Lanthanide Chelating Protein Probe
A R T I C L E S
pressure and coevaporated with toluene. The crude mixture was
dissolved in N,N-dimethylformamide (60 mL), triethylamine was
added until the pH was neutral, 2-(aminoethyl)methanethiosulfonate
hydrobromide (1.5 g, 6 mmol), N-hydroxysuccinimide (1.2 g, 10
mmol), and N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide (1.9
g, 10 mmol) were added and stirred for 30 h at room temperature.
The reaction mixture was concentrated under reduced pressure and
purified by HPLC (0.1% trifluoroacetic acid and a 10-90%
acetonitrile gradient on a C18 preparative column). Fractions
containing product were pooled, concentrated, and freeze-dried;
overall yield 1.6 g (84%) as a yellow oil. 1H NMR (600 MHz D2O,
348 K): δ 3.68 (s, 8H), 3.73-3.75 (m, 12H), 3.84 (s, 6H), 3.89 (s,
4H), 3.94 (t, 4H), 4.88 (s, 4H), 8.07 (t, 2H), 8.15 (t, 2H), 8.25 (d,
2H), 8.82 (d, 2H). 13C NMR (600 MHz D2O, 348 K): δ 35.1, 38.6,
49.7, 50.0, 50.2, 53.0, 55.0, 128.1, 129.8, 131.3, 140.2, the CdO
was invisible in the APT spectrum. HR-MS: m/z 777.25557 [M +
H]+, calcd [C30H49N8O8S4] 777.25559. FTIR: 2933.4, 2362.5,
1666.4, 1389.5, 1317.6, 1129.6, 957.3, 706.9, 551.7.
reduce the cysteines. After washing away the surplus of dithiotreitol,
10 equiv of Ln-CLaNP-5 (7a-f) were added to a 60 µM solution
of the reduced Paz in degassed buffer containing 20 mM sodium
phosphate pH 7.0 supplemented with 150 mM NaCl and stirred on
ice for 1 h under an argon atmosphere. Monomeric probe attached
protein was purified from dimer and surplus of probe using a
Superdex 75 column. In the case of Paz L8C/K10C an additional
purification was performed on a HiTrap SP column. Probe
attachment was in general >90% estimated from the absence of
1
diamagnetic peaks in the [15N, H]-HSQC spectra. In the case of
Yb-CLaNP-5 attached to 15N-enriched Paz D100C/S104C, probe
attachment was less efficient (60%), and clear diamagnetic peaks
were visible in the spectrum. PCSs and RDCs could still be
determined, however. The probe labeling efficiency was followed
by mass spectrometry analysis. DTT treatment of 14N Paz D100C/
S104C (theoretical mass 13528.76 Da) reduced the mass from
14170.13 to 13528.02 Da, suggesting a loss of two glutathion- and
two oxygen-adducts. Incubation of reduced Paz with Yb-CLaNP-5
yielded a mass of 14314.19 Da, indicating the probe to be attached
via both pendant arms (theoretical mass 14314.62).
Fluorescence. Fluorescence of Eu-CLaNP-5 was measured in
water on a Varian Cary Eclipse spectrometer. Fluorescence decay
was recorded using excitation at a wavelength of 250 nm and
measuring emission at 617 nm with bandwidths of 5 nm. Decay
curves were fitted with a single exponential function in OriginPro
7.5 (www.OriginLab.com).
Ln Ligation to 1,4,7,10-Tetraazacyclododecane-1,7-[di-(N-
oxido-pyridine-2-yl)methyl]-4,10-bis(2-(acetylamino)ethylmethane-
sulfonothioate) (7a-f). A typical procedure is exemplified for the
synthesis of Lu-CLaNP-5 (7a). Lu(OAc)3 (9 mg, 20 µmol) was
dissolved in N,N-dimethylformamide (0.2 mL). CLaNP-5 (6, 100
mg, 0.12 mmol) was disolved in N,N-dimethylformamide (0.5 mL).
A total of 80 µL of the CLaNP-5 solution was added to the reaction
mixture and stirred for 1 h at room temperature, giving quantitative
yields. Ligation efficiency was monitored by LCMS (0.1% trifluo-
roacetic acid and a 10-90% acetonitrile gradient on a C18 analytical
column), [M + H]+ 949 m/z. 1H NMR (600 MHz D2O, 348 K): δ
3.19 (m, 8H), 3.49 (m, 8H), 3.601 (m, 8H), 3.81 (m, 4H), 3.91 (s,
6H), 4.41 (s, 4H), 8.25 (d, 2H), 8.32 (t, 2H), 8.43 (t, 2H), 9.00 (d,
2H). 13C NMR (600 MHz D2O, 348 K): δ 34.1, 39.0, 49.8, 52.8,
55.3, 55.9, 64.2, 128.0, 129.6, 136.5, 140.9, 145.5, 176.5. HR-MS:
m/z 949.17334 [M + H]+, calcd [C30H46N8O8S4Lu] 949.17291.
FTIR: 3505.5, 2931.0, 2362.5, 1652.1, 1386.0, 1091.4, 658.2, 352.4,
321.1.The other Ln ions Yb, Eu, Dy, Gd, and Tm were chelated to
6 following the same procedure.
Protein NMR. Typically, NMR samples contained 100-500 µM
Ln-CLaNP-5 attached Paz in 20 mM sodium phosphate, pH 7.0,
6% D2O (v/v), and 1 equiv of ascorbic acid under an argon
1
atmosphere to keep the Cu atom in the reduced state. [15N, H]-
HSQC and IPAP spectra were recorded at 293 K on a Bruker
Avance DMX 600 spectrometer equipped with a TCI-Z-GRAD
azara) and analyzed in Ansig for Windows.46 The assignments of
the resonances were based on previous work.47 The fits of observed
versus back-calculated NMR parameters are expressed in a quality
factor Q, defined as the ratio of the rmsd between observed and
calculated data and the rms of the observed.48
Lu-5 Complex. Lu was chelated to crude 1,4,7,10-tetraazacy-
clododecane-1,7-bis(acetate)-4,10-bis(pyridine-N-oxide) (5) simi-
larly to described above and purified by HPLC. 1H NMR (600 MHz
D2O, 350 K): δ 2.74 (s, 4H), 3.09-3.14 (m, 8H), 3.29 (s, 4H),
3.58 (s, 4H), 4.07 (s, 4H), 7.78 (d, 2H), 7.81 (t, 2H), 7.96 (t, 2H),
8.56 (d, 2H). 13C NMR (600 MHz D2O, 350 K): δ 54.2, 57.1, 57.2,
68.2, 129.0, 130.4, 137.6, 142.4, 146.8, 180.3. Large linewidths
were found for the resonances of the protons of the polyaza-ring
and the protons of the pyridine methylene groups. These resonances
could only be resolved at elevated temperatures (348 K), indicating
the cyclen ring to be in exchange between different conformational
species. The methylene protons of the acetate pendant arms were
well resolved.
Production Pseudoazurin Double Cys Mutants. The produc-
tion and purification of the 15N enriched Alcaligenes faecalis
pseudoazurin (Paz) double cysteine mutant E51C/E54C was
performed as described before,19 with small modifications. Paz was
purified on a CM column followed by a HiTrap SP column. Double
cysteine mutations L8C/K10C and D100C/S104C were introduced
in the pET24c vector, containing the Paz gene as a Nhe I and Xho
I insert as described for the E51C/E54C mutant.18 Forward and
backward primers for L8C/K10C and D100C/S104C, respectively,
were CATATGGCTAGCGAAAATATCGAAGTTCATATGTGC
and the T7 reverse primer and GCCCGGCCAATCTATGCCA-
GATCGTTTGCGCCAAGA and CGATCTGGTCTAGATTGGC-
CGGG. Mutagenesis was confirmed by DNA sequencing. The
expression and purification of these mutants were performed the
same way as for the E51C/E54C mutant. All three mutants could
be produced with yields varying between 5 and 50 mg/L.
Attachment of Probe to Protein (8a-j). To a 0.5 mM solution
of Paz double cysteine mutant in 20 mM sodium phosphate pH
7.0 was added 5 mM dithiotreitol and incubated on ice for 1 h to
PCS-Based ꢀ-Tensor Determinations. PCSs are defined as the
difference in ppm between the resonances of a nucleus in a
paramagnetic sample and a diamagnetic sample. Eu, Yb, Dy, and
Tm containing CLaNP-5 are anisotropic paramagnetic probes and
Lu-CLaNP-5 served as the diamagnetic sample. PCS is related to
the distance between a nucleus and the paramagnetic ion according
to eq 1
1
3
2
PCS )
∆ꢀax(3cos2 θ - 1) + ∆ꢀrh(sin2 θ cos 2Ω)
[
]
12πr3
(1)
where r, θ, and Ω are the polar coordinates of the nucleus with
respect to the principle axes of the ꢀ-tensor and ∆ꢀax and ∆ꢀrh are
the axial and rhombic components of the ꢀ-tensor, respectively.
The structure of Paz was taken from PDB entry 1PY0 and the metal
position was optimized by using X-PLOR-NIH version 2.9.949 and
the XPCS energy term for PCS.50 The ꢀ-tensors were obtained by
Euler rotation of Ln-centered Paz and fitting of the experimentally
obtained PCSs to eq 1 as described.51 The previously reported
values for ∆ꢀax and ∆ꢀrh of Yb-CLaNP-5 were in the wrong units.29
The currently reported values should be used instead.
(46) Helgstrand, M.; Kraulis, P.; Allard, P.; Hard, T. J. Biomol. NMR 2000,
18, 329–336.
(47) Impagliazzo, A.; Ubbink, M. J. Biomol. NMR 2004, 29, 541–542.
(48) Hulsker, R.; Baranova, M. V.; Bullerjahn, G. S.; Ubbink, M. J. Am.
Chem. Soc. 2008, 130, 1985–1991.
(49) Schwieters, C. D.; Kuszewski, J. J.; Tjandra, N.; Clore, G. M. J. Magn.
Reson. 2003, 160, 65–73.
(50) Banci, L.; Bertini, I.; Cavallaro, G.; Giachetti, A.; Luchinat, C.; Parigi,
G. J. Biomol. NMR 2004, 28, 249–261.
(51) Worrall, J. A.; Kolczak, U.; Canters, G. W.; Ubbink, M. Biochemistry
2001, 40, 7069–7076.
9
J. AM. CHEM. SOC. VOL. 130, NO. 44, 2008 14811