfer Difference • NMR spectroscopy •
Fluorescent-based Thermal Shift Assay
[16] S. Bhakta, Mol Biol 2013, 2, e108.
[17] J. Ollinger, M. A. Bailey, G. C. Moraski, et al. PloS one
2013, 8, e60531.
[18] a) O. Vergnolle, H. Xu, J. M. Tufariello, L. Favrot, A. A.
Malek, W. R. Jacobs, Jr., J. S. Blanchard, J Biol Chem 2016,
291, 22315-22326. b) L. Baugh, I. Phan, D. W. Begley, et al.
Tuberculosis 2015, 95, 142-148.
References:
[1] World Health Organization ed., 2018. Global tuberculosis
report 2017. World Health Organization.
https://www.who.int/tb/publications/global_report/en/
[19] O. Fedorov, F. H. Niesen, S. Knapp, Methods Mol Biol
2012, 795, 109-118.
[2] European Centre for Disease Prevention and
Control/WHO Regional Office for Europe. Tuberculosis
surveillance and monitoring in Europe 2017. Stockholm:
European Centre for Disease Prevention and Control.
[20] P. A. McDonnell, J. Yanchunas, J. A. Newitt, et al., Anal
Biochem 2009, 392, 59-69.
[21] C. Moreau, T. Kirchberger, J. M. Swarbrick, S. J. Bartlett,
R. Fliegert, T. Yorgan, A. Bauche, A. Harneit, A. H. Guse, B. V.
L. Potter, J. Med. Chem. 2013, 56, 10079−10102.
[3] a) C. Dye, Lancet 2006, 367, 938-940; b) K. Dheda, T.
Gumbo, G. Maartens, et al., Lancet Respir Med 2017, 5, 291-
360.
[22] L. D. Marroquin, J. Hynes, J. A. Dykens, J. D. Jamieson
and Y. Will, Toxicol. Sci., 2007, 97, 539-547. [22] B. Meyer, T.
Peters, Angew Chem Int Ed Engl 2003, 42, 864-890.
[4] a) Z. Fang, S. L. Sampson, R. M. Warren, N. C. Gey van
Pittius, M. Newton-Foot, Tuberculosis (Edinb) 2015, 95, 123-
130; b) C. Ratledge, Tuberculosis (Edinb) 2004, 84, 110-130.
[23] A. J. Manning, Y. Ovechkina, A. McGillivray, L. Flint, D. M.
Roberts, T. Parish, Methods 2017, 127, 3–11.
[5] A. L. Lamb, Biochim Biophys Acta 2015, 1854, 1054-1070.
[6] G. M. Rodriguez, Trends Microbiol 2006, 14, 320-327.
[24] C. Ratledge, Tuberculosis 2004, 84(1-2),110-130.
[25] S. D. Pandey, M. Choudhury, S. Yousuf, P. R. Wheeler,
S. V. Gordon, A. Ranjan, M. Sritharan J. Bacteriol. 2014, 196,
1853–1865.
[7] a) R. Barclay, D. F. Ewing, C. Ratledge, J. Bacteriol 1985,
164, 896-903; b) C. Ratledge, M. Ewing, Microbiology 1996,
142, 2207-2212.
[26] B. Meyer, T. Peters, Angew Chem Int Ed Engl 2003, 42,
864-890.
[8] J. J. De Voss, K. Rutter, B. G. Schroeder, C. E. Barry, 3rd,
J. Bacteriol 1999, 181, 4443-4451.
[27] C. Dalvit, G. P. Fogliatto, A. Stewart, M. Veronesi and B.
Stockman, J. Biomol. NMR 2001, 21, 349-359.
[9] S. T. Cole, R. Brosch, J. Parkhill, et al., Nature 1998, 393,
537-544.
[28] C. B. Cooper J Med Chem, 2013, 56, 7755-7760.
[10] a) L. E. Quadri, J. Sello, T. A. Keating, P. H. Weinreb, C. T.
Walsh, Chem Biol 1998, 5, 631-645; b) M. D. McMahon, J. S.
Rush, M. G. Thomas, J Bacteriol 2012, 194, 2809-2818; c) S. S.
Chavadi, K. L. Stirrett, U. R. Edupuganti, O. Vergnolle, G.
Sadhanandan, E. Marchiano, C. Martin, W. G. Qiu, C. E. Soll, L.
E. Quadri, J Bacteriol 2011, 193, 5905-5913.
[29] a) P. J. Myler, R. Stacy, L. Stewart, B. L. Staker, W. C. Van
Voorhis, G. Varani, G. W. Buchko, Infect Disord Drug Targets
2009, 9, 493-506; b) R. Stacy, D. W. Begley, I. Phan, B. L.
Staker, W. C. Van Voorhis, G. Varani, G. W. Buchko, L. J.
Stewart, P. J. Myler, Acta Crystallogr Sect F Struct Biol Cryst
Commun 2011, 67, 979-984.
6
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900217
ChemMedChem
FULL PAPER
[30] a) C. M. Bryan, J. Bhandari, A. J. Napuli, D. J. Leibly, R.
Choi, A. Kelley, W. C. Van Voorhis, T. E. Edwards, L. J. Stewart,
Acta Crystallogr Sect F Struct Biol Cryst Commun 2011, 67,
1010-1014; b) R. Choi, A. Kelley, D. Leibly, S. N. Hewitt, A.
Napuli, W. Van Voorhis, Acta Crystallogr Sect F Struct Biol Cryst
Commun 2011, 67, 998-1005.
[31] C. Aslanidis, P. J. de Jong, Nucleic Acids Res 1990, 18,
6069-6074.
[32] F. W. Studier, Protein Expr Purif 2005, 41, 207-234.
[33] E. S. Zuniga, A. Korkegian, S. Mullen, et al. Bioorg Med
Chem 2017, 25, 3922-3946.
[34] C. Dalvit, G. P. Fogliatto, A. Stewart, M. Veronesi and B.
Stockman, J. Biomol. NMR 2001, 21, 349-359.
[35] G. M. Morris, R. Huey, W. Lindstrom, et al. J Comput
Chem 2009, 30, 2785-2791.
[36] O. Trott, A. J. Olson J Comput Chem 2010, 31, 455-461.
[37] N. M. O'Boyle, M. Banck, C. A. James, et al. J. Cheminf.
2011, 3:33.
[38] J. J. May, N. Kessler, M. A. Marahiel, M. T. Stubbs Proc
Natl Acad Sci USA 2002, 99, 12120-12125.
7
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900217
ChemMedChem
FULL PAPER
Entry for the Table of Contents
An integrated target-based and phenotypic screening method was developed and deployed to identify 5-hydroxy-indol-3-ethylamino-
(2-nitro-4-trifluoromethyl)benzene (5) as an attractive hit-molecule that bound with high affinity to MbtA, producing a MIC90 of 13 µM.
8
This article is protected by copyright. All rights reserved.