Regulated expression of the Escherichia coli lepB gene as a tool for cellular testing of antimicrobial compounds that inhibit signal peptidase I in vitro

Article abstract of DOI:10.1128/AAC.46.11.3549-3554.2002

Escherichia coli under-expressing lepB was utilized to test cellular inhibition of signal peptidase I (SPase). For the construction of a lepB regulatable strain, the E. coli lepB gene was cloned into pBAD, with expression dependent on L-arabinose. The chr

Full text of DOI:10.1128/AAC.46.11.3549-3554.2002

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Nov. 2002, p. 3549–3554
0066-4804/02/$04.00ϩ0 DOI: 10.1128/AAC.46.11.3549–3554.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Vol. 46, No. 11
Regulated Expression of the Escherichia coli lepB Gene as a Tool for
Cellular Testing of Antimicrobial Compounds That Inhibit
Signal Peptidase I In Vitro
Maria D. F. S. Barbosa,1* Siqi Lin,2 Jay A. Markwalder,3 Jonathan A. Mills,1 Joseph A. DeVito,1
Christopher A. Teleha,3 Vasudha Garlapati,1 Charles Liu,4 Andy Thompson,4
George L. Trainor,3 Michael G. Kurilla,1 and David L. Pompliano1
Departments of Antimicrobial Research,1 Leads Discovery,2 and Chemistry,3 Bristol-Myers Squibb Company,
Wilmington, Delaware 19880, and J-Star Research, Inc., South Plainfield, New Jersey 070804
Received 14 February 2002/Returned for modification 22 May 2002/Accepted 19 August 2002
Escherichia coli under-expressing lepB was utilized to test cellular inhibition of signal peptidase I (SPase).
For the construction of a lepB regulatable strain, the E. coli lepB gene was cloned into pBAD, with expression
dependent on L-arabinose. The chromosomal copy of lepB was replaced with a kanamycin resistance gene,
which was subsequently removed. SPase production by the lepB regulatable strain in the presence of various
concentrations of L-arabinose was monitored by Western blot analysis. At lower arabinose concentrations
growth proceeded more slowly, possibly due to a decrease of SPase levels in the cells. A penem SPase inhibitor
with little antimicrobial activity against E. coli when tested at 100 ␮M was utilized to validate the cell-based
system. Under-expression of lepB sensitized the cells to penem, with complete growth inhibition observed at 10
to 30 ␮M. Growth was rescued by increasing the SPase levels. The cell-based assay was used to test cellular
inhibition of SPase by compounds that inhibit the enzyme in vitro. MD1, MD2, and MD3 are SPase inhibitors
with antimicrobial activity against Staphylococcus aureus, although they do not inhibit growth of E. coli. MD1
presented the best spectrum of antimicrobial activity. Both MD1 and MD2 prevented growth of E. coli
under-expressing lepB in the presence of polymyxin B nonapeptide, with growth rescue observed when wild-type
levels of SPase were produced. MD3 and MD4, a reactive analog of MD3, inhibited growth of E. coli
under-expressing lepB. However, growth rescue in the presence of these compounds following increased lepB
expression was observed only after prolonged incubation.
The development of antibiotic-resistant bacteria as well as
the emergence of new pathogens has created a need for novel
antimicrobial drugs. Microbial genome sequencing efforts have
focused on the identification of essential genes, some of which
code for membrane-bound proteins of unknown function. Cell-
based assays utilizing strains under-expressing target genes
may provide a means for identifying inhibitors of novel pro-
teins in the absence of known function or of an in vitro bio-
chemical assay.
Signal peptidase I (SPase) is an essential enzyme for many
microorganisms. Escherichia coli has only one gene (lepB) that
codes for a catalytically active SPase (11). Repression of lepB
expression by an arabinose (Ara) promoter (10) or by partial
deletion of the natural promoter (11) results in cessation of cell
growth and division. The Staphylococcus aureus spsB gene en-
codes an active SPase (8). Experiments in which the spsB gene
was cloned into a plasmid that is temperature sensitive for
replication indicated that spsB is also essential for growth. An
open reading frame immediately upstream of the spsB gene
encodes a homologous sequence and was predicted to be de-
void of catalytic activity (8).
SPases catalyze the processing of N-terminal signal peptides,
thereby allowing the release of exported proteins from mem-
branes (9, 12). The bacterial SPases consist of single polypep-
tides anchored to the membrane by one or two transmembrane
domains. The best-characterized SPase is from E. coli, which
spans the membrane twice (1, 9). SPases are irreversibly inhib-
ited by certain penem compounds, which act by acylation of the
active site serine (6, 17). The crystal structure of a catalytically
active soluble fragment of the E. coli enzyme has been de-
scribed in complex with a ␤-lactam (5S, 6S penem) (17). The
SPase structure is consistent with the use of Lys 145 as a
general base in the activation of the nucleophilic active site Ser
90 (5).
SPase biochemical assays are available (7, 14, 26), but no
compounds that effectively inhibit SPase both in vitro and in
vivo have been described to date. An efficient synthetic sub-
strate for SPase was recently reported, which presents a
kcat/Km ratio of 2.5 ϫ 106 MϪ1 sϪ1 (20). However, SPase
inhibition in vitro by a given compound does not necessarily
correlate with antimicrobial activity. The relevance of bio-
chemical screens is further complicated by the indication that
the SPase active site may be partially submerged in the lipid
bilayer (23), making its active site somewhat inaccessible to
compounds screened in vitro. Here we describe SPase inhibi-
tors obtained with a biochemical assay and the development of
a cell-based assay that allowed for investigation of specific
cellular inhibition of the target.
Many membrane and secretory proteins in both eukaryotic
and prokaryotic cells are synthesized as precursors with an
N-terminal signal peptide containing 15 to 30 amino acids.
* Corresponding author. Present address: Xencor, 111 W. Lemon
Ave., Monrovia, CA 91016. Phone: (626) 737-8005. Fax: (626) 256-
3727. E-mail: mbarbosa@xencor.com.
3549

3550
BARBOSA ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
MATERIALS AND METHODS
Bacterial strains and plasmids. E. coli TOP10 and plasmid pBAD-HisA (13)
were obtained from Invitrogen (San Diego, Calif.). E. coli DY329 (24) was
genetically modified for the construction of a knockout strain. All other bacterial
strains were from the American Type Culture Collection. Plasmid pJDP8 is a
derivative of pSC101 containing the cre gene (21).
Cloning of the E. coli lepB gene. The lepB gene from E. coli ATCC 47076 (12,
15) was PCR amplified and inserted into the BamHI and NdeI sites of plasmid
pET26(ϩ) (Novagen) as previously described (20) to generate pMB1. pMB2 was
engineered by inserting E. coli lepB into the NcoI site of pBAD-His (Invitrogen)
after amplification with the following primers: forward, 5ЈCATGCCATGGAT
GGCGAATATGTTTGCCCTGA 3Ј; reverse, 5ЈCATGCCATGGAGATGG
TATTAATGGATGCCG 3Ј. Chromosomal DNA and plasmid isolation, DNA
desalting, and purification from agarose gels were performed with Qiagen kits.
DNA transformation into E. coli was performed either according to instructions
from the manufacturer or by following standard techniques (18).
Western blot analysis. Wild-type E. coli SPase was purified as previously
described (20). Polyclonal antibodies against SPase were produced in a rabbit by
Research Genetics, Inc. (Huntsville, Ala.). After centrifugation, the 10-week
bleed was subjected to ammonium sulfate precipitation followed by affinity
purification with protein G (Boehringer Mannheim, Indianapolis, Ind.). For
Western blot analysis, the proteins in the cell extracts were separated by sodium
dodecyl sulfate electrophoresis in gradient gels (4 to 20% acrylamide; Invitrogen)
according to instructions from the manufacturer. The samples from E. coli
TOP10 cells over-expressing lepB were prepared by freezing and thawing fol-
lowed by boiling with sodium dodecyl sulfate-containing buffer (18). For expres-
sion analysis of the E. coli lepB regulatable strain, DNase (Gibco BRL) was
added to the cells, which were then lysed with a French press at 12,000 lb/in2 and
processed as described above (18). After transfer to nitrocellulose membranes,
the Western blot was processed using anti-rabbit alkaline phosphatase-conju-
gated antibodies (18).
Construction of a lepB regulatable strain. The E. coli strain we used (strain
391) is a derivative from DY329 that had the araCBAD operon knocked out and
was therefore unable to metabolize ara. The bacteriophage ␭ recombination
system was used to promote homologous recombination (16, 24). The antibiotic
markers were removed by utilizing the bacteriophage P1 site-specific recombi-
nation system cre-loxP (21). The primers used to amplify a kanamycin (KAN)
resistance gene from a linear loxP-KAN cassette contained the loxP sites (un-
derlined) and lepB flanking sequences (in italic) as follows: forward primer, 5Ј
GGAAGCGTTCCTCGCCATTCTGCACGTCGGCAAAGACAACAAATAACC
CTTAGGAGTTGGTATCACGAGGCCCTTTCGTCTT 3Ј; reverse primer, 5Ј
TAGCCACGGGAGATTTATCTCATAAATAATTCACGTTGTCGCCATAACG
GCGACAACGTGTTTTCACCGTCATCACCGAAAC 3Ј. Electroporation-
competent (24) E. coli 391 cells containing pBAD with E. coli lepB were trans-
formed with the linear loxP-KAN cassette, and recombinants were selected on
Luria-Bertani (LB) agar containing 0.2% Ara, 30 ␮g of KAN per ml, and 50 ␮g
of ampicillin (AMP) per ml. The resulting colonies were tested for growth on
plates containing antibiotics, with and without Ara. The colonies growing exclu-
sively on Ara-containing agar were tested by PCR, with distal primers designed
according to the lepB flanking genes rnc and lepA (forward primer, 5Ј TAATC-
CGGCAGAAAAGGCGCT 3Ј; reverse primer, 5Ј TACTGCTGGCACTAC-
GATGA 3Ј). The KAN resistance gene used to replace the chromosomal copy of
lepB in a strain expressing E. coli lepB from pBAD was removed by transforming
the cells with pJDP8 followed by selection on LB agar containing Ara, specti-
nomycin, and AMP. Loss of the KAN resistance mark was ascertained by streak-
ing the cells on LB medium containing Ara, KAN, and AMP. Spectinomycin-
resistant, AMP-resistant, and KAN-sensitive cultures were then transferred to
LB medium containing Ara and AMP and incubated at 37°C to obtain isolated
colonies, which were again tested for loss of the KAN resistance marker.
Growth studies. Growth of E. coli (E. coli parent strain containing or not
containing pBAD-HisA and a lepB regulatable strain) was investigated in 50-ml
Falcon tubes containing 3 ml of LB medium or RM minimal medium (18).
Incubation was done at 32°C and 250 rpm. Growth was monitored by measuring
the optical density at 600 nm, after 10 and 20 h of incubation. The effect of SPase
inhibitors on E. coli TOP10 or the lepB regulatable strain containing the E. coli
lepB gene cloned into pBAD was tested in the presence of various concentrations
of polymyxin B nonapeptide (Pbn) (22). Further tests with compounds that
inhibit growth of the lepB regulatable strain (cell-based assay) utilized 96-well
plates, with 150 ␮l of medium added per well. Plates were incubated with
agitation at 32°C and optical density was determined at intervals. Inocula were
prepared by transferring the cells from frozen stocks to LB agar containing AMP
and Ara. Various concentrations of Ara were tested for inoculum preparation.
FIG. 1. Growth of E. coli TOP10 bearing pMB2 was investigated in
LB medium (LB) and LB medium supplemented with 20 ␮g of Pbn per
ml (LB-Pbn), 100 ␮M penem (LB-P), or both Pbn and penem (LB-
Pbn-P). Growth was measured as the increase in optical density at 600
nm after 20 h of incubation. The initial optical density of the inoculum
was 0.1. Experiments were performed in duplicate.
Drug susceptibility testing. MICs were determined for a panel of microorgan-
isms (4). In brief, bacterial cultures were inoculated in 96-well plates containing
liquid medium with various concentrations of the test compounds. Growth was
monitored by measuring the optical density of the culture after incubation at
37°C for 24 h.
Synthesis of penem and MD4 and stability tests for SPase inhibitors. Penem
64 was synthesized as previously described (2, 3, 6). MD4 is a reactive analog of
MD3, synthesized to test the effect of a possible breakdown product of MD3.
MD4 was synthesized by the addition of freshly prepared vinylmagnesium bro-
mide to 2,5-dichlorobenzaldehyde in tetrahydrofuran (THF) and oxidation of the
resulting alcohol with MnO2 in CH2Cl2. Stability tests were performed with the
SPase inhibitors MD1, MD2, and MD3 dissolved in dimethyl sulfoxide (DMSO),
methanol, or Tris buffer. The compounds were incubated at room temperature,
and degradation was assessed after various incubation times.
SPase biochemical assay and IC50 determinations. SPase and
K5L10YFSASALAϳKIK(fluorescein)NH2 peptide (1:10 ratio) were incubated
using previously described assay conditions (20), except that the hydrolysis of
peptide was monitored by reading the fluorescence polarization value of fluo-
rescein on an Acquest machine (LJL Biosystem, Sunnyvale, Calif.) at an excita-
tion wavelength of 485 nm and an emission wavelength of 530 nM. An in-house
compound library was tested at 14.5 ␮M. For 50% inhibitory concentration
(IC50) determinations, compound concentrations ranging from 100 ␮M to 1 nM
were used in the assay.
RESULTS
Effect of a penem inhibitor of SPase on growth of E. coli and
S. aureus. The effect of penem on growth of E. coli TOP10
containing pMB2 was tested in the presence and absence of
Pbn (Fig. 1). The addition of 100 ␮M penem to the culture
medium caused a 31% reduction of the optical density. Almost
complete growth inhibition was observed when both penem
and Pbn were present. Results for growth inhibition by penem
as a measure of optical density were corroborated by counts of
viable cells. Pbn concentrations varying from 5 to 40 ␮g/ml
were tested (data not shown). A concentration of 10 ␮g/ml was
selected for further tests as the highest Pbn concentration that
still presented a negligible effect on cell growth. S. aureus
cultures were insensitive to penem concentrations up to 200
␮M, in the presence or absence of Pbn (data not shown).
Construction of an E. coli lepB regulatable strain. PMB2
containing the lepB gene under the control of a repressible
promoter was cloned into E. coli, and the chromosomal copy of
lepB was replaced by a KAN resistance gene. lepB sequences
flanking the kan gene allowed homologous recombination

VOL. 46, 2002
SIGNAL PEPTIDASE I INHIBITORS
3551
FIG. 2. Construction of a lepB regulatable E. coli strain. (A) Schematic representation of the strategy utilized to replace the lepB gene by a
loxP-Kan-loxP resistance cassette. The positions of the flanking primers used to confirm the gene replacement are indicated. The figure is not drawn
to scale. (B) PCR amplification of E. coli chromosomal DNA with Primer For and Primer Rev. Lanes: 1, molecular size markers; 2, parent strain
E. coli 391; 3, KAN-resistant E. coli lepB regulatable strain; 4, KAN-sensitive E. coli lepB regulatable strain.
(Fig. 2A). Recombinants with the chromosomal copy of lepB
deleted were selected as E. coli cells able to grow in the pres-
ence of Ara exclusively. Integration of the kan gene into the
chromosome was monitored by PCR analysis (Fig. 2B). DNA
fragments were amplified with primers designed according to
the sequences of the lepB flanking genes. The fragment from
the parental strain was smaller than the KAN-resistant lepB
regulatable strain. Upon removal of the KAN marker, the size
of the PCR fragment amplified decreased relative to the pa-
rental strain, and the resulting strain was unable to grow on
medium with KAN or without Ara. The lepB regulatable strain
was capable of growing on either RM medium or LB medium
supplemented with Ara, but growth was slower with the former
medium. In addition, a lower optical density was observed at
the stationary phase following growth on RM medium (data
not shown). Hence, LB medium was utilized for further stud-
ies.
coli (Fig. 3A). The minimum Ara concentrations required to
support growth similar to that of the parental strain after 24 h
of incubation were in the range of 0.0002 to 0.0004%. Expres-
sion of the lepB gene was monitored by Western blot analysis
(Fig. 3B). After incubation of the cells for 10 or 22 h with
0.05% Ara, the level of SPase in the lepB regulatable strain was
similar to the level observed in cell extracts from the parental
E. coli. Cell extracts from the lepB regulatable strain incubated
with 0.0002% Ara had lower levels of SPase. Purified SPase
was run in parallel. A second band observed with the purified
enzyme represents an autolysis product (20). Some growth of
the lepB regulatable strain in the absence of the inducer may be
due to residual SPase in the cells. Hence, the inoculum was
routinely prepared by growing the cells on plates containing
0.01% Ara. The levels of SPase in the inoculum prepared as
described above were not sufficient to support residual growth
in fresh medium without Ara.
Expression of lepB and its effect on growth inhibition by
penem. Several Ara concentrations were evaluated for the
induction of gene expression in the lepB regulatable strain of E.
The effect of an SPase inhibitor was tested utilizing cells
producing various levels of the target enzyme (Fig. 4A). Un-
der-expression of lepB sensitized the cells to penem, with com-
FIG. 3. Effect of L-Ara concentration on growth and SPase production by a KAN-sensitive E. coli lepB regulatable strain that contains pMB2.
(A) Growth in the presence of various Ara concentrations (% [wt/vol]). Open squares, 0; closed triangles, 0.0001; inverted triangles, 0.0002; open
circles, 0.0004; closed squares, 0.05; closed circles, 0.1. Experiments were performed in duplicate and repeated independently. (B) Western blot
analysis of lepB expression after 10 h (lanes 1, 3, and 5) and 22 h (lanes 2, 4, and 6) of incubation. Three micrograms of total cell protein was loaded
in each lane. Lanes: SP, purified SPase; 1 and 2, lepB regulatable strain with 0.0002% Ara; 3 and 4, lepB regulatable strain with 0.05% Ara; 5 and
6, parent strain.

3552
BARBOSA ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
FIG. 4. Growth rescue of an E. coli lepB regulatable strain by increased expression of lepB in the presence of penem and different Ara
concentrations. (A) Growth on LB medium. (B) Growth on LB medium supplemented with 10 ␮g of Pbn per ml. Closed squares, 0.0004% Ara;
closed triangles, 0.05% Ara; open circles, 0.0004% Ara and 10 ␮M penem; closed circles, 0.05% Ara and 10 ␮M penem. Experiments were
performed in duplicate and repeated independently.
plete growth inhibition observed at a concentration of 10 ␮M.
The SPase produced in cells grown with 0.05% Ara was suffi-
cient to support growth similar to that of the parental strain in
both the presence and absence of penem. The same growth
rescue by production of higher levels of SPase was observed
when 10 ␮g of Pbn per ml was included in the medium (Fig.
4B).
SPase inhibitors from a high-throughput screen. A bio-
chemical assay for SPase activity identified 112 compounds
that inhibited SPase at 14.5 ␮M. IC50 values were determined
for the 112 compounds, and three with antimicrobial activity
(MD1, MD2, and MD3) were tested further in a cell-based
assay. The structures of these SPase inhibitors are shown in
Fig. 5. The IC50 values for SPase inhibition were 2.2, 5.3, 5.0,
and 1.3 ␮M for MD1, MD2, MD3, and penem 69, respectively.
MD1, MD2, and MD3 displayed antimicrobial activity against
S. aureus but did not inhibit growth of wild-type E. coli (Table
1).
inhibition in the biochemical assay by MD4 was 4.9 ␮M. MD3
was very unstable, both in DMSO and Tris buffer. Degradation
of this compound led to the formation of reactive products.
MD2 was stable after 5 days in DMSO but appeared to un-
dergo solvolysis in methanol, with approximately 30% conver-
sion after 1 week. After 1 day of incubation in DMSO, the
nuclear magnetic resonance spectrum of MD1 suggested that it
was 25% degraded. Similar degradation results for the MD1
nuclear magnetic resonance spectrum was observed after ad-
ditional incubation for 6 days.
In vivo inhibition of SPase. No growth inhibition of the lepB
regulatable strain was observed in the presence of 30 ␮M
MD1, MD2, or MD3 in LB medium containing 0.0004% Ara
(data not shown). However, when the effect of these com-
pounds was tested in the presence of 10 ␮g of Pbn per ml,
growth inhibition and growth rescue were observed at low and
high Ara concentrations, respectively (Fig. 7). When penem
was tested at 30 ␮M, the growth rescue of the lepB regulatable
strain with 0.05% Ara was delayed relative to growth with 10
␮M penem and 0.05% Ara (Fig. 4A and Fig. 7A). MD4, a
reactive analog of MD3, also inhibited growth of the lepB
regulatable strain (Fig. 7A). However, growth rescue at a
higher Ara concentration in the presence of both MD3 and
MD4 took place only after a prolonged incubation time.
Penem, MD3, and MD4 completely inhibited the growth of
cells under-expressing lepB, while only partial inhibition was
observed in the presence of MD1 and MD2.
Synthesis of penem and MD4 and stability tests for SPase
inhibitors. The penem 64 compound was synthesized as pre-
viously reported (6). MD4 is a reactive compound synthesized
to test the effect of a possible breakdown product of MD3, one
of the SPase inhibitors (Fig. 6). The IC50 value for SPase
TABLE 1. Susceptibility of a panel of microorganisms to
SPase inhibitors
MIC (␮g/ml)
Microorganism
MD1
MD2
MD3
E. coli ATCC 25922
Ͼ64
Ͼ11.4
Ͼ11.4
5.7
Ͼ9
9
2.3
4.5
Ͼ9
9
Haemophilus influenzae ATCC 49766
Moraxella catarrhalis ATCC 25238
S. aureus ATCC 13709
8
2
2
11.4
Streptococcus pneumoniae ATCC 49619
Candida albicans ATCC 90028
NDa
4
11.4
Ͼ11.4
FIG. 5. Chemical structures of SPase inhibitors. MD1, MD2, and
MD3 were selected from a high-throughput screen that utilized a
biochemical assay.
a ND, not determined.

VOL. 46, 2002
SIGNAL PEPTIDASE I INHIBITORS
3553
this compound in the presence of Pbn. Polymyxin derivatives
that lack the fatty acid tail are generally not bactericidal but are
capable of permeabilizing the outer membrane (22). In this
respect, the best-characterized derivative is Pbn. Its MICs for
E. coli and Salmonella enterica serovar Typhimurium are
higher than 300 ␮g/ml, but even as low a concentration as 0.3
␮g/ml is sufficient to permeabilize the outer membrane (22). In
the present work Pbn itself had a negligible negative effect on
cell growth at the concentrations utilized. The growth results
obtained at different Ara concentrations and in the presence or
absence of penem might be indicative that specific inhibition of
the target activity in vivo was taking place. However, the use of
other systems and/or promoters (19, 25) may provide more
tightly regulated expression at the level of individual cells and
increase the accuracy of the cell-based assays.
Three SPase inhibitors selected with a biochemical assay
were active against bacterial strains, although they did not
inhibit growth of wild-type E. coli at the concentrations tested.
Those compounds affected growth of the E. coli strain under-
expressing lepB only in the presence of Pbn, perhaps due to the
E. coli permeability barrier. Cell-based assays employing gram-
positive organisms might be more sensitive to lower concen-
trations of the compounds. MD3 was very unstable, and it is
possible that a reactive degradation product was solely respon-
sible for the inhibition of the SPase biochemical reaction as
well as cell growth. MD4 is a reactive analog of MD3. MD3
and MD4 yielded similar inhibition profiles when tested with
the cell-based assay and also had similar IC50 values for SPase
inhibition with a biochemical assay. When either MD3 or MD4
was present in the medium, growth rescue by high concentra-
tions of Ara was observed only after prolonged incubation.
This is in contrast to the inhibition observed with penem, a
time-dependent irreversible inhibitor of SPase (17). MD1 and
MD2 only partially inhibited growth of the strain under-ex-
pressing lepB. The percentage of growth inhibition observed
correlated with the IC50 values obtained with the biochemical
assay, although the mechanism of action of these compounds
in vivo is not clearly defined. Similar to the data obtained with
penem, these results also indicate that a cell-based assay uti-
FIG. 6. Synthesis of MD4. a, vinylmagnesium bromide, THF, 0°C;
b, MnO2, CH2Cl2.
DISCUSSION
SPase is essential for bacterial growth (10). Under the con-
ditions routinely utilized for inoculum preparation, no residual
growth of the lepB regulatable strain in the absence of Ara was
observed. However, some increase in the optical density fol-
lowing incubation in medium without Ara can be observed,
presumably contingent upon the residual levels of SPase in the
cells. This is in agreement with previous work aimed at dem-
onstrating the essentiality of the lepB gene product (10). Those
authors had observed that the growth rate of a lepB regulatable
strain was identical in the presence or absence of Ara during
the initial hours of incubation in liquid medium, a result that
suggested that time was needed to dilute the SPase originally
present among the daughter cells.
An E. coli recombinant strain was constructed, with lepB
expression from pBAD dependent on the Ara concentration.
Previous analyses of gene expression from plasmids containing
the araBAD promoter have indicated that at subsaturating
concentrations of Ara, intermediate levels of expression rep-
resent a population average of cells that are individually dif-
ferent (19). However, those authors used a very high Ara
concentration (0.1%) to induce green fluorescent protein syn-
thesis prior to examining the cells by fluorescence microscopy.
We have observed that when the Ara concentration in the
medium is lowered to the minimum sufficient to support
growth similar to that of the parent strain, the cells become
sensitized to inhibitors of SPase. An SPase inhibitor, penem
(6), was utilized to validate the system. E. coli was sensitized to
FIG. 7. Growth impairment of an E. coli lepB regulatable strain as an indication of SPase inhibition by 30 ␮M MD1, MD2, MD3, or MD4. The
growth medium was LB containing 10 ␮g of Pbn per ml. Penem (30 ␮M) was included as a control for the experiments. The compounds were
dissolved in 100% DMSO. The final DMSO concentration in the medium was 1%. Closed symbols, 0.0004% Ara; open symbols, 0.05% Ara.
(A) Growth in the presence of MD3 and MD4. Squares, penem; inverted triangles, MD3; circles, MD4. (B) Growth in the presence of MD1 and
MD2. Squares, DMSO; inverted triangles, MD1; circles, MD2. Experiments were done in triplicate and repeated twice.

3554
BARBOSA ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
12. Date, T., and W. Wickner. 1981. Isolation of the Escherichia coli leader
peptidase gene and effects of leader peptidase overproduction in vivo. Proc.
Natl. Acad. Sci. USA 78:6106–6110.
lizing strains under-expressing a given gene may be used for
initial investigations of target inhibition in whole cells.
13. Guzman. L.-M., D. Belin, M. J. Carson, and J. Beckwith. 1995. Tight regu-
lation, modulation, and high-level expression by vectors containing the arab-
inose PBAD promoter. J. Bacteriol. 177:4121–4130.
14. Kuo, D., J. Weidner, P. Griffin, S. K. Shah, and W. B. Knight. 1994. Deter-
mination of the kinetic parameters of Escherichia coli leader peptidase ac-
tivity using a continuous assay: the pH dependence and time-dependent
inhibition by ␤-lactams are consistent with a novel serine protease mecha-
nism. Biochemistry 33:8347–8354.
ACKNOWLEDGMENTS
We thank K. Amsler and L. Foster for MIC determinations. We also
thank R. Stein and R. Bruckner for providing purified SPase and Y.
Bukhtiyarov for critical reading of the manuscript.
REFERENCES
15. March, P. E., and M. Inouye. 1985. Characterization of the lep operon of
Escherichia coli. J. Biol. Chem. 260:7206–7213.
16. Murphy, K. C. 1998. Use of bacteriophage ␭ recombination functions to
promote gene replacement in Escherichia coli. J. Bacteriol. 180:2063–2071.
17. Paetzel, M., R. E. Dalbey, and N. C. J. Strynadka. 1998. Crystal structure of
a bacterial signal peptidase in complex with a ␤-lactam inhibitor. Nature
396:186–190.
1. Allsop, A. E., M. J. Ashby, G. Brooks, G. Bruton, S. Coulton, P. D. Edwards,
S. A. Elsmere, I. K. Hatton, A. C. Kaura, S. D. McLean, M. J. Pearson, N. D.
Pearson, C. R. Perry, T. C. Smale, and R. Southgate. 1997. Inhibition of
protein export in bacteria: the signaling of a new role for ␤-lactams, p. 61–72.
In P. H. Bentley and P. J. O’Hanlon (ed.), Anti-infectives. Recent advances
in chemistry and structure-activity relationships. The Royal Society of Chem-
istry, Cambridge, United Kingdom.
18. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning, a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.
2. Allsop, A. E., G. Brooks, P. D. Edwards, A. C. Kaura, and R. Southgate.
1996. Inhibitors of bacterial signal peptidase: a series of 6-(substituted oxy-
ethyl) penems. J. Antibiot. 49:921–928.
19. Siegele, D. A., and J. C. Hu. 1997. Gene expression from plasmids containing
the araBAD promoter at subsaturating inducer concentrations represents
mixed populations. Proc. Natl. Acad. Sci. USA 94:8168–8172.
20. Stein, R. L., M. D. F. S. Barbosa, and R. Bruckner. 2000. Kinetic and
mechanistic studies of signal peptidase I from Escherichia coli. Biochemistry
39:7973–7983.
21. Sternberg, N., B. Sauer, R. Hoess, and K. Abremski. 1986. Bacteriophage P1
cre gene and its regulatory region. Evidence for multiple promoters and for
regulation by DNA methylation. J. Mol. Biol. 187:197–212.
22. Vaara, M. 1992. Agents that increase the permeability of the outer mem-
brane. Microbiol. Rev. 56:395–411.
23. Van Klompenburg, W., M. Paetzel, J. M. De Jong, R. E. Dalbey, R. A. Demel,
G. Von Heijne, and B. De Kruijff. 1998. Phosphatidylethanolamine mediates
insertion of the catalytic domain of leader peptidase in membranes. FEBS
Lett. 431:75–79.
24. Yu, D., H. M. Ellis, E.-C. Lee, N. A. Jenkins, N. G. Copeland, and D. L.
Court. 2000. An efficient recombination system for chromosome engineering
in Escherichia coli. Proc. Natl. Acad. Sci. USA 97:5978–5983.
25. Zhang, L., F. Fan, L. M. Palmer, M. A. Lonetto, C. Petit, L. L. Voelker, A. St.
John, B. Bankosky, M. Rosenberg, and D. McDevitt. 2000. Regulated gene
expression in Staphylococcus aureus for identifying conditional lethal phe-
notypes and antibiotic mode of action. Gene 255:297–305.
3. Allsop, A. E., G. Brooks, G. Bruton, S. Coulton, P. D. Edwards, I. K. Hatton,
A. C. Kaura, S. D. McLean, N. D. Pearson, T. C. Smale, and R. Southgate.
1995. Penem inhibitors of bacterial signal peptidase. Bioorg. Med. Chem.
Lett. 5:443–448.
4. Amsterdan, D. 1996. Susceptibility testing of antimicrobials in liquid me-
dium, p. 52–111. In V. Lorian (ed.), Antibiotics in laboratory medicine, 4th
ed. Williams & Wilkins, Baltimore, Md.
5. Black, M. T. 1993. Evidence that the catalytic activity of prokaryote leader
peptidase depends upon the operation of a serine-lysine catalytic dyad. J.
Bacteriol. 175:4957–4961.
6. Black, M. T., and G. Bruton. 1998. Inhibitors of bacterial signal peptidases.
Curr. Pharm. Design 4:133–154.
7. Chatterjee, S., D. Suciu, R. E. Dalbey, P. C. Kahn, and M. Inouye. 1995.
Determination of Km and kcat for signal peptidase I using a full length
secretory precursor, pro-OmpA-nuclease A. J. Mol. Biol. 245:311–314.
8. Cregg, K. M., E. Imogen Wilding, and M. T. Black. 1996. Molecular cloning
and expression of the spsB gene encoding an essential type I signal peptidase
from Staphylococcus aureus. J. Bacteriol. 178:5712–5718.
9. Dalbey, R. E., M. O. Lively, S. Bron, and J. M. Van Dul. 1997. The chemistry
and enzymology of the type I signal peptidases. Protein Sci. 6:1129–1138.
10. Dalbey, R. E., and W. Wickner. 1985. Leader peptidase catalyzes the release
of exported proteins from the outer surface of the Escherichia coli plasma
membrane. J. Biol. Chem. 29:15925–15931.
26. Zong, W., and S. J. Benkovic. 1998. Development of an internally quenched
fluorescent substrate for Escherichia coli leader peptidase. Anal. Biochem.
255:66–73.
11. Date, T. 1983. Demonstration by a novel genetic technique that leader
peptidase is an essential enzyme of Escherichia coli. J. Bacteriol. 154:76–83.