Immobilization of a novel cold active esterase onto Fe3O4~cellulose nano-composite enhances catalytic properties

Article abstract of DOI:10.1016/j.ijbiomac.2016.03.016

A novel esterase, EstH was cloned, purified and characterized from the marine bacterium Zunongwangia sp. The purified EstH showed optimum activity at 30 °C and pH 8.5 with ~50% of original activity at 0 °C. EstH was stable in high salt conditions (0-4.5 M

Full text of DOI:10.1016/j.ijbiomac.2016.03.016

International Journal of Biological Macromolecules 87 (2016) 488–497
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules
journal homepage: www.elsevier.com/locate/ijbiomac
Immobilization of a novel cold active esterase onto Fe3O4∼cellulose
nano-composite enhances catalytic properties
Mohammad Asadur Rahmana,b,1, Umma Culsuma,b,1, Ashok Kumarb, Haofeng Gaoa,
Nan Hua,∗
a College of Biotechnology and Pharmaceutical Engineering, Nanjing Tech University, Nanjing 211800, China
b State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, China
a r t i c l e i n f o
a b s t r a c t
Article history:
A novel esterase, EstH was cloned, purified and characterized from the marine bacterium Zunongwangia
sp. The purified EstH showed optimum activity at 30 ◦C and pH 8.5 with ∼50% of original activity at 0 ◦C.
EstH was stable in high salt conditions (0–4.5 M NaCl). To improve the characteristics and explore the
possibilities for application, a new immobilization matrix, Fe3O4∼cellulose nano-composite, was pre-
pared and was characterized by Fourier Transform Infrared Spectroscopy (FTIR) and Scanning Electron
Microscope (SEM). Interestingly the optimal temperature of immobilized EstH elevated to 35 ◦C. Com-
pared to its free form, immobilized EstH showed better temperature stability (48.5% compared to 22.40%
at 50 ◦C after 30 min), prolonged half-life (32 h compared to 18 h), higher storage stability (∼71% activity
compared to ∼40% after 50 days of storage), improved pH tolerance (∼73% activity at pH 4 and 10), and,
more importantly, reusability (∼50% activity after 8 repetitive cycles of usage). Enzyme kinetics showed
an increase in the Vmax (from 35.76 to 51.14 ␮M/min) and Kcat (from 365 s−1 to 520 s−1) after immobiliza-
tion. The superior catalytic properties of immobilized EstH suggest its great potential in biotechnology
and industrial processes.
Received 11 February 2016
Received in revised form 8 March 2016
Accepted 9 March 2016
Available online 11 March 2016
Keywords:
Cold active
Immobilization
Nano-composites
Salt tolerance
© 2016 Elsevier B.V. All rights reserved.
1. Introduction
Immobilized enzymes can maintain the conformational change
and the physiochemical properties, prevent the enzyme from being
Esterases (EC 3.1.1.1) of microbial origin with good stabil-
ity and activity have potential applications in food and dairy
industries, detergents, pharmaceuticals, synthesis of optically pure
compounds, bioremediation, perfume production and even in
biomedical device production [1–4]. Esterases with some unusual
characteristics such as cold active are energy saving and easy to
be inactivated in synthetic reactions is useful in the production of
heat sensitive materials [5–7]. On the other hand, esterases which
are stable in high pH and salt conditions, can catalyze reactions
in both nonaqueous and aqueous/organic media and can be uti-
lized to degrade organic matters in saline water [8–10]. Moreover,
structural modification and immobilization could contribute to the
thermostability of cold adapted enzymes as compared to the free
enzymes [11–14].
aggregated in organic media and continuous reaction processes,
reduce the possibility of denaturation in the conditions of high tem-
perature, pH and organic solvents, and also facilitate storage and
maintenance compared with the free ones [15–20]. Furthermore,
immobilization is very crucial for the production of fine chemicals
by removing the enzyme from reaction system and control over
product formation [21].
The chemical structure of immobilization support and large sur-
face area are the important factors to achieve sufficient enzyme
loading and catalytic efficiency in aqueous or organic media [22].
Organic and inorganic nanoparticles with a large surface area are
proved to be excellent materials for immobilization of enzymes.
Furthermore, selection of a suitable immobilization method is
another important factor for the successful immobilization of an
enzyme. Magnetic nanoparticles like Fe3O4 have been used effi-
ciently in immobilization because of their superparamagnetism,
high surface area, easy separation from the reaction mixture by
applying magnetic fields as well as controlling mechanism of the
orientation on the enzymes attached to the support [23–26]. Sur-
face modification or coating of Fe3O4 nanoparticles with organic
materials can enhance the binding efficiency of an enzyme with
∗
Corresponding author: College of Biotechnology and Pharmaceutical Engineer-
ing, Nanjing Tech University, Nanjing 211800, China.
E-mail addresses: nayongeb@gmail.com (M.A. Rahman), eshageb@gmail.com
(U. Culsum), ashok.nadda09@gmail.com (A. Kumar), zane gao1986@163.com
(H. Gao), hunan@njtech.edu.cn (N. Hu).
1
Authors have equal contribution to the work.
http://dx.doi.org/10.1016/j.ijbiomac.2016.03.016
0141-8130/© 2016 Elsevier B.V. All rights reserved.

M.A. Rahman et al. / International Journal of Biological Macromolecules 87 (2016) 488–497
489
the support materials either by hydrogen bonding or van der Waals
interaction or electrostatic interactions. In recent studies, nanocel-
lulose has been synthesized from various natural sources which
proved to be a good template for the formation of nano-composites
[27]. Nanocellulose shows a unique property to self-assemble
with improved thermal stability as well as solvent stability [28].
Thus, cellulose-based nano-composites with inorganic materials
like Fe3O4 nanoparticles can sustain relatively high temperatures,
pH and extreme physiochemical conditions and provide well-
defined mesostructure with metal oxide scaffolds to protect any
biomolecules like protein/enzyme from denaturation [29,30]. In
recent years, cellulose of different origins has been used as a sup-
porting matrix for the formation of iron oxide and as filler for
the homogeneous distribution of pre-synthesized crystalline nano-
structures [29,31,32].
In the present study, a novel family VII cold active and salt toler-
ant esterase from Zunongwangia sp. was purified and immobilized
onto a Fe3O4∼cellulose nano-composite. Both Fe3O4 nanoparti-
cles and nanocellulose were synthesized separately and assorted
by sol-gel method to prepare a hybrid nano-composite. The puri-
fied esterase was immobilized onto this nano-composite and the
improved bio-catalytic properties were studied in comparison with
those of the free esterase.
correct insert of the plasmid was confirmed by sequencing, and
the recombinant plasmid of pGEX-6P-1-EstH was used for further
study.
2.3. Expression and purification of EstH
The recombinant plasmid pGEX-6p-1-EstH was transformed
into E. coli BL21 (DE3) competent cells for expression. E. coli BL21
(DE3) cells containing the recombinant plasmid pGEX-6P-1-EstH
were grown in the liquid LB medium containing 100 ␮g/ml ampi-
cillin at 37 ◦C overnight, followed by inoculation at 1:100 dilution
into fresh LB liquid medium containing 100 ␮g/ml ampicillin and
incubation at 37 ◦C till OD600 reached 0.6. Then 1 mM (final concen-
tration) IPTG was added and cultured for 16 h at 18 ◦C and 180 rpm.
Next, the cells were collected and washed twice with PBS buffer
(0.8% NaCl, 0.02% KCl, 0.142% Na2HPO4, 0.027% KH2PO4; pH 7.4)
by centrifugation at 8000 rpm for 10 min and resuspended in PBS
buffer and then the cells were disrupted by a French press and
the crude enzyme was obtained as supernatant by centrifugation
at 12000 rpm for 40 min at 4 ◦C. Finally, glutathione-S transferase
(GST)-tagged fusion esterase GST-EstH was purified according
to manufacturer’s instructions using Glutathione Sepharose 4B
columns (GE Healthcare). 3C protease solution (10 U/␮l PreScis-
sion; Pharmacia) was used to remove the GST tag and the purified
protein was eluted with a moderate amount of PBS buffer (pH 7.4).
The protein was quantified with Bradford reagent (Sigma, USA)
using bovine serum albumin (BSA) as a standard [34] and the pro-
teins were analyzed by 12% SDS-PAGE.
2. Material and methods
2.1. Strains, vectors and chemicals
The marine bacterium Zunongwangia sp. and its genome have
been already reported [33]. It was grown in high-salt Luria-
Bertani medium (HLB) (peptone 1%, yeast extract 0.5%, NaCl
2%) at 28 ◦C. Escherichia coli strains DH5␣ (Takara, Japan) and
BL21 (DE3) (Novagen, USA) were used as the bacterial hosts for
plasmid (pGEX-6P-1, GE Healthcare, USA) amplification and het-
erologous expression, respectively. The enzymes used such as
restriction endonucleases, DNA polymerase, and T4 DNA ligase
were purchased from Takara (Kyoto, Japan) and the substrates,
p-nitrophenyl esters: p-nitrophenyl acetate (C2), p-nitrophenyl
butyrate (C4), p-nitrophenyl hexanoite (C6), p-nitrophenyl capry-
late (C8), p-nitrophenyl laurate (C12), and p-nitrophenyl palmitate
(C16) were purchased from Sigma-Aldrich (St. Louis, MO, USA)
and Microcrystalline cellulose (MCC) was procured from Merck
Schuchardt, Germany. All the other chemicals and buffers used
were of high purity and analytical grade.
2.4. Sequence analysis
The sequence similarity was examined by Basic Local Alignment
Search Tool (BLAST) program from the server at National Centre of
Biotechnology, USA (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Mul-
tiple sequence alignment was done by the Clustal W Method of
BioEdit Sequence Alignment Editor Program. Phylogeny analysis
was performed using the sequences of previously determined I-VIII
family esterases/lipases [35] with MEGA 6.0 program [36].
2.5. Enzyme activity assay
One unit of esterase activity was determined by the produc-
tion of 1 ␮mol of p-nitrophenol from p-nitrophenyl butyrate (pNPB,
C4) in 1 min using p-Nitrophenol as standard. The volume of each
standard reaction mixture was 200 ␮l consisting of 3 ␮l of 20 mM
substrate, 2 ␮l of pure enzyme (2 ␮l of immobilized enzyme sus-
pension) and 195 ␮l Tris–HCl buffer (50 mM, pH 8.5), and the
reaction mixture without the addition of any enzyme was con-
sidered as standard. The reaction continued for 7 min at 30 ◦C for
the free enzyme and 35 ◦C for the immobilized one with continu-
ous shaking, followed by the separation of immobilized biocatalyst
by applying magnetic field, and the absorbance of the released
p-nitrophenyl was recorded at 405 nm using 96-well plate with
Thermo Scientific Multiscan Spectrum.
2.2. Gene cloning and recombinant plasmid construction
The putative esterase containing gene EstH encodes a protein
(GenBank No. ADF54626.1) which was amplified using the genomic
DNA of Zunongwangia sp. as template with the following primers
EstH F: 5ꢀ CGCGGATCCATGAAAAAAATCATACTGTTATTTGCA -3ꢀ
and EstH R: 5ꢀ- CCGCTCGAGTTATTGTTCGGTGTACTTTTTATCTAA -
3ꢀ with restriction enzyme sites of BamHI and XhoI, (underlined)
respectively. PCR was performed in a thermal cycler programmed
with 95 ◦C for 30 s, 30 cycles of 94 ◦C for 30 s, 57 ◦C for 30 s and
72 ◦C for 1.40 min and a final elongation of 72 ◦C for 10 min. Then
the PCR products were purified using 1% agarose gel using gel mini
purification kit (AXYGEN, USA). Next, the vector and purified PCR
products were digested with BamHI and XhoI, and purified by gel.
The digested and purified gene was cloned into the digested and
purified pGEX-6P-1 vector using T4 DNA ligase and transformed
into the competent E. coli DH5␣ cells, followed by incubation in
solid LB medium (1% NaCl, 1% peptone, 0.5% yeast extract, 1.5%
agar) supplemented with 100 ␮g/ml ampicillin at 37 ◦C overnight,
and then the recombinant plasmids were extracted. Finally, the
2.6. Synthesis of Fe3O4∼cellulose nano-composite
The spherical cellulose nanogel was prepared by controlled
acidic hydrolysis as previously described [37] with minor modi-
fications [38]. Nanogel was prepared by mixing 5 g of MCC in 50 ml
distilled water and H2SO4 was as added drop by drop to a final
concentration of 63.4 wt% under shaking condition. Later on, the
solution was transferred into 10-fold volume of cold water, sepa-
rated by centrifugation and neutralized with dd H2O and Na2CO3
(2% v/v). Then, the cellulose nanogel was washed, diluted (5 wt%)

490
M.A. Rahman et al. / International Journal of Biological Macromolecules 87 (2016) 488–497
Fig. 1. Amino Acid sequence alignment. Amino acid Sequence alignment of EstH with other members of ␣/␤ hydrolase superfamily, Famly VII esterase, estDL30 and estCS2
from metagenomic library and putative carboxylesterase from E. adriatica (WP 019670332.1). The catalytic triads, Ser 221-Glu 3337-His 456, are indicated by a black filled
arrow and the conserved motif Gly 219-X-Ser 221-X-Gly 223 is indicated by a black box.
and homogenized with a high-pressure homogenizer. After wash-
ing the absolute ethanol, acetone, hexane and distilled water,
the prepared nanogel was stored in distilled water for further
use.
The magnetic nanoparticles (MNPs) were synthesized using the
modfied chemical co-precipitation method [39]. The iron oxide
slats (FeCl3·6H2O; 4.2 g and FeCl2·4H2O; 2.16 g) were dissolved
in 200 ml of dd H2O in nitrogen rich environment under con-
tinuous stirring. The reaction mixture was incubated at 85 ◦C
for 5 min and then supplemented with 40 ml of ammonia. The
reaction ran for 12 h and megnetic nanoparticles were collected
by megnetic separation and washed 3 times with ddH2O. MNPs
coated with nano-cellulose were synthesized by the sol–gel
reaction. Firstly, Fe3O4 particles were washed
3 times with
ethanol, and dispersed in 200 ml of ethanol. Afterward, 50 mg
of MNPs were mixed with 4 ml of nanocellulose suspension
in the dispersion solution and incubated at 45 ◦C under shak-
ing (180 rpm) for 12 h. The nano-composites were separated
from the reaction mixture and washed separately with distilled
water, absolute ethanol, hexane and stored at 4 ◦C for further
use.

M.A. Rahman et al. / International Journal of Biological Macromolecules 87 (2016) 488–497
491
activity after incubating the enzyme for 24 h at 4 ◦C in the same pH
buffer.
The effects of various organic solvents (methanol, acetonitrile,
isopropanol, ethanol, n-propanol, Dimethyl sulfoxide (DMSO) and
ethylene glycol) and detergents (Tween-20, Tween-80, sodium
dodecyl sulfate (SDS), cetyltrimethylammonium bromide (CTAB)
and Triton X-100) were determined by pre-incubating both the free
and immobilized EstH enzymes separately with different concen-
trations of organic solvents (10–40%, v/v) and detergents (5% v/v)
for 40 min and 1 h respectively.
The decrease the 50% of its original activity was recorded. The
reusability of immobilized EstH was measured through repetitive
cycles at standard condition using p-nitrophenyl butyrate as sub-
strate. After every assay, the immobilized EstH was recovered and
washed three times with PBS buffer and added to a fresh reaction
system to determine the enzyme activity of the next run. This step
was repeated 10 times and the remaining activity was measured
after each run and the activty in its initial step was determined as
100%. To evaluate the storage stability, both free and immobilized
EstH forms were stored at 4 ◦C for 50 days and the remaining activ-
ity was measured at an interval of 5 days under stardard conditions.
The half life was determined by incubating the both forms of the
biocatalyst at their optimal temperature for 34 h. The hydrolytic
activity was determined after each 30 min.
The effects of NaCl on the activity and stability of EstH were
also tested with varying concentrations (1–4.5 M). The specific
activity without NaCl was defined as 100%. Stability was deter-
mined by incubating the enzyme in pH 8.5 Tris-HCl (50 mM)
buffer with different concentrations of NaCl at 4 ◦C for 12 h,
and the relative activity was determined under the standard
conditions. The specific activity after incubation with 0 M NaCl
was defined as 100%. Different concentrations of p-nitrophenyl
butyrate ranging from 1 to 80 mM were used to measure the
initial rate of reaction. Michaelis–Menten constant (Km), was
determined according to Lineweaver–Burkplot, and the catalytic
Fig. 2. SDS-PAGE analysis of purified EstH. Lane M, the standard protein molecu-
lar mass marker; Lane 1, the purified EstH from the vector pGEX-6p-1-EstH (MW
61.2 kDa); Lane 2, induced cell supernatant of pGEX-6p-1 as control; Lane 3, induced
cell supernatant from the vector pGEX-6p-1-EstH.
2.7. Characterization of Fe3O4∼cellulose nano-composite
The Fe3O4∼ cellulose nanocomposite was studied by Fourier
Transform Infrared Spectroscopy (FTIR; NEXUS 870, Thermo, Madi-
son, USA) and Transmission Electron Microscopy (TEM; Hitachi,
Tokyo, Japan). A KQ3200E ultrasonicator with the ultrasonic
frequency of 40 kHz (KunShan Ultrasonic Instruments Co., Ltd. Kun-
Shan, China) was used to disperse the cellulose nanogel.
constant (Kcat) was calculated according to the value of Vmax
,
the molecular weight and the concentration of the purified pro-
tein using the Graphpad Prism software (Graphpad, San Diego, CA,
USA).
2.8. Immobilization of purified esterase onto Fe3O4∼cellulose
nano-composite
3. Results
To immobilize EstH with the nanocomposites, purified EstH was
mixed with the slurry of Fe3O4∼cellulose nanocomposite at the
ratio of 1:4 and incubated at 4 ◦C under mild shaking for 12 h. After
overnight incubation, the biocatalyst mixture was centrifuged
(10000 rpm) and the supernatant was removed by decantation.
The nanocomposite bound esterase was washed 3 times with PBS
to remove the unbound or loosely bound protein. The protein
loading/immobilization yield (IY) and immobilization efficiency
(IE) were determined using previously described method [40].
3.1. Gene cloning and sequence analysis of EstH
The putative esterase encoding gene, EstH was success-
fully cloned from Zunongwangia sp. with a length of 1644 bp,
2.9. Comparison of hydrolytic properties of free and immobilized
EstH
The substrate specificity of EstH was determined by the standard
method with the different acyl chain lengths of p-NP esters from
C2 to C16. The optimal temperature was determined by incubating
the reaction mixture from 0 to 80 ◦C for 5 min. For thermostabil-
ity assay, the enzyme was incubated in a temperature range of
30–60 ◦C and samples were collected every 30 min for 3 h. The
residual effect was determined by standard condition. Enzyme
activity without any incubation was considered as 100%. Buffer
with various pH values, phosphate–citrate buffer (pH 4.0–8.0) and
Tris–HCl buffer (pH 8.0–10.0) were used to determine the opti-
mal pH. pH stability was determined by measuring the remaining
Fig. 3. TEM images of nano-composite. TEM images of Nanocellulose-Fe3O4 nano-
composite.

492
M.A. Rahman et al. / International Journal of Biological Macromolecules 87 (2016) 488–497
Table 1
FTIR spectra of nano-composite.
Type of chemical bond
Frequency (cm−1
)
Possible assignment
C
O
C
O
H of cellulose
H of cellulose
H of cellulose
H of cellulose
2850
2900
897
1371
1430
1060
895
Bond streching
Bond streching
Bond vibraton and deformation
Bond vibration and deformation
absorption
stretching vibration
absorption
CH2 group of cellulose
C
Anomeric carbon of cellulose
Fe
O
O
582–588
absorption
encoding 547amino acid residues with a calculated molecular
mass of 61.2 kDa. EstH shows 65% similarity with hypothetical
carboxylesterase from Maribacter sp. Hel I 7 (WP 027065146),
64% similarity with Eudoraea adriatica (WP 019670332) and
Emticicia oligotrophica (WP 015030002) and 63% similarity with
Runella limosa (WP 028524560) and Algoriphagus mannitolivorans
(WP 026951097). Sequence alignment shows the conserved motif
is Gly 219-X-Ser 221-X-Gly 223 and the catalytic triads are Ser
221-Glu 337-His 456. The multiple sequence alignments of EstH
sequence with various closely related genera is shown in Fig. 1.
from 2 to 20 nm. The diameter of cellulose nanospheres was in the
range of 50–200 nm. The sol-gel reaction resulted in the forma-
tion of a firm sheath of cellulose around the Fe3O4 nanoparticle.
The resulting micro-particles showed a larger size as compared
to both of these nanostructures (Fig. 3). The O-H and C-H stretch-
ing peaks were observed at 2900 cm−1 and 2850 cm−1 respectively.
The bending vibration and deformation vibration of O H and C
H
.
bonds of cellulose were recorded at 1371 cm−1 and 897 cm−1
The peaks at 2800 cm−1 and 2900 cm−1 showed the stretching
vibrations of O H and C H, respectively. The major bands at
1430 cm−1 were attributed to the C H deformation vibrations of
CH2 group in cellulose [41]. The bands at 1060 cm−1 in the spectra
of nano-cellulose were associated with the C O stretching vibra-
tion. The anomeric carbon of cellulose showed the absorption band
at 895 cm−1, for NCC. The bands at 588 and 582 cm−1 in the spectra
of MNPs were the characteristic absorption of the Fe O bond, con-
firming the presence of magnetite nanoparticles (Table 1). Although
in a previous study of Fe2O3 nanoparticles were also represented
the Fe O stretching at 535 cm−1 in another study [42].
3.2. Expression and purification of EstH
EstH was expressed and purified in soluble form using E. coli
BL21 (DE3) cells with the recombinant plasmid pGEX-6P-1-EstH.
The recombinant fusion protein (EstH+ GST) had a molecular
weight of 87.2 kDa, with 61.2 kDa and 26 kDa for EstH and GST tag,
respectively (Fig. 2). The purified EstH was of 61.2 kDa in size with
a single band after the removal of GST tag.
3.3. Synthesis and characterization of Fe3O4∼cellulose
3.4. Immobilization of purified esterase onto Fe3O4∼cellulose
nano-composite
nano-composite
The Fe3O4 nanoparticles were characterized by Transmission
Electron Microscopy (TEM) and the size of each particle ranged
The purified esterase, EstH was immobilized by incubating
the protein with nano-composite for 12 h and separated by using
Fig. 4. Schematic representation of immobilization of EstH onto nanocomposites. Schematic representation of nanocomposite synthesis and immobilization of EstH onto
that.

M.A. Rahman et al. / International Journal of Biological Macromolecules 87 (2016) 488–497
493
Fig. 6. Effect of temperature and pH on EstH activity and stability. (A) Temperature specificity was investigated by incubating the reaction in a temperature range from 0 to
80 ◦C (Filled circle for EstH and dotted square for immobilized EstH). The specific activity for EstH at 30 ◦C and immobilized EstH at 35 ◦C was defined as 100%. (B) Temperature
stability was measured by incubating the enzyme at different temperatures (40 ◦C, filled circle EstH; dotted empty circle immobilized EstH; 45 ◦C, filled triangle EstH; inverted
dotted filled triangle immobilized EstH; 50 ◦C empty diamond EstH and dotted filled diamond immobilized EstH). The residual activity was measured at standard conditions
and samples were withdrawn every 30 min for 3 h. The specific activity without incubation was defined as 100%. (C) For pH activity test phosphate–citrate buffer (pH 4.0–8.0)
and Tris–HCl buffer (pH 8.0–10.0) were used and (D) pH stability was determined under standard conditions by calculating the residual activity after incubating the enzyme
for 24 h at 4 ◦C in the phosphate–citrate buffer (pH 4.0–8.0) and Tris–HCl buffer (pH 8.0–10.0). The activity at pH 8.5 and stability at pH 8 were considered as 100% (Filled
circle for EstH and dotted square for immobilized EstH).
magnet on the wall of calibrated tube. The immobilized biocatalyst
IY of ∼60% binding of the total protein and IE was calculated to be
∼75% and enzyme loading was ∼10 mg of protein g−1 of matrix.
The immobilized biocatalyst was washed 3 times with PBS and
stored at 4 ◦C for later use (Fig. 4).
the highest stability at pH 8, and immobilized EstH showed notice-
ably higher stability compared to the free form. At pH 4 and 10, free
EstH showed ∼58% and ∼63% activity, which was ∼73% that of the
immobilized one (Fig. 6D).
The stability of free and immobilized EstH against different
organic solvents was tested in different concentrations (10–40%,
v/v) by incubating them for 40 min. Free EstH showed more than
90% of the original activity in the presence of 10–30%, v/v DMSO
and ethanol. However, the activity was greatly reduced by acetoni-
trile in 20%, v/v concentration and no activity was detected in 30%,
v/v. Interestingly in the presence of Ethylene glycol in all tested
3.5. Comparison of catalytic properties of free and immobilized
EstH
Both forms of EstH can hydrolyze short chain esters from C2 to
C8, showing the highest activity against C4 and no activity against
C12 and C16, indicating that it is an esterase rather than lipase.
Free EstH showed 31%, 49% and 22% of relative activity against
C2, C6 and C8, which was 23%, 60% and 12% for the immobilized
one (Fig. 5). Free EstH showed highest activity at 30 ◦C with ∼50%
of relative activity at 0 ◦C and maintained more than 87% activ-
ity from 20 to 40 ◦C whereas immobilized EstH had the apparent
optimal activity at 35 ◦C with 43% of relative activity at 0 ◦C and
retained more than 92% activity from 20 to 40 ◦C (Fig. 6A). With
gradual increase of temperature and time, the activities of both
free and immobilized EstH declined steadily, but varied from each
other. After 3 h of incubation, free EstH lost almost 35% activity at
40 ◦C, but at 50 ◦C, it showed only 22.40% activity after 30 min of
incubation and completely deactivated after 90 min of incubation.
However, immobilized EstH lost only 26% activity at 40 ◦C, and at
50 ◦C, it showed 48.5% activity after 30 min of incubation and com-
pletely deactivated after 120 min of incubation (Fig. 6B). Both forms
of EstH presented their maximum activity at around pH 8.5 and
were active in a broad pH range (Fig. 6C). After 24 h incubation in
different pH buffers, they showed good stability from pH 4–10, with
Fig. 5. Substrate specificity of EstH using p-NP esters. Substrate specificity was mea-
sured using p-NP esters from C2 to C16. For both free and immobilized EstH, activity
towards p-nitrophenyl butyrate (C4) was defined as 100%.

494
M.A. Rahman et al. / International Journal of Biological Macromolecules 87 (2016) 488–497
values for immobilized EstH were 0.22 mM and 520 s−1 versus
0.18 mM and 365 s−1 for the free one. Similarly, in a previous
study, a-Chymotrypsin immobilized in Polystyrene nanoparticles
was reported with increased Kcat as compared to free enzyme [43].
Also the Km and Vmax of immobilized one were found to be higher
than free enzyme has also been reported [44–46].
4. Discussion
Marine environment is a vast pool of novel biocatalysts and
more research efforts are being made to identify new genes with
unusual properties from marine environment compared to the ter-
restrial microorganisms [10]. With the gradual development of
science and technology, in silico-based search for novel genes from
the genomic information available has become an efficient way
to clone and characterize industrially important novel enzymes
[47]. In this study, a new esterase gene, EstH was cloned from
the genomic information of the marine bacterium Zunongwangia
sp. and the esterase was found to be cold-active and salt-tolerant
and was able to improve catalytic properties when immobilized on
Fe3O4∼cellulose nano-composite. Generally, lipases/esterases are
basically divided into eight groups according to their amino acid
sequences and basic biological properties [35]. Phylogenetic anal-
ysis indicates that EstH and its related proteins belong to group
VII (Fig. S1). In recent years, some other esterases of this group
has been identified and characterized, such as estCS2 from a com-
post metagenomic library [48], est-XG2 from an activated sludge
sample metagenomic library [49] and estDL30 from an alluvial soil
metagenomic library [50].
Marine microorganisms could be a good source of cold active
enzymes [51]. Retaining activity at a low temperature and losing
activity at a moderate temperature are the major characteristics of
cold active enzymes [52]. EstH showed ∼50% of its original activ-
ity at 0 ◦C with the optimal activity at 30 ◦C and lost its activity
quickly at above 50 ◦C. Low energy consumption to promote the
reaction is the most attractive property of the cold active enzymes
[53]. Additionally, this type of esterase could be applied to produce
frail compounds in an industrial scale [51], quicken inactivation to
reduce unexpected chemical reactions and transform heat labile
substrates [54], synthesize fragile pharmaceutical compounds and
bioremediate waste products in cold conditions [51,55]. Due to the
good activity at low temperature, EstH has potential for various
industrial applications and bioremediations. The optimal tempera-
ture of EstH is the same with some previously reported cold active
enzymes [56–59]. At 0 ◦C, EstH shows almost the same activity
with est10 (55%) from Psychrobacter pacificensis [52] and estO (50%)
from Pseudoalteromonas arctica [60]. Interestingly, the optimal
temperature of the immobilized EstH shifted from 30 ◦C to 35 ◦C.
After immobilization, increased thermostability [12,15,16,61,62],
Fig. 7. Measurement of EstH reusability. Reusability was tested by collecting the
nano-composite after centrifugation and using it again in the reaction system up
to 10 cycles. The reaction was done in standard system and the initial activity was
considered as 100%.
concentrations the activity of the immobilized EstH was found to
be increased as compared to free one but little or no activity was
detected in the presence of 40%, v/v acetonitrile, ethanol and iso-
propanol (Table 2).
Enzyme recyclability is an important factor for cost reduction in
industrial processes. EstH could maintain ∼70% of its initial activ-
ity after 5 repetitive cycles and ∼40% activity after 10 repetitive
cycles (Fig. 7). The storage stability of both EstH was determined
from 5 days to 50 days in standrad conditions. The immobilized
EstH decreased its activity much more slowly compared to the free
one, retaining ∼ 71% of the initial activity after 50 days of storage at
4 ◦C versus ∼40% activity for the free one (Fig. 8). The 50% decrease
in the original activity was reported after 32 h for the Immobilized
EstH compared to 18 h for its free form.
Free EstH was inactivated completely when incubated for 1 h
at different concentrations of ionic detergents CTAB and SDS, but
was slightly stimulated by 0.5% (v/v) non-ionic detergent Tween
20, and remained quite stable even in 1% and 2% (v/v) Tween 20.
Additionally, it was obviously inhibited by Tween 80 and Triton
X-100, retaining 37.6% and 9.1% activity respectively. In contrast,
immobilized EstH remained quite stable in detergents, maintaining
101.2%, 22.1% and 14.1% activity in 2% (v/v) non-ionic detergent
Tween 20, Tween 80 and Triton X-100 (Table 3).
Noticeably, both free and immobilized EstH showed a steady
increase of activity up to 3 M NaCl and a decrease at 4.5 M NaCl.
In the presence of 3 M NaCl, free and immobilized EstH showed
129% and 115% of the original activity, respectively. EstH revealed
even high activity when incubated with 1 M to 4.5 M NaCl for
12 h. Free EstH showed 105% activity at 3 M and 89% activity at
4.5 M NaCl whereas immobilized EstH showed 104% and 68% activ-
ity at 3 M and 4.5 M NaCl, respectively (Fig. 9). The Km and Kcat
Table 2
Effect of different organic solvent on the stability of EstH.
Compounds
Relative Activity (%)
Free Enzyme
Immobilized Enzyme
10% (v/v)
20% (v/v)
30% (v/v)
40% (v/v)
10% (v/v)
20% (v/v)
30% (v/v)
40% (v/v)
None
100.0
100.0
100.0
100.0
100.0
100.0
100.0
100.0
Ethylene Glycol
Acetonitrile
Methanol
DMSO
Ethanol
Isopropanol
94.0 1.7
101.1 3.2
103.5 0.6
100.7 0.3
104.0 1.0
80.3 2.9
82.2 1.2
21.6 3.1
102.3 2.2
100.4 0.6
84.9 2.6
71.7 1.0
73.8 1.8
ND
80.0 3.2
91.7 2.3
99.6 1.3
66.1 2.7
40.4 3.9
ND
19.6 1.3
83.3 2.2
40.9 0.8
23.8 1.9
113.2 1.2
100.0 2.1
95.6 1.5
65.8 0.5
116.9 4.2
75.7 1.6
111.7 1.6
34.5 2.1
72.8 0.7
72.3 2.2
80.7 0.8
37.6 1.8
100.5 3.4
ND
66.5 3.3
63.9 1.6
15.0 2.1
26.9 0.2
55.9 0.2
ND
53.7 1.5
30.4 1.1
6.5 1.8
ND
Effects of organic solvents 5–50% (v/v) were tested by incubating the enzyme at room temperature for 40 min. Then the residual activity was determined against that not
incubated with any organic solvent under standard conditions. The esterase activity without any additives was defined as 100%. All determinations were performed in
triplicate.

M.A. Rahman et al. / International Journal of Biological Macromolecules 87 (2016) 488–497
495
[71]. At high temperature, free EstH was denatured more quickly
than the immobilized one. For both the free and immobilized EstH
enzymes, heat could make them conformationally flexible but the
immobilized one could still be catalytically active [72]. Thus, the
thermostability achieved by immobilizing EstH on Fe3O4∼cellulose
nano-composite is useful for industrial applications. Another note-
worthy characteristic of EstH is its salt tolerance. EstH is active in
the presence of high concentration of NaCl and even works well
without the presence of NaCl, indicating that EstH is halotolerant
but not halophilic. EstH showed 90% activity after treatment with
4.5 M NaCl. Though immobilization has lessened the salt tolerance
slightly, the result is still impressive. After immobilization, EstH
showed about 70% activity at 4.5 M NaCl. Generally, halophilic and
halotolerant enzymes contain more acidic amino acid residues as a
shield to protect the surface of the protein from being dehydrated,
or in other words, keep it hydrated by binding with salt ions to
minimize the hydrophobicity of the protein and its properties of
being aggregated with high salt concentrations [73–75]. EstH con-
tains a large amount of acidic amino acid residues (31 Asp+ 48 Glu;
14.25%), which may impart it salt tolerance, but it needs to be fur-
ther elucidated in the future. The structural modeling by Molecular
Operating Environment (MOE) also reveals the presence of nega-
tive surface charge, which may contribute to salt tolerance (Fig. S2).
As both free and immobilized EstH enzymes showed, to a certain
degree, the tolerance of salt and some organic solvents, it can be
used in reactions containing both organic and inorganic media [9].
Enzyme immobilization is a solution to reduce process cost
through its reusability [76]. After the 8th cycle, the immobi-
lized EstH retained ∼50% of activity, indicating its good industrial
potential in reusability efficiency. A lipase from C. rugosa was
immobilized onto a Eupergit C support and retained only 30%
of activity after 5 cycles of reuse [18]; the molecular sieve-
immobilized lipase from Bacillus coagulans had 58.5% activity after
the 5th time of usage [70]. Additionally, storage stability of a biocat-
alyst is an important factor for the industrial usage. A free enzyme
gradually loses its activity during storage, but an immobilized
enzyme can show a good storage stability [14,62]. In the present
study, EstH showed better storage stability (∼71% after 50 days)
than the C. rugosa lipase immobilized on poly macroporous poly-
mer particles, which showed 50% activity after 54 days of storage
at 4 ◦C [19].
Fig. 8. Determination of the storage stability of EstH. The storage stability of both
EstH was determined at a regular interval of five days for fifty days under standrad
conditions. The initial activity on the first day was considered as 100%.
and changed optimal temperature such as the increase from 40 ◦C
to 45 ◦C in the para-nitrobenzyl esterase of Bacillus subtilis after
immobilization in magnetic beads [63], from 30 ◦C to 37 ◦C by
covalent immobilization of a lipase in carboxyl-activated magnetic
nanoparticles [64], from 40 ◦C to 45 ◦C in Celite-Immobilized Can-
dida rugosa lipase, [65], and from 65 ◦C to 70 ◦C after the entrapment
of esterase into silicate coated Ca-alginate beads [62] has been
reported in various studies. Additionaly, the optimal pH of both
free and immobilized EstH was 8.5, which was the same with
another cold-adapted esterase, rEstKp from Pseudomonas man-
delii immobilized on graphene oxide [12]. According to previous
reports, the molecular mechanism underlying the cold activity
is that the esterase has more glycine and proline residues, less
arginine residues and lower proportion of Arg/(Arg + Lys) to give
the protein flexibility and plasticity, rendering the enzyme cold
active [5,51,53]. In EstH, the ratio of Arg/(Arg + Lys) was only 0.23,
much lower than that of the other reported cold adapted esterases
[52,66,67], which may be the molecular reason of its cold active
property. EstH also showed slightly higher thermostability than
some other reported cold active esterases which tend to be inac-
tivated at above 40 ◦C within a very short time [58,67–69]. To
synthesize a thermally and operationally stable enzyme, immobi-
lization on a solid support is an important tool in biotechnology
[70], and is the most frequently used method to increase the sta-
bility of some enzymes, because immobilization matrix protects
the enzyme from being denatured and restricts the conformational
change. More interestingly, immobilized EstH displayed better cat-
alytic efficiency at elevated temperatures than the free EstH. At over
60 ◦C, EstH lost its activity totally, probably due to the disturbance
of globular structure of the protein, causing protein unfolding and
loss of enzymatic activity. Actually, immobilization gives rigidity
through attachment of the enzyme to the matrix, thus prevent-
ing protein aggregation and proteolysis like intermolecular process
5. Conclusions
In this study, we immobilized a novel cold active and salt
tolerant esterase, EstH on Fe3O4∼cellulose nano-composite and
extensively characterized both the free and immobilized EstH in
terms of pH, temperature, relative stability, reusability and storage
stability. The results show that a type of immobilization method
by covalent attachment enhanced thermostability with a shift of
optimal temperature (from 30 to 35 ◦C), storage stability (∼71%
Table 3
Effect of different detergents on EstH.
Detergents
Relative Activity (%)
Free Enzyme
Immobilized Enzyme
0.5% (v/v)
1%(v/v)
2%(v/v)
0.5%(v/v)
1%(v/v)
2%(v/v)
None
100.0
100.0
100.0
100.0
100.0
100.0
Tween 20
Tween 80
Triton-X-100
SDS (w/v)
CTAB (w/v)
108.3 2.3
73.6 3.5
40.5 1.7
ND
100.1 1.0
57.0 3.2
18.9 1.1
ND
95.3 1.0
37.6 2.5
9.1 0.3
ND
132.8 3.2
64.8 1.1
41.1 1.9
6.4 0.8
4.5 0.3
113.8 4.3
43.4 1.8
28.4 1.4
1.6 0.1
2.1 0.5
101.2 4.1
22.1 1.3
14.1 1.6
ND
ND
ND
ND
ND
Data are presented as mean values SD. The enzyme was pre-incubated with different concentrations of detergents for 1 h at room temperature (RT). The residual activity was
measured at standard conditions. The esterase activity without any detergents was defined as 100%. All determinations were performed in triplicate. (ND = Not determined).

496
M.A. Rahman et al. / International Journal of Biological Macromolecules 87 (2016) 488–497
[18] Z. Knezevic, N. Milosavic, D. Bezbradica, Z. Jakovljevic, R. Prodanovic,
Biochem. Eng. J. 30 (2006) 269–278.
[19] B.K. Vaidya, G.C. Ingavle, S. Ponrathnam, B.D. Kulkarni, S.N. Nene, Bioresour.
Technol. 99 (2008) 3623–3629.
[20] S. Kumar, A. Dwevedi, A.M. Kayastha, J. Mol. Catal. B: Enzym. 58 (2009)
138–145.
[21] D. Bozhinova, B. Galunsky, G. Yueping, M. Franzreb, R. Köster, V. Kasche,
Biotechnol. Lett. 26 (2004) 343–350.
[22] P. Blanco, M. Fernández-Pérez, C. Otero, G. Dıı´az-González, J. Mol. Catal. B:
Enzym. 30 (2004) 83–93.
[23] C. Sun, J.S.H. Lee, M. Zhang, Adv. Drug Deliv. Rev. 60 (2008) 1252–1265.
[24] S. Laurent, D. Forge, M. Port, A. Roch, C. Robic, L. Vander Elst, R.N. Muller,
Chem. Rev. 108 (2008) 2064–2110.
[25] P.Z. Xu, G.M. Huang, D.L. Feng, C.L. Hu, S. Zhao, M.H. Lai, C. Wei, Z. Huang, C.
Xie, G.X. Liu, Z. Feng, Sci. Total Environ. 424 (2012) 1–10.
[26] J. Xu, J. Sun, Y. Wang, J. Sheng, F. Wang, M. Sun, Molecules 19 (2014)
11465–11486.
[27] D. Klemm, F. Kramer, S. Moritz, T. Lindstrom, M. Ankerfors, D. Gray, A. Dorris,
Angew. Chem. Int. Ed. Engl. 50 (2011) 5438–5466.
Fig. 9. Effect of NaCl on the activity and stability of EstH. Effect of NaCl on the activ-
ity is indicated by filled circle for EstH and dotted square for immobilized EstH and
activity was measured at pH 8.5 Tris-HCl (50 mM) buffer with a different concentra-
tion of NaCl (0–4.5 M) under the standard conditions. The specific activity without
NaCl was defined as 100%. Stability (filled triangle for EstH and inverted dotted filled
triangle for immobilized EstH) was determined by incubating the enzyme in pH 8.5
Tris-HCl (50 mM) buffer with different concentrations of NaCl at 4 ◦C for 12 h, and
the relative activity was determined under the standard conditions. The specific
activity after incubation with 0 M NaCl was defined as 100%.
[28] S. Beck-Candanedo, M. Roman, D.G. Gray, Biomacromolecules 6 (2005)
1048–1054.
[29] A. Maleki, M. Kamalzare, Catal. Commun. 53 (2014) 67–71.
[30] S. Liu, X. Luo, J. Zhou, Magnetic responsive cellulose nanocomposites and their
applications, in: T.G.M. van de Ven (Ed.), Cellulose–Medical, Pharmaceutical
and Electronic Applications, InTech, Rijeka, Croatia, 2013, pp. 105–124, chap 6.
[31] A. Ivanova, K. Fominykh, D. Fattakhova-Rohlfing, P. Zeller, M. Doblinger, T.
Bein, Inorg. Chem. 54 (2015) 1129–1135.
[32] J. Zhou, R. Li, S. Liu, Q. Li, L. Zhang, L. Zhang, J. Guan, J. Appl. Polym. Sci. 111
(2009) 2477–2484.
activity after 50 days of storage), pH tolerance (pH 4–10) and more
importantly, reusability(∼50% activity after 8 cycles of reuse). These
newly characterized features of the immobilized EstH suggest that
immobilization by covalent bonding can increase the biotechnolog-
ical potential of this biocatalyst for applications in a wide variety
of fields.
[33] Q.L. Qin, X.Y. Zhang, X.M. Wang, G.M. Liu, X.L. Chen, B.B. Xie, H.Y. Dang, B.C.
Zhou, J. Yu, Y.Z. Zhang, BMC Genomics 11 (2010) 1471–2164.
[34] M.M. Bradford, Anal. Biochem. 72 (1976) 248–254.
[35] J.L. Arpigny, K.E. Jaeger, Biochem. J. 343 (1999) 177–183.
[36] K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, Mol. Biol. Evol. 30
(2013) 2725–2729.
[37] M. Ioelovich, Nanosci. Nanotechnol. 2 (2012) 9–13.
[38] A. Kumar, S. Zhang, G. Wu, C.C. Wu, J. Chen, R. Baskaran, Z. Liu, Colloids Surf. B
Biointerfaces 136 (2015) 1042–1050.
[39] H.-M. Jiang, Z.-P. Yan, Y. Zhao, X. Hu, H.-Z. Lian, Talanta 94 (2012) 251–256.
[40] S.K. Patel, V.C. Kalia, J.H. Choi, J.R. Haw, I.W. Kim, J.K. Lee, J. Microbiol.
Biotechnol. 24 (2014) 639–647.
[41] M.M.F.A. Ibrahim Agblevor, W.K. El-Zawawy, BioResources 5 (2010) 397–418.
[42] S.K.S. Patel, S.H. Choi, Y.C. Kang, J.-K. Lee, Nanoscale (2016) http://pubs.rsc.
org/en/content/articlepdf/2016/nr/c6nr00346j.
Competing interests
The authors claim that they have been no competing interests.
Acknowledgements
[43] H. Jia, G. Zhu, P. Wang, Biotechnol. Bioeng. 84 (2003) 406–414.
[44] R.O. Cristovao, S.C. Silverio, A.P. Tavares, A.I. Brigida, J.M. Loureiro, R.A.
Boaventura, E.A. Macedo, M.A. Coelho, World J. Microbiol. Biotechnol. 28
(2012) 2827–2838.
[45] B. Sahoo, S.K. Sahu, D. Bhattacharya, D. Dhara, P. Pramanik, Colloids Surf. B
Biointerfaces 101 (2013) 280–289.
[46] T.N. Nwagu, B.N. Okolo, H. Aoyagi, World J. Microbiol. Biotechnol. 28 (2012)
335–345.
[47] H. Kwoun Kim, Y.J. Jung, W.C. Choi, H.S. Ryu, T.K. Oh, J.K. Lee, FEMS Microbiol.
Lett. 235 (2004) 349–355.
This work was supported by grants from National Natural Sci-
ence Foundation of China (no. 31200580), Hubei province Science
and Technology support project (2014BBB009) China, National Sci-
ence Foundation of China (No. 31270162) and a Project Funded
by the Priority Academic Program Development of Jiangsu Higher
Education Institutions.
[48] C.-H. Kang, K.-H. Oh, M.-H. Lee, T.-K. Oh, B.H. Kim, J.-H. Yoon, Microb. Cell Fact.
10 (2011) 41.
References
[49] H. Shao, L. Xu, Y. Yan, J. Ind. Microbiol. Biotechnol. 40 (2013) 1211–1222.
[50] W. Tao, M. Lee, J. Wu, N. Kim, S.-W. Lee, J. Microbiol. 49 (2011) 178–185.
[51] B. Joseph, P.W. Ramteke, G. Thomas, Biotechnol. Adv. 26 (2008) 457–470.
[52] G. Wu, G. Wu, T. Zhan, Z. Shao, Z. Liu, Extremophiles 17 (2013) 809–819.
[53] G. Feller, C. Gerday, Nat. Rev. Microbiol. 1 (2003) 200–208.
[54] J. Jeon, J.-T. Kim, S. Kang, J.-H. Lee, S.-J. Kim, Mar. Biotechnol. 11 (2009)
307–316.
[55] K. Novototskaya-Vlasova, S. Yakimov, L. Petrovskaya, D. Gilichinsky, FEMS
Microbiol. Ecol. 82 (2012) 367–375.
[56] M.H. Lee, K.S. Hong, S. Malhotra, J.H. Park, E.C. Hwang, H.K. Choi, Y.S. Kim, W.
Tao, S.W. Lee, Appl. Microbiol. Biotechnol. 88 (2010) 1125–1134.
[57] L. Kulakova, A. Galkin, T. Nakayama, T. Nishino, N. Esaki, Biochim. Biophys.
Acta (BBA)—Proteins Proteomics 1696 (2004) 59–65.
[1] T. Panda, B.S. Gowrishankar, Appl. Microbiol. Biotechnol. 67 (2005) 160–169.
[2] F. Hasan, A.A. Shah, A. Hameed, Enzyme Microb. Technol. 39 (2006) 235–251.
[3] U.T. Bornscheuer, FEMS Microbiol. Rev. 26 (2002) 73–81.
[4] U.T. Bornscheuer, C. Bessler, R. Srinivas, S. Hari Krishna, Trends Biotechnol. 20
(2002) 433–437.
[5] R. Cavicchioli, K.S. Siddiqui, D. Andrews, K.R. Sowers, Curr. Opin. Biotechnol.
13 (2002) 253–261.
[6] C. Gerday, M. Aittaleb, M. Bentahir, J.P. Chessa, P. Claverie, T. Collins, S.
D’Amico, J. Dumont, G. Garsoux, D. Georlette, A. Hoyoux, T. Lonhienne, M.A.
Meuwis, G. Feller, Trends Biotechnol. 18 (2000) 103–107.
[7] R. Margesin, F. Schinner, J. Biotechnol. 33 (1994) 1–14.
[8] A. Oren, FEMS Microbiol. Ecol. 39 (2002) 1–7.
[58] E.Y. Yu, M.A. Kwon, M. Lee, J.Y. Oh, J.E. Choi, J.Y. Lee, B.K. Song, D.H. Hahm, J.K.
Song, Appl. Microbiol. Biotechnol. 90 (2011) 573–581.
[59] P. Mander, S. Cho, J. Simkhada, Y. Choi, D. Park, J. Ha, J. Yoo, Biotechnol.
Bioproc. E. 17 (2012) 67–75.
[60] R. Al Khudary, R. Venkatachalam, M. Katzer, S. Elleuche, G. Antranikian,
Extremophiles 14 (2010) 273–285.
[9] G.A. Sellek, J.B. Chaudhuri, Enzyme Microb. Technol. 25 (1999) 471–482.
[10] X. Jiang, Y. Huo, H. Cheng, X. Zhang, X. Zhu, M. Wu, Extremophiles 16 (2012)
427–435.
[11] M. Matsumoto, K. Ohashi, Biochem. Eng. J. 14 (2003) 75–77.
[12] H.J. Lee, H.K. Han, J. Chung, H.-S. Jang, S.-H. Lee, C. Woo, Bioresour. Technol.
148 (2013) 620–623.
[61] S. Montero, M.D. Virto, D. María, C. Landeta, I. Agud, R. Solozabal, J.M.
Lascaray, M. Renobales, M.J. Llama, J.L. Serra, Enzyme Microb. Technol. 15
(1993) 239–247.
[13] G. Feller, J. Phys. Condens. Matter. 22 (2010) 0953–8984.
[14] A. Yahs¸ i, F. S¸ ahin, G. Demirel, H. Tümtürk, Int. J. Biol. Macromol. 36 (2005)
253–258.
[62] S. Gülay, G. S¸ anlı-Mohamed, Int. J. Biol. Macromol. 50 (2012) 545–551.
[63] J.-M. Park, M. Kim, J.-Y. Park, D.-H. Lee, K.-H. Lee, J. Min, Y.-H. Kim, Process
Biochem. 45 (2010) 259–263.
[64] Y.T. Zhu, X.Y. Ren, Y.M. Liu, Y. Wei, L.S. Qing, X. Liao, Mater. Sci. Eng. C Mater.
Biol. Appl. 38 (2014) 278–285.
[65] S. Fadılogˇlu, Z. Söylemez, J. Agric. Food Chem. 46 (1998) 3411–3414.
[66] G. Wu, S. Zhang, H. Zhang, S. Zhang, Z. Liu, J. Mol. Catal. B: Enzym. 98 (2013)
119–126.
[15] Rodrigo Volcan Almeida, Roberta Vieira Branco, Bruno Peixoto, Cíntia da Silva
Lima, Sylvia Maria Campbell Alqueres, Orlando Bonifácio Martins, Octavio
Augusto Ceva Antunes, Denise Maria Guimarães Freire, Biochem. Eng. J. 39
(2008) 531–537.
[16] R.V. Branco, M.L.E. Gutarra, J.M. Guisan, D.M.G. Freire, R.V. Almeida, J.M.
Palomo, BioMed Res. Int. 2015 (2015) 250532.
[17] P. Villeneuve, J.M. Muderhwa, J. Graille, M.J. Haas, J. Mol. Catal. B: Enzym. 9
(2000) 113–148.

M.A. Rahman et al. / International Journal of Biological Macromolecules 87 (2016) 488–497
497
[67] J. Fu, H.K. Leiros, D. de Pascale, K.A. Johnson, H.M. Blencke, B. Landfald, Appl.
[73] S. Fukuchi, K. Yoshimune, M. Wakayama, M. Moriguchi, K. Nishikawa, J. Mol.
Biol. 327 (2003) 347–357.
Microbiol. Biotechnol. 97 (2013) 3965–3978.
[68] H. Cies´lin´ ski, A.M. Białkowska, A. Długołecka, M. Daroch, K.L. Tkaczuk, H.
Kalinowska, J. Kur, M. Turkiewicz, Arch. Microbiol. 188 (2007) 27–36.
[69] K.-C. Ko, S.-O. Rim, Y. Han, B. Shin, G.-J. Kim, J. Choi, J. Song, J. Ind. Microbiol.
Biotechnol. 39 (2012) 681–689.
[70] S. Raghuvanshi, R. Gupta, J. Ind. Microbiol. Biotechnol. 36 (2009) 401–407.
[71] M. Basri, W.M.Z.W. Yunus, W.S. Yoong, K. Ampon, C.N.A. Razak, A.B. Salleh, J.
Chem. Technol. Biotechnol. 66 (1996) 169–173.
[74] M. Müller-Santos, E.M. de Souza, O. Pedrosa Fde, D.A. Mitchell, S. Longhi, F.
Carrière, S. Canaan, N. Krieger, Biochim. Biophys. Acta 8 (2009) 719–729.
[75] J. Gomes, W. Steiner, Food Technol. Biotechnol. 42 (2004) 223–235.
[76] A. Chaubey, R. Parshad, S. Koul, S. Taneja, G. Qazi, Appl. Microbiol. Biotechnol.
73 (2006) 598–606.
[72] M.B. Abdul Rahman, S.M. Tajudin, M.Z. Hussein, R.N.Z.R. Abdul Rahman, A.B.
Salleh, M. Basri, Appl. Clay Sci. 29 (2005) 111–116.