Design of potent inhibitors for Schistosoma japonica glutathione S-transferase

Article abstract of DOI:10.1016/j.bmc.2005.07.077

We implemented both structure-based drug design and the concept of polyvalency to discover a series of potent and unsymmetrical Schistosoma japonicum glutathione S-transferase (SjGST) inhibitors 10-12. This strategy achieved not only an excellent enhancement (10- to 490-fold) in the inhibitory potency, compared to the monofunctional analogues 1-5, but was also an effective modification by selecting a hydrophobic moiety with a flexible linker. The designed compounds with a low micromolar hit demonstrate special values in refining the new generation of SjGST inhibitors. The stoichiometry of the binding is one inhibitor molecule per SjGST monomer via isothermal titration calorimetric measurement.

Full text of DOI:10.1016/j.bmc.2005.07.077

Bioorganic & Medicinal Chemistry 14 (2006) 304–318
Design of potent inhibitors for Schistosoma japonica
glutathione S-transferase
Shu-Chuan Jao,a Jessica Chen,b Kelvin Yanga and Wen-Shan Lia,*
aInstitute of Chemistry, Academia Sinica, Taipei 11529, Taiwan
bDepartment of Chemistry, National Central University, Chung-Li 32054, Taiwan
Received 16 June 2005; revised 22 July 2005; accepted 22 July 2005
Available online 4 November 2005
Abstract—We implemented both structure-based drug design and the concept of polyvalency to discover a series of potent and
unsymmetrical Schistosoma japonicum glutathione S-transferase (SjGST) inhibitors 10–12. This strategy achieved not only an excel-
lent enhancement (10- to 490-fold) in the inhibitory potency, compared to the monofunctional analogues 1–5, but was also an effec-
tive modification by selecting a hydrophobic moiety with a flexible linker. The designed compounds with a low micromolar hit
demonstrate special values in refining the new generation of SjGST inhibitors. The stoichiometry of the binding is one inhibitor
molecule per SjGST monomer via isothermal titration calorimetric measurement.
ꢀ 2005 Elsevier Ltd. All rights reserved.
1. Introduction
people and causing 280 thousand deaths annually.
Although numerous inhibitors for cytosolic and other
parasitic GSTs are known,28–36 to our knowledge, very
few are reported for SjGST.37,38 In the present study,
we describe the discovery and synthesis of potent inhib-
itors of SjGST capable of occupying the active site of
the enzyme by a structure-based drug design approach.
Furthermore, the feasibility of the inhibitor binding to
the dimer interface of SjGST is examined.
The glutathione S-transferase from the helminthes
Schistosoma japonicum (SjGST) catalyzes glutathione
(GSH) conjugations by facilitating the nucleophilic at-
tack of the sulfhydryl group on various xenobiotics.1–7
By forming less toxic and more soluble GSH conju-
gates,8–13 the harmful electrophiles are readily exported
and excreted from the cell. Since this mechanism is the
parasiteꢀs primary defense system, reduction of the
SjGST activity could potentially diminish the wormꢀs
ability to withstand electrophilic and oxidative damage
resulting from environmental stress and drug adminis-
tration. In fact, it has been recently reported on the basis
of crystallographic data that the major antischistosomal
drug, praziquantel,14 directly binds to SjGST and might
have the potential to block the entrance of substrates,15
even though in vitro study demonstrated that prazi-
quantel does not inhibit SjGST activity16 using the con-
ventional CDNB (1-chloro-2,4-dinitrobenzene) assay.
Nonetheless, the administration of artemether17 or oltip-
raz18,19 resulted in a time- and dose-dependent decrease
of the activity of schistosome GST. Thus, this enzyme
draws great attraction as a drug target against schistoso-
miasis,20–27 a tropical disease infecting 200 million
2. Results and discussion
A series of GSH analogues (1–5) were first synthesized
with the key Cys modified into different groups, that
is, a Ser, a Thr, a b-cyanoalanine, a (S)-2-amino-4-cya-
nobutyric acid, and a L-glutamyl methyl ester (Scheme
1). The IC50 values were determined using CDNB as-
say39 and the inhibition data are summarized in Table
1. Among the compounds tested, cyano glutathione 3
showed the smallest IC50 value of 147 lM. Methyl or
methylene groups appearing at c position make poor
inhibitors such as compounds 2, 4, and 5. Suggested
by molecular modeling (see Section 4), compound 2,
with an extra methyl substitution, gave much poor inhi-
bition compared to 1, presumably due to van der Waals
strain resulting from the methyl group and the indole
side chain of Trp8 in the active site (Fig. 1A). Therefore,
compound 1, c-L-glutamyl-L-seryl-glycine (GOH), was
chosen as our glutathionyl building block.
Keywords: Drug design; Molecular modeling; Epiandrosterone;
Schistosoma japonica glutathione S-transferase; Inhibitors.
*
Corresponding author. Tel.: +886 2 27898662; fax: +886 2
27831237; e-mail: wenshan@chem.sinica.edu.tw
0968-0896/$ - see front matter ꢀ 2005 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2005.07.077

S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
305
CO2Me
CONH2
n
R
OH
OH
Boc
OH
Fmoc
N
H
N
H
Z
OH
O
N
H
O
O
R = H
R = CH3
17 : n = 1
18 : n = 2
25
1. GlyOtBu, HBTU,
DIPEA, DMF
GlyOtBu, HBTU,
DIPEA, DMF
DCC/Py
2. H2/Pd-C
3. BocGluOtBu, HBTU,
DIPEA, DMF
CN
R
OH
n
Boc
OH
Fmoc
GlyOtBu
CO2Me
N
H
N
H
O
O
O
H
N
13 : R = H
14 : R = CH3
19 : n = 1
20 : n = 2
GlyOtBu
N
Boc
H
CO2tBu
O
26
1. Formic acid
2. BocGluOtBu, HBTU,
DIPEA, DMF
GlyOtBu, HBTU,
DIPEA, DMF
TFA
R
OH
GlyOtBu
CO2Me
CN
O
H
N
n
O
Boc
GlyOtBu
Boc
N
H
N
H
H2N
GlyCO2H
CO2tBu
15 : R = H
16 : R = CH3
O
N
H
O
CO2H
O
21 : n = 1
22 : n = 2
5
1. Formic acid
2. BocGluOtBu, HBTU,
DIPEA, DMF
1. CCl4/PPh3 or CBr4/PPh3
2. TFA
R
X
CN
O
O
n
H
N
H2N
GlyCO2H
GlyOtBu
N
H
Boc
N
H
CO2H
O
CO2tBu
O
1 : R = H, X = OH
2 : R = CH3, X = OH
23 : n = 1
24 : n = 2
TFA
CN
n
O
H2N
GlyCO2H
N
H
CO2H
O
3 : n = 1
4 : n = 2
Scheme 1. Synthesis of the monofunctional analogues 1–5.
Table 1. Monovalent inhibitors for SjGST
quantel (1GTB)15,16 were used to identify the binding
cavity of the enzyme. It was realized that S-hexyl gluta-
thione (HEX) and S-2-iodobenzyl glutathione (IBZ)
occupied both glutathione binding site (G site) and elec-
trophile binding site (H site), while praziquantel (PZQ)
was binding at the dimer interface. Since their positions
within the enzyme were not far from each other
(Fig. 1B), our plan was to construct multivalent inhibi-
tors, occupying multiple sites of SjGST, to result in a
more favorable binding than the monofunctional ana-
logues. The optimizations can be achieved by exploring
the binding domains and the tether between them.
R1
R2
O
H
N
H2N
C
2H
N
H
CO2H
O
Compound
R1
R2
IC50 (lM)
1
2
3
4
5
H
OH
OH
H
395
>1500
147
CH3
CN
CH2CN
CH2CO2Me
H
>3000
774
H
´
Experimentally, Remoue et al. confirmed a specific bind-
ing of testosterone to Schistosoma haematobium gluta-
thione S-transferase (ShGST) with a high Kd value
of affinity at 2.57 · 10ꢀ7 M.41 Other steroids such as
To understand the existing binding modes of SjGST,
crystal structures of enzyme with S-hexyl glutathione
(1M9A), S-2-iodobenzyl glutathione (1M9B)40 or prazi-

306
S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
Figure 1. (A) Steric hindrance resulting from methyl group of Thr in compound 2 (red) and the residue Trp 8 of SjGST (green); (B) The relative
positions of the inhibitors, that is, S-hexyl glutathione (HEX, purple), S-2-iodobenzyl glutathione (IBZ, cyan), and praziquantel (PZQ, red)
occupying the G, H sites and the dimer interface of SjGST.
D5-androstene-3,17-dione,42 3b-(iodoacetoxy)dehydroi-
soandrosterone,43 17b-estradiol-3,17-disulfate,43 and
17b-iodoacetoxy-estradiol-3-sulfate44 were reported to
have a binding interaction with rat GST 1-1 or human
GST A3-3. Due to the lack of X-ray structure, however,
the precise binding site of steroid inside specific GST is
still unclear. Because steroids are known to bind with
specific GST,41–46 existing steroidal analogues are cho-
sen as the hydrophobic moieties to enhance the binding
affinity between inhibitor and SjGST. Prior to testing
the multivalent inhibitor potency, we prepared two epi-
androsterone derivatives, 38 and 44, with different link-
ers (aspartic acid and succinic acid). Compound 38 was
synthesized by the esterification of 28 and Fmoc-Asp
(O-t-Bu)-OH followed by subsequent deprotection of
t-Bu and Fmoc groups (Scheme 2). Derivative 44 was
prepared by treating 28 with succinic anhydride in the
presence of pyridine and 4-dimethylaminopyridine
(DMAP). Compound 38 was found to have an IC50 of
128 lM, while 44 had an IC50 of 294 lM.
Having the building blocks in hand, compounds 6–8
were prepared with an Asp linkage to connect GOH
and 27–29, respectively. The synthetic pathway is out-
lined in Scheme 2. L-Aspartic acid was first esterified
to 27–29 separately then to GOH. Compounds 6–8 were
obtained after removal of the Fmoc and then acidolytic
cleavage of the remaining t-Bu and Boc groups. All
products were purified by lipophilic Sephadex LH-20
and reverse-phase HPLC. The indene substructure of 6
O
FmocHN
O
OR
O
OR
O
OR
H2N
b, c
d,e
a
ROH
R"HN
O
O
O
O
O
O
O
H
N
H
N
27-29
R'O
O
BocHN
CO2tBu
H2N
CO2H
N
H
N
H
31-33 R'= tBu, R"= Fmoc
34-36 R'= H, R"= Fmoc
37-39 R'= H, R"= H
CO2tBu
b
d
CO2H
6-8
40-42
6 : R = 27b
7 : R = 28
8 : R = 29
OR
OR
O
O
O
O
O
O
h
g
f
R
OH
ROH
O
O
O
O
O
27-30
O
H
N
H
N
43-46
H2N
CO2H
9-12
BocHN
CO2tBu
47-50
N
H
N
H
CO2H
O
CO2tBu
9a : R = 27a; 9b : R = 27b
10 : R = 28; 11 : R = 29
12 : R = 30
O
O
Cl
O
ROH =
HO
HO
27a (3α)
27b (3β)
HO
HO
OH
28
29
30
Scheme 2. Synthesis of the bifunctional analogues 6–12. Reagents and conditions: (a) Fmoc-Asp(O-t-Bu)-OH, DMAP, DCC, CH2Cl2, 25 ꢁC; (b)
TFA, CH2Cl2, 0 ꢁC; (c) 15, DMAP, DCC, CH2Cl2, 25 ꢁC; (d) DBU, CH2Cl2, rt; (e) TFA, 2% H2O, 0 ꢁC; (f) succinic anhydride, DMAP, pyridine, rt;
(g) 15, DMAP, DCC, CH2Cl2, 25 ꢁC; (h) TFA, 2% H2O, 0 ꢁC.

S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
307
Table 2. Bivalent inhibitors for SjGST
was chosen because it was analogous to the correspond-
ing epiandrosterone rings C and D. However, the indene
substructure of 6 with an extra hydroxyl group and the
absence of classical steroids rings A and B in compari-
son with the epiandrosterone moiety of 7 or 8 should
reduce the potential of hydrophobicity and might have
a somewhat lower affinity for the electrophile binding
site (H site). As expected, compounds 7 and 8 display
a 10- to 16-fold improvement in potency over 1, while
6 exhibits a 2-fold reduction (Table 2), indicating that
the tight-binding inhibitors need an epiandrosterone
moiety. In contrast, current observation suggests that
attachment of the indene group to 1 through an Asp
linker does not promote proper binding in the active site
of SjGST and lead to the poor activity.
Compound
#
IC50 (lM)
O
O
O
OH
6
896
H2N
O
O
O
O
H2N
GlyCO2H
N
H
O
CO2H
O
O
7
24
H2N
O
O
O
H2N
GlyCO2H
In addition, compounds 9–11 were prepared using succi-
nyl linkage between GOH and 27–29 to test the influence
of the linker (Scheme 2). The significance is demonstrat-
ed by comparing compounds 6–8 and 9–11—the linkers
are of the same length, but compounds having a succinyl
tether yield an IC50 value about 3-fold lower (Table 2).
All of the tight-binding inhibitors contained both steroid
and succinyl linker. For example, 10 and 12 display IC50
values of 8 and 7 lM, representing a 112- to 128-fold
enhancement over 6. Furthermore, compounds 10–12
are at least 10- to 490-fold more potent than monofunc-
tional compounds 1–5 and 9- to 42-fold more effective
than compounds 38 and 44.
N
H
O
CO2H
O
O
O
8
40
H2N
O
O
O
O
H2N
GlyCO2H
N
H
CO2H
O
O
O
O
OH
9a (a-isomer) 277
9b (b-isomer) 230
O
O
O
H2N
GlyCO2H
N
H
In order to visualize the feasible binding mode between
inhibitors and enzyme, we carried out a molecular mod-
eling study of docking compound 10 to X-ray structure
of SjGST. First, potential binding pockets were identi-
fied using the ActiveSite_Search module within the
InsightII program (see Section 4). Two cavities were
found near the G site and were used to dock the epian-
drosterone moiety. After energy minimization of en-
zyme–ligand complexes, two different and stable
conformations were obtained. One of the complexes
had the inhibitor occupying the same sites as HEX,
IBZ, and PZQ (Fig. 2, conformation 1). The epiandros-
terone moiety was found at the dimer interface with
hydrophobic interaction to both Tyr 104 residues from
each monomer (Fig. 3). The second conformation illus-
trated that the epiandrosterone moiety located near the
H site and the cavity near surface (Fig. 2, conformation
2). If the inhibitor adopted the second conformation,
one GST dimer would be able to bind two inhibitors.
On the other hand, if the inhibitor occupied the dimer
interface just like PZQ, one GST dimer could only inter-
act with one inhibitor. In addition, PZQ would interfere
with this interaction. In order to verify which model is
more appropriate, isothermal titration calorimetry
(ITC) and kinetic study were performed. Figure 4 dem-
onstrates the thermodynamics of 10 binding to SjGST
monomer in a 0.96:1 stoichiometry. The ITC result
unambiguously suggests that 10 did not bind to the di-
mer interface because occupation of the single dimer
interface would simultaneously preclude binding by
another inhibitor. As mentioned above, PZQ is known
to bind to the dimer interface without interfering with
SjGSTꢀs catalytic ability. More significant support was
CO2H
O
O
O
10
11
12
8
14
7
O
O
O
O
O
O
H2N
H2N
H2N
GlyCO2H
N
H
CO2H
CO2H
CO2H
O
O
O
O
O
O
GlyCO2H
N
H
Cl
O
O
O
O
O
GlyCO2H
N
H
disclosed from kinetic effect of PZQ on inhibition of
SjGST by compound 11 (Fig. 5). The IC50 value of 11
(14 lM) for SjGST was not affected by up to 250 lM
PZQ. This strongly indicates that PZQ does not
compete with 11 for SjGST binding at the dimer inter-
face. Both direct evidences favor the second conforma-
tion (Fig. 2, conformation 2) and suggest the ligands

308
S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
Figure 2. Visualization of the binding cavities of SjGST with the
bound inhibitor 10 in two different binding modes (conformation 1 and
conformation 2). The bound inhibitor 10 in conformation 1, occupying
the same sites as HEX, IBZ, and PZQ (red), is shown in yellow. The
conformation 2, occupying the G site and the cavity near surface, is
depicted in green. The symmetric structure of conformation 2 (left
portion of this picture) is displayed in the other SjGST monomer.
Figure 3. Interactions between 10 (conformation 1) and SjGST. The
residues from the other monomer were labeled green.
Figure 4. Isothermal calorimetric titration of SjGST with inhibitor 10.
Top, the exothermic binding effect was observed from the addition of
10 lL aliquots of 125 lM 10 to a 6 lM solution of SjGST. The
concentration was expressed as SjGST monomer; bottom, binding
isotherm corresponding to the integrated heats in the top panel
represents the best fitted curve using ORIGIN 5.0 software.
(10–12) might interact with the G and H sites of SjGST
during inhibitory binding. Interestingly, both conforma-
tions have succinyl linker located in a hydrophobic envi-
ronment surrounded by Ile 10, Tyr 111 or Leu 13. This
+
makes additional NH3 group from the Asp linker less
favorable. A more detailed picture of the interaction be-
tween ligand and SjGST requires an X-ray structure
determination of the complex and the putative steroid
binding site will then be revealed.
3. Conclusions
In summary, we have successfully designed novel and
unsymmetrical inhibitors of SjGST. These compounds
demonstrate the first example to enhance a positive
interaction toward SjGST by manipulating the hydro-
phobicity of the linker and using the steroid moiety as
the inhibitor building block. The present results suggest
that further development of a new generation of SjGST
inhibitors is quite likely to be discovered.
Figure 5. Inhibition of SjGST activity by inhibitor 11 in the presence
or absence of PZQ at a concentration of 100 lM. Each data point
represents the mean of at least three experiments plus or minus
standard error. Activity is expressed as percentage of uninhibited
control.
4. Experimental
4.1. Materials and general methods
enzymes were from Promega or New England Biolabs.
Minipreps and gel extraction DNA purification kits
were from Qiagen. Plasmids pET-15b and pGEX-4T-1
Chemicals were obtained from Aldrich. All amino acids
were purchased from Advanced Chemtech. Restriction

S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
309
were from Novagen and Amersham Pharmacia Biotech,
respectively. Oligonucleotide synthesis and DNA
sequencing reactions were conducted by the MDBio. Hi-
Trap affinity column was purchased from Amersham
Pharmacia Biotech.
Method 11: Vydac 201SP54 C18 column, flow rate 1 mL/
min, using the following gradient: from 50% C, linear to
40% C in 5 min, then linear to 10% C in 15 min, then linear
to 100% B in 5 min, 5 min isocratic, then linear to50% C in
5 min, then isocratic.
Method 12: Vydac 201SP54 C18 column, flow rate 2 mL/
min, using the following gradient: from 30% C, linear to
20% C in 5 min, then linear to 10% C in 20 min, then linear
to 30% C in 5 min, then isocratic.
1H and 13C NMR spectra were recorded with Bruker
AMX400 or 500 MHz instruments. Proton chemical
shifts (d) are reported in parts per million (ppm) relative
to the methine singlet at 7.24 ppm for the residual
CHCl3 in the deuteriochloroform or the methyl pentet
at 3.30 ppm for the residual CHD2OD in the metha-
nol-d4. Carbon chemical shifts are reported in parts
per million relative to the internal 13C signals in CDCl3
(77.0 ppm) and CD3OD-d4 (49.0 ppm). Mass spectra
were obtained with a FAB JMS-700 double focusing
mass spectrometer (JEOL, Tokyo, Japan), MALDI
Voyager DE-PRO (Applied Biosystem Houston,
USA), and ESI Finnigan LCQ mass spectrometer (Ther-
mo Finnigan, San Jose, CA, USA) in negative mode.
The purity of compounds was determined by reverse-
phase analytical HPLC (Waters 2695 System with a
996 PDA detector), using Vydac 201SP54 C18 column
(250 · 4.6 mm, 5 lm) and Sephadex LH-20 (170 · 10
mm) column. The separation procedure was performed
using H2O/0.1% TFA (A), 89.95% CH3CN/10% H2O/
0.05% TFA (B), and 89.9% H2O, 10% CH3CN/0.1%
TFA (C) as eluents. Twelve different methods were used:
Semipreparative reverse-phase HPLC was conducted on
a Vydac 201SP510 C18 column (250 · 10 mm, 5 lm)
using H2O/0.1% TFA (A) and 89.95% CH3CN/10%
H2O/0.05% TFA (B) as eluents; detection at 220,
254 nm with a Waters 2487 dual k absorbance detector.
4.2. Subcloning, expression, and purification of
Schistosoma japonica glutathione S-transferase (SjGST)
The DNA of glutathione S-transferase was amplified
by PCR from plasmid pGEX-4T-1 using oligonucleo-
tides (50–30): GGAATTCCATATGTCCCCTATACT
AG and GCGGGATCCTTATTTTGGAGG having
NdeI and BamHI restriction sites. The resulting prod-
uct was cut by NdeI and BamHI, and ligated into
pET-15b to yield pET15b-GST. This construct allowed
expression of GST in N-terminal fusion with a hexahis-
tidine tag in Escherichia coli under control of IPTG
inducible T7 promoter. The expression construct was
verified by sequence analysis and was transformed into
E. coli strain BL21. A portion (14 mL) of overnight cell
culture was inoculated for each 1 L of culture medium
at 37 ꢁC. IPTG was added to a final concentration of
0.4 mM when the OD600 reached 1.0 in LB media.
The cells were harvested after 4 h by centrifugation at
6000 rpm and stored at ꢀ80 ꢁC. E. coli cells (from
1 L) were resuspended in 30 mL of 20 mM Tris–HCl,
pH 7.4, 0.2 mM DTT at 4 ꢁC. The suspension was passed
twice through a French press. The pressure should not
exceed 11,000 psi. The resulting cell lysate was centri-
fuged at 12,000 rpm for 20 min. To the supernatant were
added 5 M NaCl and 5 M imidazole solution so that the
final concentration of NaCl was 500 mM and imidazole
was 10 mM. The solution was again centrifuged at
12,000 rpm for 20 min and the supernatant was applied
to a fully equilibrated Ni2+ chelating column (bed
volume 5 mL). The column was washed with 25 mL,
20 mM Tris–HCl, pH 7.4, NaCl 500 mM, and imidazole
10 mM. The bound protein was eluted by applying a gra-
dient of imidazole from 10 mM to 300 mM to the col-
umn. Fractions containing GST were pooled and
dialyzed against 20 mM Tris–HCl, pH 7.4, and were
finally stored in 20% glycerol at ꢀ80 ꢁC.
Method 1: Vydac 201SP54 C18 column, flow rate 2 mL/
min, using the following gradient: from 100% A, 15 min
isocratic.
Method 2: Sephadex LH-20 column, flow rate 0.75 mL/
min, using the following isocratic: 100% H2O.
Method 3: Vydac 201SP54 C18 column, flow rate 2 mL/
min, using the following gradient: from 100% A, 12 min
isocratic, linear to 90% B in 8 min, then linear to 100%
A in 7 min, then isocratic.
Method 4: Sephadex LH-20 column, flow rate 0.75 mL/
min, using the following isocratic: 50% H2O, 50% MeOH.
Method 5: Vydac 201SP54 C18 column, flow rate 2 mL/
min, using the following gradient: from 98% A, 5 min
isocratic, linear to 70% A in 15 min, then linear to
50% A in 5 min, then linear to 100% A, then isocratic.
Method 6: Vydac 201SP54 C18 column, flow rate 1 mL/
min, using the following gradient: from 100% C, 5 min
isocratic, linear to 95% C in 10 min, then linear to
100% B, then isocratic.
Method 7: Sephadex LH-20 column, flow rate 0.75 mL/
min, using the following isocratic: 100% MeOH.
Method 8: Vydac 201SP54 C18 column, flow rate 2 mL/
min, using the following gradient: from 60% C, linear to
40% C in 20 min, then linear to 90% B in 5 min, then lin-
ear to 60% C in 5 min, then isocratic.
Method 9: Vydac 201SP54 C18 column, flow rate 1 mL/
min, using the following gradient: from 70% C, linear to
55% C in 10 min, then linear to 100% B in 4 min, 1 min
isocratic, then linear to 70% C in 14 min, then isocratic.
Method 10: Vydac 201SP54 C18 column, flow rate
1 mL/min, using the following gradient: from 90% C,
linear to 85% C in 20 min, then linear to 20% C in
5 min, 1 min isocratic, then linear to 90% C in 6 min,
then isocratic.
4.3. SjGST assays
Ten nanomoles of SjGST was incubated with 1 mM
CDNB in 0.1 M potassium phosphate buffer, pH 6.5, in
a total volume of 225 lL at 30 ꢁC for 3 min. The reaction
was initiated by adding 25 lL of 10 mM GSH and moni-
tored at 340 nm. To determine the IC50, various concen-
trations of the inhibitor were incubated with SjGST for
3 min prior to initiation by GSH. The IC50 values were

310
S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
obtained by fitting the data to the equation
Vi = V0/[(1 + Cinh)/IC50], where Cinh is the concentration
of the inhibitor.
resulting structure suggested that the methyl group from
Thr has van der Waals strain with the residue Trp 8
(Fig. 1).
4.4. Isothermal titration calorimetry
Then again, GST–GOH obtained from previous calcula-
tion was used as the receptor to dock succinyl epian-
drosterone moiety in the binding site. The binding
pockets were identified using the ActiveSite_Search
function within the Binding_Site module in the insightII
program (Accelrys, San Diego, CA). The grid size was
set to 1.4 A. The cutoff size and the site opening were
set to default values which were 50 grid points and
˚
7 A, respectively. GOH moiety was treated as part of
the protein. Cavities reported from the calculation were
ignored if not close to the G site. This lead to two big
pockets for docking succinyl epiandrosterone moiety
(Fig. 2). On the other hand, the succinyl epiandroster-
one moiety was built on the androsten-3b-ol-17-one tak-
en from the X-ray structure, 1E3R.47 The succinyl linker
was constructed using Builder module within the pro-
gram. The dihedral angles of the succinyl linker were
adjusted such that it resembled the dihedral angles of
the S-hexyl moiety in the X-ray structure (1M9A). At
the first stage simulation, GST and the GOH moieties
were fixed. The complex was subjected to 1000 steps of
minimization using conjugate gradients. After the mini-
mization, the whole inhibitor was free to move and sub-
jected to another 1000 steps of minimization. This
construction generated the first conformation (Fig. 2).
To lead epiandrosterone moiety to take the other cavity
near the surface, the dihedral angles of the succinyl link-
er were rotated manually to dock epiandrosterone moi-
ety to the enzyme. Again, after two stages of
minimization, conformation 2 was generated (Fig. 2).
Thermodynamic analysis of the interaction between
SjGST and 10 was performed using a VP-ITC microcal-
orimeter (MicroCal, Inc., Northhampton, MA). The
protein (6 lM monomer) solution in the calorimetric cell
was titrated with inhibitor 10 (125 lM) solution dis-
solved in the same buffer (10 mM potassium phosphate,
pH 6.5, and 10% DMSO). Both solutions were degassed
under vacuum for 10 min. All experiments were per-
formed at 25 ꢁC with a 300 lL injection syringe. The
titration solution was injected with a stirring speed of
300 rpm at discrete intervals of 240 s. Titrations were
performed by injecting 10 lL of 10 stock into the ITC
sample cell containing 6 lM SjGST. The data were inte-
grated and fitted using a one-site binding model with the
ORIGIN 5 analysis software (MicroCal).
˚
4.5. Modeling of the inhibitor SjGST complex
Models of the SjGST complexed with the inhibitor mol-
ecules, c-glutamyl-L-threonylglycine (2) or epiandroster-
one-succinyl-glutathione (10), were generated by
Discover within InsightII program (Accelrys, San
Diego, CA). The starting geometry was taken from the
crystallographic coordinates of SjGST and its inhibi-
tors, S-hexyl glutathione, from the Protein Data Bank,
1M9A.40 Compared with the other two SjGST struc-
tures, 1M9B and 1GTB, the water molecules, which
˚
were 5 A close to the bound inhibitors, that is, S-hexyl
glutathione, S-2-iodobenzyl glutathione, and praziquan-
tel, were removed. After deleting the S-hexyl moiety,
hydrogen atoms were added to the glutathione and the
protein by insight II automatically. Finally, the sulfur
atom in the glutathione was replaced by an oxygen to
give c-glutamyl-L-serylglycine (GOH). The partial
charges were assigned using CFF91 force field. This
GOH bound GST was then subjected to energy minimi-
zation as described below. All heavy atoms were teth-
ered using harmonic restraints and energy minimized
using conjugated gradient until the maximum derivative
4.6. Synthesis and characterization of monofunctional
inhibitors
4.6.1. c-Glutamyl-L-serylglycine (1). Compound 15
(0.14 g, 0.16 mmol) was dissolved in TFA (3 mL) with
2% ddH2O (60 lL) and the reaction mixture was stirred
at 0 ꢁC for 2 h. The TFA solution was then removed on
a rotary evaporator and the residue was used membrane
(MWCO = 100) to remove salt. The residue was dissolved
in water/TFA (100:0.1) and then purified by RP-HPLC
(isocratic: 100% A). The product 1was obtained as a white
solid (78 mg, 37%) upon lyophilization. 1H NMR (D2O,
400 MHz) d 4.52 (t, J = 5.3 Hz, 1H), 4.04–4.01 (m, 3H),
3.90 (d, J = 5.3 Hz, 2H), 2.62 (td, J = 7.2, 2.3 Hz, 2H),
2.27–2.22 (m, 2H); 13C NMR (D2O, 100 MHz) d 174.6,
173.0, 172.3, 61.0, 55.5, 52.7, 41.0, 30.9, 25.5; MS (FAB,
m/z) 292 (M+H)+; HRFABMS calcd for C10H18O7N3
292.1145, found 292.1144; Analytical HPLC: Method 1:
tR, 7.99 min; single peak (100% area); Method 2: tR,
9.10 min (97% area).
˚
was less than 0.5 kcal/(molA). The restraints were then
only applied to the backbone of GST and the heavy
atoms of GOH. The whole structure was again mini-
mized until the maximum derivative was less than
˚
0.25 kcal/(molA). Finally, the restraints were removed
and minimized until the maximum derivative was less
˚
than 0.1 kcal/(molA). This structure, GST–GOH, was
used as the starting coordinates for constructing c-glut-
amyl-L-threonylglycine bound GST and docking succi-
nyl epiandrosterone moiety in the future steps.
To build c-glutamyl-L-threonylglycine bound GST, the
serine residue in GOH was replaced by a threonine. Res-
4.6.2. c-Glutamyl-L-threonylglycine (2). The similar path-
way used to prepare 1 synthesized this compound. The
product was purified by RP-HPLC (isocratic: 100% A)
˚
idues located beyond 5 A of the molecule were tethered.
1
The whole complex was then subjected to 1000 steps of
energy minimization, 1000 steps of dynamics at 300 K,
and finally 1000 steps of energy minimization untill the
to give 2 (56 mg, 66%) upon lyophilization. H NMR
(D2O, 400 MHz) d 4.44 (d, J = 3.5 Hz, 1H), 4.32 (m,
1H), 4.14–4.04 (m, 3H), 2.73–2.65 (m, 1H), 2.31–2.27
(m, 1H), 1.30 (d, J = 5.1 Hz, 3H); 13C NMR (D2O,
˚
maximum derivative was less than 0.1 kcal/(molA). The

S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
311
100 MHz) d 174.8, 173.1, 172.6, 172.4, 67.0, 59.1, 52.9,
41.1, 31.0, 25.7, 18.7; MS (FAB, m/z) 306 (M+H)+;
HRFABMS calcd for C11H20O7N3 306.1301, found
306.1304; Analytical HPLC: Method 1: tR, 8.30 min, sin-
gle peak (100% area); Method 2: tR, 8.68 min (93% area).
The residue was dissolved in EtOAc, washed with water,
dried over Na2SO4, and concentrated in vacuo. The prod-
uct was purified by silica gel chromatography (hexane/
EtOAc 7:3 to6:4)toafford 13(1.96 g, 90%)asa white solid.
TLC (SiO2, hexane/EtOAc 3:7): Rf = 0.60; mp124–125 ꢁC;
1H NMR (CDCl3, 400 MHz) d 7.80 (d, J = 7.5 Hz, 2H),
7.64 (d, J = 6.2 Hz, 2H), 7.44 (t, J = 7.4 Hz, 2H), 7.34
(td, J = 7.5, 1.0 Hz, 2H), 7.01 (br, 1H), 6.23 (d,
J = 7.0 Hz, 1H), 4.46 (d, J = 6.8 Hz, 2H), 4.42 (s, 1H),
4.25 (t, J = 6.9 Hz, 1H), 4.10 (d, J = 9.6 Hz, 1H), 4.00 (d,
J = 4.3 Hz, 2H), 3.78 (dd, J = 11.2, 5.6 Hz, 1H), 3.51 (s,
1H), 1.50 (s, 9H); 13C NMR (CDCl3, 100 MHz) d 171.1,
169.0, 156.5, 143.6, 141.2, 127.6, 127.0, 125.0, 119.9, 82.5,
67.2, 62.9, 55.9, 47.0, 42.1, 27.9; MS (FAB, m/z) 441
(M+H)+; HRFABMS calcd for C24H29N2O6 441.2026,
found 441.2017.
4.6.3. N5-[(1S)-2-[(Carboxymethyl)amino]-1-(cyanometh-
yl)-2-oxoethyl]glutamine (3). Compound 3 was synthe-
sized from 23 by the similar pathway used to prepare 1.
Tripeptide 3 was purified by RP-HPLC (gradient: 100%
A, 12 min isocratic, 8 min to 10% A and 90% B) and
was obtained as a white solid (74 mg, 48%) upon lyophi-
lization. 1H NMR (D2O, 400 MHz) d 4.88–4.85 (m,
1H), 4.06–4.03 (m, 3H), 3.07 (dd, J = 7.8, 5.5 Hz, 2H),
2.65–2.60 (m, 2H), 2.29–2.23 (m, 2H); 13C NMR (D2O,
100 MHz) d 174.5, 173.0, 171.9, 172.0, 118.1, 52.5, 49.4,
41.2, 30.9, 25.4, 20.0; MS (FAB, m/z) 301 (M+H)+;
HRFABMS calcd for C11H17N4O6 301.1148, found
301.1148; Analytical HPLC: Method 3: tR, 9.26 min
(100% area); Method 4: tR, 8.62 min (98% area).
4.6.7. tert-Butyl-N-(tert-butoxycarbonyl)-a-(tert-butyl)-c-
glutamyl-L-serylglycinate (15). Compound 13 (1.96 g,
4.45 mmol) was dissolved in CH2Cl2 (10 mL). DBU
(0.7 mL, 4.67 mmol) was added dropwise and the reaction
mixture was stirred at 25 ꢁC for 20 min. The solvent was
then removed on a rotary evaporator and the residue
was purified by flash chromatography (5:5 hexane/EtOAc
to 9:1 CH2Cl2/MeOH) to afford the Fmoc-deprotected
dipeptide as an oil (0.95 g, 98%). TLC (SiO2, CH2Cl2/
MeOH 9:1): Rf = 0.20. The Fmoc-deprotected dipeptide
(0.95 g, 4.36 mmol), Boc-Glu-O-tBu (1.19 g, 3.92 mmol),
and HBTU (1.65 g, 4.36 mmol) were dissolved in dry
DMF (15 mL) at room temperature under nitrogen, and
DIPEA (2.28 mL, 13.08 mmol) was added dropwise.
The resulting solution was stirred at 25 ꢁC for 40 min
and then concentrated in vacuo. EtOAc was added to
the reaction residue, which was then washed repeatedly
with water. The organic layers were dried over anhydrous
Na2SO4 and filtered, and the filtrate evaporated. The res-
idue was purified by silica gel column chromatography
(hexane/EtOAc 7:3 to 6:4) to obtain the desired product
15 as a white crystal (1.58 g, 72%). TLC (SiO2, hexane/
4.6.4. c-Glutamyl-5-azanylidyne-L-norvalylglycine (4).
Compound 4 was synthesized from 24 by the similar
pathway used to prepare 3. The final product 4 was puri-
fied by RP-HPLC (gradient: 100% A, 12 min isocratic,
8 min to 10% A and 90% B) to afford a white solid
(43 mg, 50%) upon lyophilization. 1H NMR (D2O,
400 MHz) d 4.54 (dd, J = 9.3, 5.1 Hz, 1H), 4.07 (d,
J = 3.8 Hz, 2H), 4.01 (t, J = 6.4 Hz, 1H), 2.67 (t,
J = 7.1 Hz, 2H), 2.63–2.56 (m, 2H), 2.32 (m, 3H),
2.13–2.07 (m, 1H); 13C NMR (D2O, 100 MHz) d
174.6, 173.1, 173.0, 172.4, 120.5, 52.9, 52.6, 41.1, 31.0,
26.6, 25.5, 13.5; MS (FAB, m/z) 315 (M+H)+;
HRFABMS calcd for C12H19O6N4 315.1305, found
315.1299; Analytical HPLC: Method 3: tR time,
9.26 min, single peak (100% area); Method 2: tR
8.62 min, single peak (>98% area).
4.6.5. c-Glutamyl-(c-methoxycarbonyl)-a-glutamylgly-
cine (5). Compound 5 was synthesized from 26 by the sim-
ilar pathway used to prepare 3. The final product 5 was
purified by RP-HPLC (gradient: 98% A and 2% B,
5 min isocratic, 15 min to 70% A and 30% B, and then
5 min to 50% A and 50% B) to afford a white solid
(30 mg, 50%) upon lyophilization. 1H NMR (D2O,
400 MHz) d 4.42 (dd, J = 8.8, 5.7 Hz, 1H), 4.08–3.98
(m, 3H), 3.73 (s, 3H), 2.61–2.53 (m, 4H), 2.26–2.16 (m,
3H), 2.09–2.02 (m, 1H); 13C NMR (D2O, 100 MHz) d
157.7, 156.6, 156.1, 155.2, 154.3, 40.6, 40.3, 40.0, 29.3,
19.3, 19.6, 18.6, 15.1, 14.5; MS (FAB, m/z) 348 (M+H)+,
HRFABMS calcd for C13H22O8N3 348.1400, found
348.1400; Analytical HPLC: Method 5: tR, 12.77 min, sin-
gle peak (100% area); Method 2: tR, 8.96 min, single peak
(100% area).
1
EtOAc 3:7): Rf = 0.40; H NMR (CDCl3, 400 MHz) d
7.29 (br, 1H), 6.96 (d, J = 6.1 Hz, 1H), 5.32 (br, 1H),
4.56–4.52 (m, 1H), 4.09 (br, 1H), 3.96 (dd, J = 11.5,
4.1 Hz, 1H), 3.88 (d, J = 5.5 Hz, 2H), 3.71 (dd, J = 10.6,
3.9 Hz, 1H), 3.51 (s, 1H), 2.32 (t, J = 7.3 Hz, 2H), 2.14
(m, 1H), 1.83 (m, 1H), 1.41–1.38 (m, 18H), 1.25–1.20
(m, 9H); 13C NMR (CDCl3, 100 MHz) d 172.7, 171.4,
170,9, 168, 9, 155.8, 82,3, 80.0, 62.7, 54.5, 53.3, 42.0,
32.1, 28.7, 28.3, 28.0, 27.9; MS (FAB, m/z) 504 (M+H)+;
HRFABMS calcd for C23H41N3O9Na 526.2741, found
526.2749.
4.6.8. N-(tert-Butoxycarbonyl)-5-nitrilo-L-norvaline (20).
A solution of Boc-L-glutamine (3 g, 12.2 mmol) in
60 mL pyridine and acetic anhydride (1.38 mL,
14.6 mmol) was stirred at room temperature overnight
and concentrated. EtOAc was added to the reaction res-
idue, which was then washed repeatedly with 6% HCl
and brine. The organic layers were dried over anhydrous
MgSO4 and filtered, and the filtrate evaporated. The res-
idue was purified by silica gel column chromatography
(5:5 hexane/EtOAc to 9:1 CH2Cl2/MeOH) to afford
the desired product 20 as a white crystal (2.67 g, 95%).
4.6.6. tert-Butyl-N-[(9H-fluoren-9-ylmethoxy)carbonyl]-L-
serylglycinate (13). Fmoc-Ser-OH (1.63 g, 4.98 mmol), H-
Gly-O-t-BuÆHCl (876 mg, 5.23 mmol), and HBTU
(2.08 g, 5.48 mmol) were dissolved in dry DMF (15 mL)
at room temperature under nitrogen. DIPEA (2.61 mL,
14.94 mmol) was added dropwise over a period of 5 min.
The resulting solution was stirred at 25 ꢁC for 40 min and
the solvent was then removed under reduced pressure.
1
TLC (SiO2, 2/8 MeOH/CH2Cl2): Rf = 0.25; H NMR

312
S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
(DMSO-d6, 400 MHz) d 7.06 (d, J = 6.2 Hz, 1H),
3.92–3.91 (m, 1H), 2.48 (t, J = 5.5 Hz, 2H), 1.99–1.94
(m, 1H), 1.83–1.79 (m, 1H), 1.34 (s, 9H); 13C NMR
(DMSO-d6, 100 MHz) d 173.1, 155.7, 119.9, 78.4, 52.4,
28.2, 28.0, 26.7, 13.7; MS (FAB, m/z) 229 (M+H)+.
used to prepare 23. Tripeptide 24 was obtained as a white
crystal (1.47 g, 45%). TLC (3:7 hexane/EtOAc): Rf = 0.6;
1H NMR (CDCl3, 400 MHz) d 6.92 (d, J = 5.1 Hz, 1H),
6.89 (t, J = 3.8 Hz, 1H), 5.27 (d, J = 5.1 Hz, 1H), 4.59
(dd, J = 10.6, 5.6 Hz, 1H), 4.10 (s, 1H), 3.89 (d,
J = 4.3 Hz, 2H), 2.54–2.46 (m, 2H), 2.34–2.25 (m, 3H),
2.18–2.16 (m, 1H), 2.07–2.00 (m, 1H), 1.82–1.79 (m,
1H), 1.45 (s, 9H), 1.44 (s, 9H), 1.42 (s, 9H); 13C NMR
(CDCl3, 100 MHz) d 172.6, 171.3, 170.5, 168.4, 155.8,
119.2, 82.2, 82.1, 79.8, 53.3, 51.7, 41.9, 32.1, 28.67, 28.2,
27.9, 27.9, 13.6;MS(FAB, m/z)527(M+H)+,HRFABMS
calcd for C25H43O8N4 527.3074, found 527.3081.
4.6.9. tert-Butyl-N-{(2S)-2-[(tert-butoxycarbonyl)amino]-
3-cyanopropanoyl}glycinate (21). To a solution of Boc-
Asn-OH (3.0 g, 13.3 mmol) in dry pyridine (20 mL)
was added DCC (2.89 g, 13.9 mmol) in dry acetone
(40 mL) under nitrogen. The suspension was stirred at
room temperature for 2 h and the DCC salt was separat-
ed from the reaction mixture by filtration. The filtrate
was concentrated and CHCl3 was added to the reaction
residue, which was then washed repeatedly with 6%
HCl(aq) and water. The organic layers were dried over
anhydrous Na2SO4 and filtered, and the filtrate evapo-
rated. The crude product was crystallized from EtOAc/
hexane (1:1) to give (2S)-2-[(tert-butoxycarbonyl)ami-
no]-3-cyanopropanoic acid (19) as a white crystal
(2.1 g, 75%). TLC (SiO2, 9:1 CH2Cl2/MeOH): Rf = 0.1.
Compound 21 was synthesized starting from 19 by the
similar pathway used to prepare 13. Dipeptide 21 was
obtained as a white crystal (2.6 g, 79%). TLC (SiO2,
9:1 CH2Cl2/MeOH): Rf = 0.6; 1H NMR (CDCl3,
400 MHz) d 7.18 (s, 1H), 5.93 (s, 1H), 4.57 (m, 1H),
3.85 (t, J = 4.9 Hz, 2H), 2.83 (d, J = 3.8 Hz, 2H), 1.38
(s, 18H); 13C NMR (CDCl3, 100 MHz) d 169.1, 168.4,
155.2, 116.9, 82.3, 80.8, 50.4, 42.0, 28.1, 27.8, 21.1; MS
(FAB, m/z) 328 (M+H)+; HRFABMS calcd for
C15H26O5N3 328.1872, found 328.1876.
4.7. Synthesis and characterization of bifunctional
inhibitors
4.7.1. [(3aR,5S,7aR)-3a,5-Dihydroxy-7a-methyloctahydro-
1H-inden-1-one]-aspartyl-glutathione (6). To a stirring
solution of 40 (105 mg, 0.1 mmol) in anhydrous CH2Cl2
(5 mL) was added neat DBU (14 lL, 0.18 mmol). The
mixture was stirred at room temperature for 30 min.
The resulting solution was then removed on a rotary evap-
orator and the residue was purified by flash chromatogra-
phy (5:5 hexane/EtOAc to EtOAc) to afford the free amine
compound as a white crystal (74 mg, 95%). TLC (SiO2,
EtOAc): Rf = 0.1. A solution of the free amine (74 mg,
0.1 mmol), TFA (2 mL), and 2% ddH2O (40 lL) was stir-
red at 0 ꢁC for 2 h. The TFA solution was then removed
on a rotary evaporator and the colorless oil was triturated
with ether to give 6 as a white precipitate. The precipitate
was dissolved in water/acetonitrile/TFA (70:30:0.1) and
the crude product was purified by RP-HPLC (gradient:
100% A, 5 min isocratic, 10 min to 95% A and 5% B,
and then in 12 min to 100% B). The product 6 was ob-
tained as a white solid (74%); 1H NMR (D2O,
400 MHz) d 5.15–5.14 (m, 1H), 4.78–4.77 (m, 1H), 4.56
(dd, J = 11.5, 4.8 Hz, 1H), 4.51 (t, J = 5.0 Hz, 1H), 4.42
(dd, J = 11.5, 4.3 Hz, 1H), 4.09–4.00 (m, 3H), 3.27 (dd,
J = 18.3, 5.8 Hz, 1H), 3.16 (dd, J = 18.3, 4.7 Hz, 1H),
2.67–2.58 (m, 3H), 2.52–2.45 (m, 1H), 2.26–2.06 (m,
5H), 1.87–1.84 (m, 2H), 1.76 (dd, J = 14.5, 8.3 Hz, 1H),
1.46–1.36 (m, 2H), 1.03 (s, 3H); 13C NMR (D2O,
100 MHz) d 225.7, 174.7, 173.0, 172.4, 171.1, 170.6,
168.1, 78.7, 73.4, 64.7, 53.1 (d, J = 27.1 Hz), 52.4, 49.2,
41.3, 38.5, 34.2, 33.8, 31.8, 31.1, 26.7, 26.2, 25.6, 16.3;
MS (FAB, m/z) 573 (M+H)+; HRFABMS calcd for
C24H37O12N4 573.2408, found 573.2401; Analytical
HPLC: Method 6: tR, 4.04 min, single peak (100% area);
Method 4: tR 10.84 min, single peak (100% area).
4.6.10. tert-Butyl-5-azanylidyne-N-(tert-butoxycarbonyl)-
L-norvalylglycinate (22). Compound 22 was synthesized
from 20 by the similar pathway used to prepare 21. Dipep-
tide 22 was obtained as a white crystal (1.76 g, 88%). TLC
(3:7 hexane/EtOAc): Rf = 0.65; 1H NMR (CDCl3,
400 MHz) d 5.79 (s, 1H), 5.14 (s, 1H), 4.03 (br, 2H),
2.47–2.36 (m, 2H), 2.14–2.13 (m, 1H), 1.91–1.89 (m, 1H),
1.45 (s, 9H), 1.42 (s, 9H); 13C NMR (CDCl3, 100 MHz)
d 170.8, 168.5, 155.6, 119.0, 82.3, 80.5, 41.9, 28.7, 28.2,
28.0, 13.7; MS (FAB, m/z) 342 (M+H)+, HRFABMS
calcd for C16H28O5N3 342.2029, found 342.2024.
4.6.11. N5-[(1S)-2-[(2-tert-Butoxy-2-oxoethyl)amino]-1-
(cyanomethyl)-2-oxoethyl]-N2-(tert-butoxycarbonyl)gluta-
mine tert-butyl ester (23). Compound 23 was synthesized
from 21 by the similar pathway used to prepare 15. Tri-
peptide 23 was obtained as a white crystal (1.1 g, 69%).
TLC (SiO2, EtOAc): Rf = 0.75; 1H NMR (CDCl3,
400 MHz) d 7.46 (d, J = 6.4 Hz, 1H), 7.34 (d, J = 4.6 Hz,
1H), 5.38 (d, J = 7.1 Hz, 1H), 4.81 (d, J = 6.7 Hz, 1H),
4.17 (s, 1H), 3.90 (dd, J = 5.4, 1.7 Hz, 2H), 2.95 (m, 1H),
2.42–2.36 (m, 4H), 2.18–2.14 (m, 1H), 1.85–1.83 (m, 1H),
1.44 (s, 9H), 1.43 (s, 9H), 1.41 (s, 9H); 13C NMR (CDCl3,
100 MHz) d 172.8, 171.3, 168.7, 168.4, 156.0, 117.1, 82.4,
82.3, 80.1, 53.1, 49.6, 42.1, 32.1, 29.0, 28.3, 28.0, 27.9,
20.2; MS (FAB, m/z) 513 (M+H)+; HRFABMS calcd
for C24H41N4O8 513.2924, found 513.2942.
4.7.2. Epiandrosterone-aspartyl-glutathione (7). Com-
pound 7 was prepared from 41 by the similar pathway
used to prepare 6. The final crude product was dissolved
in water/acetonitrile/TFA (60:40:0.1) and purified by
RP-HPLC (gradient: 60% A and 40% B, 25 min to 40%
A and 60% B, and then in 5 min to 10% A and 90% B).
1
The product 7 was obtained as a white solid (30%). H
NMR (CDCl3, 400 MHz) d 4.82 (t, J = 5.0 Hz, 1H),
4.64 (d, J = 5.6 Hz, 2H), 4.40 (t, J = 5.4 Hz, 1H), 4.03–
3.93 (m, 3H), 3.12 (d, J = 5.5 Hz, 2H), 2.66–2.62 (m,
2H), 2.47 (dd, J = 19.1, 8.9 Hz, 1H), 2.25–2.22 (m, 2H),
2.12–2.07 (m, 1H), 1.90–1.77 (m, 5H), 1.70–1.48 (m,
6H), 1.44–1.26 (m, 7H), 1.14–1.10 (m, 2H), 0.94 (s, 3H),
4.6.12. tert-Butyl-N-(tert-butoxycarbonyl)-a-(tert-butyl)-
c-glutamyl-5-azanylidyne-L-norvalylglycinate (24). Com-
pound 24 was synthesized from 22 by the similar pathway

S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
313
0.91 (s, 3H), 0.82–0.81 (m, 1H); 13C NMR (CDCl3,
125 MHz) d 229.7, 174.5, 172.5, 172.2, 171.0, 170.3,
168.2, 77.8, 64.4, 53.6, 52.9, 52.3, 50.7, 49.0, 48.5, 44.0,
41.0, 36.0, 35.9, 35.1, 34.4, 33.6, 33.0, 30.9, 30.3, 27.8,
26.6, 25.5, 21.3, 20.0, 13.2, 11.4; MS (m/z) 679 (M+H)+;
HRMS-MALDI calcd for C33H51N4O11 (M+H)+,
679.3554, found 679.3553; Analytical HPLC: Method 8:
tR, 8.62 min (98% area); Method 7: tR 12.44 min (97%
area).
20% A and 80% B) to afford 9b as a white solid (68%).
1H NMR (MeOH-d4, 400 MHz) d 5.03–4.99 (m, 1H),
4.73 (dd, J = 6.0, 4.9 Hz, 1H), 4.40 (dd, J = 11.3,
4.8 Hz, 1H), 4.34 (dd, J = 11.3, 6.2 Hz, 1H), 3.98 (t,
J = 6.3 Hz, 1H), 3.94 (d, J = 2.8 Hz, 2H), 2.65–2.57
(m, 6H), 2.53–2.44 (m, 1H), 2.36–2.11 (m, 4H), 2.04–
1.95 (m, 2H), 1.93–1.77 (m, 3H), 1.60 (dd. J = 14.1,
8.4 Hz, 1H), 1.38–1.29 (m, 2H), 0.98 (s, 3H); 13C
NMR (D2O, 100 MHz) d 226.4, 174.6, 174.4, 174.2,
172.9, 172.4, 171.3, 78.8, 70.9, 63.8, 53.3, 52.9, 52.7,
41.3, 38.3, 34.2, 31.9, 31.1, 29.4, 28.9, 26.9, 25.9, 25.7,
15.7; MS (FAB, m/z) 558 (M+H)+; HRFABMS calcd
for C24H36O12N3 558.2299, found 558.2293; Analytical
HPLC: Method 10: tR, 6.44 min, single peak (98% area);
Method 4: tR 11.31 min, single peak (100% area).
4.7.3. Prasterone-aspartyl-glutathione (8). Compound 8
was prepared from 42 by the similar pathway used to pre-
pare 6. The crude product was dissolved in water/acetoni-
trile/TFA(70:30:0.1)andpurified byRP-HPLC(gradient:
70% A and 30% B, 10 min to 55% A and 45% B, and then
in 4 min to 100% B). Tripeptide 8 was obtained as a white
solid(48 mg, 48%). 1H NMR(MeOH-d4, 500 MHz) d5.52
(d, J = 5.0 Hz, 1H), 4.77–4.76 (m, 1H), 4.74–4.68 (m, 1H),
4.60 (dd, J = 11.3, 4.9 Hz, 1H), 4.49 (t, J = 5.0 Hz, 1H),
4.40 (dd, J = 11.4, 4.0 Hz, 1 H), 4.07–3.97 (m, 3H), 3.29
(dd, J = 18.1, 5.4 Hz, 1H), 3.14 (dd, J = 18.1, 4.9 Hz,
1H), 2.62 (t, J = 5.9 Hz, 2H), 2.56 (dd, J = 19.4, 8.4 Hz,
1H), 2.39–2.37 (m, 2H), 2.24–1.91 (m, 9H), 1.81–1.53
(m, 7H), 1.41–1.10 (m, 3H), 1.08 (s, 3H), 0.89 (s, 3H);
13C NMR (D2O, 100 MHz) d 229.3, 174.7, 172.9, 172.7,
171.1, 170.5, 168.2, 140.4, 122.9, 77.8, 64.7, 53.2, 52.5,
51.2, 49.8, 49.2, 48.4, 48.1, 41.3, 37.2, 36.6, 36.4, 36.1,
33.9, 31.2, 31.1, 30.9, 30.5, 26.9, 25.7, 21.6, 20.0, 18.9,
13.1; MS (FAB, m/z) 677 (M+H)+; HRFABMS calcd
for C33H48O11N4Na 699.3217, found 699.3217; Analyti-
cal HPLC: Method 9: tR, 5.36 min (93% area); Method
7: tR 12.07 min, single peak (99% area).
4.7.6. Epiandrosterone-succinyl-glutathione (10). Com-
pound 10 was prepared from 48 by the similar pathway
used to prepare 9a. The crude product was purified by
RP-HPLC (gradient: 50% A, 5 min to 40% A, 15 min to
10% A, and then 5 min to 100% B) to afford 10 as a white
1
solid (34%). H NMR (MeOH-d4, 400 MHz) d 4.67 (t,
J = 5.9 Hz, 1H), 4.64–4.60 (m, 1H), 4.34 (dd, J = 11.3,
4.8 Hz, 1H), 4.29 (dd, J = 11.3, 6.2 Hz, 1H), 3.96 (t,
J = 6.4 Hz, 1H), 3.88 (d, J = 1.9 Hz, 2H), 2.57–2.54 (m,
6H), 2.38 (dd, J = 19.1, 8.7 Hz, 1H), 2.17–1.88 (m, 4H),
1.79–1.45 (m, 9H), 1.36–1.14 (m, 7H), 1.04–0.98 (m,
2H), 0.85 (s, 3H), 0.82 (s, 3H), 0.75–0.69 (m, 1H); 13C
NMR (MeOH-d4, 100 MHz) d 224.1, 174.7, 174.0,
173.92, 172.7, 171.8, 171.6, 75.6, 64.8, 55.9, 54.0, 53.8,
52.9, 46.2 42.0, 38.0, 36.9, 36.8, 36.5, 35.2, 33.0, 32.5,
32.1, 30.4, 30.0, 29.7, 28.6, 27.1, 22.8, 21.7, 14.3, 12.7;
MS (FAB, m/z) 664 (M+H)+; HRFABMS calcd for
C33H50O11N3 664.3445, found 664.3445; Analytical
HPLC: Method 11: tR, 4.77 min, single peak (100% area);
Method 7: tR 10.40 min, single peak (100% area).
4.7.4. [(3aR,5R,7aR)-3a,5-Dihydroxy-7a-methyloctahy-
dro-1H-inden-1-one]-succinyl-glutathione (9a). A mixture
of 47a (76 mg, 0.16 mmol), TFA (3 mL), and 2% ddH2O
(60 lL) was stirred at 0 ꢁC for 2 h. The TFA solution
was then removed on a rotary evaporator and the color-
less oil was triturated with ether to give a white precip-
itate. The crude precipitate was dissolved in water/
acetonitrile/TFA (70:30:0.1) and purified by RP-HPLC
(gradient: 90% A, 20 min to 85% A, then in 5 min to
4.7.7. Prasterone-succinyl-glutathione (11). Compound
11 was prepared from 49 by the similar pathway used
to prepare 9a. The crude product was dissolved in
water/acetonitrile/TFA (70:30:0.1) and purified by RP-
HPLC (gradient: 50% A, 5 min to 40% A, then in
20 min to 100% B) to afford 11 as a white solid
1
20% A) to afford 9a as a white solid (40 mg, 66%). H
1
NMR (D2O, 400 MHz) d 4.90–4.85 (m, 1H), 4.72 (t,
J = 5.8 Hz, 1H), 4.39 (dd, J = 11.3, 4.9 Hz, 1H), 4.34
(dd, J = 11.5, 6.2 Hz, 1H), 4.00 (t, J = 6.4 Hz, 1H),
3.93 (d, J = 2.0 Hz, 2H), 2.65–2.57 (m, 6H), 2.40–2.37
(m, 2H), 2.25–2.08 (m, 4H), 1.86–1.83 (m, 2H), 1.66
(dd, J = 12.5, 11.2 Hz, 1H), 1.53–1.35 (m, 3H), 1.04 (s,
3H); 13C NMR (D2O, 100 MHz) d 223.3, 174.7, 173.9,
173.8, 172.7, 171.8, 171.6, 80.3, 72.6, 64.8, 53.9, 53.8,
42.0, 39.6, 34.4, 32.5, 32.4, 30.4, 30.3, 30.0, 27.5, 27.1,
13.9; MS (LCQ, m/z) 588 (M+H)+; HRFABMS calcd
for C24H36O12N3 558.2299, found 558.2299; Analytical
HPLC: Method 10: tR, 4.23 min, single peak (100%
area); Method 4: tR 9.71 min, single peak (100% area).
(80 mg, 71%). H NMR (MeOH-d4, 400 MHz) d 5.43
(d, J = 4.9 Hz, 1H), 4.72 (dd, J = 6.0, 4.9 Hz, 1H),
4.59–4.52 (m, 1H), 4.41–4.32 (m, 2H), 4.01 (t,
J = 6.5 Hz, 1H), 3.93 (d, J = 1.9 Hz, 2H), 2.64–2.57
(m, 7H), 2.45 (dd, J = 19.1, 8.4 Hz, 1H), 2.34 (d,
J = 7.7 Hz, 2H), 2.22–2.05 (m, 4H), 1.95–1.71 (m, 4H),
1.68–1.53 (m, 6H), 1.36–1.26 (m, 2H), 1.52–1.08 (m,
1H), 1.06 (s, 3H), 1.06–1.04 (m, 1H), 0.89 (s, 3H); 13C
NMR (MeOH-d4, 100 MHz) d 226.8, 175.1, 174.6,
174.54, 173.4, 171.8, 141.2, 123.3, 76.2, 64.9, 54.2,
53.8, 52.8, 51.5 42.1, 38.9, 38.0, 37.8, 37.0, 32.6, 32.4,
31.7, 30.3, 29.9, 28.6, 27.1, 22.8, 21.3, 19.8, 14.0; MS
(FAB, m/z) 662 (M+H)+; HRFABMS calcd for
C33H48O11N3 662.3289, found 662.3302; Analytical
HPLC: Method 11: tR, 9.39 min, single peak (97% area);
Method 7: tR, 12.26 min (91% area).
4.7.5. [(3aR,5S,7aR)-3a,5-Dihydroxy-7a-methyloctahy-
dro-1H-inden-1-one]-succinyl-glutathione (9b). Com-
pound 9b was prepared from 47b by the similar
pathway used to prepare 9a. The crude product was
purified by RP-HPLC (gradient: 90% A and 10% B,
20 min to 85% A and 15% B, and then in 5 min to
4.7.8. (17-Chloro-3b-hydroxy-androsta-5,16-diene)-succi-
nyl-glutathione (12). Compound 12 was prepared from
50 by the similar pathway used to prepare 9a. The crude

314
S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
product was purified by RP-HPLC (gradient: 30% A
and 70% B, 5 min to 20% A and 80% B, and then in
20 min to 10% A and 90% B) to afford 12 as a white sol-
141.2, 141.1, 127.6, 127.0, 125.1, 125.0, 119.9, 81.6,
76.7, 75.0, 67.1, 54.1, 51.2, 50.6, 47.6, 47.0, 44.4, 37.7,
36.5, 35.7, 35.5, 34.9, 34.8, 33.6, 31.4, 30.6, 28.1, 28.0,
27.9, 27.9, 27.2, 21.7, 20.4, 13.7, 12.1; MS (m/z) 684
(M+H)+; HRMS-MALDI calcd for C42H54NO7
(M+H)+ 684.3900, found 684.3903.
1
id (29%). H NMR (MeOH-d4, 500 MHz) d 5.61–5.61
(m, 1H), 5.39 (d, J = 4.4 Hz, 1H), 4.70 (t, J = 5.9 Hz,
1H), 4.56–4.49 (m, 1H), 4.37 (dd, J = 11.3, 4.8 Hz,
1H), 4.33 (dd, J = 11.3, 6.1 Hz, 2H), 3.95–3.83 (m,
3H), 2.63–2.54 (m, 6H), 2.31 (d, J = 7.8 Hz, 2H), 2.17–
2.12 (m, 3H), 1.98–1.76 (m, 6H), 1.71–1.48 (m, 6H),
1.31 (td, J = 12.6, 4.6 Hz, 2H), 1.15–1.09 (m, 1H), 1.07
(s, 3H), 0.89 (s, 3H); 13C NMR (MeOH-d4, 125 MHz)
d 174.7, 171.9, 173.9, 172.7, 171.9, 171.6, 146.1, 141.6,
125.9, 123.4, 75.90, 64.8, 57.4, 53.9, 52.2, 42.0, 39.3,
38.3, 38.2, 35.1, 32.2, 32.0, 31.6, 31.0, 30.3, 30.0, 28.9,
27.1, 21.8, 19.8, 15.5; MS (FAB, m/z) 680 M+;
HRFABMS calcd for C33H47O10N3Cl 680.2905, found
680.2944; Analytical HPLC: Method 12: tR, 10.65 min,
single peak (97% area); Method 7: tR 13.85 min, single
peak (100% area).
4.7.11. (5-Androsten-17-one-3b)-yl-b-tert-butyl-N-[(9H-flu-
oren-9-ylmethoxy)carbonyl]-L-aspartate (33). Compound
33 was prepared from 29 by the similar pathway used to
prepare 31. The product 33 was obtained as a white crystal
(1.1 g, 80%). TLC (SiO2, 6:4 hexane/EtOAc): Rf = 0.6;
1
mp = 84–86 ꢁC; H NMR (CDCl3, 400 MHz) d 7.73 (d,
J = 7.5 Hz, 2H), 7.58 (t, J = 6.6 Hz, 2H), 7.37 (t,
J = 7.3 Hz, 2H), 7.28 (td, J = 7.4, 0.9 Hz, 2H), 5.83 (d,
J = 8.5 Hz, 1H), 5.37 (d, J = 4.5 Hz, 1 H), 4.69–4.66 (m,
1H), 4.57–4.52 (m, 1 H), 4.40 (dd, J = 10.4, 7.2 Hz, 1H),
4.31 (dd, J = 10.5, 7.4 Hz, 1H), 4.22 (t, J = 7.2 Hz, 1H),
2.92 (dd, J = 16.8, 4.6 Hz, 1H), 2.75 (dd, J = 16.8, 4.4 Hz,
1H), 2.42 (dd, J = 19.3, 8.6 Hz, 1H), 2.33–2.28 (m, 2H),
2.10–2.01 (m, 2H), 1.91–1.80 (m, 4H), 1.64–1.46 (m, 6
H), 1.44 (s, 9H), 1.29–1.21 (m, 2H), 1.11 (dd, J = 14.6,
4.6 Hz, 1H), 1.00–0.95 (m, 1H), 0.99 (s, 3H), 0.85 (s, 3H);
13C NMR (CDCl3, 100 MHz) d 220.8, 170.0, 169.9,
155.9, 143.8, 143.6, 141.2, 139.5, 127.6, 127.0, 125.1,
125.0, 122.1, 119.9, 81.6, 77.2, 75.2, 67.1, 51.5, 51.5, 50.6,
50.0, 47.4, 47.0, 37.7, 36.7, 36.6, 35.7, 31.3, 31.3, 30.6,
28.0, 28.0, 27.9, 27.9, 27.5, 21.8, 20.2, 19.2, 13.4; MS
(FAB, m/z) 682 (M+H)+; HRFABMS calcd for
C42H52O7N 682.3744, found 682.3755.
4.7.9. 4-[(3aR,5S,7aR)-3a-hydroxy-7a-methyloctahydro-
1H-inden-1-one-5]-yl-b-tert-butyl-N-[(9H-fluoren-9-ylmeth-
oxy)carbonyl]-L-aspartate (31). To a solution of 27b (0.44 g,
2.4 mmol), Fmoc-Asp(O-t-Bu)-OH (1.1 g, 2.4 mmol), and
DMAP (87 mg, 0.7 mmol) in anhydrous CH2Cl2 (50 mL)
was added DCC (0.59 g, 2.8 mmol) in anhydrous CH2Cl2
(1.5 mL) dropwise under nitrogen. The suspension was stir-
red at room temperature for 3 h and then the DCC salt was
separated from the reaction mixture by filtration. The fil-
trate was concentrated and purified by silica gel column
chromatography (hexane/EtOAc 9:1 to 6:4) to afford 31
as a white solid (1.2 g, 84%). TLC (5:5 hexane/EtOAc):
4.7.12. (5a-Androstan-17-one-3b)-yl-N-[(9H-fluoren-9-
ylmethoxy)carbonyl]-L-aspartate (35). To a solution of
32 (590 mg, 0.86 mmol) in dry CH2Cl2 (15 mL) at 0 ꢁC
was added TFA (1 mL, 13 mmol). The solution was stir-
red at 0 ꢁC for 2 h. The resulting mixture was then re-
moved on a rotary evaporator and the residue was
partitioned between CH2Cl2 and NaHCO3. The organic
layer was dried (Na2SO4), filtered, and concentrated.
The crude residue was purified by chromatography (8:2
hexane/EtOAc to 5:5) to afford 35 as a white crystal
(0.5 g, 92%). TLC (6:4 hexane/EtOAc): Rf = 0.15;
1
Rf = 0.5; mp: 72–74 ꢁC; H NMR (CDCl3, 400 MHz) d
7.73 (d, J = 7.5 Hz, 2H), 7.56 (d, J = 7.1 Hz, 2H), 7.37 (t,
J = 7.4 Hz, 2H), 7.27 (t, J = 7.4 Hz, 2H), 5.82 (d,
J = 8.7 Hz, 1H), 5.06–5.05 (m, 1H), 4.53–4.50 (m, 1H),
4.35 (d, J = 7.2 Hz, 2H), 4.20 (t, J = 7.1 Hz, 1H), 2.86
(dd, J = 16.9, 4.5 Hz, 1H), 2.73 (dd, J = 15.9, 3.1 Hz, 1H),
2.48–2.42 (m, 1H), 2.27–2.18 (m, 1H), 2.07–2.01 (m, 1H),
1.96–1.85 (m, 3H), 1.75–1.72 (m, 1H), 1.62–1.56 (m, 1H),
1.41 (s, 9H), 1.37–1.30 (m, 2H), 0.98 (s, 3H); 13C NMR
(CDCl3, 100 MHz) d 218.7, 170.2, 169.9, 156.0, 143.7,
143.6, 141.2, 127.7, 127.0, 125.0, 119.9, 81.9, 78.1, 71.1,
67.3, 52.4, 50.6, 47.0, 40.1, 37.6, 34.2, 32.9, 28.0, 27.1,
26.9, 16.6; MS (FAB, m/z) 578 (M+H)+; HRFABMS calcd
for C33H40O8N 578.2754, found 578, 2750.
1
mp = 103 ꢁC; H NMR (CDCl3, 400 MHz) d 8.55 (br,
1H), 7.73 (d, J = 7.4 Hz, 2H), 7.58 (d, J = 7.5 Hz, 2H),
7.37 (t, J = 7.4 Hz, 2H), 7.30–7.26 (m, 2H), 5.92 (d,
J = 8.4 Hz, 1H), 4.77–4.72 (m, 1H), 4.63–4.59 (m, 1H),
4.47–4.30 (m, 2H), 4.21 (t, J = 7.1 Hz, 1H), 3.06 (dd,
J = 17.2, 4.6 Hz, 1H), 3.06 (dd, J = 17.2, 4.6 Hz, 1H),
2.91 (dd, J = 16.8, 4.4 Hz, 1H), 2.40 (q, J = 8.5 Hz, 1H),
2.06–2.01 (m, 1H), 1.83–1.66 (m, 6H), 1.59–1.56 (m,
2H), 1.49–1.43 (m, 3H), 1.35–1.29 (m, 1H), 1.26–1.25
(m, 5H), 0.96–0.87 (m, 2H), 0.81 (s, 3H), 0.78 (s, 3H),
0.63–0.60 (m, 1H); 13C NMR (CDCl3, 100 MHz) d
221.1, 175.1, 170.0, 156.0, 143.6, 143.6, 141.2, 127.7,
127.0, 125.1, 119.9, 75.4, 67.3, 54.1, 51.2, 50.4, 47.7,
47.0, 44.4, 36.5, 35.7, 35.5, 34.8, 33.5, 31.3, 30.6, 28.1,
27.1, 21.6, 20.3, 13.7, 12.1, 12.1; MS (m/z) 628 (M+H)+;
HRMS-MALDI calcd for C38H46NO7 (M+H)+,
628.3274, found 628.3282.
4.7.10. (5a-Androstan-17-one-3b)-yl-b-tert-butyl-N-[(9H-
fluoren-9-ylmethoxy)carbonyl]-L-aspartate (32). Com-
pound 32 was prepared from 28 by the similar pathway
used to prepare 31. Monopeptide 32 was obtained as a
white crystal (58%). TLC (6:4 hexane/EtOAc):
Rf = 0.6; mp = 82 ꢁC; 1H NMR (CDCl3, 400 MHz) d
7.48 (d, J = 7.5 Hz, 2H), 7.58 (t, J = 6.6 Hz, 2H), 7.37
(t, J = 7.5 Hz, 2H), 7.28 (td, J = 7.4, 1.1 Hz, 2H), 5.82
(d, J = 8.6 Hz, 1H), 4.77–4.74 (m, 1H), 4.54–4.74 (m,
1H), 4.42–4.37 (m, 1H), 4.31–4.28 (m, 1H), 4.22 (t,
J = 7.2 Hz, 1H), 2.90 (dd, J = 16.9, 4.8 Hz, 1H), 2.74
(dd, J = 16.9, 4.5 Hz, 1H), 2.40 (q, J = 8.3 Hz, 1H),
2.05–2.00 (m, 1H), 2.00–1.72 (m, 7H), 1.62–1.46 (m,
5H), 1.43 (s, 9H), 1.28–1.19 (m, 7H), 1.01–0.91 (m,
1H), 0.82 (s, 3H), 0.80 (s, 3H); 13C NMR (CDCl3,
100 MHz) d 221.0, 170.3, 169.9, 155.9, 143.8, 143.6,
4.7.13. (5-Androsten-17-one-3b)-yl-N-[(9H-fluoren-9-ylmeth-
oxy)carbonyl]-L-aspartate (36). Compound 36 was pre-
pared from 33 by the similar pathway used to prepare

S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
315
1
34. The product was purified by chromatography (hex-
ane/EtOAc 8:2 to 5:5) to afford 36 as a yellow crystal
(0.9 g, 89%). TLC (SiO2, 5:5 hexane/EtOAc): Rf = 0.5;
mp = 112–126 ꢁC; H NMR (CDCl3, 400 MHz) d 7.74
Rf = 0.35; mp = 112 ꢁC; H NMR (CDCl3, 400 MHz) d
7.72 (d, J = 7.5 Hz, 2H), 7.62 (d, J = 6.8 Hz, 2H), 7.36
(t, J = 7.3 Hz, 2H), 7.27 (t, J = 7.4 Hz, 2H), 7.14 (br,
1H), 6.98 (br, 1H), 6.42 (br, 1H), 5.22 (d, J = 7.3 Hz,
1H), 4.79–4.58 (m, 3H), 4.39–4.28 (m, 2H), 4.23–4.07
(m, 3H), 3.90 (t, J = 5.3 Hz, 2H), 3.47–3.42 (m, 1H),
3.00–2.85 (m, 2H), 2.43–2.33 (m, 3H), 2.10–2.00 (m,
2H), 1.91–1.87 (m, 3H), 1.77–1.73 (m, 2H), 1.69–1.63
(m, 2H), 1.54–1.49 (m, 3H), 1.39 (m, 27H), 1.35–1.96
(m, 7H), 0.81 (s, 3H), 0.80 (s, 3H), 0.69–0.68 (m, 1H);
13C NMR (CDCl3, 100 MHz) d 221.2, 172.5, 171.4,
170.8, 169.5, 169.1, 168.5, 156.3, 155.7, 143.8, 143.7,
141.2, 127.7, 127.1, 125.2, 119.9, 82.4, 82.2, 79.8, 75.5,
67.3, 64.4, 60.3, 54.1, 53.5, 51.6, 51.3, 50.6, 47.7, 47.0,
44.5, 42.1, 38.6, 37.5, 36.5, 35.8, 35.6, 35.0, 33.8, 32.1,
31.4, 30.7, 28.6, 28.3, 28.2, 27.9, 27.2, 21.7, 20.4, 13.8,
12.2; MS (m/z) 1113 (M+H)+; HRMS-MALDI calcd
for C61H85N4O15 (M+H)+, 1113.6011, found 1113.6014.
1
(d, J = 7.5 Hz, 2H), 7.58 (d, J = 7.3 Hz, 2H), 7.38 (t,
J = 7.4 Hz, 2 H), 7.29 (t, J = 7.5 Hz, 2H), 6.25 (br, 1H),
5.81 (d, J = 8.5 Hz, 1H), 5.38 (d, J = 3.9 Hz, 1H), 4.69–
4.61 (m, 2H), 4.41 (t, J = 7.6 Hz, 1H), 4.35 (t,
J = 7.2 Hz, 1H), 4.22 (t, J = 7.0 Hz, 1H), 3.08 (dd,
J = 17.7, 4.6 Hz, 1H), 2.92 (dd, J = 17.6, 4.2 Hz, 1H),
2.44 (dd, J = 19.3, 8.6 Hz, 1H), 2.31–2.29 (m, 2H), 2.11–
2.02 (m, 2H), 1.94–1.80 (m, 4H), 1.61–1.42 (m, 7H),
1.29–1.22 (m, 2H), 1.14–1.08 (m, 1H), 0.92 (s, 3H), 0.85
(s, 3H); MS (FAB, m/z) 626 (M+H)+; HRFABMS calcd
for C38H44O7N 626.3118, found 626.3125.
4.7.14. [(3aR,5S,7aR)-3a,5-Dihydroxy-7a-methyloctahy-
dro-1H-inden-1-one]-aspartyl-glutathione ester (40). TFA
(7 mL, 97 mmol) was added dropwise to a stirred solution
of compound 31 (1.0 g, 1.6 mmol) in anhydrous CH2Cl2
(15 mL) and the mixture was allowed to stir at 0 ꢁC for
2 h. The reaction solution was then concentrated and
CH2Cl2 was added to the reaction residue, which was then
washed repeatedly with NaHCO3(aq) and water. The
organic layers were dried over anhydrous Na2SO4 and fil-
tered, and the filtrate evaporated. The residue was puri-
fied by silica gel column chromatography (hexane/
EtOAc 8:2 to 5:5) to afford 34 as a white crystal (0.79 g,
88%). TLC (3:7 hexane/EtOAc): Rf = 0.25.
4.7.16. Prasterone-aspartyl-glutathione ester (42). Com-
pound 42 was prepared from 36 by the similar pathway
used to prepare 40. Compound 42 was obtained as a white
crystal (0.44 mg, 80%). TLC (SiO2, 6:4 hexane/EtOAc):
Rf = 0.3; 1H NMR (CDCl3, 400 MHz) d 7.74 (d,
J = 7.5 Hz, 2 H), 7.62 (d, J = 6.8 Hz, 2H), 7.37 (t,
J = 7.3 Hz, 2H), 7.28 (tt, J = 7.5, 1.4 Hz, 2H), 7.14 (s,
1H), 6.90 (s, 1H), 6.39 (d, J = 8.0 Hz, 1H), 5.37 (d,
J = 4.6 Hz, 1H), 5.21 (d, J = 5.6 Hz, 1H), 4.78–4.76 (m,
1H), 4.67–4.60 (m, 2H), 4.40–4.30 (m, 1H), 4.22 (t,
J = 7.2 Hz, 2H), 4.10 (s, 1H), 3.95 (dd, J = 18.2, 5.4 Hz,
1H), 3.87 (dd, J = 18.2, 5.1 Hz, 1H), 3.00 (dd, J = 16.5,
4.8 Hz, 1H), 2.88 (dd, J = 16.6, 3.6 Hz, 1H), 2.44 (dd,
J = 19.3, 8.6 Hz, 1 H), 2.38–2.27 (m, 3H), 2.11–2.01 (m,
3H), 1.95–1.81 (m, 7H), 1.66–1.44 (m, 5H), 1.41 (s, 9H),
1.39 (s, 9H), 1.39 (s, 9H), 1.30–1.23 (m, 2H), 1.17–1.08
(m, 1H), 1.05–1.01 (m, 4H), 0.86 (s, 3H); 13C
NMR(CDCl3, 100 MHz) d 221.0, 172.6, 171.3, 170.7,
169.5, 169.1, 168.2, 156.3, 155.6, 143.8, 143.7, 141.2,
139.3, 127.7, 127.1, 125.2, 122.3, 119.9, 82.4, 82.2, 79.9,
77.2, 75.6, 67.3, 64.4, 51.7, 51.6, 50.6, 50.0, 49.1, 47.5,
47.0, 42.1, 37.9, 37.5, 36.7, 36.6, 32.0, 31.4, 31.3, 30.7,
29.6, 28.6, 28.3, 27.9, 27.9, 27.5, 21.8, 20.3,19.3, 13.5;
MS (FAB, m/z) 1111 (M+H)+, HRFABMS calcd for
C61H83O15N4 1111.5855, found 1111.5849.
To a solution of 34 (380 mg, 0.75 mmol), 15 (400 mg,
0.79 mmol), and DMAP (91 mg, 0.23 mmol) in anhy-
drous CH2Cl2 (15 mL) was added DCC (170 mg,
0.83 mmol) in anhydrous CH2Cl2 (1 mL) under nitro-
gen. The suspension was stirred at room temperature
for 4 h and the DCC salt was separated from the reac-
tion mixture by filtration. The filtrate was concentrated
and purified by silica gel column chromatography (hex-
ane/EtOAc 9:1 to 6:4) to afford 40 as a white crystal
1
(0.39 g, 51%). TLC (4:6 hexane/EtOAc): Rf = 0.25; H
NMR (CDCl3, 400 MHz) d 7.75 (d, J = 7.5 Hz, 2H),
7.68 (d, J = 4.9 Hz, 2H), 7.38 (t, J = 7.4 Hz, 2H), 7.29
(t, J = 7.4 Hz, 2H), 7.17 (m, 1H), 6.96 (d, J = 9.3 Hz,
1H), 5.36 (d, J = 8.4 Hz, 1H), 5.04 (s, 1H), 5.02 (m,
1H), 4.87 (d, J = 7.4 Hz, 1H), 4.77–4.69 (m, 2H), 4.36
(d, J = 5.5 Hz, 2H), 4.26 (t, J = 7.3 Hz, 1H), 4.19 (d,
J = 4.2 Hz, 1H), 4.11 (dd, J = 0.9, 7.2 Hz, 1H), 3.95 (d,
J = 4.7 Hz, 2H), 3.08 (dd, J = 16.5, 4.3 Hz, 1H), 2.86
(dd, J = 16.5, 3.4 Hz, 1H), 2.57–2.46 (m, 4H), 2.29–
2.22 (m, 3H), 2.12–1.68 (m, 6H), 1.45 (s, 9H), 1.40 (s,
18H), 1.32–1.24 (m, 1H), 1.02 (s, 3H); 13C NMR
(CDCl3, 100 MHz) d 218.5, 172.5, 171.5, 169.4, 168.9,
168.3, 156.4, 155.7, 143.8, 143.7, 141.1, 127.6, 127.0,
126.9, 125.2, 125.1, 119.9, 82.4, 80.0, 77.8, 77.2, 72.1,
67.3, 64.7, 53.4, 52.5, 51.0, 50.5, 42.1, 41.0, 38.5, 37.7,
34.3, 32.7, 32.1, 28.8, 28.2, 28.0, 27.9, 26.9, 18.1; MS
(FAB, m/z) 1029 (M+Na)+; HRFABMS calcd for
C52H70O16N4Na 1029.4685, found 1029.4691.
4.7.17. 4-[(3aR,5R,7aR)-3a-Hydroxy-7a-methyloctahydro-
1H-inden-1-one-5]-oxy-4-oxobutanoic acid (43a). To a
solution of 27a (176 mg, 1.0 mmol) and succinic anhy-
dride (0.3 g, 3.0 mmol) in anhydrous pyridine (7 mL) at
room temperature was added DMAP (86 mg, 1.0 mmol).
The resulting solution was refluxed at 60 ꢁC and the reac-
tion progress was monitored by TLC. After 12 h, the sus-
pension was partitioned between H2O (40 mL) and
EtOAc (60 mL). The organic layer was washed with 6%
HCl (3 · 10 mL), NaHCO3 (2 · 10 mL), and brine. Dry-
ing over MgSO4 and evaporation of the organic layer
afforded a residue, which was purified by silica gel
column chromatography (hexane/EtOAc 8:2 to 5:5).
The product 43a was obtained as a colorless liquid
(0.3 g, 86%). TLC (EtOAc): Rf = 0.45; 1H NMR (CDCl3,
400 MHz) d 4.93–4.85 (m, 1H), 2.59 (s, 4H), 2.41–2.38
(m, 2H), 2.30–2.24 (m, 1H), 2.14–2.09 (m, 1H),
1.89–1.82 (m, 2H), 1.67 (t, J = 11.2 Hz, 1H), 1.53–1.33
4.7.15. Epiandrosterone-aspartyl-glutathione ester (41).
Compound 41 was prepared from 35 by the similar path-
way used to prepare 40. Tripeptide 41 was obtained as a
white crystal (40%). TLC (6:4 hexane/EtOAc):

316
S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
(m, 3H), 1.05 (s, 3H); 13C NMR (CDCl3, 100 MHz) d
223.7, 176.5, 174.1, 80.6, 72.7, 54.2, 39.9, 34.7, 32.6,
30.8, 30.7, 30.3, 27.7, 14.2; MS (FAB, m/z) 285
(M+H)+; HRFABMS calcd for C14H21O6 285.1338,
found 285.1336.
1.15–1.11 (m, 1H), 1.03–1.01 (m, 4H), 0.87 (s, 3H); 13C
NMR (CDCl3, 100 MHz) d 177.9, 171.5, 144.6, 140.0,
124.6, 122.1, 74.4, 55.7, 50.3, 47.4, 38.0, 36.8, 33.6, 31.0,
30.6, 30.5, 29.2, 28.9, 27.6, 20.5, 19.2, 14.9; MS (FAB,
m/z) 389 (M+HꢀH2O)+, HRFABMS calcd for
C23H32O4Cl 407.1989, found 407.1989.
4.7.18. 4-[(3aR,5S,7aR)-3a-Hydroxy-7a-methyloctahydro-
1H-inden-1-one-5]-oxy-4-oxobutanoic acid (43b). Com-
pound 43b was prepared from 27b by the similar pathway
used to prepare 43a. Compound 43b was obtained as a
4.7.22. [(3aR,5R,7aR)-3a,5-Dihydroxy-7a-methyloctahy-
dro-1H-inden-1-one]-succinyl-glutathione ester (47a). To
a solution of 43a (255 mg, 0.9 mmol), 15 (315 mg,
0.63 mmol), and DMAP (37 mg, 0.30 mmol) in anhy-
drous CH2Cl2 (5 mL) was added DCC (264 mg,
1.0 mmol) in anhydrous CH2Cl2 (1 mL) under nitrogen.
The suspension was stirred at room temperature for 3 h
and the DCC salt was separated from the reaction mix-
ture by filtration. The filtrate was concentrated and puri-
fied by silica gel column chromatography (hexane/
EtOAc 9:1 to 6:4) to afford 47a as a white crystal
(568 mg, 82%). TLC (3:7 hexane/EtOAc): Rf = 0.45;
1H NMR (CDCl3, 400 MHz) d 6.97–6.95 (m, 2H), 5.26
(s, 1H), 4.93–4.89 (m, 1H), 4.74–4.70 (m, 1H), 4.42
(dd, J = 11.3, 5.4 Hz, 1H), 4.38 (dd, J = 11.3, 5.1 Hz,
1H), 4.09 (s, 1H), 3.93 (dd, J = 18.2, 5.4 Hz, 1H), 3.85
(dd, J = 18.2, 5.1 Hz, 1 H), 2.83–2.82 (m, 1H), 2.64–
2.56 (m, 4H), 2.55–2.41 (m, 2H), 2.35–2.25 (m, 3H),
2.12–2.05 (m, 2H), 2.00–1.89 (m, 3H), 1.77–1.68 (m,
2H), 1.58–1.46 (m, 1H), 1.43–1.42 (m, 18H), 1 .39 (s,
9H), 1.27–1.22 (m, 1H), 1.05 (s, 3H); 13C NMR (CDCl3,
100 MHz) d 219.7, 172.7, 172.1, 171.7, 171.3, 168.9,
168.5, 155.8, 82.4, 80.1, 78.6, 71.1, 63.6, 53.4, 52.4,
52.2, 42.1, 38.7, 33.5, 32.3, 31.5, 29.4, 29.1, 28.3, 28.0,
27.9, 27.6, 26.2, 14.6; MS (FAB, m/z) 770 (M+H)+;
HRFABMS calcd for C37H60O14N3 770.4075, found
770.4075.
1
yellow liquid (85%). TLC (EtOAc): Rf = 0.45; H NMR
(CDCl3, 400 MHz) d 4.89–4.87 (m, 1H), 2.55–2.46 (m,
4H), 2.40–2.36 (m, 1H), 2.22–2.15 (m, 1H), 2.03–1.98
(m, 1H), 1.93–1.85 (m, 2H), 1.77–1.73 (m, 1H), 1.63–
1.61 (m, 1H), 1.47 (dd, J = 14.2, 8.4 Hz, 1H), 1.28–1.17
(m, 2 H), 0.87 (s, 3H); 13C NMR (CDCl3, 100 MHz) d
219.6, 177.2, 171.8, 78.3, 70.1, 52.5, 51.9, 39.9, 32.7,
29.2, 28.9, 28.8, 27.0, 16.7; MS (FAB, m/z) 285
(M+H)+; HRFABMS calcd for C14H21O6 285.1338,
found 285.1331.
4.7.19. 4-(Epiandrosterone-3b)-oxy-4-oxobutanoic acid (44).
Compound 44 was prepared from 28 by the similar pathway
used to prepare 43. Compound 44 was obtained as a white
solid (80%). TLC (4:6 hexane/EtOAc): Rf = 0.45;
1
mp = 236 ꢁC; H NMR (CDCl3, 400 MHz) d 4.68 (m,
1H), 2.64–2.54 (m, 4H), 2.40 (q, J = 8.1 Hz, 1H), 2.08–
1.98 (m, 1H), 1.89–1.87 (m, 1H), 1.77–1.69 (m, 4H),
1.61–1.56 (m, 1H), 1.52–1.42 (m, 3H), 1.35–1.18 (m, 7H),
1.03–0.89 (m, 2H), 0.82 (s, 3H), 0.81 (s, 3H), 0.71–0.64 (m,
2H); 13C NMR (CDCl3, 100 MHz) d 221.4, 177.6, 171.6,
74.0, 54.3, 51.3, 47.8, 44.6, 36.6, 35.8, 35.6, 35.0, 33.8, 31.5,
30.8, 29.2, 29.0, 28.2, 27.3. 21.7, 20.4, 13.8, 12.2; MS
(FAB, m/z) 391 (M+H)+; HRMS-MALDI calcd for
C23H35O5 (M+H)+, 391.2484, found 391.2483.
4.7.23. [(3aR,5S,7aR)-3a,5-Dihydroxy-7a-methyloctahy-
dro-1H-inden-1-one]-succinyl-glutathione ester (47b).
Compound47b was preparedfrom 43b by the similar path-
way used to prepare 47a. The product 47b was obtained
as a white crystal (0.53 mg, 82%). TLC (SiO2, 3:7 hexane/
4.7.20. 4-(5-Androsten-17-one-3b)-oxy-4-oxobutanoic acid
(45). Compound 45 was prepared from 29 by the similar
pathway used to prepare 43a. The product 45 was obtained
as a white crystal (0.81 g, 61%). TLC (SiO2, 5:5 hexane/
1
1
EtOAc): Rf = 0.50; mp = 232–234 ꢁC; H NMR (CDCl3,
EtOAc): Rf = 0.45; H NMR (CDCl3, 400 MHz) d 7.24
400 MHz) d 5.38 (d, J = 4.9 Hz, 1 H), 4.65–4.57 (m, 1H),
2.65 (t, J = 6.1 Hz, 2H), 2.58 (t, J = 6.8 Hz, 2H), 2.44
(dd, J = 19.4, 8.5 Hz, 1H), 2.33–2.30 (m, 2H), 2.12–2.02
(m, 2H), 1.96–1.87 (m, 1H), 1.87–1.80 (m, 3H), 1.67–1.59
(m, 3H), 1.57–1.48 (m, 2H), 1.48–1.41 (m, 1H), 1.30–1.22
(m, 2H), 1.15–1.08 (m, 1H), 1.02–0.97 (m, 4H), 0.86 (s,
3H); 13C NMR (CDCl3, 100 MHz) d 221.2, 171.9, 171.5,
139.8, 122.0, 74.3, 51.7, 50.1, 47.5, 37.9, 36.9, 36.7, 35.8,
31.4, 31.3, 30.8, 29.2, 28.8, 27.6, 21.9, 20.3, 19.3, 13.5; MS
(FAB, m/z) 389 (M+H)+; HRFABMS calcd for
C23H33O5 389.2328, found 389.2332.
(s, 1 H), 6.99 (d, J = 6.7 Hz, 1H), 5.34 (s, 1H), 5.04–
4.98 (m, 1 H), 4.73–4.68 (m, 1H), 4.45 (dd, J = 11.3,
4.8 Hz, 1H), 4.39 (dd, J = 11.3, 5.3 Hz, 1H), 4.14 (s,
1H), 3.95 (dd, J = 18.2, 5.4 Hz, 1H), 3.86 (dd, J = 18.2,
5.0 Hz, 1H), 2.58–2.53 (m, 5H), 2.53–2.45 (m, 1H),
2.39–2.34 (m, 2H), 2.25–2.06 (m, 2H), 2.05–1.91 (m,
6H), 1.76–1.72 (m, 1H), 1.43–1.42 (m, 18H), 1.40 (s,
9H), 1.31–1.24 (m, 1H), 0.97 (s, 3H); 13C NMR (CDCl3,
100 MHz) d 218.9, 172.9, 172.6, 172.0, 171.53, 169.1,
168.6, 155.9, 82.3, 80.0, 78.0, 70.5, 63.2, 53.5, 52.5,
52.2, 42.1, 40.7, 34.3, 32.8, 32.2, 29.7, 29.3, 28.7, 28.3,
28.0, 27.8, 27.1, 17.5; MS (FAB, m/z) 770 (M+H)+;
HRFABMS calcd for C37H60O14N3 770.4075, found
770.4078.
4.7.21. 4-(17-Chloro-androsta-5,16-diene-3b)-oxy-4-oxobu-
tanoic acid (46). Compound 46 was prepared from 30 by
the similar pathway used to prepare 43a. Compound 46
was obtained as a white solid (76%). TLC (4:6 hexane/
4.7.24. Epiandrosterone-succinyl-glutathione ester (48).
Compound 48 was prepared from 44 by the similar
pathway used to prepare 47a. Compound 48 was ob-
tained as a white crystal (73%). TLC (6:4 hexane/EA-
1
EtOAc): Rf = 0.45; mp = 160–161 ꢁC; H NMR (CDCl3,
400 MHz) d 5.60 (dd, J = 3.1, 1.7 Hz, 1H), 5.37 (d,
J = 5.1 Hz, 1H), 4.65–4.58 (m, 1H), 2.65 (td, J = 7.5,
1.7 Hz, 2H), 2.58 (td, J = 7.1, 1.3 Hz, 2H), 2.32–2.29 (m,
2H), 2.12–2.29 (m, 1H), 1.95–1.82 (m, 5H), 1.67–1.56 (m,
4H), 1.53–1.46 (m, 2H), 1.32 (td, J = 12.5, 4.6 Hz, 1H),
1
tOAc): Rf = 0.3; H NMR (CDCl3, 400 MHz) d 6.95–
6.93 (m, 2H), 5.24 (m, 1H), 4.73–4.63 (m, 2H), 4.42–
4.33 (m, 2H), 4.08–4.05 (m, 1H), 3.93–3.81 (m, 2H),

S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
317
2.57–2.54 (m, 5H), 2.36–2.28 (m, 3H), 2.27–1.86
Supplementary data
(m, 3H), 1.74–1.46 (m, 9H), 1.39 (s, 9H), 1.38 (s, 9H),
1.37 (s, 9H), 1.32–0.82 (m, 12H), 0.79 (s, 3H), 0.78 (s,
3H), 0.66–0.64 (m, 1H); 13C NMR (CDCl3, 100 MHz)
d 221.2, 172.6, 171.4, 169.0, 168.6, 155.8, 82.3, 79.9,
74.2, 63.6, 54.3, 53.5, 52.3, 51.4, 47.7, 44.7, 42.2, 36.7,
35.9, 35.7, 35.1, 33.9, 33.8, 32.3, 31.6, 30.9, 29.6, 29.2,
28.9, 28.4, 28.0, 27.4, 27.3, 25.6, 24.9, 21.8, 20.5, 13.8,
12.2; MS (FAB, m/z) 876 (M+H)+; HRFABMS calcd
for C46H74O13N3 876.5222, found 876.5225.
Supplementary data associated with this article can be
found, in the online version, at doi:10.1016/j.bmc.2005.
07.077.
References and notes
´
1. Andu´jar-Sanchez, M.; Marıa Clemente-Jimenez, J.;
Rodriguez-Vico, F.; Las Heras-Vazquez, F. J.; Jara-Perez,
´
´
´
V.; Camara-Artigas, A. Biochem. Biophys. Res. Commun.
2004, 314, 6.
4.7.25. Prasterone-succinyl-glutathione ester (49). Com-
pound 49 was prepared from 45 by the similar pathway
used to prepare 47a. The product 49 was obtained as a
white crystal (0.47 g, 81%). TLC (SiO2, 6:4 hexane/
EtOAc): Rf = 0.25; 1H NMR (CDCl3, 400 MHz) d
7.01 (d, J = 6.5 Hz, 1H), 6.95 (t, J = 5.2 Hz, 1H), 5.37
(d, J = 4.7 Hz, 1 H), 5.26 (d, J = 5.6 Hz, 1H), 4.75–
4.70 (m, 1H), 4.62–4.55 (m, 1H), 4.44 (dd, J = 11.3,
4.1 Hz, 1H), 4.36 (dd, J = 11.3, 5.0 Hz, 1H), 4.11 (s, 1
H), 3.94 (dd, J = 18.1, 5.5 Hz, 1H), 3.85 (dd, J = 18.1,
5.1 Hz, 1H), 2.44 (s, 4H), 2.43 (dd, J = 19.3, 8.7 Hz,
1H), 2.35–2.29 (m, 3H), 2.14–2.01 (m, 3H), 1.95–1.79
(m, 5H), 1.65–1.46 (m, 7H), 1.43–1.42 (m, 18H), 1.40
(s, 9H), 1.29–1.22 (m, 2H), 1.15–1.11 (m, 1H), 1.01–
0.88 (m, 4H), 0.85 (s, 3H); 13C NMR (CDCl3,
100 MHz) d 221.1, 172.7, 172.2, 172.0, 171.3, 169.0,
168,6, 139.8, 122.0, 121.9, 82.3, 79.9, 77.2, 74.3, 74.1,
63.5, 53.3, 52.2, 51.7, 50.3, 50.1, 47.5, 42.0, 38.0, 36.8,
36.7, 35.8, 32.2, 31.4, 31.3, 30.7, 29.4, 29.1, 28.3, 28.0,
27.9, 27.8, 27.6, 21.8, 20.3, 19.3, 13.5; MS (FAB, m/z)
874 (M+H)+; HRFABMS calcd for C46H72O13N3
874.5065, found 874.5064.
2. Townsend, D. M.; Tew, K. D. Oncogene 2003, 22,
7369.
´
3. Ortiz-Salmeron, E.; Yassin, Z.; Clemente-Jimenez, M. J.;
Las Heras-Vazquez, F. J.; Rodriguez-Vico, F.; Baron, C.;
´
´
Garcıa-Fuentes, L. Eur. J. Biochem. 2001, 268, 4307.
4. Kaplan, W.; Husler, P.; Klump, H.; Erhardt, J.; Sluis-
¨
Cremer, N.; Dirr, H. Protein Sci. 1997, 6, 399.
5. Walker, J.; Crowley, P.; Moreman, A. D.; Barrett, J. Mol.
Biochem. Parasitol. 1993, 61, 255.
6. Brophy, P. M.; Barrett, J. Parasitology 1990, 100, 345.
7. Smith, D. B.; Davern, K. M.; Board, P. G.; Tiu, W. U.;
Garcia, E. G.; Mitchell, G. F. Proc. Natl. Acad. Sci.
U.S.A. 1986, 83, 8703.
8. Jacob, C.; Giles, G. I.; Giles, N. M.; Sies, H. Angew.
Chem., Int. Ed. 2003, 42, 4742.
9. Rinaldi, R.; Eliasson, E.; Swedmark, S.; Morgenstern, R.
Drug Metab. Dispos. 2002, 30, 1053.
10. Dekant, W. Toxicol. Lett. 2001, 124, 21.
11. del Socorro Murdoch, P.; Kratochwil, N. A.; Parkinson, J.
A.; Patriarca, M.; Sadler, P. J. Angew. Chem., Int. Ed.
1999, 38, 2949.
12. Hayes, J. D.; Pulford, D. J. Crit. Rev. Biochem. Mol. Biol.
1995, 30, 445.
13. Wilce, M. C. J.; Parker, M. W. Biochim. Biophys. Acta
1994, 1205, 1.
14. Cioli, D. Curr. Opin. Infect. Dis. 2000, 13, 659.
15. McTigue, M. A.; Williams, D. R.; Tainer, J. A. J. Mol.
Biol. 1995, 246, 21.
4.7.26. (17-Chloro-3b-hydroxy-androsta-5,16-diene)-suc-
cinyl-glutathione ester (50). Compound 50 was prepared
from 46 by the similar pathway used to prepare 47a.
Compound 50 was obtained as a white solid (81%).
1
TLC (6:4 hexane/EtOAc): Rf = 0.25; H NMR (CDCl3,
16. Milhon, J. L.; Thilboldeaux, R. L.; Glowac, K.; Tracy, J.
W. Exp. Parasitol. 1997, 87, 268.
400 MHz) d 6.99–6.93 (m, 2H), 5.59 (t, J = 1.4 Hz, 1H),
5.35 (d, J = 5.0 Hz, 1H), 5.27 (d, J = 6.0 Hz, 1H), 4.73
(dd, J = 12.5, 5.2 Hz, 1H), 4.61–4.53 (m, 1H), 4.44 (dd,
J = 11.2, 5.2 Hz, 1H), 4.36 (dd, J = 11.2, 5.0 Hz, 1H),
4.11 (s, 1H), 3.94 (dd, J = 18.2, 5.3 Hz, 1H), 3.85 (dd,
J = 18.2, 4.8 Hz, 1H), 2.58 (s, 4H), 2.34–2.27 (m, 4H),
2.14–2.08 (m, 3H), 1.95–1.73 (m, 5H), 1.66–1.44 (m,
6H), 1.42 (s, 18H), 1.39 (s, 9 H), 1.33–1.26 (m, 1H),
1.11–1.04 (m, 1H), 1.01–0.99 (m, 4H), 0.85 (s, 3H); 13C
NMR (CDCl3, 100 MHz) d 172.5, 172.1, 171.9, 171.3,
168.9, 168.5, 155.7, 144.6, 139.9, 124.5, 122.1, 82.2,
79.9, 74.4, 63.5, 55.6, 53.3, 52.1, 50.3, 47.4, 42.0, 38.0,
36.7, 33.5, 32.2, 30.9, 30.5, 30.4, 29.4, 29.1, 28.9, 28.3,
28.0, 27.9, 27.6, 20.4, 19.1, 14.8; MS (FAB, m/z) 892
(M+H)+; HRFABMS calcd for C46H71O12ClN3
892.4727, found 892.4734.
17. Xiao, S.-H.; You, J.-Q.; Gao, H.-F.; Mei, J.-Y.; Jiao, P.-
Y.; Chollet, J.; Tanner, M.; Utzinger, J. Exp. Parasitol.
2002, 102, 38.
18. Nare, B.; Smith, J. M.; Prichard, R. K. Biochem. Phar-
macol. 1991, 42, 1287.
19. Nare, B.; Smith, J. M.; Prichard, R. K. Biochem. Phar-
macol. 1992, 43, 1345.
20. Hu, W.; Yan, Q.; Shen, D.-K.; Liu, F.; Zhu, Z.-D.; Song,
H.-D.; Xu, X.-R.; Wang, Z.-J.; Rong, Y.-P.; Zeng, L.-C.;
Wu, J.; Zhang, X.; Wang, J.-J.; Xu, X.-N.; Wang, S.-Y.;
Fu, G.; Zhang, X.-L.; Wang, Z.-Q.; Brindley, P. J.;
McManus, D. P.; Xue, C.-L.; Feng, Z.; Chen, Z.; Han, Z.-
G. Nat. Genet. 2003, 35, 139.
21. Mascie-Taylor, C. G. N.; Karim, E. Science 2003, 302, 1921.
22. Nwaka, S.; Ridley, R. G. Nat. Rev. Drug Discov. 2003, 2,
919.
23. Kensler, T. W.; Qian, G.-S.; Chen, J.-G.; Groopman, J. D.
Nat. Rev. Cancer 2003, 3, 321.
24. Bergquist, N. R. Trends Parasitol. 2002, 18, 309.
25. Kohn, A. B.; Anderson, P. A. V.; Roberts-Misterly, J. M.;
Greenberg, R. M. J. Biol. Chem. 2001, 276, 36873.
26. Utzinger, J.; Xiao, S.; Keiser, J.; Chen, M.; Zheng, J.;
Tanner, M. Curr. Med. Chem. 2001, 8, 1841.
27. Woolhouse, M. E. J.; Hagan, P. Nat. Med. 1999, 5,
1225.
Acknowledgments
We thank the National Science Council, Department of
Health and Academia Sinica, for financial support. We
thank Li-Fang Huang for assisting in the ITC
experiments.

318
S.-C. Jao et al. / Bioorg. Med. Chem. 14 (2006) 304–318
´
38. Ortiz-Salmeron, E.; Yassin, Z.; Clemente-Jimenez, M. J.;
´
Las Heras-Vazquez, F. J.; Rodriguez-Vico, F.; Baron, C.;
28. Andu´jar-Sꢀanchez, M.; Smith, A. W.; Clemente-Jimenez, J.
M.; Rodriguez-Vico, F.; Las Heras-Vazquez, F. J.; Jara-
´
´
´
Garcıa-Fuentes, L. Biochim. Biophys. Acta 2001, 1548,
106.
Perez, V.; Camara-Artigas, A. Biochemistry 2005, 44, 1174.
29. Wu, Z.; Minhas, G. S.; Wen, D.; Jiang, H.; Chen, K.;
Zimniak, P.; Zheng, J. J. Med. Chem. 2004, 47, 3282.
30. Harwaldt, P.; Rahlfs, S.; Becker, K. Biol. Chem. 2002, 383,
821.
39. Habig, W. H.; Pabst, M. J.; Jakoby, W. B. J. Biol. Chem.
1974, 249, 7130.
40. Cardoso, R. M. F.; Daniels, D. S.; Bruns, C. M.; Tainer, J.
A. Proteins 2003, 51, 137.
31. Cancilla, M. T.; Leavell, M. D.; Chow, J.; Leary, J. A.
Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 12008.
32. Asakura, T.; Ohkawa, K.; Takahashi, N.; Takada, K.;
Inoue, T.; Yokoyama, S. Br. J. Cancer 1997, 76, 1333.
33. Zheng, J.; Mitchell, A. E.; Jones, A. D.; Hammock, B. D.
J. Biol. Chem. 1996, 271, 20421.
34. Ploemen, J. H.; Van Schanke, A.; Van Ommen, B.; Van
Bladeren, P. J. Cancer Res. 1994, 54, 915.
35. Hall, A.; Robson, C. N.; Hickson, I. D.; Harris, A. L.;
Proctor, S. J.; Cattan, A. R. Cancer Res. 1989, 49, 6265.
36. Tew, K. D.; Bomber, A. M.; Hoffman, S. J. Cancer Res.
1988, 48, 3622.
´
`
41. Remoue, F.; Mani, J.-C.; Pugniere, M.; Schacht, A.-M.;
Capron, A.; Riveau, G. Infect. Immunol. 2002, 70, 601.
42. Gu, Y.; Guo, J.; Pal, A.; Pan, S.-S.; Zimniak, P.; Singh, S.
V.; Ji, X. Biochemistry 2004, 43, 15673.
43. Barycki, J. J.; Colman, R. F. Arch. Biochem. Biophys.
1997, 345, 16.
44. Vargo, M. A.; Colman, R. F. J. Biol. Chem. 2001, 276,
2031.
45. Lyon, R. P.; Atkins, W. M. Biochemistry 2002, 41,
10920.
46. Johansson, A.-S.; Mannervik, B. J. Biol. Chem. 2001, 276,
33061.
47. Ha, N. C.; Kim, M. S.; Lee, W.; Choi, K. Y.; Oh, B. H. J.
Biol. Chem. 2000, 275, 41100.
´
37. Yassin, Z.; Ortiz-Salmeron, E.; Garcıa-Maroto, F.; Baron,
C.; Garcıa-Fuentes, L. Biochim. Biophys. Acta 2004, 1698,
´
´
´
227.